WorldWideScience

Sample records for basidiomycete phanerochaete chrysosporium

  1. Phanerochaete chrysosporium genomics

    Science.gov (United States)

    Luis F. Larrondo; Rafael Vicuna; Dan Cullen

    2005-01-01

    A high quality draft genome sequence has been generated for the lignocellulose-degrading basidiomycete Phanerochaete chrysosporium (Martinez et al. 2004). Analysis of the genome in the context of previously established genetics and physiology is presented. Transposable elements and their potential relationship to genes involved in lignin degradation are systematically...

  2. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  3. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site.

  4. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  5. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  6. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  7. Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

    Science.gov (United States)

    Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

    2007-01-01

    We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

  8. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The aim of this study was to produce a secreted, heterologously expressed Phanerochaete chrysosporium cellobiohydrolase (CBHI.1) protein that required no in vitro chemical refolding and to investigate the cellulolytic activity of the clone expressing the glutathione S-transferase (GST) fused CBHI.1 protein. Plate enzyme ...

  9. Characterisation of a chimeric Phanerochaete chrysosporium ...

    African Journals Online (AJOL)

    The aim of this study was to purify and analyse a Phanerochaete chrysosporium cbhI.1 gene-product expressed as an inducible, secreted, heterologous protein from an Escerichia coli pGEXcbhI.1 clone. Using glutathione Sepharose 4B affinity chromatography, the expressed protein was purified from the supernatant of an ...

  10. Bioremediation of textile effluent using Phanerochaete chrysosporium

    African Journals Online (AJOL)

    The discharge of these waste residues into the environment eventually poison, damage or ... breakdown of the chlorolignin residues and the chromophoric groups responsible for the dark coloration of the textile effluent can be accomplished by the use of enzymes from the white rot fungus, Phanerochaete chrysosporium.

  11. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The aim of this study was to produce a secreted, heterologously expressed Phanerochaete chrysosporium cellobiohydrolase (CBHI.1) protein that required no in vitro chemical refolding and to investigate the cellulolytic activity of the clone expressing the glutathione S-transferase (GST) fused. CBHI.1 protein. Plate enzyme ...

  12. A homokaryotic derivative of a Phanerochaete chrysosporium strain and its use in genomic analysis of repetitive elements

    Science.gov (United States)

    Philip. Stewart; Jill. Gaskell; Daniel. Cullen

    2000-01-01

    Analysis of complex gene families in the lignin-degrading basidiomycete Phanerochaete chrysosporium has been hampered by the dikaryotic nuclear condition. To facilitate genetic investigations in P. chrysosporium strain BRM-F-1767, we isolated a homokaryon from regenerated protoplasts. The nuclear condition was established by PCR amplification of five unlinked genes...

  13. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Science.gov (United States)

    Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen

    2012-01-01

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...

  14. Transcriptome and secretome analyses of Phanerochaete chrysosporium reveal complex patterns of gene expression

    Science.gov (United States)

    Amber J. Vanden Wymelenberg; Jill A. Gaskell; Michael D. Mozuch; Philip J. Kersten; Grzegorz Sabat; Diego Martinez; Daniel Cullen

    2009-01-01

    The wood decay basidiomycete Phanerochaete chrysosporium was grown under standard ligninolytic or cellulolytic conditions and subjected to whole-genome expression microarray analysis and liquid chromatography-tandem mass spectrometry of extracellular proteins. A total of 545 genes were flagged on the basis of significant changes in transcript accumulation and/or...

  15. A novel extracellular multicopper oxidase from Phanerochaete chrysosporium with ferroxidase activity

    Science.gov (United States)

    Luis F. Larrondo; Loreto Salas; Francisco Melo; Rafael Vicuna; Daniel Cullen

    2003-01-01

    Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified...

  16. The nop gene from Phanerochaete chrysosporium encodes a peroxidase with novel structural features

    Science.gov (United States)

    Luis F. Larrondo; Angel Gonzalez; Tomas Perez-Acle; Dan Cullen; Rafael Vicuna

    2005-01-01

    Inspection of the genome of the ligninolytic basidiomycete Phanerochaete chrysosporium revealed an unusual peroxidase-like sequence. The corresponding full length cDNA was sequenced and an archetypal secretion signal predicted. The deduced mature protein (NoP, novel peroxidase) contains 295 aa residues and is therefore considerably shorter than other Class II (fungal)...

  17. Comparative transcriptome and secretome analysis of wood decay fungi Postia placenta and Phanerochaete chrysosporium

    Science.gov (United States)

    Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen

    2010-01-01

    Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...

  18. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  19. Metabolic regulation at the tricarboxylic acid and glyoxylate cycles of the lignin-degrading basidiomycete Phanerochaete chrysosporium against exogenous addition of vanillin.

    Science.gov (United States)

    Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki

    2005-10-01

    A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.

  20. The Phanerochaete chrysosporium secretome : database predictions and initial mass spectrometry peptide identifications in cellulose-grown medium

    Science.gov (United States)

    Amber J. Vanden Wymelenberg; Grzegorz Sabat; Diego Martinez; Alex S. Rajangam; Tuula T. Teeri; Jill A. Gaskell; Philip J. Kersten; Daniel Cullen

    2005-01-01

    The white rot basidiomycete, Phanerochaete chrysosporium, employs an array of extracellular enzymes to completely degrade the major polymers of wood : cellulose, hemicellulose and lignin. Towards the identification of participating enzymes, 268 likely secreted proteins were predicted using SignalP and TargetP algorithms. To assess the reliability of secretome...

  1. Significant alteration of gene expression in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species

    Science.gov (United States)

    Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen

    2011-01-01

    Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...

  2. Genomic organization of a cellulase gene family in Phanerochaete chrysosporium

    Science.gov (United States)

    Sarah F. Covert; Jennifer Bolduc; Daniel Cullen

    1992-01-01

    Southern blot and nucleotide sequence analysis of Phanerochaete chrysosporium BKM-F-1767 genomic clones indicate that this wood-degrading fungus contains at least six genes with significant homology to the Trichoderma reesei cellobiohydrolase I gene (cbh1). Using pulsed-field gel electrophoresis to separate P. chrysosporium chromosomes, the six cellulase genes were...

  3. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Science.gov (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  4. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica; Floudas, Dimitrios; HIbbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Ruben; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavin, Jose L.; Oguiza, Jose A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kues, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan

    2011-12-06

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.

  5. Cloning and expression of Phanerochaete chrysosporium ...

    African Journals Online (AJOL)

    Owner

    Two of these sequences/genes, namely, cbhI.1 and cbhI.2 were characterised from genomic and cDNA libraries (Sims et al., 1994). Howard et al. (2004) reported on cbhI.1, and hence cbhI.2 is the focus of this report. The sequence data for P. chrysosporium. ME446 cbhI.2 appears in the. EMBL/GenBank/DDBJ Sequence ...

  6. Nitrate reductase gene involvement in hexachlorobiphenyl dechlorination by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    De, Supriyo; Perkins, Michael; Dutta, Sisir K.

    2006-01-01

    Polychlorobiphenyl (PCB) degradation usually occurs through reductive dechlorination under anaerobic conditions and phenolic ring cleavage under aerobic conditions. In this paper, we provide evidence of nitrate reductase (NaR) mediated dechlorination of hexachlorobiphenyl (PCB-153) in Phanerochaete chrysosporium under non-ligninolytic condition and the gene involved. The NaR enzyme and its cofactor, molybdenum (Mo), were found to mediate reductive dechlorination of PCBs even in aerobic condition. Tungsten (W), a competitive inhibitor of this enzyme, was found to suppress this dechlorination. Chlorine release assay provided further evidence of this nitrate reductase mediated dechlorination. Commercially available pure NaR enzyme from Aspergillus was used to confirm these results. Through homology search using TBLASTN program, NaR gene was identified, primers were designed and the RT-PCR product was sequenced. The NaR gene was then annotated in the P. chrysosporium genome (GenBank accession no. AY700576). This is the first report regarding the presence of nitrate reductase gene in this fungus with the explanation why this fungus can dechlorinate PCBs even in aerobic condition. These fungal inoculums are used commercially as pellets in sawdust for enhanced bioremediation of PCBs at the risk of depleting soil nitrates. Hence, the addition of nitrates to the pellets will reduce this risk as well as enhance its activity

  7. Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Mileski, G.J.; Bumpus, J.A.; Jurek, M.A.; Aust, S.D.

    1988-01-01

    Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [ 14 C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble metabolites of [ 14 C]PCP during degradation. Involvement of the lignin-degrading system of this fungus was suggested by the fact that the time of onset, time course, and eventual decline in the rate of PCP mineralization were similar to those observed for [ 14 C]lignin degradation. Also, a purified ligninase was shown to be able to catalyze the initial oxidation of PCP. Although biodegradation of PCP was decreased in nutrient nitrogen-sufficient (i.e., nonligninolytic) cultures of P. chrysosporium, substantial biodegradation of PCP did occur, suggesting that in addition to the lignin-degrading system, another degradation system may also be responsible for some of the PCP degradation observed. Toxicity studies showed that PCP concentrations above 4 mg/liter (15 μM) prevented growth when fungal cultures were identified by inoculation with spores. The lethal effects of PCP could, however, be the circumvented by allowing the fungus to establish a mycelial mat before adding PCP. With this procedure, the fungus was able to grow and mineralize [ 14 C]PCP at concentrations as high as 500 mg/liter (1.9 mM)

  8. Impact of Phanerochaete chrysosporium on the Functional Diversity of Bacterial Communities Associated with Decaying Wood.

    Directory of Open Access Journals (Sweden)

    Vincent Hervé

    Full Text Available Bacteria and fungi naturally coexist in various environments including forest ecosystems. While the role of saprotrophic basidiomycetes in wood decomposition is well established, the influence of these fungi on the functional diversity of the wood-associated bacterial communities has received much less attention. Based on a microcosm experiment, we tested the hypothesis that both the presence of the white-rot fungus Phanerochaete chrysosporium and the wood, as a growth substrate, impacted the functional diversity of these bacterial communities. Microcosms containing sterile sawdust were inoculated with a microbial inoculum extracted from a forest soil, in presence or in absence of P. chrysosporium and subsequently, three enrichment steps were performed. First, bacterial strains were isolated from different microcosms previously analyzed by 16S rRNA gene-based pyrosequencing. Strains isolated from P. chrysosporium mycosphere showed less antagonism against this fungus compared to the strains isolated from the initial forest soil inoculum, suggesting a selection by the fungus of less inhibitory bacterial communities. Moreover, the presence of the fungus in wood resulted in a selection of cellulolytic and xylanolytic bacterial strains, highlighting the role of mycospheric bacteria in wood decomposition. Additionally, the proportion of siderophore-producing bacteria increased along the enrichment steps, suggesting an important role of bacteria in iron mobilization in decaying-wood. Finally, taxonomic identification of 311 bacterial isolates revealed, at the family level, strong similarities with the high-throughput sequencing data as well as with other studies in terms of taxonomic composition of the wood-associated bacterial community, highlighting that the isolated strains are representative of the wood-associated bacterial communities.

  9. Impact of Phanerochaete chrysosporium on the Functional Diversity of Bacterial Communities Associated with Decaying Wood.

    Science.gov (United States)

    Hervé, Vincent; Ketter, Elodie; Pierrat, Jean-Claude; Gelhaye, Eric; Frey-Klett, Pascale

    2016-01-01

    Bacteria and fungi naturally coexist in various environments including forest ecosystems. While the role of saprotrophic basidiomycetes in wood decomposition is well established, the influence of these fungi on the functional diversity of the wood-associated bacterial communities has received much less attention. Based on a microcosm experiment, we tested the hypothesis that both the presence of the white-rot fungus Phanerochaete chrysosporium and the wood, as a growth substrate, impacted the functional diversity of these bacterial communities. Microcosms containing sterile sawdust were inoculated with a microbial inoculum extracted from a forest soil, in presence or in absence of P. chrysosporium and subsequently, three enrichment steps were performed. First, bacterial strains were isolated from different microcosms previously analyzed by 16S rRNA gene-based pyrosequencing. Strains isolated from P. chrysosporium mycosphere showed less antagonism against this fungus compared to the strains isolated from the initial forest soil inoculum, suggesting a selection by the fungus of less inhibitory bacterial communities. Moreover, the presence of the fungus in wood resulted in a selection of cellulolytic and xylanolytic bacterial strains, highlighting the role of mycospheric bacteria in wood decomposition. Additionally, the proportion of siderophore-producing bacteria increased along the enrichment steps, suggesting an important role of bacteria in iron mobilization in decaying-wood. Finally, taxonomic identification of 311 bacterial isolates revealed, at the family level, strong similarities with the high-throughput sequencing data as well as with other studies in terms of taxonomic composition of the wood-associated bacterial community, highlighting that the isolated strains are representative of the wood-associated bacterial communities.

  10. Pyranose 2-oxidase from Phanerochaete chrysosporium--Expression in E.coli and Biochemical Characterization

    Czech Academy of Sciences Publication Activity Database

    Pisanelli, I.; Kujawa, M.; Spadiut, O.; Kittl, R.; Halada, Petr; Volc, Jindřich; Mozuch, M. D.; Kersten, P.; Haltrich, D.; Peterbauer, C.

    2009-01-01

    Roč. 142, č. 2 (2009), s. 97-106 ISSN 0168-1656 Institutional research plan: CEZ:AV0Z50200510 Keywords : Pyranose 2-oxidase * Phanerochaete chrysosporium * Lignocellulose degradation Subject RIV: CE - Biochemistry Impact factor: 2.881, year: 2009

  11. Regulation of Gene Expression during the Onset of Ligninolytic Oxidation by Phanerochaete chrysosporium on Spruce Wood

    Science.gov (United States)

    Premsagar Korripally; Christopher G. Hunt; Carl J. Houtman; Don C. Jones; Peter J. Kitin; Dan Cullen; Kenneth E. Hammel; A. A. Brakhage

    2015-01-01

    Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in...

  12. Organization and differential regulation of a cluster of lignin peroxidase genes of Phanerochaete chrysosporium

    Science.gov (United States)

    Philip. Stewart; Daniel. Cullen

    1999-06-01

    The lignin peroxidases of Phanerochaete chrysosporium are encoded by a minimum of 10 closely related genes. Physical and genetic mapping of a cluster of eight lip genes revealed six genes occurring in pairs and transcriptionally convergent, suggesting that portions of the lip family arose by gene duplication events. The completed sequence of 1ipG and lipJ, together...

  13. Influence of Populus Genotype on Gene Expression by the Wood Decay Fungus Phanerochaete chrysosporium

    Science.gov (United States)

    Jill Gaskell; Amber Marty; Michael Mozuch; Philip J. Kersten; Sandra Splinter Bondurant; Grzegorz Sabat; Ali Azarpira; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Dan Cullen

    2014-01-01

    We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba tremula) and syringyl (S)-rich transgenic derivatives. Acombination ofmicroarrays and liquid chromatography- tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793...

  14. Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium (1988)

    Science.gov (United States)

    Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [14C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble met...

  15. Influence of gamma rays radiation on lignin degradation potency of phanerochaete chrysosporium and ganoderma lucidum

    International Nuclear Information System (INIS)

    Tri Retno DL; Nana Mulyana; Nurhasni; Uswatun Hasanah

    2016-01-01

    This research aims to increase the activity of extracellular enzymes lignolitik fungi phanerochaete chrysosporium and ganoderma lucidum to degrade lignocellulosic waste. Lignocellulosic difficult to degrade because it is composed of lignin, cellulose and hemicellulose. Phanerochaete chrysosporium and ganoderma lucidum group white rot fungi can degrade lignin because it is able to synthesize enzymes lignin peroxidase (LiP). Irradiation low dose gamma rays capable menstimulsi increase extracellular enzyme activity. Fungi phanerochaete chrysosporium and ganoderma lucidum in medium slent exposed to gamma irradiation at doses of 0 (control), 200, 400, 600, 800 and 1000 Gy. In a liquid medium containing Potatoes Dextrose Broth (PDB), mineral salts with the substrate lignin alkali 0 and 5 % w/v, fungi phanerochaete chrysosporium were exposed to a dose of 600 Gy of gamma rays have LiP activity (30 U/mL) by 2.5 times higher compared with controls (12 U/mL). While ganoderma lucidum that are exposed to gamma radiation at a dose of 800 Gy has LiP activity (34 U/mL) was 1.7 times higher than the control (20 U/mL). On a solid substrate fermentation of white teak powder (Gmelina arborea Roxb.) For 12 days at pH 6.4 and water content of 79 % by fungi phanerochaete chrysosporium were exposed to gamma ray dose of 600 Gy has an efficiency of lignin degradation by 42 %, whereas on fungi ganoderma lucidum that are exposed gamma ray dose of 800 Gy has an efficiency of lignin degradation by 21 % with optimal conditions of pH 7. And; water content of 71.3 %. (author)

  16. Computational analysis of the Phanerochaete chrysosporium v2.0 genome database and mass spectrometry identiWcation of peptides in ligninolytic cultures reveal complex mixtures of secreted proteins

    Science.gov (United States)

    Amber Vanden Wymelenberg; Patrick Minges; Grzegorz Sabat; Diego Martinez; Andrea Aerts; Asaf Salamov; Igor Grigoriev; Harris Shapiro; Nik Putnam; Paula Belinky; Carlos Dosoretz; Jill Gaskell; Phil Kersten; Dan Cullen

    2006-01-01

    The white-rot basidiomycete Phanerochaete chrysosporium employs extracellular enzymes to completely degrade the major polymers of wood: cellulose, hemicellulose, and lignin. Analysis of a total of 10,048 v2.1 gene models predicts 769 secreted proteins, a substantial increase over the 268 models identified in the earlier database (v1.0). Within the v2.1 ‘computational...

  17. Delignification of Sawdust White Teak (Gmelina arborea Roxb. by Fungi Phanerochaete chrysosporium Irradiated Gamma Ray

    Directory of Open Access Journals (Sweden)

    Nurhasni Nurhasni

    2016-12-01

    Full Text Available Abstrak Biomassa lignoselulosa yang merupakan limbah pemanenan kayu harus dilakukan proses untuk memisahkan selulosa, hemiselulosa dan lignin sehingga dapat termanfaatkan. Penelitian ini bertujuan untuk mengetahui efektivitas inokulan fungi Phanerochaete chrysosporium iradiasi gamma dan pretreatment kimia terhadap percepatan delignifikasi serbuk kayu jati putih (Gmelina arborea Roxb. sehingga dapat dimanfaatkan dalam proses pulping. Pada penelitian ini dilakukan pretreatment substrat kayu jati putih (Gmelina arborea Roxb. menggunakan larutan NaOH 1% dan H2SO4 1% serta iradiasi gamma Co-60, yang mempunyai daya ionisasi kecil, daya tembus yang tinggi serta Co-60 dapat memancarkan sinar gamma dengan waktu paruh pendek. Penelitian ini dilakukan dalam dua tahap, tahap pertama penentuan dosis optimum iradiasi gamma terhadap fungi Phanerochaete chrysosporium (0 Gy, 200 Gy, 400 Gy, 600 Gy, 800 Gy, dan 1000 Gy dan tahap kedua analisis karakteristik substrat kayu jati putih yang telah di pretreatment dengan metode Solid State Fermentation (SSF selama 21 hari. Hasil penelitian menunjukkan bahwa dosis optimum pemberian iradiasi gamma pada fungi Phanerochaete chrysosporium yaitu pada dosis 600 Gy yang dapat meningkatkan aktivitas enzim lignin peroksidase (LiP sebesar 22.18 U/mL. Proses pretreatment kimia dengan menggunakan H2SO4 1% dapat mempercepat proses biodelignifikasi yang menghasilkan efisiensi degradasi lignin tertinggi yaitu sebesar 25.65%.   Kata kunci: Lignoselulosa, delignifikasi, Solid State Fermentation (SSF, Phanerochaete chrysosporium,iradiasi gamma.   Abstract   Lignocellulose biomass is waste wood harvesting should be a process for separating cellulose, hemicellulose and lignin that can be utilized. This study aims to determine the effectiveness of the inoculant fungi Phanerochaete chrysosphorium gamma irradiation and chemical pretreatment to accelerate delignification powder white teak (Gmelina arborea Roxb.. In this research

  18. Decolorization of Azo, Triphenyl Methane, Heterocyclic, and Polymeric Dyes by Lignin Peroxidase Isoenzymes from Phanerochaete chrysosporium

    OpenAIRE

    Ollikka, Pauli; Alhonmäki, Kirsi; Leppänen, Veli-Matti; Glumoff, Tuomo; Raijola, Timo; Suominen, Ilari

    1993-01-01

    The ligninolytic enzyme system of Phanerochaete chrysosporium decolorizes several recalcitrant dyes. Three isolated lignin peroxidase isoenzymes (LiP 4.65, LiP 4.15, and LiP 3.85) were compared as decolorizers with the crude enzyme system from the culture medium. LiP 4.65 (H2), LiP 4.15 (H7), and LiP 3.85 (H8) were purified by chromatofocusing, and their kinetic parameters were found to be similar. Ten different types of dyes, including azo, triphenyl methane, heterocyclic, and polymeric dyes...

  19. Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium

    KAUST Repository

    Espinosa-Ortiz, Erika J.

    2014-10-24

    The ability of Phanerochaete chrysosporium to reduce the oxidized forms of selenium, selenate and selenite, and their effects on the growth, substrate consumption rate, and pellet morphology of the fungus were assessed. The effect of different operational parameters (pH, glucose, and selenium concentration) on the response of P. chrysosporium to selenium oxyanions was explored as well. This fungal species showed a high sensitivity to selenium, particularly selenite, which inhibited the fungal growth and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency, whereas less than 10 % selenium removal was achieved for incubations with selenate. P. chrysosporium was found to be a selenium-reducing organism, capable of synthesizing elemental selenium from selenite but not from selenate. Analysis with transmission electron microscopy, electron energy loss spectroscopy, and a 3D reconstruction showed that elemental selenium was produced intracellularly as nanoparticles in the range of 30–400 nm. Furthermore, selenite influenced the pellet morphology of P. chrysosporium by reducing the size of the fungal pellets and inducing their compaction and smoothness.

  20. Aqueous two-phase system purification for superoxide dismutase induced by menadione from Phanerochaete chrysosporium.

    Science.gov (United States)

    Kavakcıoğlu, Berna; Tongul, Burcu; Tarhan, Leman

    2017-03-01

    In the present work, the partitioning behavior of menadione-induced superoxide dismutase (SOD; EC 1.15.1.1), an antioxidant enzyme that has various applications in the medical and cosmetic industries, from the white rot fungus Phanerochaete chrysosporium has been characterized on different types of aqueous two-phase systems (ATPSs) (poly(ethylene glycol)/polypropylene glycol (PEG/PPG)-dextran, PEG-salt and PPG-salt). PEG-salt combinations were found most optimal systems for the purification of SOD. The best partition conditions were found using the PEG-3350 24% and K 2 HPO 4 5% (w/w) with pH 7.0 at 25 °C. The partition coefficient of total SOD activity and total protein concentration observed in this system were 0.17 and 6.65, respectively, with the recovery percentage as 78.90% in the bottom phase and 13.17% in the top phase. The highest purification fold for SOD from P. chrysosporium was found as 6.04 in the bottom phase of PEG 3350%24 - K 2 HPO 4 %5 (w/w) system with pH 7.0. SOD purified from P. chrysosporium was determined to be a homodimer in its native state with a molecular weight of 60  ± 4 kDa. Consequently, simple and only one step PEG-salt ATPS system was developed for SOD purification from P. chrysosporium.

  1. Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Hitoshi; MacDonald, Jacqueline; Syed, Khajamohiddin; Salamov, Asaf; Hori, Chiaki; Aerts, Andrea; Henrissat, Bernard; Wiebenga, Ad; vanKuyk, Patricia A.; Barry, Kerrie; Lindquist, Erika; LaButti, Kurt; Lapidus, Alla; Lucas, Susan; Coutinho, Pedro; Gong, Yunchen; Samejima, Masahiro; Mahadevan, Radhakrishnan; Abou-Zaid, Mamdouh; de Vries, Ronald P.; Igarashi, Kiyohiko; Yadav, Jagit S.; Grigoriev, Igor V.; Master, Emma R.

    2012-02-17

    Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s) among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.

  2. Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

    Science.gov (United States)

    Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

    2004-01-01

    Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

  3. Pemanfaatan Serbuk Kayu untuk Produksi Etanol dengan Perlakuan Pendahuluan Delignifikasi Menggunakan Jamur Phanerochaete Chrysosporium

    Directory of Open Access Journals (Sweden)

    Denny Irawati

    2009-01-01

    Full Text Available Utilization of Sawdust to Produce Ethanol Using Delignification Pre-treatment with White Rot Fungi Phanerochaete chrysosporium Currently, Indonesia is in the middle ofpetroleum crisis. One ofthe alternative fuels which can be used as a petroleum substitute is ethanol. Ethanol can be produced from timber waste (sawdust. Indonesia in 2003 had timber waste potency of about 3-4 millions m3. However, ethanol production from sawdust has problems due to its lignin content. Therefore, research on bio-delignification treatment of sawdust prior to ethanol making process is required. In the present study ethanol was produced by simultaneous saccharification and fermentation (SSF using crude cellulose from Trichoderma viride and Saccharomyces cerevisiae. The raw materials for ethanol production are sengon (Paraserianthes falcataria (L. Nielsen syn., meranti (Shorea sp. and teak (Tectona grandis LIIVN.f. sawdust after pretreatment with white rot fungi Phanerochaete chrysosporium for 10, 20 and 30 days incubation time. The yield of ethanol was between 1.65-44.83 g/1. The best combination treatment is sengon sawdust with 30 day incubation time.

  4. Responses of Phanerochaete chrysosporium to toxic pollutants: physiological flux, oxidative stress, and detoxification.

    Science.gov (United States)

    Zeng, Guang-Ming; Chen, An-Wei; Chen, Gui-Qiu; Hu, Xin-Jiang; Guan, Song; Shang, Cui; Lu, Lun-Hui; Zou, Zheng-Jun

    2012-07-17

    The white-rot fungus Phanerochaete chrysosporium has been widely used for the treatment of waste streams containing heavy metals and toxic organic pollutants. The development of fungal-based treatment technologies requires detailed knowledge of the relationship between bulk water quality and the physiological responses of fungi. A noninvasive microtest technique was used to quantify real-time changes in proton, oxygen, and cadmium ion fluxes following the exposure of P. chrysosporium to environmental toxic (2,4-dichlorophenol and cadmium). Significant changes in H(+) and O(2) flux occurred after exposure to 10 mg/L 2,4-dichlorophenol and 0.1 mM cadmium. Cd(2+) flux decreased with time. Reactive oxygen species formation and antioxidant levels increased after cadmium treatment. Superoxide dismutase activity correlated well with malondialdehyde levels (r(2) = 0.964) at low cadmium concentrations. However, this correlation diminished and malondialdehyde levels significantly increased at the highest cadmium concentration tested. Real-time microscale signatures of H(+), O(2), and Cd(2+) fluxes coupled with oxidative stress analysis can improve our understanding of the physiological responses of P. chrysosporium to toxic pollutants and provide useful information for the development of fungal-based technologies to improve the treatment of wastes cocontaminated with heavy metals and organic pollutants.

  5. Influence of Populus genotype on gene expression by the wood decay fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Gaskell, Jill; Marty, Amber; Mozuch, Michael; Kersten, Philip J; Splinter BonDurant, Sandra; Sabat, Grzegorz; Azarpira, Ali; Ralph, John; Skyba, Oleksandr; Mansfield, Shawn D; Blanchette, Robert A; Cullen, Dan

    2014-09-01

    We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba × tremula) and syringyl (S)-rich transgenic derivatives. A combination of microarrays and liquid chromatography-tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793 proteins. Comparisons of P. chrysosporium transcript abundance in medium containing poplar or glucose as a sole carbon source showed 113 regulated genes, 11 of which were significantly higher (>2-fold, P < 0.05) in transgenic line 64 relative to the parental line. Possibly related to the very large amounts of syringyl (S) units in this transgenic tree (94 mol% S), several oxidoreductases were among the upregulated genes. Peptides corresponding to a total of 18 oxidoreductases were identified in medium consisting of biomass from line 64 or 82 (85 mol% S) but not in the parental clone (65 mol% S). These results demonstrate that P. chrysosporium gene expression patterns are substantially influenced by lignin composition. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Lignocellulose Degradation during Solid-State Fermentation: Pleurotus ostreatus versus Phanerochaete chrysosporium

    Science.gov (United States)

    Kerem, Zohar; Friesem, Dana; Hadar, Yitzhak

    1992-01-01

    Lignocellulose degradation and activities related to lignin degradation were studied in the solid-state fermentation of cotton stalks by comparing two white rot fungi, Pleurotus ostreatus and Phanerochaete chrysosporium. P. chrysosporium grew vigorously, resulting in rapid, nonselective degradation of 55% of the organic components of the cotton stalks within 15 days. In contrast, P. ostreatus grew more slowly with obvious selectivity for lignin degradation and resulting in the degradation of only 20% of the organic matter after 30 days of incubation. The kinetics of 14C-lignin mineralization exhibited similar differences. In cultures of P. chrysosporium, mineralization ceased after 18 days, resulting in the release of 12% of the total radioactivity as 14CO2. In P. ostreatus, on the other hand, 17% of the total radioactivity was released in a steady rate throughout a period of 60 days of incubation. Laccase activity was only detected in water extracts of the P. ostreatus fermentation. No lignin peroxidase activity was detected in either the water extract or liquid cultures of this fungus. 2-Keto-4-thiomethyl butyric acid cleavage to ethylene correlated to lignin degradation in both fungi. A study of fungal activity under solid-state conditions, in contrast to those done under defined liquid culture, may help to better understand the mechanisms involved in lignocellulose degradation. PMID:16348683

  7. Maturation of green waste compost as affected by inoculation with the white-rot fungi Trametes versicolor and Phanerochaete chrysosporium.

    Science.gov (United States)

    Gong, Xiaoqiang; Li, Suyan; Sun, Xiangyang; Zhang, Lu; Zhang, Tao; Wei, Le

    2017-04-01

    Green waste was separately inoculated on day 0 and day 14 with either Trametes versicolor or Phanerochaete chrysosporium to determine their effects on composting time and compost quality. Inoculation with T. versicolor and P. chrysosporium caused more rapid and higher increases in compost temperatures, increased the duration of the thermophilic temperature stage, and reduced the maturity time. Inoculation with T. versicolor and P. chrysosporium greatly increased the quality of the final composts in terms of pH, electrical conductivity, organic matter concentration, C/N ratio, germination index, and nutrient content. Inoculation with T. versicolor and P. chrysosporium also significantly increased the degradation of lignin by 7.1% and 8.2%, respectively, and increased the degradation of cellulose by 10.6% and 13.6%, respectively.

  8. [Research and application of producing laccase by Phanerochaete chrysosporium in solid-state fermentation system].

    Science.gov (United States)

    Peng, Dan; Xie, Geng-xin; Zeng, Guang-ming; Chen, Yao-ning; Chen, Fu-rong; Hu, Shuang; Yu, Zhen

    2008-12-01

    The potential of banana skin and corn cob as a support-substrate for the production of extracellular laccase by the white-rot fungus Phanerochaete chrysosporium (BKMF-1767) was investigated. The results indicate that laccase showed a maximum activity of 12.68 U/g when the proportion of banana skin and corn cob is 1:2 and the inducer is 0.4 mmol/L CuSO4. In addition, crude laccase enzyme shows degradation activity to pentachlorophenol (PCP) without redox mediator or with the redox mediator (ABTS) at a concentration of 5 mmol/L, and the degradation rates of PCP were 37.8% and 97% respectively after 6 h. The crude laccase was purified by treatment of (NH4)2SO4, and the purified laccase could make the degradation rate of PCP to 81.8% within 6 h.

  9. Decolorization of Congo Red by Phanerochaete chrysosporium: the role of biosorption and biodegradation.

    Science.gov (United States)

    Bosco, Francesca; Mollea, Chiara; Ruggeri, Bernardo

    2017-10-01

    The degradation of Congo Red by means of Phanerochaete chrysosporium BKM-F-1767 is reported in this work. Solid and liquid cultures have been prepared to evaluate in vivo biodegradation as well as the role of biosorption phenomena on mycelium. Moreover, in vitro tests have been performed to define the influence of MnP on dye decolorization. P. chrysosporium, cultivated on Malt Extract Agar in the presence of Congo Red 0.005% (w/v), has shown good growth and the ability to decolorize the dye in the 25-39°C temperature range. It has also been cultivated in a low NMM liquid medium with the aforementioned dye concentration in immobilized stationary cultures inducted for Lignin Peroxidase (LiP) and Manganese Peroxidase (MnP) production. Congo Red was absorbed on the biomass and then decolorized (93% and 85% for the LiP and MnP cultures, respectively). The cultures with added Congo Red have shown a higher MnP synthesis rate than a control without the dye. The enzymatic degradation of Congo Red has also been investigated by means of the extracellular fluid for different MnP activities (0-300 IU/l); the decolorization percentage has been found to be clearly related to the enzyme concentration up to a value of about 200 IU/l.

  10. Degradation of Diuron by Phanerochaete chrysosporium: Role of Ligninolytic Enzymes and Cytochrome P450

    Directory of Open Access Journals (Sweden)

    Jaqueline da Silva Coelho-Moreira

    2013-01-01

    Full Text Available The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μg/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl-3-methylurea] and DCPU [(3,4-dichlorophenylurea], were detected in the culture medium at the concentrations of 0.74 μg/mL and 0.06 μg/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT, a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.

  11. Degradation of diuron by Phanerochaete chrysosporium: role of ligninolytic enzymes and cytochrome P450.

    Science.gov (United States)

    Coelho-Moreira, Jaqueline da Silva; Bracht, Adelar; de Souza, Aline Cristine da Silva; Oliveira, Roselene Ferreira; de Sá-Nakanishi, Anacharis Babeto; de Souza, Cristina Giatti Marques; Peralta, Rosane Marina

    2013-01-01

    The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μ g/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl)-3-methylurea] and DCPU [(3,4-dichlorophenyl)urea], were detected in the culture medium at the concentrations of 0.74 μ g/mL and 0.06 μ g/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT), a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.

  12. Facile green extracellular biosynthesis of CdS quantum dots by white rot fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Chen, Guiqiu; Yi, Bin; Zeng, Guangming; Niu, Qiuya; Yan, Ming; Chen, Anwei; Du, Jianjian; Huang, Jian; Zhang, Qihua

    2014-05-01

    This study details a novel method for the extracellular microbial synthesis of cadmium sulfide (CdS) quantum dots (QDs) by the white rot fungus Phanerochaete chrysosporium. P. chrysosporium was incubated in a solution containing cadmium nitrate tetrahydrate, which became yellow from 12h onwards, indicating the formation of CdS nanocrystals. The purified solution showed a maximum absorbance peak between 296 and 298 nm due to CdS particles in the quantum size regime. The fluorescence emission at 458 nm showed the blue fluorescence of the nanoparticles. X-ray analysis of the nanoparticles confirmed the production of CdS with a face-centered cubic (fcc) crystal structure. The average grain size of the nanoparticles was approximately 2.56 nm, as determined from the full width at half-maximum (FWHM) measurement of the most intense peak using Scherer's equation. Transmission electron microscopic analysis showed the nanoparticles to be of a uniform size with good crystallinity. The changes to the functional groups on the biomass surface were investigated through Fourier transform infrared spectroscopy. Furthermore, the secretion of cysteine and proteins was found to play an important role in the formation and stabilization of CdS QDs. In conclusion, our study outlines a chemical process for the molecular synthesis of CdS nanoparticles. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Phanerochaete chrysosporium inoculation shapes the indigenous fungal communities during agricultural waste composting.

    Science.gov (United States)

    Zhang, Jiachao; Zeng, Guangming; Chen, Yaoning; Liang, Jie; Zhang, Chang; Huang, Binbin; Sun, Weimin; Chen, Ming; Yu, Man; Huang, Hongli; Zhu, Yi

    2014-09-01

    Inoculation with exogenous white-rot fungi has been proven to be an efficient method to promote lignocellulose biodegradation during agricultural waste composting. Indigenous fungal communities, the most important organisms responsible for mineralization and decomposition of lignocellulosic materials in composts, can be affected by sample properties and other biotic factors. This research was conducted to determine the effects of the Phanerochaete chrysosporium inoculation on the indigenous fungal communities during agricultural waste composting. Fungal communities in samples with different inoculation regimes were investigated by sequencing and quantitative PCR. Results showed that P. chrysosporium inoculants produced significant negative effects on the indigenous fungal community abundance during the thermophilic stage. Samples inoculated during Phase II contained higher proportion of Acremonium chrysogenum and Galactomyces geotrichum, while those non-inoculated samples were dominated by Coprinopsis cinerea and Scytalidium thermophilum. Moreover, the indigenous fungal community abundance was significantly correlated with the C/N ratio, water soluble carbon and moisture content (P < 0.05). Redundancy analysis indicated that the most variation in distribution of indigenous fungal community structure was statistically explained by nitrate, C/N ratio, and moisture content, factors which solely explained 29.6 % (F = 30.316, P = 0.002), 25.6 % (F = 26.191, P = 0.002) and 10.0 % (F = 10.249, P = 0.002) of the variation in the indigenous fungal community structure, respectively.

  14. Enhanced Delignification of Lignocellulosic Biomass by Recombinant Fungus Phanerochaete chrysosporium Overexpressing Laccases and Peroxidases.

    Science.gov (United States)

    Coconi Linares, Nancy; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2018-02-27

    Ligninolytic enzyme production and lignin degradation are typically the rate-limiting steps in the biofuel industry. To improve the efficiency of simultaneous bio-delignification and enzyme production, Phanerochaete chrysosporium was transformed by shock wave-induced acoustic cavitation to co-overexpress 3 peroxidases and 1 laccase and test it on the degradation of sugarcane bagasse and wheat bran. Lignin depolymerization was enhanced by up to 25% in the presence of recombinant fungi in comparison with the wild-type strain. Sugar release on lignocellulose was 2- to 6-fold higher by recombinant fungi as compared with the control. Wheat bran ostensibly stimulated the production of ligninolytic enzymes. The highest peroxidase activity from the recombinant strains was 2.6-fold higher, whereas the increase in laccase activity was 4-fold higher in comparison to the control. The improvement of lignin degradation was directly proportional to the highest peroxidase and laccase activity. Because various phenolic compounds released during lignocellulose degradation have proven to be toxic to cells and to inhibit enzyme activity, a significant reduction (over 40%) of the total phenolic content in the samples treated with recombinant strains was observed. To our knowledge, this is the first report that engineering P. chrysosporium enhances biodegradation of lignocellulosic biomass. © 2018 S. Karger AG, Basel.

  15. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    International Nuclear Information System (INIS)

    Huang, Zhenzhen; Chen, Guiqiu; Zeng, Guangming; Chen, Anwei; Zuo, Yanan; Guo, Zhi; Tan, Qiong; Song, Zhongxian; Niu, Qiuya

    2015-01-01

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles

  16. VANILLIN PRODUCTION BY PHANEROCHAETE CHRYSOSPORIUM GROWN ON GREEN COCONUT AGRO-INDUSTRIAL HUSK IN SOLID STATE FERMENTATION

    OpenAIRE

    Elisabete dos Santos Barbosa; Daniel Perrone; Ana Lúcia do Amaral Vendramini; Selma Gomes Ferreira Leite

    2008-01-01

    Agro-industrial residues have become an important source for the production of chemical compounds using biological pathways, contributing to preservation of the environment and making the overall process economically supportable. Vanillin is a very important aromatic compound for the food, beverage, and pharmaceutical industries. The aim of the present study was to evaluate the vanillin production by solid-state fermentation on green coconut residue using the basidiomycete Phanerochaete chrys...

  17. Organic matters removal from landfill leachate by immobilized Phanerochaete chrysosporium loaded with graphitic carbon nitride under visible light irradiation.

    Science.gov (United States)

    Hu, Liang; Liu, Yutang; Zeng, Guangming; Chen, Guiqiu; Wan, Jia; Zeng, Yunxiong; Wang, Longlu; Wu, Haipeng; Xu, Piao; Zhang, Chen; Cheng, Min; Hu, Tianjue

    2017-10-01

    This study investigated the technical applicability of a combination of Phanerochaete chrysosporium (P. chrysosporium) with photocatalyst graphitic carbon nitride (g-C 3 N 4 ) for organic matters removal from landfill leachate under visible light irradiation. Photocatalyst g-C 3 N 4 was well immobilized on the hyphae surface of P. chrysosporium by calcium alginate. The typical absorption edge in visible light region for g-C 3 N 4 was at about 460 nm, and the optical absorption bandgap of g-C 3 N 4 was estimated to be 2.70 eV, demonstrating the great photoresponsive ability of g-C 3 N 4 . An optimized g-C 3 N 4 content of 0.10 g in immobilized P. chrysosporium and an optimized immobilized P. chrysosporium dosage of 1.0 g were suitable for organic matters removal. The removal efficiency of total organic carbon (TOC) reached 74.99% in 72 h with the initial TOC concentration of 100 mg L -1 . In addition, the gas chromatography coupled with mass spectrometry (GC-MS) measurements showed that immobilized P. chrysosporium presented an outstanding removal performance for almost all organic compounds in landfill leachate, especially for the volatile fatty acids and long-chain hydrocarbons. The overall results indicate that the combination P. chrysosporium with photocatalyst g-C 3 N 4 for organic matters removal from landfill leachate may provide a more comprehensive potential for the landfill leachate treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Continuous treatment of coloured industry wastewater using immobilized Phanerochaete chrysosporium in a rotating biological contactor reactor.

    Science.gov (United States)

    Pakshirajan, Kannan; Kheria, Sumeet

    2012-06-30

    Coloured industry wastewaters often contain dyes and other toxic ingredients, and, therefore, pose serious threat to the receiving environment. Among the available methods the eco-friendly biological method has gained maximum attention due to its many advantages over the traditional methods. In the present study, continuous biological treatment of coloured wastewater from a textile dyeing industry was investigated using the white rot fungus Phanerochaete chrysosporium in a rotating biological contactor (RBC) reactor. The raw wastewater was diluted with an equal volume of either distilled water or media containing glucose at varying concentrations to study its effect on the decolourization process. Results revealed that the wastewater could be decolourized to an extent of more than 64% when diluted with media containing glucose; and, a maximum decolourization efficiency of 83% was obtained with 10 g/l glucose concentration. COD removal efficiencies were also found to be consistent with the decolourization efficiencies of the wastewaters. Further, the results were correlated with the enzyme activities of manganese peroxidase (MnP) and lignin peroxidase (LiP) by the fungus, which were found to play some significant role in decolourization of the wastewater. Results of replacing the costly carbon source glucose in the decolourization media with the more cheap molasses, however, revealed very high COD removal efficiency, but low decolourization efficiency of the industry wastewater. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. ABILITY OF Phanerochaete chrysosporium AND Trametes versicolor TO REMOVE Zn2+, Cr3+, Pb2+ METAL IONS

    Directory of Open Access Journals (Sweden)

    Josué Solís Pacheco

    2015-07-01

    Full Text Available The use of fungal biomass as an alternative for removing heavy metals has become increasingly important in recent years, replacing conventional methods based on chemical physical processes. In this study, we evaluated the biosorption of Zn2+, Cr3+ and Pb2+, which were analyzed to determine their effect on growth kinetic parameters of Phanerochaete chrysosporium strain ATCC 32629 and Trametes versicolor ATCC 1267. Growth kinetics were performed in four liquid culture media: 1 Yeast Nitrogen Base (YNB used as control, 2 YNB medium plus Pb2+ (0.25, 1 and 2 mg L-1, 3 YNB medium plus Zn2+ (5, 10 and 20 mg L-1 and 4 YNB medium plus Cr3+ (0.5, 1 and 2 mg L-1. The flasks were incubated at 25 °C with shaking at 150 rpm. Metal concentrations were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AES with prior acid digestion of the sample. The results demonstrated that Phanerochaete chrysosporium ATCC 32629 and Trametes versicolor ATCC 12679 are able to grow in the culture medium with Pb2+, Zn2+ and Cr3+ ions at different concentrations. However, P. chrysosporium ATCC 32629 showed greater adaptability and ability to adsorb Cr3+ in the culture medium at concentrations of 0.5 and 1 mg L-1, whereas T. versicolor ATCC 12679 was capable of Pb2+ biosorption at concentrations of 0.25, 1 and 2 mg L-1.

  20. Sorption of zinc onto elemental selenium nanoparticles immobilized in Phanerochaete chrysosporium pellets.

    Science.gov (United States)

    Espinosa-Ortiz, Erika J; Shakya, Manisha; Jain, Rohan; Rene, Eldon R; van Hullebusch, Eric D; Lens, Piet N L

    2016-11-01

    The use of a novel hybrid biosorbent, elemental selenium nanoparticles (nSe 0 ) immobilized in pellets of Phanerochaete chrysosporium, to remove Zn from aqueous solutions was investigated. Fungal pellets containing nSe 0 (nSe 0 -pellets) showed to be better biosorbents as they removed more Zn (88.1 ± 5.3 %) compared to Se-free fungal pellets (56.2 ± 2.8 %) at pH 4.5 and an initial Zn concentration of 10 mg L -1 . The enhanced sorption capacity of nSe 0 -pellets was attributed to a higher concentration of sorption sites resulting in a more negative surface charge density, as determined by analysis of the potentiometric titration data. Fourier transform infrared spectroscopy (FT-IR) analysis of fungal pellets prior to and after being loaded with Zn showed the functional groups, including hydroxyl and carboxyl groups, involved in the sorption process. The experimental data indicated that the sorption rate of the nSe 0 -pellets fitted well to the pseudo-second order kinetic model (R 2  = 0.99), and the sorption isotherm was best represented by the Sips model (Langmuir-Freundlich) with heterogeneous factor n = 1 (R 2  = 0.99), which is equivalent to the Langmuir model. Operational advantages of fungal pelleted reactors and the Zn removal efficiencies achieved by nSe 0 -pellets under mild acidic conditions make nSe 0 -pellet based bioreactors an efficient biosorption process.

  1. Biological composting of petroleum waste organics using the white rot fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    McFarland, M.J.; Xiu J, Qiu; Aprill, W.A.; Sims, R.C.

    1990-01-01

    Environmental enrichment of the white rot fungus Phanerochaete chrysosporium in biological compost soil reactors was effective in enhancing the rates of Benzo(a)pyrene removal over that observed under natural soil conditions. In contaminated soil compost systems amended with fungal inoculum and primary substrate, maximum Benzo(a)pyrene removal rates of 0.31 mg B(a)p/kg compost material-day (0.25 mgB(a)p/kg soil-day) were observed while in unamended soil conditions, maximum removal rates of 0.13 mg B(a)p/kg soil-day were recorded. Additions of primary substrate without any fungal inoculum gave compound removal rates similar to soil only conditions (i.e., 14 mg B(a)p/kg soil-day). Differences in contaminant and radioactivity ( 14 C) removal rates indicated that Benzo(a)pyrene derived carbon was being incorporated into nonvolatile materials within the compost environment. Contaminated soil pH had a significant effect on Benzo(a)pyrene removal rates during composting treatment. With acid soils (pH-4.8), a maximum Benzo(a)pyrene removal rate of 0.11 mg B(a)p/kg compost material-day was determined compared to 0.31 mg B(a)p/kg compost material-day in alkaline (pH-8.0) soil. Oxygen availability appeared to be one of the most important process variables influencing both fungal growth and Benzo(a)pyrene removal. Periodic pulses of oxygen equivalent to a three volume turnover of reactor headspace every three days resulted in increasing the Benzo(a)pyrene removal rate from 0.31 mg B(a)p/kg compost material-day to 0.85 mg B(a)p/kg compost material day

  2. Biodegradation of TNT (2,4,6-Trinitrotoluene) by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Fernando, T.; Bumpus, J.A.; Aust, S.D.

    1990-01-01

    Extensive biodegradation of TNT (2,4,6-trinitrotoluene) by the white rot fungus Phanerochaete chrysosporium was observed. At an initial concentration of 1.3 mg/liter, 35.4 ± 3.6% of the [ 14 C]TNT was degraded to 14 CO 2 in 18 days. The addition of glucose 12 days after the addition of TNT did not stimulate mineralization, and, after 18 days of incubation with TNT only, about 3.3% of the initial TNT could be recovered. Mineralization of [ 14 C]TNT absorbed on soil was also examined. Ground corncobs served as the nutrient for slow but sustained degradation of [ 14 C]TNT to 14 CO 2 such that 6.3 ± 0.6% of the [ 14 C]TNT initially present was converted to 14 CO 2 during the 30-day incubation period. Mass balance analysis of liquid cultures and of soil-corncob cultures revealed that polar [ 14 C]TNT metabolites are formed in both systems, and high-performance liquid chromatography analyses revealed that less then 5% of the radioactivity remained as undegraded [ 14 C]TNT following incubation with the fungus in soil and liquid cultures. When the concentration of TNT in cultures (both liquid and soil) was adjusted to contamination levels that might be found in the environment, i.e., 10,000 mg/kg in soil and 100 mg/liter in water, mineralization studies showed that 18.4 ± 2.9% and 19.6 ± 3.5% of the initial TNT was converted to 14 CO 2 in 90 days in soil and liquid cultures, respectively. In both cases (90 days in water at 100 mg/liter and in soil at 10,000 mg/kg) approximately 85% of the TNT was degraded. These results suggest that this fungus may be useful for the decontamination of sites in the environment contaminated with TNT

  3. EFFECTS OF CULTURE PARAMETERS ON DDT [1,1,1-TRICHLO- RO-2,2-BIS(4-CHLOROPHENYL) ETHANE] BIODEGRADATION BY PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    The lignin degrading system of the white rot fungus Phanerochaete chrysosporium is able to degrade a wide variety of structurally diverse organopollutants to carbon dioxide. Current research is focused on ways to increase or optimize rates of biodegradation in order to a...

  4. BIODEGRADATION OF DDT [1,1,1-TRICHLORO-2,2-BIS(4- CHLOROPHENYL) ETHANE] BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the form...

  5. BIODEGRATION OF 2,4,5-TRICHLOROPHENOXYACETIC ACID IN LIQUID CULTURE AND IN SOIL BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    Extensive biodegradation of [14C]-2,4,5-trichlorophenoxyacetic acid ([[14C]-2,4,5-T) by the white rot fungus Phanerochaete chrysosporium was demonstrated in nutrient nitrogen-limited aqueous cultures and in [14C]-2,4,5-T-contaminated soil inoculat...

  6. Microbial pretreatment of cotton stalks by Phanerochaete chrysosporium for bioethanol production

    Science.gov (United States)

    Shi, Jian

    Lignocellulosic biomass has been recognized as a widespread, potentially low cost renewable source of mixed sugars for fermentation to fuel ethanol. Pretreatment, as the first step towards conversion of lignocellulose to ethanol, remains one of the main barriers to technical and commercial success of the processing technology. Existing pretreatment methods have largely been developed on the basis of physiochemical technologies which are considered relatively expensive and usually involve adverse environmental impacts. In this study, an environmentally benign alternative, microbial pretreatment using Phanerochaete chrysosporium, was explored to degrade lignin in cotton stalks and facilitate their conversion into ethanol. Two submerged liquid pretreatment techniques (SmC), shallow stationary and agitated cultivation, at three inorganic salt concentrations (no salts, modified salts without Mn2+, modified salts with Mn2+) were compared by evaluating their pretreatment efficiencies. Shallow stationary cultivation with no salt was superior to other pretreatment conditions and gave 20.7% lignin degradation along with 76.3% solids recovery and 29.0% carbohydrate availability over a 14 day period. The influence of substrate moisture content (65%, 75% and 80% M.C. wet-basis), inorganic salt concentration (no salts, modified salts without Mn2+ , modified salts with Mn2+) and culture time (0-14 days) on pretreatment effectiveness in solid state (SSC) systems was also examined. It was shown that solid state cultivation at 75% M.C. without salts was the most preferable pretreatment resulting in 27.6% lignin degradation, 71.1% solids recovery and 41.6% carbohydrate availability over a period of 14 days. A study on hydrolysis and fermentation of cotton stalks treated microbially using the most promising SmC (shallow stationary, no salts) and SSC (75% moisture content, no salts) methods resulted in no increase in cellulose conversion with direct enzyme application (10.98% and 3

  7. Simultaneous removal of ciprofloxacin, norfloxacin, sulfamethoxazole by co-producing oxidative enzymes system of Phanerochaete chrysosporium and Pycnoporus sanguineus.

    Science.gov (United States)

    Gao, Nan; Liu, Chun-Xiao; Xu, Qiu-Man; Cheng, Jing-Sheng; Yuan, Ying-Jin

    2018-03-01

    Pycnoporus sanguineus could remove 98.5% ciprofloxacin (CIP), 96.4% norfloxacin (NOR), 100% sulfamethoxazole (SMX), and 100% their mixture through biotransformation within 2 d, while Phanerochaete chrysosporium could only remove 64.5% CIP, 73.2% NOR, and 63.3% SMX through biosorption and biotransformation within 8 d, respectively. The efficiencies of antibiotic bioremoval under co-culture were more than that under the pure culture of P. chrysosporium but less than that under the pure culture of P. sanguineus. However, only 2% CIP and 3% NOR under co-culture were detected in the mycelia. In vitro enzymatic degradation and in vivo cytochrome P450 inhibition experiments revealed that laccase and cytochrome P450 could play roles in the removal of above all antibiotics, while manganese peroxidase could only play role in SMX removal. Transformation products of CIP and NOR under the pure culture of P. chrysosporium could be assigned to three different reaction pathways: (i) defluorination or dehydration, (ii) decarboxylation, and (iii) oxidation of the piperazinyl substituent. Additionally, other pathways, (iv) monohydroxylation, and (v) demethylation or deethylation at position N 1 also occurred under the co-culture and pure culture of P. sanguineus. Antibacterial activity of antibiotics could be eliminated after treatments with pure and co-culture of P. chrysosporium and P. sanguineus. The cytotoxicity of the metabolites of SMX and NOR under co-culture was lower than that under the pure culture of P. sanguineus, indicating co-culture is a more environmentally friendly strategy to eliminate SMX and NOR. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Activity of the ligninolytic enzymes of the Phanerochaete chrysosporium and its variation with the Mn+2 addition

    International Nuclear Information System (INIS)

    Jimenez T, Gloria Alicia; Mejia G, Amanda I; Lopez O, Betty Lucy

    1999-01-01

    The activity of the ligninolytic enzymes, lignin peroxidase (LiP), manganese peroxidase (MnP) and Laccase, in submerged cultures of Phanerochaete chrysosporium, with limited amounts of carbon and nitrogen, were affected by the addition of Mn+2. In cultures with o and 1,25 ppm of Mn+2, only the lip was detected and its higher activity level was observed in the cultures with 1.25 ppm of Mn+2. The cultures with 40 ppm of Mn+2 showed activities of lip, MnP and Laccase. The presence of the three enzymes in the same culture had not been reported and it is of great importance because is shows that the fungus and its lignolitic machinery can act sequentially

  9. Perubahan Komposisi Kimia Kulit Buah Kakao Akibat Penambahan Mangan dan Kalsium dalam Biokonversi dengan Kapang Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    Suparjo

    2009-12-01

    Full Text Available Bioconversion is a method to increase quality of high lignocellulose-containing feedstuffs. Fermentation occurs during bioconversion is influenced primarily by length of fermentation and mineral supplementation to the medium. This study was aimed at determining the effect of these two factors on dry matter (DM, organic matter (OM, neutral detergent fiber (NDF and acid detergent fiber (ADF, and cellulose-to-lignin ratio of cocoa pod incubated with Phanerochaete chrysosporium. Twenty four treatments containing of 4 mineral supplementations (no mineral, Ca, Mn, and Ca+Mn and 6 different lengths of fermentation (0, 5, 10, 15, 20, and 25 days were designed randomly to 72 fermentation glass jars in a 4x6 factorial arrangement. Length of fermentation had significant effect on all parameters measured. Mineral significantly affected changes of DM and OM, NDF and ADF content, and cellulose-to-lignin ratio, but not DM and OM content. In conclusion, supplementation of Ca to cocoa pod incubated with P. chrysosporium for 15 days contributed positively (P<0.05 to changes of OM (13.83% and DM (11.30%. The cellulose-to-lignin ratio of 1.34 was the optimum result of Mn supplementation for 10 days incubation.

  10. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  11. Lignin peroxidase gene family of Phanerochaete chrysosporium : complex regulation by carbon and nitrogen limitation and identification of a second dimorphic chromosome

    Science.gov (United States)

    Philip Stewart; Philip Kersten; Amber J. Vanden Wymelenberg; Jill A. Gaskell; Daniel Cullen

    1992-01-01

    Lignin peroxidases (LiP) of Phanerochaete chrysosporium are encoded by a family of six closely related genes. Five LiP genes have been localized to the same dimorphic chromosome. In this investigation, relative transcript levels of the LiP genes were determined. Transcripts of the LiPA, LiPB, and 0282 genes were at similar levels in both carbon-and nitrogen-limited...

  12. FTIR as an easy and fast analytical approach to follow up microbial growth during fungal pretreatment of poplar wood with **Phanerochaete chrysosporium**

    OpenAIRE

    Cornet, I.; Wittner, N.; Tofani, G.; Tavernier, S.

    2018-01-01

    Abstract: Since the determination of the fermentation kinetics is one of the main challenges in solid state fermentation, the quantitative measurement of biomass growth during microbial pretreatment by FTIR spectroscopy in Attenuated Total Reflectance mode was evaluated. Peaks at wave numbers of 1651 cm−1 and 1593 cm−1 showed to be affected during pretreatment of poplar wood particles by Phanerochaete chrysosporium MUCL 19343. Samples with different microbial biomass fractions were obtained f...

  13. Transcript patterns of Phanerochaete chrysosporium genes in organopollutant contaminated soils and in wood

    Science.gov (United States)

    Amber. Vanden Wymelenberg; Bernard. Janse; Jill. Gaskell; Diane. Dietrich; Marcelo. Vallim; Dan. Cullen

    1998-01-01

    We describe here recent methods for quantitative assessment of specific P. chrysosporium mRNAs in organopollutant contaminated soils and in Aspen wood chips. Magnetic capture techniques were used to rapidly purify poly(A)-RNA, and quantitative RT-PCR protocols were developed for all known lignin peroxidase (lip) and cellobiohydrolase (cbh1) genes. The methodology is...

  14. Overview of parameters influencing biomass and bioreactor performance used for extracellular ligninase production from Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    Seteno Ntwampe

    2010-10-01

    Full Text Available The production of extracellular enzymes is gaining momentum as commercial interests seek alternative ways to improve the productivity in the biotechnology and pharmaceutical industries. Early research studies looked at improving batch bioreactor operational challenges; however, the use of continuous cultures was indicated to be favourable. This led to a new approach developed to produce extracellular enzymes continuously using fixed-film bioreactors from biofilms immobilised on polymeric and inorganic membranes. In this review, the performance of P. chrysosporium biomass, evaluated in terms of ligninase production using different bioreactor operation conditions, is highlighted. Furthermore, the limitations related to the implementation of optimised batch culture conditions to continuous fixed-film bioreactors are discussed. DO transportation, trace element toxicity and lipid peroxidation effects on P. chrysosporium biomass in fixed-film bioreactors operated for elongated periods, are also discussed.

  15. Decolourization potential of white-rot fungus Phanerochaete chrysosporium on synthetic dye bath effluent containing Amido black 10B

    Directory of Open Access Journals (Sweden)

    S. Senthilkumar

    2014-12-01

    Full Text Available Synthetic azo dyes are extensively used in textile industry and are not easily degraded into the environment due to their complex structure. Due to the low degree of fixation of these dyes to fabrics, more than 10–15% of the dye does not bind to fabrics during colour processing and release into water bodies as effluent cause serious environmental pollution. White-rot fungus is found to be capable of degrading lignin which has a complex structure similar to azo dyes. In this study, the decolourization potential of white-rot fungus Phanerochaete chrysosporium, which is capable of decolourizing synthetic dye bath effluent, was investigated. Maximum decolourization of 98% was achieved on the third day under normal conditions. The rate of decolourization carried out at different concentrations revealed that the increase in dye effluent concentration suppresses the percentage decolourization. The optimized amounts of nutrients were found to be 0.5%, 0.1% and 0.5% of glucose, manganese sulphate and ammonium salts, respectively. The addition of inducers such as starch and lignin increased enzyme production and the rate of decolourization.

  16. Long serial analysis of gene expression for transcriptome profiling during the initiation of ligninolytic enzymes production in Phanerochaete chrysosporium.

    Science.gov (United States)

    Minami, Masahiko; Kureha, Orie; Mori, Mari; Kamitsuji, Hisatoshi; Suzuki, Kazumi; Irie, Toshikazu

    2007-06-01

    To analyze the transcriptome profile during the initiation of manganese peroxidase (MnP) and lignin peroxidase (LiP) production in Phanerochaete chrysosporium, we constructed long serial analysis of gene expression (LongSAGE) libraries. A total of 13,666 tags (the number of cumulative counted tags) that included 6,945 unique tags (the number of distinct tags) were isolated from the day-3 culture, which just started the enzymes production and was 24 h after veratryl alcohol addition and oxygen-purge into the culture (day-2 culture). A total of 12,402 tags that included 6,396 unique tags were isolated from the day-2 culture, in which the activity of enzymes is not detected. The comparison of the two libraries suggested that 38 genes showed significant (p < or = 0.01) fourfold or greater upregulation; this included the MnP gene (mnp2, mnp3) and LiP H8 gene. On the other hand, 43 genes showed significant (p < or = 0.01) fourfold or greater downregulation. This LongSAGE analysis found many new candidate genes regulating the enzymes production.

  17. Cloning, expression and characterization of an aryl-alcohol dehydrogenase from the white-rot fungus Phanerochaete chrysosporium strain BKM-F-1767

    Directory of Open Access Journals (Sweden)

    Yang Dong-Dong

    2012-06-01

    Full Text Available Abstract Background The white-rot fungus Phanerochaete chrysosporium is among the small group of fungi that can degrade lignin to carbon dioxide while leaving the crystalline cellulose untouched. The efficient lignin oxidation system of this fungus requires cyclic redox reactions involving the reduction of aryl-aldehydes to the corresponding alcohols by aryl-alcohol dehydrogenase. However, the biochemical properties of this enzyme have not been extensively studied. These are of most interest for the design of metabolic engineering/synthetic biology strategies in the field of biotechnological applications of this enzyme. Results We report here the cloning of an aryl-alcohol dehydrogenase cDNA from the white-rot fungus Phanerochaete chrysosporium, its expression in Escherichia coli and the biochemical characterization of the encoded GST and His6 tagged protein. The purified recombinant enzyme showed optimal activity at 37°C and at pH 6.4 for the reduction of aryl- and linear aldehydes with NADPH as coenzyme. NADH could also be the electron donor, while having a higher Km (220 μM compared to that of NADPH (39 μM. The purified recombinant enzyme was found to be active in the reduction of more than 20 different aryl- and linear aldehydes showing highest specificity for mono- and dimethoxylated Benzaldehyde at positions 3, 4, 3,4 and 3,5. The enzyme was also capable of oxidizing aryl-alcohols with NADP + at 30°C and an optimum pH of 10.3 but with 15 to 100-fold lower catalytic efficiency than for the reduction reaction. Conclusions In this work, we have characterized the biochemical properties of an aryl-alcohol dehydrogenase from the white-rot fungus Phanerochaete chrysosporium. We show that this enzyme functions in the reductive sense under physiological conditions and that it displays relatively large substrate specificity with highest activity towards the natural compound Veratraldehyde.

  18. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes

    DEFF Research Database (Denmark)

    Manavalan, Arulmani

    2006-01-01

    Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production...... at 3.5-fold increase compared to control. Solid-state fermentation using wheat bran as substrate exhibit, maximum laccase activity of 48.89 ± 1.82 U/L on day 5, whereas it was only 30.21 ± 1.66 and 22.56 ± 1.22 U/L, respectively, in batch fermentation in a laboratory scale bioreactor and in static...

  19. Characterization of a Phanerochaete chrysosporium glutathione transferase reveals a novel structural and functional class with ligandin properties.

    Science.gov (United States)

    Mathieu, Yann; Prosper, Pascalita; Buée, Marc; Dumarçay, Stéphane; Favier, Frédérique; Gelhaye, Eric; Gérardin, Philippe; Harvengt, Luc; Jacquot, Jean-Pierre; Lamant, Tiphaine; Meux, Edgar; Mathiot, Sandrine; Didierjean, Claude; Morel, Mélanie

    2012-11-09

    Glutathione S-transferases (GSTs) form a superfamily of multifunctional proteins with essential roles in cellular detoxification processes. A new fungal specific class of GST has been highlighted by genomic approaches. The biochemical and structural characterization of one isoform of this class in Phanerochaete chrysosporium revealed original properties. The three-dimensional structure showed a new dimerization mode and specific features by comparison with the canonical GST structure. An additional β-hairpin motif in the N-terminal domain prevents the formation of the regular GST dimer and acts as a lid, which closes upon glutathione binding. Moreover, this isoform is the first described GST that contains all secondary structural elements, including helix α4' in the C-terminal domain, of the presumed common ancestor of cytosolic GSTs (i.e. glutaredoxin 2). A sulfate binding site has been identified close to the glutathione binding site and allows the binding of 8-anilino-1-naphtalene sulfonic acid. Competition experiments between 8-anilino-1-naphtalene sulfonic acid, which has fluorescent properties, and various molecules showed that this GST binds glutathionylated and sulfated compounds but also wood extractive molecules, such as vanillin, chloronitrobenzoic acid, hydroxyacetophenone, catechins, and aldehydes, in the glutathione pocket. This enzyme could thus function as a classical GST through the addition of glutathione mainly to phenethyl isothiocyanate, but alternatively and in a competitive way, it could also act as a ligandin of wood extractive compounds. These new structural and functional properties lead us to propose that this GST belongs to a new class that we name GSTFuA, for fungal specific GST class A.

  20. Gene Expression Patterns of Wood Decay Fungi Postia placenta and Phanerochaete chrysosporium Are Influenced by Wood Substrate Composition during Degradation

    Science.gov (United States)

    Skyba, Oleksandr; Cullen, Dan; Douglas, Carl J.

    2016-01-01

    ABSTRACT Identification of the specific genes and enzymes involved in the fungal degradation of lignocellulosic biomass derived from feedstocks with various compositions is essential to the development of improved bioenergy processes. In order to elucidate the effect of substrate composition on gene expression in wood-rotting fungi, we employed microarrays based on the annotated genomes of the brown- and white-rot fungi, Rhodonia placenta (formerly Postia placenta) and Phanerochaete chrysosporium, respectively. We monitored the expression of genes involved in the enzymatic deconstruction of the cell walls of three 4-year-old Populus trichocarpa (poplar) trees of genotypes with distinct cell wall chemistries, selected from a population of several hundred trees grown in a common garden. The woody substrates were incubated with wood decay fungi for 10, 20, and 30 days. An analysis of transcript abundance in all pairwise comparisons highlighted 64 and 84 differentially expressed genes (>2-fold, P 4-fold, P wood substrate composition and the duration of incubation. Many of the significantly expressed genes encode “proteins of unknown function,” and determining their role in lignocellulose degradation presents opportunities and challenges for future research. IMPORTANCE This study describes the variation in expression patterns of two wood-degrading fungi (brown- and white-rot fungi) during colonization and incubation on three different naturally occurring poplar substrates of differing chemical compositions, over time. The results clearly show that the two fungi respond differentially to their substrates and that several known and, more interestingly, currently unknown genes are highly misregulated in response to various substrate compositions. These findings highlight the need to characterize several unknown proteins for catalytic function but also as potential candidate proteins to improve the efficiency of enzymatic cocktails to degrade lignocellulosic substrates

  1. In vitro and in vivo inhibitory effects of some fungicides on catalase produced and purified from white-rot fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Kavakçıoğlu, Berna; Tarhan, Leman

    2014-10-01

    In this study, in vitro and in vivo effects of some commonly used fungicides, antibiotics, and various chemicals on isolated and purified catalase from Phanerochaete chrysosporium were investigated. The catalase was purified 129.10-fold by using 60% ammonium sulfate and 60% ethanol precipitations, DEAE-cellulose anion exchange and Sephacryl-S-200 gel filtration chromatographies from P. chrysosporium growth in carbon- and nitrogen-limited medium for 12 days. The molecular weight of native purified catalase from P. chrysosporium was found to be 290 ± 10 kDa, and sodium dodecyl sulfate (SDS)-PAGE results indicated that enzyme consisted of four apparently identical subunits, with a molecular weight of 72.5 ± 2.5 kDa. Kinetic characterization studies showed that optimum pH and temperature, Km and Vmax values of the purified catalase which were stable in basic region and at comparatively high temperatures were 7.5, 30°C, 289.86 mM, and 250,000 U/mg, respectively. The activity of purified catalase from P. chrysosporium was significantly inhibited by dithiothreitol (DTT), 2-mercaptoethanol, iodoacetamide, EDTA, and sodium dodecyl sulfate (SDS). It was found that while antibiotics had no inhibitory effects, 45 ppm benomyl, 144 ppm captan, and 47.5 ppm chlorothalonil caused 14.52, 10.82, and 38.86% inhibition of purified catalase, respectively. The inhibition types of these three fungicides were found to be non-competitive inhibition with the Ki values of 1.158, 0.638, and 0.145 mM and IC50 values of 0.573, 0.158, 0.010 mM, respectively. The results of in vivo experiments also showed that benomyl, captan and chlorothalonil caused 15.25, 1.96, and 36.70% activity decreases after 24-h treatments compared to that of the control.

  2. Evaluación de la degradación del plaguicida clorpirifos en muestras de suelo utilizando el hongo Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    Margarita María Lopera Mesa

    2005-01-01

    Full Text Available Se evaluó la degradación del insecticida clorpirifos en muestras de suelo durante 21 días, utilizando el hongo Phanerochaete chrysosporium. En los ensayos se obtuvieron porcentajes de degradación, en promedio, para las muestras con hongo, de 96,3, 82,4 y 62,2% cuando se trabajaron, respectivamente, con concentraciones iniciales de clorpirifos de 0,95, 5,3 y 9,4 µg/g. Igualmente, los porcentajes de degradación estuvieron acompañados del aumento en la velocidad de degradación, cuando se partió de la concentración inicial de 0,95 µg/g.

  3. Catabolic fate of Streptomyces viridosporus T7A-Produced, acid precipitable polymeric lignin upon incubation with ligninolytic Streptomyces species and Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Pometto, A.L. III; Crawford, D.L.

    1986-01-01

    Degradation of ground and hot-water-extracted corn stover (Zea mays) lignocellulose by Streptomyces viridosporus T7A generates a water-soluble lignin degradation intermediate termed acid-precipitable polymeric lignin (APPL). The further catabolism of T7A-APPL by S. viridosporus T7A, S. badius 252, and S. setonii75Vi2 was followed for 3 weeks. APPL catabolism by Phanerochaete chrysosporium was followed in stationary cultures in a low-nitrogen medium containing 1% (wt/vol) glucose and 0.05% (wt/vol) T7A-APPL. Metabolism of the APPL was followed by turbidometric assay (600 nm) and by direct measurement of APPL recoverable from the medium. Accumulation and disappearance of soluble low-molecular-weight products of APPL catabolism were followed by gas-liquid chromatography and by high-pressure liquid chromatography, utilizing a diode array detector. Mineralization of a [ 14 C-lignin]APPL was also followed. The percent 14 C recovered as 14 CO 2 , 14 C-APPL, 14 C-labeled water-soluble products, and cell mass-associated radioactivity, were determined for each microorganism after 1 and 3 weeks of incubation in bubbler tube cultures at 37 0 C. P. chrysosporium evolved the most 14 CO 2 , and S. viridosporus gave the greatest decrease in recoverable 14 C-APPL. The results show that S. badius was not able to significantly degrade the APPL, while the other microorganisms demonstrated various APPL-degrading abilities

  4. A Ca-alginate particle co-immobilized with Phanerochaete chrysosporium cells and the combined cross-linked enzyme aggregates from Trametes versicolor.

    Science.gov (United States)

    Li, Yanchun; Wang, Zhi; Xu, Xudong; Jin, Liqiang

    2015-12-01

    For improving stability of immobilized white-rot fungus to treat various effluents, Phanerochaete chrysosporium cells and the combined cross-link enzyme aggregates (combi-CLEAs) prepared from Trametes versicolor were co-immobilized into the Ca-alginate gel particles in this paper. The activity yields of obtained combi-CLEAs were 42.7% for lignin peroxidases (LiPs), 31.4% for manganese peroxidases (MnPs) and 40.4% for laccase (Lac), respectively. And their specific activities were 30.2U/g as combi-CLEAs-LiPs, 9.5 U/g as combi-CLEAs-MnPs and 28.4 U/g as combi-CLEAs-Lac. Further, the present of the combi-CLEAs in the particles extremely improved their ability to degrade the dyes. Compared to the immobilized Ph. chrysosporium without the combi-CLEAs, the co-immobilized particles enhanced the decolorized rate of Acid Violet 7 (from 45.2% to 93.4%) and Basic Fuchsin (from 12.1% to 67.9%). In addition, the addition of the combi-CLEAs improved the adaptability of the white-rot fungal particles to adverse environmental conditions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Enhanced oxidation of benzo[a]pyrene by crude enzyme extracts produced during interspecific fungal interaction of Trametes versicolor and Phanerochaete chrysosporium.

    Science.gov (United States)

    Qian, Linbo; Chen, Baoliang

    2012-01-01

    The effects of interspecific fungal interactions between Trametes versicolor and Phanerochaete chrysosporium on laccase activity and enzymatic oxidation of polycyclic aromatic hydrocarbons (PAHs) were investigated. A deadlock between the two mycelia rather than replacement of one fungus by another was observed on an agar medium. The laccase activity in crude enzyme extracts from interaction zones reached a maximum after a 5-day incubation, which was significantly higher than that from regions of T. versicolor or P. chrysosporium alone. The enhanced induction of laccase activity lasted longer in half nutrition than in normal nutrition. A higher potential to oxidize benzo[a]pyrene by a crude enzyme preparation extracted from the interaction zones was demonstrated. After a 48 hr incubation period, the oxidation of benzo[a]pyrene by crude enzyme extracts from interaction zones reached 26.2%, while only 9.5% of benzo[a]pyrene was oxidized by crude extracts from T. versicolor. The oxidation was promoted by the co-oxidant 2,2'-azinobis-3-ethylbenzthiazoline-6-sulphonate diammonium salt (ABTS). These findings indicate that the application of co-culturing of white-rot fungi in bioremediation is a potential ameliorating technique for the restoration of PAH-contaminated soil.

  6. OPTIMASI BIOKRAFT JAMUR Phanerochaete chrysosporium TERHADAP KOMPONEN KIMIA CAMPURAN BATANG DAN LIMBAH CABANG MANGIUM SEBAGAI BAHAN BAKU PULP

    Directory of Open Access Journals (Sweden)

    Devi Silsia

    2010-11-01

    Full Text Available Optimation biokraft of fungi P. Chrysosporium through elongated incubation time on mixed stem and branch waste mangium is a solution to solve the environmental pollution problem, low quality of pulp and limited raw material. Effect of P. Chrysosporium 10 % concentration and 45 days incubation time on pre research could not decrease lignin optimally and exstractive degradation had not occured yet. The aims of the study were to observe the effect of incubation time extension, and to determine the best incubation time of P. Chrysosporium applied at 10 % concentration based on the chemical component percentage, 45, 60 and 75 days on mixed stem and branch as raw material for pulp. Results showed that increasing incubation time decreased extractive and lignin content and increased holocelulosa and alpha celulosa content. Mixed stem and branch with 10% amount and 75 day incubation time of P. Chrysosporium gave the best results for raw material of pulp.

  7. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Zuo, Yanan [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li, Zhongwu; Yan, Ming [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Guo, Zhi; Huang, Zhenzhen; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-03-21

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag{sup +} and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag{sup +} to AgNPs.

  8. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    International Nuclear Information System (INIS)

    Zuo, Yanan; Chen, Guiqiu; Zeng, Guangming; Li, Zhongwu; Yan, Ming; Chen, Anwei; Guo, Zhi; Huang, Zhenzhen; Tan, Qiong

    2015-01-01

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag + and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag + to AgNPs

  9. The putative endoglucanase PcGH61D from Phanerochaete chrysosporium is a metal-dependent oxidative enzyme that cleaves cellulose.

    Directory of Open Access Journals (Sweden)

    Bjørge Westereng

    Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.

  10. Mineralization of 2,4-Dichlorophenoxyacetic Acid (2,4-D) and Mixtures of 2,4-D and 2,4,5-Trichlorophenoxyacetic Acid by Phanerochaete chrysosporium

    Science.gov (United States)

    Yadav, J. S.; Reddy, C. A.

    1993-01-01

    Evidence is presented for mineralization of 2,4-dichlorophenoxyacetic acid (2,4-D) in nutrient-rich media (high-nitrogen and malt extract media) by wild-type Phanerochaete chrysosporium and by a peroxidase-negative mutant of this organism. Mass balance analysis of [U-ring-14C]2,4-D mineralization in malt extract cultures showed 82.7% recovery of radioactivity. Of this, 38.6% was released as 14CO2 and 27.0, 11.2, and 5.9% were present in the aqueous, methylene chloride, and mycelial fractions, respectively. 2,4-D and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) were simultaneously mineralized when presented as a mixture, and mutual inhibition of degradation was not observed. In contrast, a relatively higher rate of mineralization of 2,4-D and 2,4,5-T was observed when these compounds were tested as mixtures than when they were tested alone. PMID:16349039

  11. Silver ion-enhanced particle-specific cytotoxicity of silver nanoparticles and effect on the production of extracellular secretions of Phanerochaete chrysosporium.

    Science.gov (United States)

    Huang, Zhenzhen; Xu, Piao; Chen, Guiqiu; Zeng, Guangming; Chen, Anwei; Song, Zhongxian; He, Kai; Yuan, Lei; Li, Hui; Hu, Liang

    2018-04-01

    This study investigated the influence of silver ions (Ag + ) on the cytotoxicity of silver nanoparticles (AgNPs) in Phanerochaete chrysosporium and noted the degree of extracellular secretions in response to the toxicant's stress. Oxalate production was elicited with moderate concentrations of 2,4-dichlorophenol (2,4-DCP) and AgNPs reaching a plateau at 10 mg/L and 10 μM, respectively. Increased oxalate accumulation was accompanied by higher activities of manganese peroxidase (MnP) and lignin peroxidase (LiP). However, the secretion of oxalate, MnP and LiP was significantly inhibited owing to Ag + incorporation into AgNP solution. Production of extracellular polymeric substances (EPS) significantly elevated with an increase in 2,4-DCP concentrations; however, after 24 h of exposure to 100 mg/L 2,4-DCP, an obvious decrease in EPS occurred, indicating that part of EPS could be consumed as carbon and energy sources to ameliorate biological tolerance to toxic stress. Furthermore, AgNP-induced "particle-specific" cytotoxicity was substantially enhanced with additional Ag + as evidenced by its significant negative impact on cellular growth, plasma membrane integrity, and morphological preservation compared with AgNPs at equal Ag concentration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Direct electron transfer--a favorite electron route for cellobiose dehydrogenase (CDH) from Trametes villosa. Comparison with CDH from Phanerochaete chrysosporium.

    Science.gov (United States)

    Stoica, Leonard; Ruzgas, Tautgirdas; Ludwig, Roland; Haltrich, Dietmar; Gorton, Lo

    2006-12-05

    This paper presents some functional differences as well as similarities observed when comparing the newly discovered cellobiose dehydrogenase (CDH) from Trametes villosa (T.v.) with the well-characterized one from Phanerochaete chrysosporium (P.c.). The enzymes were physically adsorbed on spectrographic graphite electrodes placed in an amperometric flow through cell connected to a flow system. In the case of T.v.-CDH-modified graphite electrodes, a high direct electron transfer (DET) current was registered at the polarized electrode in the presence of the enzyme substrate reflecting a very efficient internal electron transfer (IET) process between the reduced FAD-cofactor and the oxidized heme-cofactor. In the case of P.c.-CDH-modified graphite electrodes, the DET process is not as efficient, and the current will greatly increase in the presence of a mediator (mediated electron transfer, MET). As a consequence, when comparing the two types of enzyme-modified electrodes an inverted DET/MET ratio for T.v.-CDH is shown, in comparison with P.c.-CDH. The rates of the catalytic reaction were estimated to be comparable for both enzymes, by measuring the combined DET + MET currents. The inverted DET/MET ratio for T.v.-CDH-modified electrodes might suggest that probably there is a better docking between the two domains of this enzyme and that the linker region of P.c.-CDH might have an active role in modulating the rate of the IET (by changing the interdomain distance), with respect to pH. Based on the new properties of T.v.-CDH emphasized in the present study, an analytical application of a third-generation biosensor for lactose was recently published.

  13. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  14. Characterisation of a chimeric Phanerochaete chrysosporium ...

    African Journals Online (AJOL)

    Fred

    soaked tissue paper, the lid of the plastic box was closed and the reaction were incubated at 37oC for 3–4 days. The plastic box with soaked tissue paper provided a humid environment that prevented the media from drying-out. After incubation, the plates were ... cbhI.1 when it was cloned into a pET vector to generate.

  15. Spatial mapping of extracellular oxidant production by a white rot basidiomycete on wood reveals details of ligninolytic mechanism.

    Science.gov (United States)

    Hunt, Christopher G; Houtman, Carl J; Jones, Don C; Kitin, Peter; Korripally, Premsagar; Hammel, Kenneth E

    2013-03-01

    Oxidative cleavage of the recalcitrant plant polymer lignin is a crucial step in global carbon cycling, and is accomplished most efficiently by fungi that cause white rot of wood. These basidiomycetes secrete many enzymes and metabolites with proposed ligninolytic roles, and it is not clear whether all of these agents are physiologically important during attack on natural lignocellulosic substrates. One new approach to this problem is to infer properties of ligninolytic oxidants from their spatial distribution relative to the fungus on the lignocellulose. We grew Phanerochaete chrysosporium on wood sections in the presence of oxidant-sensing beads based on the ratiometric fluorescent dye BODIPY 581/591. The beads, having fixed locations relative to the fungal hyphae, enabled spatial mapping of cumulative extracellular oxidant distributions by confocal fluorescence microscopy. The results showed that oxidation gradients occurred around the hyphae, and data analysis using a mathematical reaction-diffusion model indicated that the dominant oxidant during incipient white rot had a half-life under 0.1 s. The best available hypothesis is that this oxidant is the cation radical of the secreted P. chrysosporium metabolite veratryl alcohol. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  16. Veratryl alcohol oxidases from the lignin-degrading basidiomycete Pleurotus sajor-caju.

    Science.gov (United States)

    Bourbonnais, R; Paice, M G

    1988-01-01

    The basidiomycete Pleurotus sajor-caju mineralizes ring-14C-labelled lignin (dehydrogenative polymer) when grown in mycological broth. Under these conditions, two veratryl alcohol oxidase (VAO) enzymes were found in the culture medium. They oxidized a number of aromatic alcohols to aldehydes and reduced O2 to H2O2. The enzymes were purified by ion-exchange and gel-permeation chromatography. The final step of purification on Mono Q resolved the activity into two peaks (VAO I and VAO II). Both enzymes had the same Mr, approx. 71,000, but their isoelectric points differed slightly, 3.8 for VAO I and 4.0 for VAO II. Their amino acid compositions were similar except for aspartic acid/asparagine and glycine. Both enzymes are glycoproteins and contain flavin prosthetic groups. Their pH optima were around 5, and kinetic constants and specificities were similar. 4-Methoxybenzyl alcohol was oxidized the most rapidly, followed by veratryl alcohol. Not all aromatic alcohols were oxidized, neither were non-aromatic alcohols. Cinnamyl alcohol was oxidized at the gamma position. The VAO enzymes thus represent a significantly different route for veratryl alcohol oxidation from that catalysed by the previously found lignin peroxidases from Phanerochaete chrysosporium. The role of the oxidases in biodegradation might be to produce H2O2 during oxidation of lignin fragments. Images Fig. 3. PMID:3060110

  17. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  18. Bioreduction of selenite and tellurite by Phanerochaete chrysosporium

    NARCIS (Netherlands)

    Espinosa‐Ortiz, E.J.

    2015-01-01

    Selenium (Se) and tellurium (Te) are elements, they are part of the chalcogens (VI‐A group of the periodic table) and share common properties. These metalloids are of commercial interest due to their physicochemical properties, and they have been used in a broad range of applications in advanced

  19. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  20. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  1. Sorption of heavy metals by four basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dey, S. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Rao, P.R.N. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India); Bhattacharyya, B.C. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Bandyopadhyay, M. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India)

    1995-04-01

    Biosorptions of Pb{sup 2+}, Cr{sup 6+}, Cd{sup 2+} and Ni{sup 2+} were investigated, with special emphasis on the first one, using live and dead fungal mycelia. Of the four fungi, namely Polyporus ostreiformis, Volvariella volvacea, Pleurotus sajor-caju and Phanerochaete chrysosporium, the last one was found to be most effective in Pb{sup 2+} removal. Total biosorption was effected in 6 days up to the Pb{sup 2+} concentration of 6 mg/l, with a specific uptake of 1.33 mg Pb{sup 2+}/g dry cell mass. The removal of other three metals varied between 28.8-73.3% from a medium containing 4 mg/l of each of the metals. (orig.)

  2. Biodegradation of degradable plastic polyethylene by phanerochaete and streptomyces species.

    Science.gov (United States)

    Lee, B; Pometto, A L; Fratzke, A; Bailey, T B

    1991-03-01

    The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placing a sheet of plastic into a drying oven at 70 degrees C under atmospheric pressure and air for 0, 4, 8, 12, 16, or 20 days. The effect of 2-, 4-, and 8-week longwave UV irradiation at 365 nm on plastic biodegradability was also investigated. For shake flask cultures, plastics were chemically disinfected and incubated-shaken at 125 rpm at 37 degrees C in 0.6% yeast extract medium (pH 7.1) for Streptomyces spp. and at 30 degrees C for the fungus in 3% malt extract medium (pH 4.5) for 4 weeks along with an uninoculated control for each treatment. Weight loss data were inconclusive because of cell mass accumulation. For almost every 70 degrees C heat-treated film, the Streptomyces spp. demonstrated a further reduction in percent elongation and polyethylene molecular weight average when compared with the corresponding uninoculated control. Significant (P reductions were demonstrated for the 4- and 8-day heat-treated films by all three bacteria. Heat-treated films incubated with P. chrysosporium consistently demonstrated higher percent elongation and molecular weight average than the corresponding uninoculated controls, but were lower than the corresponding zero controls (heat-treated films without 4-week incubation). The 2- and 4-week UV-treated films showed the greatest biodegradation by all three bacteria. Virtually no degradation by the fungus was observed. To our knowledge, this is the first report demonstrating bacterial degradation of these oxidized polyethylenes in pure

  3. [Antiviral properties of basidiomycetes metabolites].

    Science.gov (United States)

    Avtonomova, A V; Krasnopolskaya, L M

    2014-01-01

    The data on the antiviral action of the Ganoderma lucidum, Lentinus edodes, Grifola frondosa, Agaricus brasiliensis and other basidiomycetes metabolites are summurized. The metabolites of these species of basidiomycetes exhibit a direct antiviral effect on herpes simplex virus types I and II, human immunodeficiency virus (HIV), hepatitis B virus, vesicular stomatitis virus, influenza virus, Epstein-Barr virus, and others. Moreover, metabolites of basidiomycetes increased antiviral immunity.

  4. The genus Phanerochaete (Corticiaceae, Basidiomycotina) sensu lato in Uruguay

    Science.gov (United States)

    Sebastian Martinez; Karen K. Nakasone

    2005-01-01

    Eight species of Phanerochaete are reported from Uruguay for the first time, including a new species, P. vesiculosa. Phanerochaete vesiculosa is characterized by thin-walled, clavate to cylindrical vesicles embedded in the subiculum. A key to the known species of Phanerochaete from Uruguay is provided.

  5. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78

    Science.gov (United States)

    Diego Martinez; Luis Larrondo; Nik Putnam; Maarten D. Sollewijn; Maarten D. Sollewijn Gelpke; Katherine Huang; Jarrod Chapman; Kevin G. Helfenbein; Preethi Ramaiya; J. Chris Detter; Frank Larimer; Pedro M. Coutinho; Bernard Henrissat; Randy Berka; Dan Cullen; Daniel Rokhsar

    2004-01-01

    White rot fungi efficiently degrade lignin, a complex aromatic polymer in wood that is among the most abundant natural materials on earth. These fungi use extracellular oxidative enzymes that are also able to transform related aromatic compounds found in explosive contaminants, pesticides and toxic waste. We have sequenced the 30-million base-pair genome of...

  6. Differential expression in Phanerochaete chrysosporium of membrane- associated proteins relevant to lignin degradation

    Science.gov (United States)

    Semarjit Shary; Alexander N. Kapich; Ellen A. Panisko; Jon K. Magnuson; Daniel Cullen; Kenneth E. Hammel

    2008-01-01

    Fungal lignin-degrading systems likely include membrane-associated proteins that participate in diverse processes such as uptake and oxidation of lignin fragments, production of ligninolytic secondary metabolites, and defense of the mycelium against ligninolytic oxidants. Little is known about the nature or regulation of these membrane-associated components. We grew...

  7. Overview of parameters influencing biomass and bioreactor performance used for extracellular ligninase production from Phanerochaete chrysosporium

    OpenAIRE

    Seteno Ntwampe; Faysol Chowdhury; Marshall Sheldon; Heinrich Volschenk

    2010-01-01

    The production of extracellular enzymes is gaining momentum as commercial interests seek alternative ways to improve the productivity in the biotechnology and pharmaceutical industries. Early research studies looked at improving batch bioreactor operational challenges; however, the use of continuous cultures was indicated to be favourable. This led to a new approach developed to produce extracellular enzymes continuously using fixed-film bioreactors from biofilms immobilised on polymeric and ...

  8. Understanding LiP Promoters from Phanerochaete chrysosporium: A Bioinformatic Analysis

    Science.gov (United States)

    Sergio Lobos; Rubén Polanco; Mario Tello; Dan Cullen; Daniela Seelenfreund; Rafael. Vicuña

    2011-01-01

    DNA contains the coding information for the entire set of proteins produced by an organism. The specific combination of proteins synthesized varies with developmental, metabolic and environmental circumstances. This variation is generated by regulatory mechanisms that direct the production of messenger ribonucleic acid (mRNA) and subsequent translation of the...

  9. A series of Xerophilic Chrysosporium species

    DEFF Research Database (Denmark)

    Skou, Jens-Peder

    1992-01-01

    Xerophilic Chrysosporium species related to C. farinicola were often isolated from uneaten provisions (pollen-and-nectar mixture) of mason bees (Osmia spp.). The fungi have an optimal growth rate on media which are 2 to 3 molar in regard to glucose, exhibit some growth up to 3.6 molar glucose...

  10. Salinity induced effects on the growth rates and mycelia composition of basidiomycete and zygomycete fungi.

    Science.gov (United States)

    Venâncio, C; Pereira, R; Freitas, A C; Rocha-Santos, T A P; da Costa, J P; Duarte, A C; Lopes, I

    2017-12-01

    Soil salinization, as the combination of primary and secondary events, can adversely affect organisms inhabiting this compartment. In the present study, the effects of increased salinity were assessed in four species of terrestrial fungi: Lentinus sajor caju, Phanerochaete chrysosporium, Rhizopus oryzae and Trametes versicolor. The mycelial growth and biochemical composition of the four fungi were determined under three exposure scenarios: 1) exposure to serial dilutions of natural seawater (SW), 2) exposure to serial concentrations of NaCl (potential surrogate of SW); and 3) exposure to serial concentrations of NaCl after a period of pre-exposure to low levels of NaCl. The toxicity of NaCl was slightly higher than that of SW, for all fungi species: the conductivities causing 50% of growth inhibition (EC 50 ) were within 14.9 and 22.0 mScm -1 for NaCl and within 20.2 and 34.1 mScm -1 for SW. Phanerochaete chrysosporium showed to be the less sensitive species, both for NaCl and SW. Exposure to NaCl caused changes in the biochemical composition of fungi, mainly increasing the production of polysaccharides. When fungi were exposed to SW this pattern of biochemical response was not observed. Fungi pre-exposed to low levels of salinity presented higher EC 50 than fungi non-pre-exposed, though 95% confidence limits overlapped, with the exception of P. chrysosporium. Pre-exposure to low levels of NaCl also induced changes in the biochemical composition of the mycelia of L. sajor caju and R. oryzae, relatively to the respective control. These results suggest that some terrestrial fungi may acquire an increased tolerance to NaCl after being pre-exposed to low levels of this salt, thus, suggesting their capacity to persist in environments that will undergo salinization. Furthermore, NaCl could be used as a protective surrogate of SW to derive safe salinity levels for soils, since it induced toxicity similar or higher than that of SW. Copyright © 2017 Elsevier Ltd. All

  11. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M.D.

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  12. Selection of white-rot basidiomycetes for bioconversion of mustard (Brassica compestris) straw under solid-state fermentation into energy substrate for rumen micro-organism.

    Science.gov (United States)

    Tripathi, M K; Mishra, A S; Misra, A K; Vaithiyanathan, S; Prasad, R; Jakhmola, R C

    2008-03-01

    Selection of white-rot fungi of bio-conversion of mustard straw (MS) into feed for ruminants. Mustard straw was cultured with Ganoderma applanatum, Coriolus versicolor and Phanerochaete chrysosporium for solid-state fermentation at 35 degrees C from 7 to 63 days for delignification and for 21 days to study dry matter digestibility and protein enrichment. Lignin loss in fungus cultured straw varied between 100 and 470 g kg(-1) lignin. Delignification was higher between 7 and 28 days fermentation with C. versicolor. Among the three fungi P. chrysosporium was the most effective in degrading lignin for longer fermentation. In-vitro dry matter digestibility (IVDMD) and crude protein content was higher in C. versicolor cultured straw. Large quantity of straw was cultured by C. versicolor for 21 days, for in vivo evaluation. Mean pH and metabolites of rumen fermentation were not different while, pH and volatile fatty acid increased at 6 h postfermentation on cultured straw feeding. Cultured straw fermentation increased (P = 0.001) small holotricks and reduced (P = 0.005) large holotricks population. Fungus cultures straw did not improve microbial enzyme concentration. Coriolus versicolor and P. chrysosporium were the promising fungus for MS bio-delignification. Coriolus versicolor treated MS improved dry matter digestibility and protein content.

  13. Decolourisation of chemically different dyes by enzymes from spent ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... creosote contaminated soil. Int. Biodeterior. Biodegrad. 44: 117-126. Gold MH, Wariishi H, Valli K (1989). Extracellular peroxidases involved in lignin degradation by white rot basidiomycetes Phanerochaete chrysosporium. In: Biocatalysis in agricultural biotechnology, Am. Chem. Soc. USA, pp. 127-140.

  14. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  15. Biological treatment of the effluent from a bleached kraft pulp mill using basidiomycete and zygomycete fungi.

    Science.gov (United States)

    Freitas, A C; Ferreira, F; Costa, A M; Pereira, R; Antunes, S C; Gonçalves, F; Rocha-Santos, T A P; Diniz, M S; Castro, L; Peres, I; Duarte, A C

    2009-05-01

    Three white-rot fungi (Pleurotus sajor caju, Trametes versicolor and Phanerochaete chrysosporium) and one soft-rot fungi (Rhizopus oryzae) species confirmed their potential for future applications in the biological treatment of effluents derived from the secondary treatment of a bleached kraft pulp mill processing Eucalyptus globulus. Among the four species P. sajor caju and R. oryzae were the most effective in the biodegradation of organic compounds present in the effluent, being responsible for the reduction of relative absorbance (25-46% at 250 nm and 72-74% at 465 nm) and of chemical oxygen demand levels (74 to 81%) after 10 days of incubation. Laccase (Lac), lignin (Lip) and manganese peroxidases (MnP) expression varied among fungal species, where Lac and LiP activities were correlated with the degradation of organic compounds in the effluent treated with P. sajor caju. The first two axes of a principal component analysis explained 88.9% of the total variation among sub-samples treated with the four fungus species, after different incubation periods. All the variables measured contributed positively to the first component except for the MnP enzyme activity which was the only variable contributing negatively to the first component. Absorbances at 465 nm, LiP and Lac enzyme activities were the variables with more weight on the second component. P. sajor caju revealed to be the only species able to perform the biological treatment without promoting an increment in the toxicity of the effluent to the Vibrio fischeri, as it was assessed by the Microtox assay. The opposite was recorded for the treatments with the other three species of fungus. EC(50-5 min) values ranging between 28 and 57% (effluent concentrations) were recorded even after 10 to 13 days of treatment with P. chrysosporium, R. oryzae or with T. versicolor.

  16. Unexpected diversity of basidiomycetous endophytes in sapwood and leaves of Hevea.

    Science.gov (United States)

    Martin, Rachael; Gazis, Romina; Skaltsas, Demetra; Chaverri, Priscila; Hibbett, David

    2015-01-01

    Research on fungal endophytes has expanded dramatically in recent years, but little is known about the diversity and ecological roles of endophytic basidiomycetes. Here we report the analysis of 310 basidiomycetous endophytes isolated from wild and planted populations of the rubber tree genus, Hevea. Species accumulation curves were nonasymptotic, as in the majority of endophyte surveys, indicating that more sampling is needed to recover the true diversity of the community. One hundred eighteen OTUs were delimited, representing nine orders of Basidiomycota (Agaricales, Atheliales, Auriculariales, Cantharellales, Hymenochaetales, Polyporales, Russulales, Septobasidiales, Tremellales). The diversity of basidiomycetous endophytes found inhabiting wild populations of Hevea was comparable to that present in plantations. However, when samples were segregated by tissue type, sapwood of wild populations was found to contain a higher number of species than sapwood of planted trees. Seventy-five percent of isolates were members of the Polyporales, the majority in the phlebioid clade. Most of the species belong to clades known to cause a white-rot type of wood decay. Two species in the insect-associated genus Septobasidium were isolated. The most frequently isolated genera included Bjerkandera, Ceriporia, Phanerochaete, Phlebia, Rigidoporus, Tinctoporellus, Trametes (Polyporales), Peniophora, Stereum (Russulales) and Coprinellus (Agaricales), all of which have been reported as endophytes from a variety of hosts, across wide geographic locations. Literature records on the geographic distribution and host association of these genera revealed that their distribution and substrate affinity could be extended if the endophytic niche was investigated as part of fungal biodiversity surveys. © 2015 by The Mycological Society of America.

  17. Phylogenetic relationships of the genus Phanerochaete inferred from the internal transcribed spacer region

    Science.gov (United States)

    Theodorus H. de Koker; Karen K. Nakasone; Jacques Haarhof; Harold H. Burdsall; Bernard J.H. Janse

    2003-01-01

    Phanerochaete is a genus of resupinate homobasidiomycetes that are saprophytic on woody debris and logs. Morphological studies in the past indicated that Phanerochaete is a heterogeneous assemblage of species. In this study the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was used to test the monophyly of the genus Phanerochaete and to infer...

  18. Gene expression patterns of wood decay fungi Postia placenta and Phanerochaete chrysosporium are influenced by wood substrate composition during degradation

    Science.gov (United States)

    Oleksandr Skyba; Daniel Cullen; Carl J. Douglas; Shawn D. Mansfield

    2016-01-01

    Identification of the specific genes and enzymes involved in the fungal degradation of lignocellulosic biomass derived from feedstocks with various compositions is essential to the development of improved bioenergy processes. In order to elucidate the effect of substrate composition on gene expression in wood-rotting fungi, we employed microarrays based on the...

  19. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  20. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  1. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  2. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2

  3. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  4. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  5. Fatal cutaneous mycosis in tentacled snakes caused by the chrysosporium anamorph of nannizziposis vriesii

    DEFF Research Database (Denmark)

    Bertelsen, Mads Frost; Crawshaw, Graham J.; Sigler, Lynne

    2005-01-01

    The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes......The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes...

  6. Comparative analysis of the secretomes of Schizophyllum commune and other wood-decay basidiomycetes during solid-state fermentation reveals its unique lignocellulose-degrading enzyme system.

    Science.gov (United States)

    Zhu, Ning; Liu, Jiawen; Yang, Jinshui; Lin, Yujian; Yang, Yi; Ji, Lei; Li, Meng; Yuan, Hongli

    2016-01-01

    The genome of Schizophyllum commune encodes a diverse repertoire of degradative enzymes for plant cell wall breakdown. Recent comparative genomics study suggests that this wood decayer likely has a mode of biodegradation distinct from the well-established white-rot/brown-rot models. However, much about the extracellular enzyme system secreted by S. commune during lignocellulose deconstruction remains unknown and the underlying mechanism is poorly understood. In this study, extracellular proteins of S. commune colonizing Jerusalem artichoke stalk were analyzed and compared with those of two white-rot fungi Phanerochaete chrysosporium and Ceriporiopsis subvermispora and a brown-rot fungus Gloeophyllum trabeum. Under solid-state fermentation (SSF) conditions, S. commune displayed considerably higher levels of hydrolytic enzyme activities in comparison with those of P. chrysosporium, C. subvermispora and G. trabeum. During biodegradation process, this fungus modified the lignin polymer in a way which was consistent with a hydroxyl radical attack, similar to that of G. trabeum. The crude enzyme cocktail derived from S. commune demonstrated superior performance over a commercial enzyme preparation from Trichoderma longibrachiatum in the hydrolysis of pretreated lignocellulosic biomass at low enzyme loadings. Secretomic analysis revealed that compared with three other fungi, this species produced a higher diversity of carbohydrate-degrading enzymes, especially hemicellulases and pectinases acting on polysaccharide backbones and side chains, and a larger set of enzymes potentially supporting the generation of hydroxyl radicals. In addition, multiple non-hydrolytic proteins implicated in enhancing polysaccharide accessibility were identified in the S. commune secretome, including lytic polysaccharide monooxygenases (LPMOs) and expansin-like proteins. Plant lignocellulose degradation by S. commune involves a hydroxyl radical-mediated mechanism for lignocellulose modification

  7. PRODUCTION OF EXTRACELLULAR KERATINASE BY CHRYSOSPORIUM TROPICUM AND TRICHOPHYTON AJELLOI

    Directory of Open Access Journals (Sweden)

    Jaroslava Kačinová

    2014-02-01

    Full Text Available Keratinous wastes constitute a troublesome environmental contaminant that is produced in large quantities in companies processing of poultry and their further use has ecological significance. We can use for degradation of keratinous wastes enzymes or strains, which produce these enzymes. The aim of this study was isolation of keratinophilic fungi from the soil samples and optimalization of culture conditions of keratinase producing strains in vitro. For the isolation of our strains, we used hair - baiting method. From the all isolated strains, we used for other screening Chrysosporium tropicum (JK39 and Trichophyton ajelloi (JK82. Production of keratinase we monitored with different time of cultivation (7th, 14th, 21th days, sources of carbon (glucose, fructose, mannitol, sucrose, concentration of carbon sources (1%, 2% and cultivation temperature (20, 25, 30, 37ºC. Keratinase production was studied in a liquid medium containing chicken feathers as a source of keratin. We recorded the maximum production of keratinase (10.51 KU/ml by Chrysosporium tropicum on 21th day of incubation with 1% glucose at 25ºC.

  8. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  9. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes

    DEFF Research Database (Denmark)

    Manavalan, Arulmani

    2006-01-01

    at 3.5-fold increase compared to control. Solid-state fermentation using wheat bran as substrate exhibit, maximum laccase activity of 48.89 ± 1.82 U/L on day 5, whereas it was only 30.21 ± 1.66 and 22.56 ± 1.22 U/L, respectively, in batch fermentation in a laboratory scale bioreactor and in static...

  10. Structure, computational and biochemical analysis of PcCel45A endoglucanase from Phanerochaete chrysosporium and catalytic mechanisms of GH45 subfamily C members

    DEFF Research Database (Denmark)

    Godoy, Andre S.; Pereira, Caroline S.; Ramia, Marina Paglione

    2018-01-01

    The glycoside hydrolase family 45 (GH45) of carbohydrate modifying enzymes is mostly comprised of ß-1,4-endoglucanases. Significant diversity between the GH45 members has prompted the division of this family into three subfamilies: A, B and C, which may differ in terms of the mechanism, general a...

  11. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  12. ACTIVE PRODUCERS OF PEROXIDASE BASIDIOMYCETES STRAINS SCREENING

    Directory of Open Access Journals (Sweden)

    T. E. Voloshko

    2013-10-01

    Full Text Available The paper is devoted to the analysis of the research data peroxidase activity of the strains of xylotrophic basidiomycetes in the dynamics of the growth. The objects of study were 57 strains, 5 of which belongs to 5 species of the order Polyporales, and 52 of which belongs to 7 species of the order Agaricales. In order to search for active producers of peroxidase the strains were cultured by the surface method in a liquid glucosepeptone medium. The accumulation of oven-dry biomass was determined by the weight method. The content of soluble protein and peroxidase activity were determined by the spectrophotometry. The studies set the level of accumulation of oven-dry biomass and peroxidase activity of the strains in 9 and 12 days of growth. The results allowed selecting the strains, which are characterized by high levels of peroxidase activity in mycelium and in the culture filtrate, including Agrocybe cylindracea 167, Pleurotus ostreatus Р-кл, Agrocybe cylindracea 960 and 218. These strains which are active producers of peroxidase may be used in the enzyme preparations obtaining technology.

  13. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described.

  14. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  15. Chrysosporium guarroi sp. nov. a new emerging pathogen of pet green iguanas (Iguana iguana).

    Science.gov (United States)

    Abarca, M L; Castellá, G; Martorell, J; Cabañes, F J

    2010-03-01

    Chrysosporium guarroi sp. nov. represented by five strains isolated from cases of dermatomycosis in pet green iguanas (Iguana iguana) in Spain, is described and illustrated. This taxon is characterized by its ability to grow at temperatures from 15 to 37 degrees C and by the presence of arthroconidia and aleurioconidia. The latter are unicellular, smooth, pyriform or clavate, sessile or borne at the ends of narrow stalks. The analysis of the sequences of the D1/D2 and ITS regions confirm the separation of this new species from others of the genus Chrysosporium.

  16. FIELD EVALUATION OF THE LIGNIN-DEGRADING FUNGUS PHANEROCHAETE SORDIDA TO TREAT CREOSOTE-CONTAMINATED SOIL

    Science.gov (United States)

    A field study to determine the ability of selected lignin-degrading fungi to remediate soil contaminated with creosote was performed at a wood-treating facility in south central Mississippi in the autumn of 1991. The effects of solid-phase bioremediation with Phanerochaete sordid...

  17. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  18. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  19. BIODEGRADATION OF ENVIRONMENTAL POLLUTANTS BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM: INVOLVEMENT OF THE LIGNIN DEGRADING SYSTEM

    Science.gov (United States)

    The white-rot fungus Phanrochaete chrysosporium has the ability to degrade a wide variety of structurally diverse organic compounds, including a number of environmentally persistent organopollutants. The unique biodegradative abilities of this fungus appears to be depend...

  20. Biosynthetic Machinery of Diterpene Pleuromutilin Isolated from Basidiomycete Fungi.

    Science.gov (United States)

    Yamane, Momoka; Minami, Atsushi; Liu, Chengwei; Ozaki, Taro; Takeuchi, Ichiro; Tsukagoshi, Tae; Tokiwano, Tetsuo; Gomi, Katsuya; Oikawa, Hideaki

    2017-12-05

    The diterpene pleuromutilin is a ribosome-targeting antibiotic isolated from basidiomycete fungi, such as Clitopilus pseudo-pinsitus. The functional characterization of all biosynthetic enzymes involved in pleuromutilin biosynthesis is reported and a biosynthetic pathway proposed. In vitro enzymatic reactions and mutational analysis revealed that a labdane-related diterpene synthase, Ple3, catalyzed two rounds of cyclization from geranylgeranyl diphosphate to premutilin possessing a characteristic 5-6-8-tricyclic carbon skeleton. Biotransformation experiments utilizing Aspergillus oryzae transformants possessing modification enzyme genes allowed the biosynthetic pathway from premutilin to pleuromutilin to be proposed. The present study sets the stage for the enzymatic synthesis of natural products isolated from basidiomycete fungi, which are a prolific source of structurally diverse and biologically active terpenoids. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Volatile organic components from fresh non-edible Basidiomycetes fungi.

    Science.gov (United States)

    Piovano, Marisa; Garbarino, Juan A; Sánchez, Elizabeth; Young, Manuel E

    2009-12-01

    The compounds responsible for the characteristic odor of eight fresh non-edible Basidiomycetes fungi were evaluated. The volatile organic compounds from the fresh samples present in the headspace of a sealed vial were determined by solid-phase microextraction gas chromatography-mass spectrometry, using a PDMS/DVB fiber. A total of twenty-eight components were identified, the most frequent being 1-octen-3-ol and 3-octanone.

  2. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts.

    Science.gov (United States)

    Buzzini, Pietro; Romano, Sergio; Turchetti, Benedetta; Vaughan, Ann; Pagnoni, Ugo Maria; Davoli, Paolo

    2005-02-01

    Thirty-seven basidiomycetous yeasts belonging to 30 species of seven genera were grown on media containing l-cysteine or l-methionine as sole nitrogen sources with the objective of evaluating volatile organic sulfur compound (VOSC) production. The headspace of yeast cultures was analyzed by the solid-phase microextraction (SPME) sampling method, and volatile compounds were quantified and identified by GC-MS techniques. Ten strains assimilating L-methionine produced the following VOSCs: 3-(methylthio)-1-propanol, methanethiol, S-methyl thioacetate, dimethyl disulfide, dimethyl trisulfide, allyl methyl sulphide and 4,5-dihydro-3(2H)-thiophenone. Production was amyl alcohol) and esters (ethyl acetate, ethyl propionate, n-propyl acetate, isobutyl acetate, n-propyl propionate, n-butyl acetate, isoamyl acetate, amyl acetate, isoamyl propionate, amyl propionate and 2-phenylmethyl acetate) were also sporadically produced. This is the first report of VOSCs production by basidiomycetous yeasts. Consequently, basidiomycetous yeasts may be considered an interesting new group of microbial VOSCs producers for the flavor industry.

  3. Antimicrobial activity of submerged cultures of Chilean basidiomycetes.

    Science.gov (United States)

    Aqueveque, Pedro; Anke, Timm; Saéz, Katia; Silva, Mario; Becerra, José

    2010-10-01

    This study is part of a screening program aimed at searching for bioactive metabolites from Chilean basidiomycetes. Submerged cultivation of fungal mycelia in liquid media was evaluated for antimicrobial activity. A total of 148 strains were obtained in vitro. The extracts produced from submerged cultures were evaluated against bacteria and fungi. In the primary antimicrobial assay, approximately 60% of the extracts presented positive biological activity. The highest frequencies of active strains were from the orders Agaricales (31.0%), Polyporales (20.6%), Sterales (18.3%), Boletales (11.4%), and Cortinariales (9.1%). Antifungal activity was more pronounced than antibacterial activity. Twelve extracts that exhibited strong antimicrobial activity showed minimum inhibitory concentration (MIC) values of 50 µL/mL against Bacillus brevis and 25∼50 µL/mL against Penicillium notatum and Paecilomyces variotii. The biological activity of some strains did not vary considerably, regardless of the substrate or collection site whereas, for others, it showed marked variations. Differences in antimicrobial activities observed in the different fungal genera suggested that the ability to produce bioactive compounds is not homogenously distributed among basidiomycetes. The information obtained from this study reveals that Chilean basidiomycetes are able to generate small and/or large variations in the normal pathway of compounds production. Thus, it is necessary to evaluate this biological and chemical wealth, which could be an unsuspected reservoir of new and potentially useful molecules. © Georg Thieme Verlag KG Stuttgart · New York.

  4. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    International Nuclear Information System (INIS)

    Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.

    2009-01-01

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  5. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    Energy Technology Data Exchange (ETDEWEB)

    Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.

    2009-07-01

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  6. The biodegradation of Olive Oil Mill Wastewaters by Sawdust and by a Phanerochaetae chrysosporium

    Directory of Open Access Journals (Sweden)

    Gonzalez, J.

    2007-12-01

    Full Text Available This paper discusses decolorization and chemical oxygen demand (COD abatement in olive mill wastewaters (OMW by Phanerochaetae chrysosporium grown in static, stirred and immobilized cultures. When P. Chrysosporium is used in cultures, no decolorization of crude OMW is observed. Decolorization occurs only after the removal of polyphenols by adsorption in sawdust, which allows a 39% polyphenol removal. The use of a High lignin peroxides (Lip producing medium, yields the highest OMW decolorization and COD removal efficiencies. The use of P. Chrysosporium immobilized on polyurethane foam leads to significant abatements of OMW polluting characteristics. And COD abatement reached 70%. The reduction of polyphenols reached its highest level at 62%. A significant effluent decolorization is apparent.Este trabajo describe la decoloración y la disminución de la demanda química de oxígeno del alpechín (OMW por Phanerochaetae chrysosporium, crecido en cultivos estáticos, agitados e inmovilizados. Cuando P. chrysosporium fue cultivado en agitación, no se observa ninguna decoloración de OMW crudo, la decoloración ocurre solamente después de eliminar los polifenoles mediante adsorción en el serrín (Disminución del 39% del contenido en polifenoles. La utilización de la lignina peroxidasa generada en el medio da lugar a la mayor decoloración de alpechín y a las eficiencias de eliminación de DQO más altas. Las pruebas de la decoloración realizadas en las muestras de OMW que fueron pretratadas por la adsorción de madera del serrín, y usaron cultivos inmovilizadas demostraron resultados mejores. Por tanto, la eficiencia de eliminación de DQO alcanzó un 70%. La reducción de los polifenoles alcanzó los niveles más altos siempre, i.e. 62%. Se observó una decoloración significativa del efluente.

  7. Tremulane sesquiterpenes from cultures of the basidiomycete Irpex lacteus.

    Science.gov (United States)

    Ding, Jian-Hai; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2018-03-01

    Five new tremulane sesquiterpenes, named irlactins F-J (1-5), were isolated from cultures of the basidiomycete Irpex lacteus together with two known analogues (6 and 7). Structures and relative configurations of compounds 1-5 were elucidated by spectroscopic data analysis. Compund 4 exhibited moderate cytotoxicities on HL-60, SMMC-7721, A-549, MCF-7, and SW480 cells with IC 50 values of 16.23, 20.40, 25.55, 19.05, and 18.58μM, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Dermatomycosis in a pet inland bearded dragon (Pogona vitticeps) caused by a Chrysosporium species related to Nannizziopsis vriesii.

    Science.gov (United States)

    Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J

    2009-08-01

    A Chrysosporium sp. related to Nannizziopsis vriesii was isolated in pure culture from squames and biopsies of facial lesions in a pet inland bearded dragon (Pogona vitticeps) in Spain. The presence in histological sections of morphologically consistent fungal elements strongly incriminates this fungus as the aetiological agent of infection. Lesions regressed following treatment with oral ketoconazole and topical chlorhexidine and terbinafine until the lizard was lost to follow up 1 month later. The ITS-5.8S rRNA gene of the isolate was sequenced and a search on the GenBank database revealed a high match with the sequences of two Chrysosporium sp. strains recently isolated from green iguanas (Iguana iguana) with dermatomycosis, also in Spain. Phylogenetic analysis of the sequences revealed that all these strains are related to N. vriesii. This is the first report of dermatomycoses caused by a Chrysosporium species related to N. vriesii in a bearded dragon outside North America.

  9. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The acceleration of sludge granulation using the chlamydospores of Phanerochaete sp. HSD

    International Nuclear Information System (INIS)

    Hailei, Wang; Li, Li; Ping, Li; Hui, Li; Guosheng, Liu; Jianming, Yao

    2011-01-01

    Highlights: → Seeding the chlamydospores of Phanerochaete sp. HSD to SBR can accelerate sludge granulation. → We reveal the annual ring-like multilayer structure of aerobic granule. → We propose the mechanism of accelerated sludge granulation. → Accelerated granular sludge reactor has better removal performance toward phenol wastewater. - Abstract: In the present paper, a novel method to accelerate sludge granulation is presented. Inoculation with chlamydospores of Phanerochaete sp. HSD accelerated sludge granulation during the treatment process of phenol wastewater, and the sludge granulation rate reached 66 ± 2% on day 7, 32 days earlier than that of the control inoculated with activated sludge only. Aerobic granule in R1 (AG R1 ) showed an annual ring-like multilayer structure and a primary core also existed in the nuclear area of the granule. The mechanism of rapid granulation revealed that the chlamydospore could survive in phenol wastewater and form the primary matrix on which aerobic granule was developed layer by layer. In addition, AG R1 developed in a phenol uptake system to counteract the adverse effects of phenol inhibition. Higher tolerance toward wastewater with high phenol strength was exhibited, and the maximum specific phenol degradation rate reached 1.54 g phenol g -1 VSS day -1 .

  11. The ferulic acid esterases of Chrysosporium lucknowense C1: Purification, characterization and their potential application in biorefinery

    NARCIS (Netherlands)

    Kuhnel, S.; Pouvreau, L.A.M.; Appeldoorn, M.M.; Hinz, S.W.A.; Schols, H.A.; Gruppen, H.

    2012-01-01

    Three ferulic acid esterases from the filamentous fungus Chrysosporium lucknowense C1 were purified and characterized. The enzymes were most active at neutral pH and temperatures up to 45 °C. All enzymes released ferulic acid and p-coumaric acid from a soluble corn fibre fraction. Ferulic acid

  12. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  13. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM SCHIZOPHYLLUM COMMUNE

    Directory of Open Access Journals (Sweden)

    А.С. Бухало

    2012-10-01

    Full Text Available  The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes Schizophyllum commune in a surface and submerged culture. 21 strains of S. commune were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains on agar mediums were shown the following enzymes: amylase, caseinase, gelatinase, polygalacturonase, pectattranselyminase, urease, lipase, cellulase, laccase and peroxydase. The demonstration of oxidizing enzymes of laccase and peroxydase depended on composition of medium. The estimation of presence and level of activity of endo-1,4-b-glucanase, exoglucanase and monophenolmonooxygenase at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of strain 1760 S. commune.

  14. TOTAL ANTIOXIDANT ACTIVITY OF SOME BASIDIOMYCETES STRAINS IN GROWTH DYNAMIC

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2016-08-01

    Full Text Available The work is devoted to the study of total antioxidant activity (AOA in the growth dynamics of basidiomycetes strains in their periodic surface cultivation on glucose-peptone medium. Subjects of research are mycelium and culture filtrate (CF from 57 strains, 5 of which are belong to 5 types of Polyporales order, and 52 of which are belong to the 7 types of Agaricales order. In order to study the dynamics of growth used method for determining the weight of absolutely dry biomass accumulation (ADB. Total AOA of mycological material was evaluated by inhibition of lipid peroxidation products accumulation intensity in the model oxidation reaction of Tween-80 by air oxygen. It was found that the most productive in terms of the accumulation of ADB are strains F. velutipes F-610 and P. eryngii P-er. Lowest values of ADB accumulation recorded for strains P. ostreatus P-14 and P-192 and P. citrinopileatus P sіtr. Were selected the most productive strains of Basidiomycetes for the level of total AOA in mycelium and CF. There are strains P. eryngii P-er, P. citrinopileatus P sіtr, P. ostreatus P-035, F. hepatica Fh-08, A. cylindracea 960, P. ostreatus P-081, P-082, P-087, P. citrinopileatus P sіtr. Has not been established the dependence between the growth and the antioxidant activity of the 9- and 12-day fungal cultures. Selected producers of natural antioxidants may be used as biological agents in biotechnology.

  15. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available the importance of screening to select superior fungal strains for use in biopulping. Under the specific pulping conditions of the screening trials, 38 strains of white-rot fungi were tested that were more suitable than the reference strains of P. chrysosporium...

  16. Biotransformation of coal derived humic acids by Basidiomycetes

    Science.gov (United States)

    Klein, O. I.; Kulikova, N. A.; Stepanova, E. V.; Koroleva, O. V.

    2009-04-01

    Introduction Low energetic coals and wastes of coal industry are promising sources for biologically active compounds including humic acids (HA). Aside from evident advantages of biocatalytic approaches for coal slime conversion such as environmental safety and cost efficiency they also could be used for the improving of HAs biological activity [1, 2]. The aim of the present study was to provide molecular characterization of the HAs formed during biotransformation of coal slime by Basidiomycetes under different cultivation conditions. Materials and methods Biotransformation of brown coal from Solncevskoe deposit (Sakhalin, Russia) was performed by liquid surface cultivation of pure culture Coriolus hirsutus 075 (Wulf. Ex. Fr.) Quel. with rich (contained glucose as a carbon source) and poor (without readily available carbon source) nutrition medium. After 30 days of cultivation coal HAs were separated by alkaline extraction followed by dialysis desalting and drying at 50C. HAs derived were characterized using size-exclusion chromatography, Fourier transformed infrared (FTIR) and 13C NMR spectroscopy. Results and discussion Molecular weight distribution of HA was not significantly affected by Basidiomycetes under all cultivation conditions studied in comparison to HAs extracted from non-conversed coal. FTIR spectra of HA obtained were typical for HAs. Biotransformation of coal did not result in appearance of new functional groups. The exception was observed under rich media conditions where absorbance at 1700 cm-1 was determined related to carbonyl groups of carboxyl and ketonic fragments. Therefore, the revealed phenomena could be explained with additional formation of the above carbonyl groups in the course of biotransformation process. Quantification of 13C NMR spectra revealed decrease of aromatic structures in HA extracted from coal after biotransformation under poor media conditions. Also a significant increase in carboxylic fragments content was observed. So

  17. Dermatitis and cellulitis in leopard geckos (Eublepharis macularius) caused by the Chrysosporium anamorph of Nannizziopsis vriesii.

    Science.gov (United States)

    Toplon, D E; Terrell, S P; Sigler, L; Jacobson, E R

    2013-07-01

    An epizootic of ulcerative to nodular ventral dermatitis was observed in a large breeding colony of 8-month to 5-year-old leopard geckos (Eublepharis macularius) of both sexes. Two representative mature male geckos were euthanized for diagnostic necropsy. The Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was isolated from the skin lesions, and identification was confirmed by sequencing of the internal transcribed spacer region of the rRNA gene. Histopathology revealed multifocal to coalescing dermal and subcutaneous heterophilic granulomas that contained septate fungal hyphae. There was also multifocal epidermal hyperplasia with hyperkeratosis, and similar hyphae were present within the stratum corneum, occasionally with terminal chains of arthroconidia consistent with the CANV. In one case, there was focal extension of granulomatous inflammation into the underlying masseter muscle. This is the first report of dermatitis and cellulitis due to the CANV in leopard geckos.

  18. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  19. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  20. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  1. COMPARATIVE CHARACTERISTICS OF BASIDIOMYCETES — PRODUCERS OF CATALASE

    Directory of Open Access Journals (Sweden)

    T. E. Voloshko

    2013-06-01

    Full Text Available The dynamics of growth and catalase activity of 57 strains of basidiomycetes were investigated. Glucose-peptone medium was used for surface cultivation of fungi. The objects of study were 57 strains, 5 of which belongs to 5 species of the order Polyporales, and others do to 7 species of the order Agaricales. The weight measurement to estimate accumulation of absolutely dry biomass was used to study growth rates. The spectrophotometric methods were used for determination of catalase activity and protein content in mycelium and culture filtrate. The specific catalase activity was calculated based on this data. The levels of biomass accumulation and catalase activity of the strains on the 9-th and 12-th days of cultivation and ability of the most fungi to synthesize mainly extracellular catalase were determined. Individual variability of the strains was shown. The results allowed selecting the strains — active producers of catalase, including F. velutipes F-2 and P. ostreatus R-208, which are perspective for use in biotechnology of enzyme preparations.

  2. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  4. Skin test reactivity of allergic subjects to basidiomycetes' crude extracts in a tropical environment.

    Science.gov (United States)

    Rivera-Mariani, Félix E; Nazario-Jiménez, Sylvette; López-Malpica, Fernando; Bolaños-Rosero, Benjamín

    2011-11-01

    Fungal allergies can be detected by the skin prick test with extracts of the organisms, but not all fungi, including the basidiomycetes, are being examined. We determined the level of sensitization to basidiomycetes in allergic subjects and compared their reactivity to commercial extracts commonly used to detect allergies. Crude spore extracts of the basidiomycetes Ganoderma applanatum, Chlorophyllum molybdites, and Pleurotus ostreatus, which are known to release numerous spores, were examined along with commercial extracts on 33 subjects with asthma, allergic or non-allergic rhinitis. Overall, affected subjects showed the highest reactivity to mites (36%), followed by Ganoderma applanatum (30%), grass (27%) Chlorophyllum molybdites (12%) and Pleurotus ostreatus (12%). Allergic rhinitis patients were most reactive to mites (58%), grass (42%), Ganoderma applanatum (25%), Penicillium spp. (25%), and cat (17%). Those with asthma primarily responded to mites (44%), Ganoderma applanatum (44%), grass (33%), and Pleurotus ostreatus (22%). IgE levels correlated with positive basidiomycetes extracts. This finding, coupled with higher reactivity to basidiospores as compared to mitospores, and the similar sensitivities of patients to G. applanatum and mites, suggest that basidiomycetes are important allergen sources in the tropics.

  5. Cutaneous hyalohyphomycosis caused by a Chrysosporium species related to Nannizziopsis vriesii in two green iguanas (Iguana iguana).

    Science.gov (United States)

    Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J

    2008-06-01

    This report describes the first isolation of a Chrysosporium species as the etiological agent of dermatomycosis in two green iguanas (Iguana iguana). The ITS-5.8S rRNA gene of the two strains was sequenced and a search on the GenBank database revealed that the closest match was Nannizziopsis vriesii. Treatment with oral ketoconazole, in combination with topical 2% chlorhexidine solution and terbinafine resulted in clinical cure.

  6. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  7. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  8. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  9. Bioremediation of the neonicotinoid insecticide clothianidin by the white-rot fungus Phanerochaete sordida.

    Science.gov (United States)

    Mori, Toshio; Wang, Jianqiao; Tanaka, Yusuke; Nagai, Kaoru; Kawagishi, Hirokazu; Hirai, Hirofumi

    2017-01-05

    Clothianidin (CLO) is a member of the neonicotinoid pesticides, which have been widely used worldwide over the last two decades. However, its toxicity for bees and neurological toxicity for humans are urgent problems. Here, the degradation of CLO by the white-rot fungus Phanerochaete sordida was examined in nitrogen-limited liquid medium. After incubation for 20days at 30°C, 37% of CLO was degraded in the cultures. High-resolution ESI-MS and NMR analyses of the culture supernatant identified N-(2-chlorothiazol-5-yl-methyl)-N'-methylurea (TZMU) as a metabolite of CLO degradation. The addition of cytochrome P450 inhibitors to the culture medium markedly reduced the degradation of CLO by P. sordida. And manganese peroxidase, a major ligninolytic enzyme secreted by this fungus, were not carried out CLO degradation. The effects of CLO and TZMU on the viability of the neuronal cell line Neuro2a demonstrated that P. sordida effectively degrades CLO into a metabolite that lacks neurotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  11. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  12. Processive endoglucanase active in crystalline cellulose hydrolysis by the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2005-01-01

    Brown rot basidiomycetes have long been thought to lack the processive cellulases that release soluble sugars from crystalline cellulose. On the other hand, these fungi remove all of the cellulose, both crystalline and amorphous, from wood when they degrade it. To resolve this discrepancy, we grew Gloeophyllum trabeum on microcrystalline cellulose (Avicel) and purified...

  13. Significant levels of extracellular reactive oxygen species produced by brown rot basidiomycetes on cellulose

    Science.gov (United States)

    Roni Cohen; Kenneth A. Jensen; Carl J. Houtman; Kenneth E. Hammel

    2002-01-01

    It is often proposed that brown rot basidiomycetes use extracellular reactive oxygen species (ROS) to accomplish the initial depolymerization of cellulose in wood, but little evidence has been presented to show that the fungi produce these oxidants in physiologically relevant quantities. We used [14C]phenethyl polyacrylate as a radical trap to estimate extracellular...

  14. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  15. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  16. Occurrence of wood-and root- rot basidiomycetes on trees in Bayero ...

    African Journals Online (AJOL)

    Several death and decays or rots of tropical trees are as result of infection caused by wood and root rot 'parasitic basidiomycetes. In the present study, survey of parasitic homobasidiomycetes causing wood and root rot on woody trees in Bayero University, Kano (two campuses) was carried out between April – September ...

  17. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  18. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  19. A Highly Diastereoselective Oxidant Contributes to Ligninolysis by the White Rot Basidiomycete Ceriporiopsis subvermispora

    Science.gov (United States)

    Daniel J. Yelle; Alexander N. Kapich; Carl J. Houtman; Fachuang Lu; Vitaliy I. Timokhin; Raymond C. Fort Jr.; John Ralph; Kenneth E. Hammel

    2014-01-01

    The white rot basidiomycete Ceriporiopsis subvermispora delignifies wood selectively and has potential biotechnological applications. Its ability to remove lignin before the substrate porosity has increased enough to admit enzymes suggests that small diffusible oxidants contribute to delignification. A key question is whether these unidentified...

  20. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  1. Mn(II) regulation of lignin peroxidases and manganese-dependent peroxidases from lignin-degrading white rot fungi

    International Nuclear Information System (INIS)

    Bonnarme, P.; Jeffries, T.W.

    1990-01-01

    Two families of peroxidases-lignin peroxidase (LiP) and manganese-dependent lignin peroxidase (MnP)-are formed by the lignin-degrading white rot basidiomycete Phanerochaete chrysosporium and other white rot fungi. Isoenzymes of these enzyme families carry out reactions important to the biodegradation of lignin. This research investigated the regulation of LiP and MnP production by Mn(II). In liquid culture, LiP titers varied as an inverse function of and MnP titers varied as a direct function of the Mn(II) concentration. The extracellular isoenzyme profiles differed radically at low and high Mn(II) levels, whereas other fermentation parameters, including extracellular protein concentrations, the glucose consumption rate, and the accumulation of cell dry weight, did not change significantly with the Mn(II) concentration. In the absence of Mn(II), extracellular LiP isoenzymes predominated, whereas in the presence of Mn(II), MnP isoenzymes were dominant. The release of 14 CO 2 from 14 C-labeled dehydrogenative polymerizate lignin was likewise affected by Mn(II). The rate of 14 CO 2 release increased at low Mn(II) and decreased at high Mn(II) concentrations. This regulatory effect of Mn(II) occurred with five strains of P. chrysosporium, two other species of Phanerochaete, three species of Phlebia, Lentinula edodes, and Phellinus pini

  2. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  3. Screening of medicinal higher Basidiomycetes mushrooms from Turkey for lovastatin production.

    Science.gov (United States)

    Atli, Burcu; Yamac, Mustafa

    2012-01-01

    As a first attempt, a study was carried out to test for lovastatin production ability in local higher Basidiomycetes mushroom isolates from Turkey. An extended screening was performed for lovastatin production in yeast lactose agar medium, among a total of 136 macrofungi isolates from the Basidiomycetes Culture Collection of Eskisehir Osmangazi University. Lovastatin production was evaluated by disc diffusion method and was also confirmed by TLC and HPLC. Only six isolates were found to be lovastatin producers. The highest production of lovastatin was obtained from the extracts from Omphalotus olearius OBCC 2002 and Pleurotus ostreatus OBCC 1031. The lovastatin amount produced by commercial strains, Aspergillus terreus NRRL 255 (7.0 mg/L) and Penicillium citrinum NRRL 1841 (7.0 mg/L), was nearly comparable to the amount produced by Pleurotus ostreatus OBCC 1031 (5.8 mg/L) and Omphalotus olearius OBCC 2002 (4 mg/L).

  4. Four new spiroaxane sesquiterpenes and one new rosenonolactone derivative from cultures of Basidiomycete Trametes versicolor.

    Science.gov (United States)

    Wang, Su-Rui; Zhang, Ling; Chen, He-Ping; Li, Zheng-Hui; Dong, Ze-Jun; Wei, Kun; Liu, Ji-Kai

    2015-09-01

    Four new spiroaxane sesquiterpenes, tramspiroins A-D (1-4), one new rosenonolactone 15,16-acetonide (5), and the known drimane sesquiterpenes isodrimenediol (6) and funatrol D (7) have been isolated from the cultures of Basidiomycete Trametes versicolor. The structures of new compounds were elucidated by means of spectroscopic methods. Compounds 1-7 were investigated for their cytotoxicities against five human cancer cell lines. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Identification of a Gene Cluster for Biosynthesis of Mannosylerythritol Lipids in the Basidiomycetous Fungus Ustilago maydis

    OpenAIRE

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A.; Kämper, Jörg; Bölker, Michael

    2006-01-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose exp...

  6. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  7. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2014-03-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose. Keywords: Basidiomycetes, mycelium, culture filtrate, polyphenols, carotenoids

  8. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  9. Clinical significance and molecular characterization of nonsporulating molds isolated from the respiratory tracts of bronchopulmonary mycosis patients with special reference to basidiomycetes.

    Science.gov (United States)

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F; Chowdhary, Anuradha

    2013-10-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger subunit (LSU) of 52 NSMs isolated from respiratory specimens. The basidiomycetes were the predominant NSMs, of which Schizophyllum commune was the most common agent in allergic bronchopulmonary mycosis (ABPM), followed by Ceriporia lacerata in invasive fungal disease. Porostereum spadiceum, Phanaerochaete stereoides, Neosartorya fischeri, and Marasmiellus palmivorus were the other molds observed. Application of ITS and LSU region sequencing identified 92% of the isolates. The antifungal susceptibility data revealed that all basidiomycetes tested were susceptible to amphotericin B and resistant to caspofungin, fluconazole, and flucytosine. Except for 3 isolates of S. commune and a solitary isolate of M. palmivorus, all basidiomycetes had low MICs for itraconazole, posaconazole, and voriconazole. Basidiomycetes were isolated from patients with ABPM, invasive pulmonary mycosis/pneumonia, or fungal balls. In addition, the majority of the basidiomycetes were isolated from patients with chronic respiratory disorders who were sensitized to one of the basidiomycetous fungi and demonstrated precipitating antibodies against the incriminating fungi, indicating an indolent tissue reaction. Thus, isolation of basidiomycetes from the lower respiratory tract could be significant, and it is important to monitor these patients in order to prevent subsequent lung damage.

  10. Two cases of atopic cough successfully treated by oral cleansing with amphotericin B: Relationship with Basidiomycetes detected from pharyngeal swab

    Directory of Open Access Journals (Sweden)

    Haruhiko Ogawa

    2004-01-01

    Full Text Available We report herein two cases of atopic cough in which Basidiomycetes was detected from pharyngeal swabs and in which gargling with amphotericin B was efficacious. One case is a 38-year-old woman and the other is a 54-year-old woman. Both patients visited Ishikawa ken Saiseikai Kanazawa Hospital for the diagnosis and treatment of isolated severe non-productive cough. They did not have bronchial hyperresponsiveness to methacholine or heightened bronchomotor tone. Bronchodilator therapy was not effective for their coughing. Basidiomycetes was isolated from pharyngeal swabs in both cases. Oral cleansing with amphotericin B at 300 mg/day for approximately 2 weeks was effective in treating the severe coughs. This is the first report concerning the effectiveness of oral cleansing with amphotericin B for atopic cough, in which Basidiomycetes was detected from pharyngeal swabs.

  11. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  12. EFFECTS OF MICROELEMENTS ON THE CAROTENOID SYNTHESIS BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-08-01

    Full Text Available The effect of microelements on growth and accumulation of carotenoids highly productive strains of basidiomycetes at surface cultivation on glucose-peptone medium was investigated. The objects of research are 3 wood destroying strain. There are Laetiporus sulphureus (Bull. Murrill Ls-08, Fomes fomentarius (L. Fr. Ff-1201 from the order Polyporales and Fistulina hepatica (Schaeff. Sibth Fh-18 from the order Agaricales. Research materials are strains mycelium and culture filtrate (CF. Absolutely dry biomass (ADB mycelium was determined by the gravimetric method, the content of carotenoids was determined by spectrophotometric method in acetone extracts of the Vetshteyn formula. Established individual influence of microelements on the accumulation of biomass and carotenoids of basidiomycetes strains. The possibility of the regulation of these processes by introducing into the glucose-peptone medium of various Fe, Cu, Zn, Ni and Mn sulphate. So, the best to increase the intensity of the growth processes and the accumulation of carotenoids strain of L. sulphureus Ls-08 is an experimental environment which includes Zn sulfate in a concentration of 8 mmol/L. To induce the accumulation of ADB and carotenoids in the mycelium and CF of strain F fomentarius Ff-1201 making in is expedient Mn sulfate in a concentration of 1.6 mmol/L. To improve carotenogenesis of F. hepatica Fh-18 strain expedient entry in GPM Mn sulphate at concentration of 8 mmol/L. These allow to optimize the concentration of microelements in nutrient medium for the cultivation of carotenoids high-producing strains of Basidiomycetes.

  13. [A new species of psychrophilic basidiomycetes yeast Leucosporidium fasciculatum sp. Nov].

    Science.gov (United States)

    Bab'eva, I P; Lisichkina, G A

    2000-01-01

    A psychrophilic yeast with a basidiomycetous developmental cycle and properties corresponding to the genus Leucosporidium Fell et al. was isolated from the fruiting body of the edible spring mushroom Gyromitra esculenta Pers. picked near Moscow. However, the isolate differed from all Leucosporidium species described to date in a number of characteristics. The results of the study of the developmental cycle and of the cultural, morphological, physiological, and biochemical properties of the new isolate, strain KBP Y-3696, allow it to be assigned to a new species of the genus Leucosporidium.

  14. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  15. Fragmentation of human IgG by a new protease isolated from the basidiomycete Armillaria mellea.

    Science.gov (United States)

    Hunneyball, I M; Stanworth, D R

    1975-01-01

    Digestion of human IgG by a new lysine-specific protease, isolated from the basidiomycete Armillaria mellea, produced Fc and Fab fragments similar to those produced by papain digestion of the same molecule. Digestion appeared to be restricted to a single cleavage point within the hinge region of the IgG molecule. Myeloma proteins of IgG1, IgG3 and IgG4 subclasses were found to be digested at an extremely rapid rate whereas IgG2 myeloma proteins appeared to be resistant to digestion by this enzyme. Images FIG. 2 FIG. 6 PMID:1201861

  16. Aethiopinolones A–E, New Pregnenolone Type Steroids from the East African Basidiomycete Fomitiporia aethiopica

    Directory of Open Access Journals (Sweden)

    Clara Chepkirui

    2018-02-01

    Full Text Available A mycelial culture of the Kenyan basidiomycete Fomitiporia aethiopica was fermented on rice and the cultures were extracted with methanol. Subsequent HPLC profiling and preparative chromatography of its crude extract led to the isolation of five previously undescribed pregnenolone type triterpenes 1–5, for which we propose the trivial name aethiopinolones A–E. The chemical structures of the aethiopinolones were determined by extensive 1D- and 2D-NMR, and HRMS data analysis. The compounds exhibited moderate cytotoxic effects against various human cancer cell lines, but they were found devoid of significant nematicidal and antimicrobial activities.

  17. Role of plants in the vegetative and reproductive growth of saprobic basidiomycetous ground fungi.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2008-11-01

    Non-symbiotic microorganisms engineered or expensively selected to degrade xenobiotic hydrocarbons or modify heavy-metal uptake of plants in soil remediations die back after their introduction into the target soils. Mycelia of saprobic basidiomycetes were therefore inoculated into soil samples of 1 l in glass vessels to record mycelial growth and reproduction in the immediate rhizosphere of up to 11 herbaceous plant species, or to study their responses to the separate volatiles from whole plant swards or their root balls whose emanations had been collected in 1.5-l plastic bags fixed to the glass vessels. Excess CO2 was controlled with NaOH solution. Volatiles from root balls of parsley and pea but not wheat, from unplanted soils, from the fungus-permeated, unplanted substrate soil itself, and from the rooting soil of whole wheat sward increased mycelial densities in Clitocybe sp. more than in Agaricus macrocarpus and indicated thus a higher nutrient state of the mycelia. Organic volatiles proved therefore to be a significant carbon source for certain basidiomycetes in poor natural soils. The contemporary decline in the number of basidiocarp initials to 0 to 36% in both fungi relative to the unplanted and aerated controls was caused by volatiles from rooted and unplanted soil and pointed thus to their ecological role as antibiotics, fumigants, toxins, and hormonal compounds. Aqueous extracts from root balls of wheat stimulated mycelial density and fruiting in A. macrocarpus contemporarily because of their contents in soil-derived macronutrients. They suppressed once more fruiting in the more sensitive Clitocybe sp. by active agents in the aqueous phase. Within plant rhizospheres, densities of Clitocybe sp. mycelia were stimulated in the presence of alfalfa, carrot, red clover, ryegrass, and spinach, whereas those of A. macrocarpus were halved by 7 of 10 plant species including alfalfa, red clover, ryegrass, and spinach. Mycelia of A. macrocarpus may thereby have

  18. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  19. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  20. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  1. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  2. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2014-04-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose.

  3. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions.

  4. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol.

  5. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  6. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  7. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  8. Novel application of fungal Phanerochaete sp. and xylanase for reduction in pollution load of paper mill effluent.

    Science.gov (United States)

    Yadav, Ravi Dutt; Chaudhry, Smita; Gupta, Sanjeev

    2012-03-01

    Four different strategies of pulping and bleaching were carried out to develop alternative mechanistic ecoenvironmental friendly approaches and generated effluent was characterised. Strategy-I included Phanerochaete sp. fungal pretreatment followed by conventional bleaching, whereas in strategy-II, fungal pretreatment was followed by enzyme xylanase aided bleaching. Strategy-III also included xylanase supplement but without prior fungal pretreatment. Chemically driven pulping and bleaching was the IV strategy. Conventional C(D)E(OP)D1D2 sequence of bleaching was used for strategy-I and IV whereas XC(D)E(OP)D1D2 sequence was applied to strategy-I and III. Strategy-II was responsible for 27.5% reduction in Kappa no. whereas the maximum (27.5%) reduction in refining energy was observed with strategy-II. Biobleaching strategies-II and III were helpful in saving 37.3 and 20.3% of elemental chlorine (Cl2) and 30.8 and 23.1% of chlorine dioxide (ClO2) respectively. In comparison to control (strategy-IV), strategy II resulted in maximum pollution load reduction of chemical oxygen demand (COD), biological oxygen demand (BOD), color and adsorbable organic halides (AOX) up to 57, 60, 30 and 43.6%, respectively.

  9. Direct lactic acid production from beech wood by transgenic white-rot fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Mori, Toshio; Kako, Hiroko; Sumiya, Tomoki; Kawagishi, Hirokazu; Hirai, Hirofumi

    2016-12-10

    A lactic acid (LA)-producing strain of the hyper-lignin-degrading fungus Phanerochaete sordida YK-624 with the lactate dehydrogenase-encoding gene from Bifidobacterium longum (Blldh) was constructed. When the endogenous pyruvate decarboxylase gene-knocked down and Blldh-expressing transformant was cultured with beech wood meal, the transformant was able to successively delignify and ferment the substrate. Supplementation of calcium carbonate into the culture medium, significantly increased the level of LA accumulation. Direct LA production (at 0.29g/l) from wood was confirmed, and additional inclusion of exogenous cellulase in this fermentation yielded significant further improvement in LA accumulation (up to 1.44g/l). This study provides the first report of direct production of LA by fermentation from woody biomass by a single microorganism, and indicates that transgenic white-rot fungi have a potential use for development of simple/easy applications for wood biorefinery. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  11. Adsorption of heavy metal from landfill leachate by wasted biosolids

    African Journals Online (AJOL)

    GREGORY

    2011-12-16

    Phanerochaete chrysosporium) was studied to remove cadmium, copper, zinc and iron from synthetic water and leachate. The biomass was produced due to the experiments conducted for bioconversion of wastewater for lignin ...

  12. Miscellaneous lanostane triterpenoids with cytotoxicities from fruiting bodies of the basidiomycete Stereum sp.

    Science.gov (United States)

    Yao, Jian-Neng; Chen, Lin; Chen, He-Ping; Zhao, Zhen-Zhu; Zhang, Shuai-Bing; Huang, Ying; Tang, Yang; Isaka, Masahiko; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2018-03-01

    Ten new highly oxygenated lanostane triterpenoids, stereinones A-J (1-10), were isolated from the fruiting bodies of the basidiomycete Stereum sp. Compounds 3 and 4 are structurally characterized as intact lanostane-type triterpenoids containing unusual 1,2-diketone functionality at C-11 and C-12, while compound 10 is a 24-methylene-lanostane. The structures of these new compounds were established based on detailed 1D and 2D NMR spectroscopic analyses, along with quantum chemical NMR calculations. All isolates were evaluated for their in vitro cytotoxicities against five human tumor cell lines (including HL-60, A-549, SMMC-7721, MCF-7, and SW480 cell lines). Compound 4 showed moderate cytotoxic activities against tumor cell lines SMMC-7721 and SW480 with IC 50 values of 9.1 and 9.8μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Cloning and Sequence Analysis of the Cellobiohydrolase I Genes from Some Basidiomycetes

    Science.gov (United States)

    Maharachchikumbura, Sajeewa S. N.; Wongkham, Shannaphimon; Sysouphanthong, Phongeun; Phookamsak, Rungtiwa; Hyde, Kevin D.

    2012-01-01

    Genes encoding the cellobiohydrolase enzyme (CBHI), designated as cbhI, were isolated from the basidiomycetes Auricularia fuscosuccinea, Pleurotus giganteus, P. eryngii, P. ostreatus, and P. sajor-caju. Initially, the fungal genomic DNA was extracted using a modified cetyltrimethyl ammonium bromide (CTAB) protocol and used as a DNA template. The cbhI genes were then amplified and cloned using the pGEM-T Easy Vector Systems. The sizes of these PCR amplicons were between 700~800 bp. The DNA sequences obtained were similar showing high identity to the cbhI gene family. These cbhI genes were partial consisting of three coding regions and two introns. The deduced amino acid sequences exhibited significant similarity to those of fungal CBHI enzymes belonging to glycosyl hydrolase family 7. PMID:22870052

  14. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  15. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  16. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  17. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  18. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    OpenAIRE

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2006-01-01

    Applied and Environmental Microbiology, Vol. 73, No.4 Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with ...

  19. Leaf extracts of Casearia sylvestris and Casearia decandra affect growth and production of ligninolytic enzymes in wood decay basidiomycetes

    OpenAIRE

    Bento, Thiara Siqueira; Torres, Luce Maria Brandão; Fialho, Mauricio Batista; Bononi, Vera Lúcia Ramos

    2016-01-01

    ABSTRACT White-rot basidiomycetes are able to deteriorate wood products and be pathogenic to living trees, requiring, thus requiring control. The tropical flora is an important source of eco-friendly antifungal compounds; however, the knowledge on how leaf extracts affect the fungal physiology is limited. Therefore, in the present work we investigated the influence of ethanolic leaf extracts of Casearia sylvestris and C. decandra at 0.1 mg mL-1 on the production of ligninolytic enzymes by Tra...

  20. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids

    OpenAIRE

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P.?antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P.?antarctica for industri...

  1. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-04-04

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications.

  2. VOLATILE COMPOUNDS IN THE AROMA OF THREE SPECIES OF WOOD-ROTTING BASIDIOMYCETES AND THEIR ANTIFUNGAL POTENTIAL

    OpenAIRE

    Cristiana Virginia PETRE; Alin Constantin DÎRȚU; Marius NICULAUA; Cătălin TĂNASE

    2017-01-01

    This study aims to determine the volatile organic compounds synthesized by three species of wood-rotting basidiomycetes: Coriolopsis gallica, Megacollybia platyphylla and Lentinus arcularius and test their antifungal potential. The species were cultivated on liquid media and kept for 25 days at 25 °C. The surface cultures were then homogenized, filtrated and extracted using solid-phase extraction and analyzed by GC-MS. The volatile compounds identified were mainly alcohols, ketones, aldehydes...

  3. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  4. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  5. Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

    Science.gov (United States)

    Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

    2016-01-01

    The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

  6. Kojic acid-mediated damage responses induce mycelial regeneration in the basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available Mechanical damage can induce fruiting body production in fungi. In this study, the antioxidant kojic acid (KA was found to enhance injured mycelial regeneration and increase fruiting body production in Hypsizygus marmoreus. KA reduced the level of reactive oxygen species (ROS, which are harmful to mycelia when excessively generated by mechanical damage. Moreover, KA increased catalase and superoxide dismutase activities and glutathione and ascorbic acid contents by up-regulating antioxidant gene expression. These results suggest that KA promotes mycelial regeneration in response to damage by activating a "stress signal" and enhances the ability of H. marmoreus to resist oxidative damage by invoking the antioxidant system. In addition, KA increased the content of extracellular ATP, which serves as a "stress signal" in response to injury, and modulated ROS signaling, decreasing NADPH oxidase gene expression and ROS levels in the mycelial-regeneration stage. KA treatment also up-regulated the MAPK, Ca2+ and oxylipin pathways, suggesting their involvement in the damage response. Furthermore, laccase and cellulase activities were stimulated by KA at different developmental stages. These results demonstrate that KA regulates gene expression and activates pathways for mycelial wound healing, regeneration of damaged mycelia and reproductive structure formation in the basidiomycete H. marmoreus.

  7. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively.

  8. Therapeutic effects of substances occurring in higher Basidiomycetes mushrooms: a modern perspective.

    Science.gov (United States)

    Wasser, S P; Weis, A L

    1999-01-01

    This review highlights some of the recently isolated and identified substances of higher Basidiomycetes mushrooms origin that express promising antitumor, immune modulating, cardiovascular and hypercholesterolemia, antiviral, antibacterial, and antiparasitic effects. Medicinal mushrooms have a long history of use in folk medicine. In particular, mushrooms useful against cancers of the stomach, esophagus, lungs, etc. are known in China, Russia, Japan, Korea, as well as the U.S.A. and Canada. There are about 200 species of mushrooms that have been found to markedly inhibit the growth of different kinds of tumors. Searching for new antitumor and other medicinal substances from mushrooms and to study the medicinal value of these mushrooms have become a matter of great significance. However, most of the mushroom origin antitumor substances have not been clearly defined. Several antitumor polysaccharides such as hetero-beta-glucans and their protein complexes (e.g., xyloglucans and acidic beta-glucan-containing uronic acid), as well as dietary fibers, lectins, and terpenoids have been isolated from medicinal mushrooms. In Japan, Russia, China, and the U.S.A. several different polysaccharide antitumor agents have been developed from the fruiting body, mycelia, and culture medium of various medicinal mushrooms (Lentinus edodes, Ganoderma lucidum, Schizophyllum commune, Trametes versicolor, Inonotus obliquus, and Flammulina velutipes). Both cellular components and secondary metabolites of a large number of mushrooms have been shown to effect the immune system of the host and therefore could be used to treat a variety of disease states.

  9. Indole-3-acetic acid biosynthetic pathways in the basidiomycetous yeast Rhodosporidium paludigenum.

    Science.gov (United States)

    Nutaratat, Pumin; Srisuk, Nantana; Arunrattiyakorn, Panarat; Limtong, Savitree

    2016-07-01

    Microorganisms produce plant growth regulators, such as auxins, cytokinins and gibberellins, to promote plant growth. Auxins are a group of compounds with an indole ring that have a positive effect on plant growth. Indole-3-acetic acid (IAA) is a plant growth hormone classified as an indole derivative of the auxin family. IAA biosynthesis pathways have been reported and widely studied in several groups of bacteria. Only a few studies on IAA biosynthesis pathways have been conducted in yeast. This study aimed to investigate IAA biosynthesis pathways in a basidiomycetous yeast (Rhodosporidium paludigenum DMKU-RP301). Investigations were performed both with and without a tryptophan supplement. Indole compound intermediates were detected by gas chromatography-mass spectrometry. Indole-3-lactic acid and indole-3-ethanol were found as a result of the enzymatic reduction of indole-3-pyruvic acid and indole-3-acetaldehyde, in IAA biosynthesis via an indole-3-pyruvic acid pathway. In addition, we also found indole-3-pyruvic acid in culture supernatants determined by high-performance liquid chromatography. Identification of tryptophan aminotransferase activity supports indole-3-pyruvic acid-routed IAA biosynthesis in R. paludigenum DMKU-RP301. We hence concluded that R. paludigenum DMKU-RP301 produces IAA through an indole-3-pyruvic acid pathway.

  10. Genetic diversity of ectomycorrhizal Basidiomycetes from African and Indian tropical rain forests.

    Science.gov (United States)

    Riviere, Taiana; Diedhiou, Abdallah G; Diabate, Moussa; Senthilarasu, G; Natarajan, K; Verbeken, Annemieke; Buyck, Bart; Dreyfus, Bernard; Bena, Gilles; Ba, Amadou M

    2007-07-01

    Ectomycorrhizal (ECM) fungi have a worldwide distribution. However, the ecology of tropical ECM fungi is poorly documented, limiting our understanding of the symbiotic associations between tropical plants and fungi. ECM Basidiomycete diversity was investigated for the first time in two tropical rain forests in Africa (Western Upper Guinea) and in Asia (Western Ghats, India), using a fragment of the mitochondrial large subunit rRNA gene to type 140 sporocarps and 54 ectomycorrhizas. To evaluate taxonomic diversity, phylogenetic analyses were performed, and 40 sequences included from identified European specimens were used as taxonomic benchmarks. Five clades were recovered corresponding to six taxonomic groups: boletoids, sclerodermatoids, russuloids, thelephoroids, and a clade grouping the Amanitaceae and Tricholomataceae families. Our results revealed that the Russulaceae species display a great diversity with several putative new species, especially in Guinea. Other taxonomic issues at family/section levels are also briefly discussed. This study provides preliminary insights into taxonomic diversity, ECM status, and biogeographic patterns of ECM fungi in tropical two rain forest ecosystems, which appear to be as diverse as in temperate and boreal forests.

  11. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. Copyright © 2012 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  12. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  13. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  14. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs.

  15. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis.

  16. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  17. A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea.

    Science.gov (United States)

    Ford, Kathryn L; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M; Foster, Gary D

    2016-07-07

    Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen.

  18. Condition of the prooxidant-antioxidant system of some strains of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2017-02-01

    Full Text Available The article deals with the calculation and comparison indications of the condition of the prooxidant-antioxidant system (PAS of strains of Basidiomycetes under periodic surface cultivation on a glucose-peptone medium. The research material consisted of the mycelium and culture filtrate (CF from 57 strains, 52 of them belonging to 7 species of the order Agaricales and 5 belonging to 5 species of the order Polyporales. The intensity of the processes of lipid peroxidation was determined by a modified spectrophotometric method for contents of active products to thiobarbituric acid. Total antioxidant activity (АОА of the mycological material was evaluated by intensity of inhibition from accumulated products of lipid peroxide oxidation (LPO in a model reaction of oxidation by Twin-80 oxygen of the air. From the data obtained, indicators of prooxidant activity (POA, indicators of reserve of substrate peroxidation (SPO and the balance coefficient of the prooxidant-antioxidant system (CbPАS were calculated. It was established that strains of Basidiomycetes are characterized by significant predominance of prooxidant activity characteristic of PAS in the culture filtrate in comparison with the mycelium indicator. The highest values of POA in the Culture Filtrate were observed on the 12-th day of cultivation for the strain Р-089 genus Pleurotus and strain Gl-2 genus Ganoderma, and for the mycelium on the 9-th day of cultivation for the strains Р-сіtr, Р-089, Р-er and Р-082 of the genus Pleurotus. There is a direct dependence between the indicators of POA in the CF and mycelium for each strain, this dependence and level of indication do not reflect their systematic placement. We distinguished a more significant prevalence of indicators of reserve of substrates peroxidation of mycelium for most strains, than for such indicators with CF The highest value of reserve SPO of mycelium was recorded for strains Р-447, Р-998, Р-039, Р-94, Р-2175,

  19. Cutaneous hyalohyphomycosis in a girdled lizard (Cordylus giganteus) caused by the Chrysosporium anamorph of Nannizziopsis vriesii and successful treatment with voriconazole.

    Science.gov (United States)

    Hellebuyck, Tom; Baert, Kris; Pasmans, Frank; Van Waeyenberghe, Lieven; Beernaert, Lies; Chiers, Koen; De Backer, Patrick; Haesebrouck, Freddy; Martel, An

    2010-08-01

    The Chrysosporium anamorph of Nannizziopsis vriesii was associated with dermatomycosis and high mortality in a group of captive giant girdled lizards (Cordylus giganteus). Treatment of one of the infected girdled lizards with voriconazole, which was selected on the basis of in vitro sensitivity testing of the isolate, resulted in resolution of lesions and negative fungal cultures from the skin. Three hours after oral administration of 10 mg/kg, the plasma level of voriconazole exceeded the 0.25-μg/mL minimal inhibitory concentration tenfold. In conclusion, administration of voriconazole at 10 mg/kg of body weight once daily for 10 weeks resulted in clinical cure and was well tolerated. A longer follow-up time and larger studies will be necessary to determine the long-term efficacy and safety of this treatment in giant girdled lizards. © 2010 The Authors. Journal compilation © 2010 ESVD and ACVD.

  20. A minimal growth medium for the basidiomycetePleurotus sapidusfor metabolic flux analysis.

    Science.gov (United States)

    Fraatz, Marco A; Naeve, Stefanie; Hausherr, Vanessa; Zorn, Holger; Blank, Lars M

    2014-01-01

    Pleurotus sapidus secretes a huge enzymatic repertoire including hydrolytic and oxidative enzymes and is an example for higher basidiomycetes being interesting for biotechnology. The complex growth media used for submerged cultivation limit basic physiological analyses of this group of organisms. Using undefined growth media, only little insights into the operation of central carbon metabolism and biomass formation, i.e. , the interplay of catabolic and anabolic pathways, can be gained. The development of a chemically defined growth medium allowed rapid growth of P. sapidus in submerged cultures. As P. sapidus grew extremely slow in salt medium, the co-utilization of amino acids using 13 C-labelled glucose was investigated by gas chromatography-mass spectrometry (GC-MS) analysis. While some amino acids were synthesized up to 90% in vivo from glucose ( e.g., alanine), asparagine and/or aspartate were predominantly taken up from the medium. With this information in hand, a defined yeast free salt medium containing aspartate and ammonium nitrate as a nitrogen source was developed. The observed growth rates of P. sapidus were well comparable with those previously published for complex media. Importantly, fast growth could be observed for 4 days at least, up to cell wet weights (CWW) of 400 g L -1 . The chemically defined medium was used to carry out a 13 C-based metabolic flux analysis, and the in vivo reactions rates in the central carbon metabolism of P. sapidus were investigated. The results revealed a highly respiratory metabolism with high fluxes through the pentose phosphate pathway and TCA cycle. The presented chemically defined growth medium enables researchers to study the metabolism of P. sapidus , significantly enlarging the analytical capabilities. Detailed studies on the production of extracellular enzymes and of secondary metabolites of P. sapidus may be designed based on the reported data.

  1. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  2. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  3. The production and analysis of carotenoid preparations from some strains of xylotrophic Basidiomycetes

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-07-01

    Full Text Available The aim of the study was selection of optimal conditions for obtaining carotenoid drugs of mycelium origin from the basidiomycete strains Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18 and the study of antibacterial and total antioxidant activity of these compounds. The strains were surface grown on a glucose-peptone medium modified for each producer. The homogenized pigments of the mycelium strains were extracted with ethanol and the solvent was separated under vacuum at 60 ºC. The absorption spectra of the carotenoid drugs were recorded for alcoholic solutions at 350–500 nm. The antibacterial activity of the carotenoids was determined by the agar diffusion method, and the total antioxidant activity was determined by the DPPH-method. It was found that the optimum temperature for carotenoid extraction is 60 °C. The absorption spectra of carotenoid drugs showed three peaks in 420, 450 and 470 nm. These results respond to the β-carotene absorption spectra. The highest antioxidant activity was noted for carotenoid drugs from F. hepatica Fh-18 and L. sulphureus Ls-08 strains obtained at an extraction temperature of 40 and 60 °C respectively. The antibacterial activity of carotenoid drugs against the test cultures was not species dependent. Carotenoid drugs with a 20% concentrate obtained from the L. sulphureus Ls-08 strain had the highest antibacterial activity against the test cultures Staphylococcus aureus and Escherichia coli. Carotenoids from the mycelium of F. hepatica Fh-18 had the highest antibacterial activity against the test culture Candida albicans. Extraction temperature of 60 °C is optimal for mycelial yield of carotenoids from the studied strains. All preparations of carotenoids exhibited antibacterial activity against the test microorganism cultures. The carotenoid drugs obtained at 40 and 60 °C from the strains F. hepatica Fh-18 and L. sulphureus Ls-08 respectively showed the highest

  4. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  5. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  6. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  7. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta

    Science.gov (United States)

    Dongsheng Wei; Carl J. Houtman; Alexander N. Kapich; Christopher G. Hunt; Daniel Cullen; Kenneth E. Hammel

    2010-01-01

    Brown rot basidiomycetes initiate wood decay by producing extracellular reactive oxygen species that depolymerize the structural polysaccharides of lignocellulose. Secreted fungal hydroquinones are considered one contributor because they have been shown to reduce Fe3+, thus generating perhydroxyl radicals and Fe2+, which...

  8. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-06-27

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence.

  9. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids

    OpenAIRE

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence.

  10. Purification and Characterization of a Trehalose Synthase from the Basidiomycete Grifola frondosa

    Science.gov (United States)

    Saito, Koki; Kase, Toshiya; Takahashi, Eiichi; Takahashi, Eisaku; Horinouchi, Sueharu

    1998-01-01

    A trehalose synthase (TSase) that catalyzes the synthesis of trehalose from d-glucose and α-d-glucose 1-phosphate (α-d-glucose 1-P) was detected in a basidiomycete, Grifola frondosa. TSase was purified 106-fold to homogeneity with 36% recovery by ammonium sulfate precipitation and several steps of column chromatography. The native enzyme appears to be a dimer since it has apparent molecular masses of 120 kDa, as determined by gel filtration column chromatography, and 60 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Although TSase catalyzed the phosphorolysis of trehalose to d-glucose and α-d-glucose 1-P, in addition to the synthesis of trehalose from the two substrates, the TSase equilibrium strongly favors trehalose synthesis. The optimum temperatures for phosphorolysis and synthesis of trehalose were 32.5 to 35°C and 35 to 37.5°C, respectively. The optimum pHs for these reactions were 6.5 and 6.5 to 6.8, respectively. The substrate specificity of TSase was very strict: among eight disaccharides examined, only trehalose was phosphorolyzed, and only α-d-glucose 1-P served as a donor substrate with d-glucose as the acceptor in trehalose synthesis. Two efficient enzymatic systems for the synthesis of trehalose from sucrose were identified. In system I, the α-d-glucose 1-P liberated by 1.05 U of sucrose phosphorylase was linked with d-glucose by 1.05 U of TSase, generating trehalose at the initial synthesis rate of 18 mmol/h in a final yield of 90 mol% under optimum conditions (300 mM each sucrose and glucose, 20 mM inorganic phosphate, 37.5°C, and pH 6.5). In system II, we added 1.05 U of glucose isomerase and 20 mM MgSO4 to the reaction mixture of system I to convert fructose, a by-product of the sucrose phosphorylase reaction, into glucose. This system generated trehalose at the synthesis rate of 4.5 mmol/h in the same final yield. PMID:9797287

  11. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  12. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  13. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  14. Cryptococcus yokohamensis sp. nov., a basidiomycetous yeast isolated from trees and a Queensland koala kept in a Japanese zoological park.

    Science.gov (United States)

    Alshahni, Mohamed Mahdi; Makimura, Koichi; Satoh, Kazuo; Nishiyama, Yayoi; Kido, Nobuhide; Sawada, Takuo

    2011-12-01

    Three strains were isolated from the nostrils of a koala and the surrounding environment in a Japanese zoological park. Sequence analysis of the nuclear rDNA internal transcribed spacer (ITS) region and the large subunit rDNA D1/D2 domains in addition to physiological and morphological studies indicated that the isolates represent a single novel species belonging to the basidiomycetous genus Cryptococcus (Tremellales, Tremellomycetes, Agaricomycotina). Phylogenetic analysis based on D1/D2 and ITS regions revealed that the novel species belongs to the Fuciformis clade. The name Cryptococcus yokohamensis sp. nov. is proposed to accommodate these isolates with strain JCM 16989(T) (=TIMM 10001(T)=CBS 11776(T)=DSM 23671(T)) as the type strain.

  15. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  16. De novo transcriptome sequencing and comprehensive analysis of the heat stress response genes in the basidiomycetes fungus Ganoderma lucidum.

    Science.gov (United States)

    Tan, Xiaoyan; Sun, Junshe; Ning, Huijuan; Qin, Zifang; Miao, Yuxin; Sun, Tian; Zhang, Xiuqing

    2018-03-29

    Ganoderma lucidum is a valuable basidiomycete with numerous pharmacological compounds, which is widely consumed throughout China. We previously found that the polysaccharide content of Ganoderma lucidum fruiting bodies could be significantly improved by 45.63% with treatment of 42 °C heat stress (HS) for 2 h. To further investigate genes involved in HS response and explore the mechanisms of HS regulating the carbohydrate metabolism in Ganoderma lucidum, high-throughput RNA-Seq was conducted to analyse the difference between control and heat-treated mycelia at transcriptome level. We sequenced six cDNA libraries with three from control group (mycelia cultivated at 28 °C) and three from heat-treated group (mycelia subjected to 42 °C for 2 h). A total of 99,899 transcripts were generated using Trinity method and 59,136 unigenes were annotated by seven public databases. Among them, 2790 genes were identified to be differential expressed genes (DEGs) under HS condition, which included 1991 up-regulated and 799 down-regulated. 176 DEGs were then manually classified into five main responsive-related categories according to their putative functions and possible metabolic pathways. These groups include stress resistance-related factors; protein assembly, transportation and degradation; signal transduction; carbohydrate metabolism and energy provision-related process; other related functions, suggesting that a series of metabolic pathways in Ganoderma lucidum are activated by HS and the response mechanism involves a complex molecular network which needs further study. Remarkably, 48 DEGs were found to regulate carbohydrate metabolism, both in carbohydrate hydrolysis for energy provision and polysaccharide synthesis. In summary, this comprehensive transcriptome analysis will provide enlarged resource for further investigation into the molecular mechanisms of basidiomycete under HS condition. Copyright © 2017. Published by Elsevier B.V.

  17. Stone-Eating Fungi: Mechanisms in Bioweathering and the Potential Role of Laccases in Black Slate Degradation With the Basidiomycete Schizophyllum commune.

    Science.gov (United States)

    Kirtzel, Julia; Siegel, Daniela; Krause, Katrin; Kothe, Erika

    2017-01-01

    Many enzymes, such as laccases, are involved in the saprotrophic lifestyle of fungi and the effects of those may be linked to enhanced bioweathering on stone surfaces. To test this hypothesis, we studied the decomposition of kerogen-enriched lithologies, especially with black slate containing up to 20% of C org . Indeed, a formation of ditches with attached hyphal material could be observed. To address enzymes involved, proteomics was performed and one group of enzymes, the multicopper oxidase family members of laccases, was specifically investigated. A role in bioweathering of rocks containing high contents of organic carbon in the form of kerogen could be shown using the basidiomycete Schizophyllum commune, a white rot fungus that has been used as a model organism to study the role of filamentous basidiomycete fungi in bioweathering of black slate. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  19. Fatty acid profiles of polar and neutral lipids of ten species of higher basidiomycetes indigenous to eastern Canada.

    Science.gov (United States)

    Pedneault, Karine; Angers, Paul; Gosselin, André; Tweddell, Russell J

    2008-12-01

    Neutral and polar lipid contents of ten species of edible mushrooms indigenous to Eastern Canada belonging to the families Agaricaceae, Amanitaceae, Boletaceae, Coprinaceae, Ganodermataceae, and Lycoperdaceae were analysed. The total lipid content of the species analysed ranged from 3.1% (Ganoderma applanatum) to 16% (w/w) d.w. (Amanita vaginata) and averaged 8.6% (w/w) d.w. Polar lipids accounted for more than 50% of the total lipids in most species and differences were observed between neutral and polar lipid contents according to the species analysed. In both lipid fractions, high proportions of unsaturated fatty acids (FAs) ranging from 62.7 to 82.3% (polar lipids) and 59.8 to 82.5% (neutral lipids) of the total FAs were observed. Analysis of FA profiles showed that both neutral and polar lipids were mainly composed of linoleic (18:2 Delta9c,12c), oleic (18:1 Delta9c), and palmitic (16:0) acids. Significant differences (P<0.05) in the contents of specific FAs were observed between mushroom species. Among the 44 FAs detected in the species analysed, the occurrence of cis-11-heptadecenoic (17:1 Delta11c) acid is reported for the first time in basidiomycetes, while elaidic acid (18:1 Delta9t) is reported for the first time in fungi.

  20. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  1. Degradation of C60 Fullerol by White-Rot Basidiomycete Fungi: Implications for Environmental Release of Nanomaterials

    Science.gov (United States)

    Schreiner, K. M.; Filley, T. R.; Bolskar, R. D.; Blanchette, R. A.

    2008-12-01

    Industrially produced carbon-based nanomaterials, including fullerenes and fullerols, will be introduced into the environment in increasing amounts over the next century. Oxygenated fullerenes are likely to be produced in the environment through both biotic and abiotic weathering, and yet the environmental fate of compounds like hydroxylated fullerenes are almost unknown. This study examines the ability of two white rot basidiomycete fungi (Phlebia tremellosa and Trametes versicolor) to metabolize and degrade 13C-labeled C60 fullerol. Both of these fungi were shown to degrade fullerol to CO2 both in the presence of wood tissue and without, and incorporate trace amounts of the carbon into fungal biomass. Absorbance data also indicate that a significant portion of the original fullerol was broken down into small molecular weight metabolites. Phlebia tremellosa proved to be, in general, more aggressive towards fullerol degradation than Trametes versicolor. These findings represent the report of fungal degradation of this important nanomaterial and also provide valuable information about the possible environmental fates of this compound.

  2. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  3. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  4. VOLATILE COMPOUNDS IN THE AROMA OF THREE SPECIES OF WOOD-ROTTING BASIDIOMYCETES AND THEIR ANTIFUNGAL POTENTIAL

    Directory of Open Access Journals (Sweden)

    Cristiana Virginia PETRE

    2017-12-01

    Full Text Available This study aims to determine the volatile organic compounds synthesized by three species of wood-rotting basidiomycetes: Coriolopsis gallica, Megacollybia platyphylla and Lentinus arcularius and test their antifungal potential. The species were cultivated on liquid media and kept for 25 days at 25 °C. The surface cultures were then homogenized, filtrated and extracted using solid-phase extraction and analyzed by GC-MS. The volatile compounds identified were mainly alcohols, ketones, aldehydes and terpenes. The most common volatiles identified in the experiment are: 1-octen-3-ol, 3-hexanol, 3-methyl-1-butanol, 3-octanone, 2-hexanone, benzaldehyde, and limonene. The volatiles metabolites of these species were tested for their antifungal activity using the bi-compartmented Petri dishes method against two species of plant pathogenic fungi: Fusarium solani and Sclerotinia sclerotiorum, on three media. The volatiles produced by Coriolopsis gallica showed the highest antifungal potential against the phytopathogens. The results revealed the importance of media composition in the synthesis of antifungal volatile compounds.

  5. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  6. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  7. Computational studies on LiP H isolated from Ganoderma lucidum GD88

    Directory of Open Access Journals (Sweden)

    Parambayil Nayana

    2015-01-01

    Full Text Available Ganoderma lucidum is a basidiomycete fungus that produces ligninase for the modification of lignin. Lignin peroxidase (LiP is a glycoprotein that acts on the recalcitrant cell wall component lignin. In the present study, the phylogenetic analysis of Ganoderma lucidum GD88 with the partial coding sequence (cds of other LiP isoforms was performed using MEGA6. After determination of the open reading frame, the +3 frame nucleotide sequence was converted to protein using the EMBOSS Transseq and the secondary structure was predicted using the Chou and Fasman Secondary Structure Prediction server (CFSSP. Protein modeling was also performed by SWISS-MODEL. The obtained result shows that the lipH partial cds of Ganoderma lucidum GD88 is homologous to the lipD gene of Phanerochaete chrysosporium. The secondary structure prediction result revealed that the percent content of the helix (67 is higher than the percent contents of sheet (53.4 and turns (13.6. According to the generated model, LiP H protein is a homodimer with chains A and B. The heme acts as a ligand and plays a major role in structure stabilization.

  8. Solid-state fermentation as a strategy to improve the bioactive compounds recovery from Larrea tridentata leaves.

    Science.gov (United States)

    Martins, Sílvia; Teixeira, José A; Mussatto, Solange I

    2013-11-01

    Chemical composition of Larrea tridentata leaves was determined and elevated content of lignin (35.96 % w/w) was found. The present study was proposed in order to evaluate the extraction of bioactive compounds, particularly phenolic compounds, by solid-state fermentation (SSF) of L. tridentata leaves. The basidiomycete Phanerochaete chrysosporium was used in the experiments due to its ability to degrade lignin. The concentration of total phenolic compounds in the extracts produced by SSF was determined. Additionally, the extracts were characterized regarding the concentration of flavonoids, quercetin, kaempferol, and nordihydroguaiaretic acid and antioxidant activity. SSF was not an efficient process to recover phenolic compounds from L. tridentata leaves. However, this process was very efficient when used as a pretreatment before the plant extraction with organic solvent (methanol). By submitting the plant to SSF and subsequently to extraction with 90 % (v/v) methanol, the recovery of phenolic compounds was improved by 33 % when compared to the results obtained by methanolic extraction of the non-fermented plant. Scanning electron microscopy micrographs revealed a major disorganization and porosity of the plant structure after fermentation, and Fourier transform infrared spectroscopy spectra indicated a possible solubilization of some constituents of lignocellulose fraction after this process, which may have favored the solvent action in the later stage.

  9. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  10. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  11. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  12. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-01-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework. PMID:17189439

  13. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-02-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework.

  14. Purification, characterization and cDNA cloning of an endo-exonuclease from the basidiomycete fungus Armillaria mellea.

    Science.gov (United States)

    Healy, V; Doonan, S; McCarthy, T V

    1999-01-01

    We have purified an endo-exonuclease from the fruiting body of the basidiomycete fungus Armillaria mellea by using an ethanol fractionation step, followed by two rounds of column chromatography. The enzyme had an apparent molecular mass of 17500 Da and was shown to exist as a monomer by gel-filtration analysis. The nuclease was active on both double-stranded and single-stranded DNA but not on RNA. It was optimally active at pH8.5 and also exhibited a significant degree of thermostability. Three bivalent metal ions, Mg2+, Co2+ and Mn2+, acted as cofactors in the catalysis. It was also inhibited by high salt concentrations: activity was completely abolished at 150 mM NaCl. The nuclease possessed both endonuclease activity on supercoiled DNA and a 3'-5' (but not a 5'-3') exonuclease activity. It generated 5'-phosphomonoesters on its products that, after a prolonged incubation, were hydrolysed to a mixture of free mononucleotides and small oligonucleotides ranging in size from two to eight bases. Elucidation of its N-terminal amino acid sequence permitted the cDNA cloning of the A. mellea nuclease via a PCR-based approach. Peptide mapping of the purified enzyme generated patterns consistent with the amino acid sequence coded for by the cloned cDNA. A BLAST search of the SwissProt database revealed that A. mellea nuclease shared significant amino acid similarity with two nucleases from Bacillus subtilis, suggesting that the three might constitute a distinct class of nucleolytic enzymes. PMID:10215611

  15. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  16. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  17. Characterization of a novel PQQ-dependent quinohemoprotein pyranose dehydrogenase from Coprinopsis cinerea classified into auxiliary activities family 12 in carbohydrate-active enzymes.

    Directory of Open Access Journals (Sweden)

    Kouta Takeda

    Full Text Available The basidiomycete Coprinopsis cinerea contains a quinohemoprotein (CcPDH named as CcSDH in our previous paper, which is a new type of pyrroloquinoline-quinone (PQQ-dependent pyranose dehydrogenase and is the first found among all eukaryotes. This enzyme has a three-domain structure consisting of an N-terminal heme b containing a cytochrome domain that is homologous to the cytochrome domain of cellobiose dehydrogenase (CDH; EC 1.1.99.18 from the wood-rotting basidiomycete Phanerochaete chrysosporium, a C-terminal family 1-type carbohydrate-binding module, and a novel central catalytic domain containing PQQ as a cofactor. Here, we describe the biochemical and electrochemical characterization of recombinant CcPDH. UV-vis and resonance Raman spectroscopic studies clearly reveal characteristics of a 6-coordinated low-spin heme b in both the ferric and ferrous states, as well as intramolecular electron transfer from the PQQ to heme b. Moreover, the formal potential of the heme was evaluated to be 130 mV vs. NHE by cyclic voltammetry. These results indicate that the cytochrome domain of CcPDH possesses similar biophysical properties to that in CDH. A comparison of the conformations of monosaccharides as substrates and the associated catalytic efficiency (kcat/Km of CcPDH indicates that the enzyme prefers monosaccharides with equatorial C-2, C-3 hydroxyl groups and an axial C-4 hydroxyl group in the 1C4 chair conformation. Furthermore, a binding study shows a high binding affinity of CcPDH for cellulose, suggesting that CcPDH function is related to the enzymatic degradation of plant cell wall.

  18. Biodegradation of lignin and nicotine with white rot fungi for the delignification and detoxification of tobacco stalk.

    Science.gov (United States)

    Su, Yulong; Xian, He; Shi, Sujuan; Zhang, Chengsheng; Manik, S M Nuruzzaman; Mao, Jingjing; Zhang, Ge; Liao, Weihong; Wang, Qian; Liu, Haobao

    2016-11-21

    Tobacco stalk is one kind of abundant crop residues in China. The high lignification of tobacco stalk increases its reusing cost and the existing of nicotine will cause serious pollution. The biodegradation of lignocellulosic biomass has been demonstrated to be an environmental and economical approach for the utilization of plant stalk. Meanwhile, many nicotine-degrading microorganisms were found in nature. However, microorganisms which could degraded both nicotine and lignin haven't been reported. Therefore, it's imperative to find some suitable microorganisms to break down lignin and simultaneously remove nicotine in tobacco stalk. The nicotine in tobacco stalk could be degraded effectively by Trametes versicolor, Trametes hirsute and Phanerochaete chrysosporium. The nicotine content in tobacco stalk was lowered to below 500 mg/kg (a safe concentration to environment) after 10 days of fermentation with Phanerochaete chrysosporium and Trametes versicolor, and 15 days with Trametes hirsute. The degradation rate of lignin in the fermented tobacco stalk was 37.70, 51.56 and 53.75% with Trametes versicolor, Trametes hirsute and Phanerochaete chrysosporium, respectively. Meanwhile, 24.28% hemicellulose was degraded by Phanerochaete chrysosporium and 28.19% cellulose was removed by Trametes hirsute. Through the enzyme activity analysis, the main and highest ligninolytic enzymes produced by Phanerochaete chrysosporium, Trametes hirsute and Trametes versicolor were lignin peroxidase (88.62 U · L -1 ), manganese peroxidase (100.95 U · L -1 ) and laccase (745.65 U · L -1 ). Meanwhile, relatively high and stable cellulase activity was also detected during the fermentation with Phanerochaete chrysosporium, and the highest endoglucanase, exoglucanase and filter paper enzyme activities were 0.38 U · mL -1 , 0.45 U · mL -1 and 0.35U · mL -1 , respectively. Moreover, the products in the fermentation of tobacco stalk with P. chrysosporium were

  19. A new mechanism of biopulping : attachment of acid groups on fiber

    Science.gov (United States)

    William R. Kenealy; Chris Hunt; Eric Horn; Carl Houtman

    2004-01-01

    We analyzed the physical properties of wood chips incubated with Ceriporiopsis subvermispora and cultural parameters of biopulping incubations of Phanerochaete chrysosporium and C. subvermispora. Dynamic mechanical analyses indicated a reduction in the modulus of elasticity (MOE) and loss modulus of spruce during the time where the biopulping energy savings effect...

  20. Decolorization of laundry effluent by filamentous fungi

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... Biodegradation of bioaccessible textile azo dyes by Phanerochaete chrysosporium, J. Biotechnol. 89: 91-98. Oliveira JR, Souza RR (2003). Biodegradação de efluentes contendo corantes utilizados na indústria têxtil. In: Seminário de Pesquisa,. Aracajú SE. Parshetti GK, Kalme SD, Gomare SS, Govindwar ...

  1. Effect of different cultivation conditions for the production of ligninolytic enzymes by the white-root Fungi Anthracophyllum discolor

    International Nuclear Information System (INIS)

    Bustamante, M.; Tortella, G. R.; Diez, M. C.

    2009-01-01

    At present, the study of the ligninolytic enzyme from white-rot fungi to degrade ligninolytic compounds has increased. Until now, most studies have been focused on the enzymatic system of Phanerochaete chrysosporium and Trametes versicolor due to its rapid growth, easy growing conditions and ligninolytic properties. (Author)

  2. Effect of different cultivation conditions for the production of ligninolytic enzymes by the white-root Fungi Anthracophyllum discolor

    Energy Technology Data Exchange (ETDEWEB)

    Bustamante, M.; Tortella, G. R.; Diez, M. C.

    2009-07-01

    At present, the study of the ligninolytic enzyme from white-rot fungi to degrade ligninolytic compounds has increased. Until now, most studies have been focused on the enzymatic system of Phanerochaete chrysosporium and Trametes versicolor due to its rapid growth, easy growing conditions and ligninolytic properties. (Author)

  3. Biodegradation of Phenol Adsorbed on Soil in the Presence of Polycyclic Aromatic Hydrocarbons.

    Czech Academy of Sciences Publication Activity Database

    Maléterová, Ywetta; Matějková, Martina; Demnerová, K.; Stiborová, H.; Kaštánek, František; Šolcová, Olga

    2016-01-01

    Roč. 3, č. 1 (2016), s. 87-98 ISSN 2397-2076 R&D Projects: GA TA ČR TA04020700 Institutional support: RVO:67985858 Keywords : polycyclic artomatic hydrocarbons * phenol * bioremediation * candida tropicalis * phanerochaete chrysosporium Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  4. Effect of metal ions on autofluorescence of the dry rot fungus Serpula lacrymans grown on spruce wood

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Žižka, Zdeněk; Švec, Karel; Nasswettrová, A.; Šmíra, P.; Kofroňová, Olga; Benada, Oldřich

    2016-01-01

    Roč. 61, č. 2 (2016), s. 119-128 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : HEAVY-METALS * CELL-WALL * PHANEROCHAETE-CHRYSOSPORIUM Subject RIV: EE - Microbiology, Virology Impact factor: 1.521, year: 2016

  5. Immobilization of Irpex lacteus to liquid-core alginate beads and their application to degradation of pollutants

    Czech Academy of Sciences Publication Activity Database

    Šíma, J.; Milne, R.; Novotný, Čeněk; Hasal, P.

    2017-01-01

    Roč. 62, č. 4 (2017), s. 335-342 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGI * ROTATING BIOLOGICAL CONTACTOR * PHANEROCHAETE-CHRYSOSPORIUM Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.521, year: 2016

  6. OXIDATION OF PERSISTANT ENVIRONMENTAL POLLUTANTS BY A WHITE ROT FUNGUS

    Science.gov (United States)

    The white rot fungus Phanerochaete chrysosporium degraded DDT [1,1,-bis(4-chlorophenyl)-2,2,2-trichloroethane], 3,4,3',4'-tetrachlorobiphenyl, 2,4,5,2',-4',5'-hexachlorobiphenyl, 2,3,7,8-tetrachlorodibenzo-p-dioxin, lindane (1,2,3,4,5,6-hexachlorocylohexane), and benzo[a]pyrene t...

  7. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    International Nuclear Information System (INIS)

    Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.

    2009-01-01

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  8. Ectomycorrhizas in vitro between Tricholoma matsutake, a basidiomycete that associates with Pinaceae, and Betula platyphylla var. japonica, an early-successional birch species, in cool-temperate forests.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Maruyama, Tsuyoshi; Neda, Hitoshi

    2015-04-01

    Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates with Pinaceae in the Northern Hemisphere and produces prized "matsutake" mushrooms. We questioned whether the symbiont could associate with a birch that is an early-successional species in boreal, cool-temperate, or subalpine forests. In the present study, we demonstrated that T. matsutake can form typical ectomycorrhizas with Betula platyphylla var. japonica; the associations included a Hartig net and a thin but distinct fungal sheath, as well as the rhizospheric mycelial aggregate "shiro" that is required for fruiting in nature. The in vitro shiro also emitted a characteristic aroma. This is the first report of an ectomycorrhizal formation between T. matsutake and a deciduous broad-leaved tree in the boreal or cool-temperate zones that T. matsutake naturally inhabits.

  9. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  10. Traceability of Asian Matsutake, Specialty Mushrooms Produced by the Ectomycorrhizal Basidiomycete Tricholoma matsutake, on the Basis of Retroelement-Based DNA Markers▿

    Science.gov (United States)

    Murata, Hitoshi; Babasaki, Katsuhiko; Saegusa, Tomoki; Takemoto, Kenji; Yamada, Akiyoshi; Ohta, Akira

    2008-01-01

    The ectomycorrhizal basidiomycete Tricholoma matsutake produces commercially valuable fruit bodies, matsutake, in forests. Here we report a PCR system targeting retroelement integration sites to differentiate among individual Asian isolates of T. matsutake based on their geographical origins, such as Japan, the area of South Korea through North Korea, the northeastern provinces of China, and the area of the southwestern provinces of China through Bhutan. The overall misjudgment rate of the analytical system was approximately 5% based on 95 samples of T. matsutake examined including those from cultures and from commodities. We also provide evidence that T. matsutake isolates grown throughout the Far East, including the northeastern provinces of China, are closely related to each other while distinct from those in the area of the southwestern provinces of China through Bhutan. The method allows us to trace back geographical origins of Asian matsutake, thus contributing to food safety, appropriate tariffs, and proper price setting. PMID:18281433

  11. Immunochemotherapy of transplanted KMT-17 tumor in WKA rats by combination of cyclophosphamide and immunostimulatory protein-bound polysaccharide isolated from basidiomycetes.

    Science.gov (United States)

    Akiyama, J; Kawamura, T; Gotohda, E; Yamada, Y; Hosokawa, M; Kodama, T; Kobayashi, H

    1977-09-01

    Protein-bound polysaccharide Kureha (PS-K) isolated from Basidiomycetes was used in combination with cyclophosphamide (CY) for the treatment of a 3-methylcholanthrene- induced KMT-17 fibrosarcoma in WKA/Mk rats. A single administration of PS-K exhibited no inhibitory effect on the growth of s.c.-inoculated KMT-17 tumor at any timing and dose. However, PS-K exhibited a marked antitumor effect when it was combined with CY. The effect of PS-K dependend on the combination timing of PS-K and CY; a marked antitumor effect was observed when PS-K was administered before CY but not if it was given after CY or before tumor inoculation. When PS-K was administered on Day 1 followed by CY on Day 3, the highest survival rate of 78.5% (11 of 14) was obtained. Delayed hypersensitivity response of rats to KMT-17 was investigat ed by radioisotopic footpad assay. On Day 12, the hypersensitivity response in rats treated with PS-K on Day 1 and CY on Day 3 was significantly higher than that in nontreated rats, indicating an enhanced specific immunity to KMT-17 possibly resulting in a marked antitumor effect.

  12. Enhancement of Ganoderic Acid Accumulation by Overexpression of an N-Terminally Truncated 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene in the Basidiomycete Ganoderma lucidum

    Science.gov (United States)

    Xu, Jun-Wei; Xu, Yi-Ning

    2012-01-01

    Ganoderic acids produced by Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, exhibit antitumor and antimetastasis activities. Genetic modification of G. lucidum is difficult but critical for the enhancement of cellular accumulation of ganoderic acids. In this study, a homologous genetic transformation system for G. lucidum was developed for the first time using mutated sdhB, encoding the iron-sulfur protein subunit of succinate dehydrogenase, as a selection marker. The truncated G. lucidum gene encoding the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) was overexpressed by using the Agrobacterium tumefaciens-mediated transformation system. The results showed that the mutated sdhB successfully conferred carboxin resistance upon transformation. Most of the integrated transfer DNA (T-DNA) appeared as a single copy in the genome. Moreover, deregulated constitutive overexpression of the HMGR gene led to a 2-fold increase in ganoderic acid content. It also increased the accumulation of intermediates (squalene and lanosterol) and the upregulation of downstream genes such as those of farnesyl pyrophosphate synthase, squalene synthase, and lanosterol synthase. This study demonstrates that transgenic basidiomycete G. lucidum is a promising system to achieve metabolic engineering of the ganoderic acid pathway. PMID:22941092

  13. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  14. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    OpenAIRE

    García Torres Angélica María; Torres Sáe Rodrigo Gonzalo

    2003-01-01

    La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de ést...

  15. Enhanced production of a diastereomer type of mannosylerythritol lipid-B by the basidiomycetous yeast Pseudozyma tsukubaensis expressing lipase genes from Pseudozyma antarctica.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2017-12-01

    Basidiomycetous yeasts in the genus Pseudozyma are known to produce extracellular glycolipids called mannosylerythritol lipids (MELs). Pseudozyma tsukubaensis produces a large amount of MEL-B using olive oil as the sole carbon source (> 70 g/L production). The MEL-B produced by P. tsukubaensis is a diastereomer type of MEL-B, which consists of 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol as a sugar moiety, in contrast to the conventional type of MELs produced by P. antarctica, which contain 4-O-β-D mannopyranosyl-(2S,3R)-erythritol. In this study, we attempted to increase the production of the diastereomer type of MEL-B in P. tsukubaensis 1E5 by introducing the genes encoding two lipases, PaLIPAp (PaLIPA) and PaLIPBp (PaLIPB) from P. antarctica T-34. Strain 1E5 expressing PaLIPA exhibited higher lipase activity than the strain possessing an empty vector, which was used as a negative control. Strains of 1E5 expressing PaLIPA or PaLIPB showed 1.9- and 1.6-fold higher MEL-B production than the negative control strain, respectively, and oil consumption was also accelerated by the introduction of these lipase genes. MEL-B production was estimated using time course analysis in the recombinant strains. Strain 1E5 expressing PaLIPA produced 37.0 ± 1.2 g/L of MEL-B within 4 days of cultivation, whereas the strain expressing an empty vector produced 22.1 ± 7.5 g/L in this time. Overexpression of PaLIPA increased MEL-B production by P. tsukubaensis strain 1E5 from olive oil as carbon source by more than 1.7-fold.

  16. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta.

    Science.gov (United States)

    Wei, Dongsheng; Houtman, Carl J; Kapich, Alexander N; Hunt, Christopher G; Cullen, Daniel; Hammel, Kenneth E

    2010-04-01

    Brown rot basidiomycetes initiate wood decay by producing extracellular reactive oxygen species that depolymerize the structural polysaccharides of lignocellulose. Secreted fungal hydroquinones are considered one contributor because they have been shown to reduce Fe(3+), thus generating perhydroxyl radicals and Fe(2+), which subsequently react further to produce biodegradative hydroxyl radicals. However, many brown rot fungi also secrete high levels of oxalate, which chelates Fe(3+) tightly, making it unreactive with hydroquinones. For hydroquinone-driven hydroxyl radical production to contribute in this environment, an alternative mechanism to oxidize hydroquinones is required. We show here that aspen wood undergoing decay by the oxalate producer Postia placenta contained both 2,5-dimethoxyhydroquinone and laccase activity. Mass spectrometric analysis of proteins extracted from the wood identified a putative laccase (Joint Genome Institute P. placenta protein identification number 111314), and heterologous expression of the corresponding gene confirmed this assignment. Ultrafiltration experiments with liquid pressed from the biodegrading wood showed that a high-molecular-weight component was required for it to oxidize 2,5-dimethoxyhydroquinone rapidly and that this component was replaceable by P. placenta laccase. The purified laccase oxidized 2,5-dimethoxyhydroquinone with a second-order rate constant near 10(4) M(-1) s(-1), and measurements of the H(2)O(2) produced indicated that approximately one perhydroxyl radical was generated per hydroquinone supplied. Using these values and a previously developed computer model, we estimate that the quantity of reactive oxygen species produced by P. placenta laccase in wood is large enough that it likely contributes to incipient decay.

  17. Analysis of the Basidiomycete Coprinopsis cinerea reveals conservation of the core meiotic expression program over half a billion years of evolution.

    Directory of Open Access Journals (Sweden)

    Claire Burns

    2010-09-01

    Full Text Available Coprinopsis cinerea (also known as Coprinus cinereus is a multicellular basidiomycete mushroom particularly suited to the study of meiosis due to its synchronous meiotic development and prolonged prophase. We examined the 15-hour meiotic transcriptional program of C. cinerea, encompassing time points prior to haploid nuclear fusion though tetrad formation, using a 70-mer oligonucleotide microarray. As with other organisms, a large proportion (∼20% of genes are differentially regulated during this developmental process, with successive waves of transcription apparent in nine transcriptional clusters, including one enriched for meiotic functions. C. cinerea and the fungi Saccharomyces cerevisiae and Schizosaccharomyces pombe diverged ∼500-900 million years ago, permitting a comparison of transcriptional programs across a broad evolutionary time scale. Previous studies of S. cerevisiae and S. pombe compared genes that were induced upon entry into meiosis; inclusion of C. cinerea data indicates that meiotic genes are more conserved in their patterns of induction across species than genes not known to be meiotic. In addition, we found that meiotic genes are significantly more conserved in their transcript profiles than genes not known to be meiotic, which indicates a remarkable conservation of the meiotic process across evolutionarily distant organisms. Overall, meiotic function genes are more conserved in both induction and transcript profile than genes not known to be meiotic. However, of 50 meiotic function genes that were co-induced in all three species, 41 transcript profiles were well-correlated in at least two of the three species, but only a single gene (rad50 exhibited coordinated induction and well-correlated transcript profiles in all three species, indicating that co-induction does not necessarily predict correlated expression or vice versa. Differences may reflect differences in meiotic mechanisms or new roles for paralogs

  18. Survey and analysis of simple sequence repeats in the Laccaria bicolor genome, with development of microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2011-01-01

    It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.

  19. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants.

  20. Influence of inoculating white-rot fungi on organic matter transformations and mobility of heavy metals in sewage sludge based composting.

    Science.gov (United States)

    Zhang, Chaosheng; Xu, Ying; Zhao, Meihua; Rong, Hongwei; Zhang, Kefang

    2018-02-15

    White-rot fungi, Phanerochaete chrysosporium was inoculated to sewage sludge composting. Its effect on transformation of organic matter and mobility of heavy metals (Zn, Pb, Cu, and Ni) was studied. Detailed sampling was performed to measure C contents in humic extracts (HE), humic acids (HAs), fulvic acids (FAs), humin and distribution of heavy metals, including acid exchangeable fraction (AE), reducible fraction (RED), oxidization fraction (OXI) and residual fraction (RES). In our study, it is evident that the HE, HAs increased obviously and hydrolyzed humin decreased markedly in inoculation. The stabilization rate ((OXI+RES)/(AE+RED)) of Zn, Pb, Cu, and Ni was 20.31%, 7%, 14.3% and 19.79% higher in inoculating reactor. Additionally, the changes of heavy metals fractions could be explained by the organic variables. The results of this study demonstrated that Phanerochaete chrysosporium passivates the heavy metal by provoking the formation of humus. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Southern blot screening for lignin peroxidase and aryl-alcohol oxidase genes in 30 fungal species.

    Science.gov (United States)

    Varela, E; Martínez, A T; Martínez, M J

    2000-10-13

    Screening to detect genes encoding lignin peroxidase (LiP) and aryl-alcohol oxidase (AAO) has been carried out with 30 fungal strain using DNA probes from genes lpo of Phanerochaete chrysosporium (encoding LiP isoenzyme H8) and aao of Pleurotus eryngii. Evidence for the presence of genes closely related to lpo was found in Bjerkandera adusta, Fomes fomentarius, Ganoderma applanatum, Ganoderma australe, Lentinula degener, Peniophora gigantea, P. chrysosporium, Phanerochaete flavido-alba and Trametes tersicolor, whereas the gene aao was detected in Pleurotus species and B. adusta. The presence of both genes was only detected in B. adusta. These results suggest that different enzymatic system, formed by enzymes encoded by different genes, are responsible for lignin degradation by white-rot fungi.

  2. Changes in Molecular Size Distribution of Cellulose during Attack by White Rot and Brown Rot Fungi

    OpenAIRE

    Kleman-Leyer, Karen; Agosin, Eduardo; Conner, Anthony H.; Kirk, T. Kent

    1992-01-01

    The kinetics of cotton cellulose depolymerization by the brown rot fungus Postia placenta and the white rot fungus Phanerochaete chrysosporium were investigated with solid-state cultures. The degree of polymerization (DP; the average number of glucosyl residues per cellulose molecule) of cellulose removed from soil-block cultures during degradation by P. placenta was first determined viscosimetrically. Changes in molecular size distribution of cellulose attacked by either fungus were then det...

  3. Aplikasi Bioaktivator SuperDec dalam Pengomposan Limbah Padat Organik Tebu

    OpenAIRE

    Goenadi, Didiek Hadjar; Santi, Laksmita Prima

    2006-01-01

    The development of a suitable technology for handling sugar cane plantation's solid organic waste especially bagasse, filter mud, and trash is one of the most important concerns in the management system of sugar cane plantation. Solid organic waste of sugar cane is potentially suitable as a compost raw material processed by introducing lingocellulosic-degrading microbes, particularly Phanerochaete chrysosporium, Trichoderma pseudokoningii, and Trichoderma sp. The microbes were formulated in...

  4. Studies of cellulose binding by cellobiose dehydrogenase and a comparison with cellobiohydrolase 1.

    OpenAIRE

    Henriksson, G; Salumets, A; Divne, C; Pettersson, G

    1997-01-01

    The binding isotherm to cellulose of cellobiose dehydrogenase (CDH) from Phanerochaete chrysosporium has been compared with that of cellobiohydrolase 1 (CBH 1) from Trichoderma reesei. CDH binds more strongly but more sparsely to cellulose than does CBH 1. In a classical Scatchard analysis, a better fit to a one-site binding model was obtained for CDH than for CBH 1. The binding of both enzymes decreased in the presence of ethylene glycol, increased in the presence of ammonium sulphate and wa...

  5. Fruiting Body Formation in Basidiomycetes

    NARCIS (Netherlands)

    Pelkmans, J.F.; Lugones, L.G.; Wosten, H.A.B.

    2016-01-01

    Establishment of the dikaryotic mycelium and formation of fruiting bodies are highly complex developmental programmes that are activated by a combination of environmental cues. A wide variety of proteins are expected to regulate and coordinate these programmes or to fulfil enzymatic conversions or

  6. Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20)

    Science.gov (United States)

    Karakaya, Pelin; Christodoulatos, Christos; Koutsospyros, Agamemnon; Balas, Wendy; Nicolich, Steve; Sidhoum, Mohammed

    2009-01-01

    The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the CL-20 concentration; levels of carbon (as glycerol) and ammonium sulfate and yeast extract as sources of nitrogen. Cultures that received CL-20 at the time of inoculation transformed CL-20 completely under all nutrient conditions studied. When CL-20 was added to pre-grown cultures, degradation was limited. The extent of mineralization was monitored by the 14CO2 time evolution; up to 51% mineralization was achieved when the fungus was incubated with [14C]-CL-20. The kinetics of CL-20 biodegradation by Phanerochaete chrysosporium follows the logistic kinetic growth model. PMID:19440524

  7. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  8. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  9. A kingdom-specific protein domain HMM library for improved annotation of fungal genomes

    Directory of Open Access Journals (Sweden)

    Oliver Stephen G

    2007-04-01

    Full Text Available Abstract Background Pfam is a general-purpose database of protein domain alignments and profile Hidden Markov Models (HMMs, which is very popular for the annotation of sequence data produced by genome sequencing projects. Pfam provides models that are often very general in terms of the taxa that they cover and it has previously been suggested that such general models may lack some of the specificity or selectivity that would be provided by kingdom-specific models. Results Here we present a general approach to create domain libraries of HMMs for sub-taxa of a kingdom. Taking fungal species as an example, we construct a domain library of HMMs (called Fungal Pfam or FPfam using sequences from 30 genomes, consisting of 24 species from the ascomycetes group and two basidiomycetes, Ustilago maydis, a fungal pathogen of maize, and the white rot fungus Phanerochaete chrysosporium. In addition, we include the Microsporidion Encephalitozoon cuniculi, an obligate intracellular parasite, and two non-fungal species, the oomycetes Phytophthora sojae and Phytophthora ramorum, both plant pathogens. We evaluate the performance in terms of coverage against the original 30 genomes used in training FPfam and against five more recently sequenced fungal genomes that can be considered as an independent test set. We show that kingdom-specific models such as FPfam can find instances of both novel and well characterized domains, increases overall coverage and detects more domains per sequence with typically higher bitscores than Pfam for the same domain families. An evaluation of the effect of changing E-values on the coverage shows that the performance of FPfam is consistent over the range of E-values applied. Conclusion Kingdom-specific models are shown to provide improved coverage. However, as the models become more specific, some sequences found by Pfam may be missed by the models in FPfam and some of the families represented in the test set are not present in FPfam

  10. Degradation of 3,3',4,4'-tetrachlorobiphenyl by selected white rot fungi

    International Nuclear Information System (INIS)

    Vyas, B.R.M.; Šašek, V.; Matucha, M.; Bubner, M.

    1994-01-01

    N-limited stationary cultures of the white rot fungi Phanerochaete chrysosporium, Trametes versicolor, and Coriolopsis polysona mineralized 1.393 ± 0.353 (0.301 ± 0.023) and 0.398 ± 0.061 (0.112 ± 0.010), and 0.015 ± 0.004 (0.002 ± 0.0008) % of the originally supplied 30.14 nmol (513.7 nmol) of 3,3′,4,4′-tetrachloro[U- 14 C]biphenyl (PCB 77) during 4 weeks. The extent of PCB 77 degradation was followed by 14 C-radioactivity partitioning into aqueous, organic soluble, biomass associated, aqueous (intracellular) and organic soluble (intracellular) fractions. After four weeks incubation the pattern of distribution of radioactivity was similar in P. chrysosporium and C. polysona at higher dose but not at the lower dose of PCB 77. T. versicolor differed in the distribution pattern of radiolabel

  11. Diversification of fungal specific class a glutathione transferases in saprotrophic fungi.

    Science.gov (United States)

    Mathieu, Yann; Prosper, Pascalita; Favier, Frédérique; Harvengt, Luc; Didierjean, Claude; Jacquot, Jean-Pierre; Morel-Rouhier, Mélanie; Gelhaye, Eric

    2013-01-01

    Glutathione transferases (GSTs) form a superfamily of multifunctional proteins with essential roles in cellular detoxification processes and endogenous metabolism. The distribution of fungal-specific class A GSTs was investigated in saprotrophic fungi revealing a recent diversification within this class. Biochemical characterization of eight GSTFuA isoforms from Phanerochaete chrysosporium and Coprinus cinereus demonstrated functional diversity in saprotrophic fungi. The three-dimensional structures of three P. chrysosporium isoforms feature structural differences explaining the functional diversity of these enzymes. Competition experiments between fluorescent probes, and various molecules, showed that these GSTs function as ligandins with various small aromatic compounds, derived from lignin degradation or not, at a L-site overlapping the glutathione binding pocket. By combining genomic data with structural and biochemical determinations, we propose that this class of GST has evolved in response to environmental constraints induced by wood chemistry.

  12. Diversification of fungal specific class a glutathione transferases in saprotrophic fungi.

    Directory of Open Access Journals (Sweden)

    Yann Mathieu

    Full Text Available Glutathione transferases (GSTs form a superfamily of multifunctional proteins with essential roles in cellular detoxification processes and endogenous metabolism. The distribution of fungal-specific class A GSTs was investigated in saprotrophic fungi revealing a recent diversification within this class. Biochemical characterization of eight GSTFuA isoforms from Phanerochaete chrysosporium and Coprinus cinereus demonstrated functional diversity in saprotrophic fungi. The three-dimensional structures of three P. chrysosporium isoforms feature structural differences explaining the functional diversity of these enzymes. Competition experiments between fluorescent probes, and various molecules, showed that these GSTs function as ligandins with various small aromatic compounds, derived from lignin degradation or not, at a L-site overlapping the glutathione binding pocket. By combining genomic data with structural and biochemical determinations, we propose that this class of GST has evolved in response to environmental constraints induced by wood chemistry.

  13. Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

    International Nuclear Information System (INIS)

    Luey, J.; Brouns, T.M.; Elliott, M.L.

    1990-11-01

    The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT ampersand E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable for the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs

  14. Animal bioavailability of defined xenobiotic lignin metabolites

    International Nuclear Information System (INIS)

    Sandermann, H. Jr.; Arjmand, M.; Gennity, I.; Winkler, R.; Struble, C.B.; Aschbacher, P.W.

    1990-01-01

    Lignin has been recognized as a major component of bound pesticide residues in plants and is thought to be undigestible in animals. Two defined ring-U- 14 C-labeled chloroaniline/lignin metabolites have now been fed to rats, where a release of ∼66% of the bound xenobiotic occurred in the form of simple chloroaniline derivatives. The observed high degree of bioavailability indicates that bound pesticidal residues may possess ecotoxicological significance. In parallel studies, the white-rot fungus Phanerochaete chrysosporium was more efficient, and a soil system was much less efficient, in the degradation of the [ring-U- 14 C]chloroaniline/lignin metabolites

  15. Biotransformations of organic energetic materials

    International Nuclear Information System (INIS)

    Matousek, J.

    2001-01-01

    This paper reviews data on the acute eco-toxicity and delayed effects (mutagenicity) of the model substance (TNT) and of a wide spectrum of its biodegradation products in the wastewaters. It also suggests main metabolic pathways of biotransformation, involving biological reduction. Some possibilities of remediation of contaminated soils utilising microbial catabolic pathways leading to the hydroxy derivatives and up to the cleavage of the aromatic ring system in the presence of the soil bacteria Pseudomonas fluorescens are shown, as well as the practical utilisation of fungi Phanerochaete chrysosporium under aerobic conditions

  16. Basidiomycete allergens: comparison of three Ganoderma species.

    Science.gov (United States)

    Horner, W E; Helbling, A; Lehrer, S B

    1993-02-01

    High atmospheric concentrations of basidiospores occur in various parts of the world. Ganoderma basidiospores are distinctive, easily identifiable in aeroallergen surveys, and widely abundant. Previous studies showed that Ganoderma basidiospores caused respiratory allergies. Thus, we investigated various extracts (spore, cap, and/or mycelial) of G. meredithae, G. lucidum, and G. applanatum for allergen components. Analyses included radioallergosorbent test (RAST) inhibition and IgE blots from isoelectric focusing (IEF) and SDS-PAGE. RAST inhibition with spores and caps of G. meredithae and G. lucidum showed that spores inhibited caps better than caps inhibited spores. Species differences were minor. Coomassie blue (CB) staining of IEF gels detected at least 23 protein bands (pI 3.6-6.6) in caps of G. meredithae and G. lucidum. G. meredithae spore extracts contained 17 of these (pI 3.6-5.0, 6.6). Spores and caps of G. meredithae contained 13 and 11 allergen bands, respectively, on IEF blots. SDS-PAGE of G. meredithae spore and cap showed one and four bands, respectively, by CB staining, but IgE blots showed 13 bands in cap and 17 in spore. Culture mycelia of G. lucidum and G. applanatum attained significant and essentially constant RAST activity by day 4. Activity was also present in culture supernatant by day 4. Blots of mycelium and supernatant detected a single allergen in day-8 mycelia and subsequently six allergen bands in day-16 mycelia and eight in day-16 supernatant (one appeared as a doublet). These data show that Ganoderma extracts contain a complex mixture of allergens. Differences among species were minor; spores and mycelia are apparently better sources of allergens than caps.

  17. ENSAIO ACELERADO DE LABORATÓRIO DE CHAPAS OSB DE SERINGUEIRA SUBMETIDAS AO ATAQUE DE FUNGOS APODRECEDORES

    Directory of Open Access Journals (Sweden)

    Esmeralda Yoshico Arakaki Okino

    2009-01-01

    Full Text Available This work aimed to evaluate the natural durability of oriented strandboards (OSB manufactured with strands of Hevea brasiliensis Müll.Arg. bonded with 5% and 8% of urea-formaldehyde (UF and phenol-formadehyde (FF resins, exposed to xilophagous fungi under laboratory conditions. In accelerated laboratory test decay, samples of OSB were exposed to the following fungi: the brown-rot fungi Gloeophyllum trabeum (Pers. ex Fries Murr., Coniophora puteana (Schumach. : Fr.P. Karst., Meruliporia incrassata (Berk. & M.A. Curtis Murrill as well as the white-rot fungi Fomes annosus (Fr. : Fr. Cooke, Trametes versicolor (L. : Fr. Pilát, Ganoderma applanatum (Pers. Pat., Bjerkandera fumosa (Pers. : Fr. P. Karst. and Phanerochaete chrysosporium Burds. Among the brown-rot fungi, the Gloeophyllum trabeum was the most aggressive, showing the highest loss of mass. Trametes versicolor and Ganoderma applanatum confirmed the preference for broadleave species. All oriented strandboards at lower UF resin contents were more degraded by Phanerochaete chrysosporium, Trametes versicolor, Ganoderma applanatum, Merulia incrassata, Coniophora puteana and Gloeophyllum trabeum, with high rate of loss of mass. Coniophora puteana showed small loss of mass when FF resin was applied. Bjerkandera fumosa showed low loss of mass only at higher resin content. Oriented strandboards exposed to Coniophora puteana showed insignificant OSB degradation.

  18. ACCELERATED LABORATORY TEST OF RUBBERWOOD ORIENTED STRANDBOARD EXPOSED TO WOOD DECAY FUNGI

    Directory of Open Access Journals (Sweden)

    Esmeralda Yoshico Arakaki Okino

    2009-10-01

    Full Text Available This work aimed to evaluate the natural durability of oriented strandboards (OSB manufactured with strands of Hevea brasiliensis Müll.Arg. bonded with 5% and 8% of urea-formaldehyde (UF and phenol-formadehyde (FF resins, exposed to xilophagous fungi under laboratory conditions. In accelerated laboratory test decay, samples of OSB were exposed to the following fungi: the brown-rot fungi Gloeophyllum trabeum (Pers. ex Fries Murr., Coniophora puteana (Schumach. : Fr.P. Karst., Meruliporia incrassata (Berk. & M.A. Curtis Murrill as well as the white-rot fungi Fomes annosus (Fr. : Fr. Cooke, Trametes versicolor (L. : Fr. Pilát, Ganoderma applanatum (Pers. Pat., Bjerkandera fumosa (Pers. : Fr. P. Karst. and Phanerochaete chrysosporium Burds. Among the brown-rot fungi, the Gloeophyllum trabeum was the most aggressive, showing the highest loss of mass. Trametes versicolor and Ganoderma applanatum confirmed the preference for broadleave species. All oriented strandboards at lower UF resin contents were more degraded by Phanerochaete chrysosporium, Trametes versicolor, Ganoderma applanatum, Merulia incrassata, Coniophora puteana and Gloeophyllum trabeum, with high rate of loss of mass. Coniophora puteana showed small loss of mass when FF resin was applied. Bjerkandera fumosa showed low loss of mass only at higher resin content. Oriented strandboards exposed to Coniophora puteana showed insignificant OSB degradation.

  19. Notas sobre Afiloforales colombianos (Basidiomycetes: Aphyllophoralles Notas sobre Afiloforales colombianos (Basidiomycetes: Aphyllophoralles

    Directory of Open Access Journals (Sweden)

    Henao Luis Guillermo

    1989-09-01

    Full Text Available Some notes and a brief diagnostic description are provided for 19 species of Aphyllophorales. The following 15 species are new reports for the Colombian mycota: Thelephora palmata, Coltricia perennis, C. cinnamomea. Cyclomyces tabacinus, Phellinus rimosus, Dentinum repandum, Clavaria laeticolor, C. zollingeri, Polyporus dictyopus, Trametes membranaceus, T scabrosa, T. villosa, Trichaptum nebularis, Tyromyces duracinus and T. stipticus. Se proporcionan algunas notas y una descripción diagnóstica de 19 especies de Afiloforales colombianos. Las siguientes 15 especies se registran por primera vez en la micota colombiana: Thelephora pelmata, Coltricia perennis, C. cinnamomea, Cyclomyces tabacinus, Phellinus rimosus, Dentinum repandum, Clavaria laeticolor, C. zollingeri, Polyporus dictyopus, Trametes membranaceus, T. scabrosa, T villosa, Trichaptum nebuleris, Tyromyces duracinus y T stipticus.

  20. Accumulation and degradation of dead-end metabolites during treatment of soil contaminated with polycyclic aromatic hydrocarbons with five strains of white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, B.E. [Centre for Chemistry and Chemical Engineering, Dept. of Biotechnology, Lund Univ. (Sweden); Henrysson, T. [Centre for Chemistry and Chemical Engineering, Dept. of Biotechnology, Lund Univ. (Sweden)

    1996-12-31

    The white-rot fungi Trametes versicolor PRL 572, Trametes versicolor MUCL 28407, Pleurotus ostreatus MUCL 29527, Pleurotus sajor-caju MUCL 29757 and Phanerochaete chrysosporium DSM 1556 were investigated for their ability to degrade the polycyclic aromatic hydrocarbons (PAH) anthracene, benz[a]anthracene and dibenz[a, h]anthracene in soil. The fungi were grown on wheat straw and mixed with artificially contaminated soil. The results of this study show that, in a heterogeneous soil environment, the fungi have different abilities to degrade PAH, with Trametes showing little or no accumulation of dead-end metabolites and Phanerochaete and Pleurotus showing almost complete conversion of anthracene to 9,10-anthracenedione. In contrast to earlier studies, Phanerochaete showed the ability to degrade the accumulated 9,10-anthracenedione while Pleurotus did not. This proves that, in a heterogeneous soil system, the PAH degradation pattern for white-rot fungi can be quite different from that in a controlled liquid system. (orig.)

  1. Isolation and molecular characterization of polyvinyl chloride (PVC) plastic degrading fungal isolates.

    Science.gov (United States)

    Ali, Muhammad Ishtiaq; Ahmed, Safia; Robson, Geoff; Javed, Imran; Ali, Naeem; Atiq, Naima; Hameed, Abdul

    2014-01-01

    The recalcitrant nature of polyvinyl chloride creates serious environmental concerns during manufacturing and waste disposal. The present study was aimed to isolate and screen different soil fungi having potential to biodegrade PVC films. After 10 months of soil burial experiment, it was observed that a number of fungal strains were flourishing on PVC films. On morphological as well as on 18rRNA gene sequence and phylogenetic basis they were identified as Phanerochaete chrysosporium PV1, Lentinus tigrinus PV2, Aspergillus niger PV3, and Aspergillus sydowii PV4. The biodegradation ability of these fungal isolates was further checked in shake flask experiments by taking thin films of PVC (C source) in mineral salt medium. A significant change in color and surface deterioration of PVC films was confirmed through visual observation and Scanning electron microscopy. During shake flask experiments, P. chrysosporium PV1 produced maximum biomass of about 2.57 mg ml(-1) followed by A. niger PV3. P. chrysosporium PV1 showed significant reduction (178,292 Da(-1)) in Molecular weight of the PVC film than control (200,000 Da(-1)) by gel permeation chromatography. Furthermore more Fourier transform infrared spectroscopy and nuclear magnetic resonance also revealed structural changes in the PVC. It was concluded that isolated fungal strains have significant potential for biodegradation of PVC plastics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

    Directory of Open Access Journals (Sweden)

    Georgios Koutrotsios

    2014-01-01

    Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.

  3. Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

    Science.gov (United States)

    Koutrotsios, Georgios; Zervakis, Georgios I.

    2014-01-01

    Olive mill wastewater (OMW) constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water) resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent's decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64%) followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW's phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment. PMID:24987685

  4. Biomass pyrolysis liquid to citric acid via 2-step bioconversion.

    Science.gov (United States)

    Yang, Zhiguang; Bai, Zhihui; Sun, Hongyan; Yu, Zhisheng; Li, Xingxing; Guo, Yifei; Zhang, Hongxun

    2014-12-31

    The use of fossil carbon sources for fuels and petrochemicals has serious impacts on our environment and is unable to meet the demand in the future. A promising and sustainable alternative is to substitute fossil carbon sources with microbial cell factories converting lignocellulosic biomass into desirable value added products. However, such bioprocesses require tolerance to inhibitory compounds generated during pretreatment of biomass. In this study, the process of sequential two-step bio-conversion of biomass pyrolysis liquid containing levoglucosan (LG) to citric acid without chemical detoxification has been explored, which can greatly improve the utilization efficiency of lignocellulosic biomass. The sequential two-step bio-conversion of corn stover pyrolysis liquid to citric acid has been established. The first step conversion by Phanerochaete chrysosporium (P. chrysosporium) is desirable to decrease the content of other compounds except levoglucosan as a pretreatment for the second conversion. The remaining levoglucosan in solution was further converted into citric acid by Aspergillus niger (A. niger) CBX-209. Thus the conversion of cellulose to citric acid is completed by both pyrolysis and bio-conversion technology. Under experimental conditions, levoglucosan yield is 12% based on the feedstock and the citric acid yield can reach 82.1% based on the levoglucosan content in the pyrolysis liquid (namely 82.1 g of citric acid per 100 g of levoglucosan). The study shows that P. chrysosporium and A. niger have the potential to be used as production platforms for value-added products from pyrolyzed lignocellulosic biomass. Selected P. chrysosporium is able to decrease the content of other compounds except levoglucosan and levoglucosan can be further converted into citric acid in the residual liquids by A. niger. Thus the conversion of cellulose to citric acid is completed by both pyrolysis and bio-conversion technology.

  5. Extracellular oxidases and the transformation of solubilised low-rank coal by wood-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ralph, J.P. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Graham, L.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Catcheside, D.E.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences

    1996-12-31

    The involvement of extracellular oxidases in biotransformation of low-rank coal was assessed by correlating the ability of nine white-rot and brown-rot fungi to alter macromolecular material in alkali-solubilised brown coal with the spectrum of oxidases they produce when grown on low-nitrogen medium. The coal fraction used was that soluble at 3.0{<=}pH{<=}6.0 (SWC6 coal). In 15-ml cultures, Gloeophyllum trabeum, Lentinus lepideus and Trametes versicolor produced little or no lignin peroxidase, manganese (Mn) peroxidase or laccase activity and caused no change to SWC6 coal. Ganoderma applanatum and Pycnoporus cinnabarinus also produced no detectable lignin or Mn peroxidases or laccase yet increased the absorbance at 400 nm of SWC6 coal. G. applanatum, which produced veratryl alcohol oxidase, also increased the modal apparent molecular mass. SWC6 coal exposed to Merulius tremellosus and Perenniporia tephropora, which secreted Mn peroxidases and laccase and Phanerochaete chrysosporium, which produced Mn and lignin peroxidases was polymerised but had unchanged or decreased absorbance. In the case of both P. chrysosporium and M. tremellosus, polymerisation of SWC6 coal was most extensive, leading to the formation of a complex insoluble in 100 mM NaOH. Rigidoporus ulmarius, which produced only laccase, both polymerised and reduced the A{sub 400} of SWC6 coal. P. chrysosporium, M. tremellosus and P. tephropora grown in 10-ml cultures produced a spectrum of oxidases similar to that in 15-ml cultures but, in each case, caused more extensive loss of A{sub 400}, and P. chrysosporium depolymerised SWC6 coal. It is concluded that the extracellular oxidases of white-rot fungi can transform low-rank coal macromolecules and that increased oxygen availability in the shallower 10-ml cultures favours catabolism over polymerisation. (orig.)

  6. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  7. Co-composting of organic fraction of municipal solid waste mixed with different bulking waste: characterization of physicochemical parameters and microbial enzymatic dynamic.

    Science.gov (United States)

    Awasthi, Mukesh Kumar; Pandey, Akhilesh Kumar; Bundela, Pushpendra Singh; Khan, Jamaluddin

    2015-04-01

    The effect of various bulking waste such as wood shaving, agricultural and yard trimming waste combined with organic fraction of municipal solid waste (OFMSW) composting was investigated through assessing their influence on microbial enzymatic activities and quality of finished compost. All three piles of OFMSW with different bulking waste were inoculated with microbial consortium. The results revealed that OFMSW combined with wood shaving and microbial consortium (Phanerochaete chrysosporium, Trichoderma viride and Pseudomonas aeruginosa) were helpful tool to facilitate the enzymatic activity and shortened composting period within 4 weeks. Maximum enzymatic activity were observed in pile 1 and 3 during the first 3 weeks, while in pile 2 relatively very low. But phosphatase activity was relatively higher in all piles until the end of the process. Maturity parameters of compost quality also favored the pile 1 as the best formulation for OFMSW composting. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Direct Surface Analysis of Fungal Species by Matrix-assisted Laser Desorption/Ionization Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Valentine, Nancy B.(BATTELLE (PACIFIC NW LAB)); Wahl, Jon H.(BATTELLE (PACIFIC NW LAB)); Kingsley, Mark T.(BATTELLE (PACIFIC NW LAB)); Wahl, Karen L.(BATTELLE (PACIFIC NW LAB))

    2001-12-01

    Intact spores and/or hyphae of Aspergillus niger, Rhizopus oryzae, Trichoderma reesei and Phanerochaete chrysosporium are analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). This study investigates various methods of sample preparation and matrices to determine optimum collection and analysis criteria for fungal analysis by MALDI-MS. Fungi are applied to the MALDI sample target as untreated, sonicated, acid/heat treated, or blotted directly from the fungal culture with double-stick tape. Ferulic acid or sinapinic acid matrix solution is layered over the dried samples and analyzed by MALDI-MS. Statistical analysis of the data show that simply using double stick tape to collect and transfer to a MALDI sample plate typically worked as well as the other preparation methods, but requires the least sample handling.

  9. The GSTome Reflects the Chemical Environment of White-Rot Fungi.

    Directory of Open Access Journals (Sweden)

    Aurélie Deroy

    Full Text Available White-rot fungi possess the unique ability to degrade and mineralize all the different components of wood. In other respects, wood durability, among other factors, is due to the presence of extractives that are potential antimicrobial molecules. To cope with these molecules, wood decay fungi have developed a complex detoxification network including glutathione transferases (GST. The interactions between GSTs from two white-rot fungi, Trametes versicolor and Phanerochaete chrysosporium, and an environmental library of wood extracts have been studied. The results demonstrate that the specificity of these interactions is closely related to the chemical composition of the extracts in accordance with the tree species and their localization inside the wood (sapwood vs heartwood vs knotwood. These data suggest that the fungal GSTome could reflect the chemical environment encountered by these fungi during wood degradation and could be a way to study their adaptation to their way of life.

  10. The GSTome Reflects the Chemical Environment of White-Rot Fungi

    Science.gov (United States)

    Deroy, Aurélie; Saiag, Fanny; Kebbi-Benkeder, Zineb; Touahri, Nassim; Hecker, Arnaud; Morel-Rouhier, Mélanie; Colin, Francis; Dumarcay, Stephane; Gérardin, Philippe; Gelhaye, Eric

    2015-01-01

    White-rot fungi possess the unique ability to degrade and mineralize all the different components of wood. In other respects, wood durability, among other factors, is due to the presence of extractives that are potential antimicrobial molecules. To cope with these molecules, wood decay fungi have developed a complex detoxification network including glutathione transferases (GST). The interactions between GSTs from two white-rot fungi, Trametes versicolor and Phanerochaete chrysosporium, and an environmental library of wood extracts have been studied. The results demonstrate that the specificity of these interactions is closely related to the chemical composition of the extracts in accordance with the tree species and their localization inside the wood (sapwood vs heartwood vs knotwood). These data suggest that the fungal GSTome could reflect the chemical environment encountered by these fungi during wood degradation and could be a way to study their adaptation to their way of life. PMID:26426695

  11. Microbial desulphurization of Turkish lignites by White Rot Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Pinar Aytar; Mesut Sam; Ahmet Cabuk [Balikesir University, Balikesir (Turkey). Department of Biology, Faculty of Arts and Science

    2008-03-15

    Biodesulphurization experiments were carried out with Tuncbilek lignite, characterized by high sulfur content (2.59%) by using Trametes versicolor ATCC 200801 and Phanerochaete chrysosporium ME 446. At fungal biomass studies, the effects of various parameters on fungal desulphurization of coals such as pH, temperature, pulp density, incubation time, and sterilization were investigated for both microorganisms. The maximum desulphurization (40%) was observed after 6 days of incubation at 35{sup o}C for T. versicolor. The optimum pH was measured at 6, and the agitation rate was fixed at 125 rpm. The pulp density was found as 5% (w/v) for the high extent of desulphurization. Also, calorific value did not change during this experiment. However, the ash and metal contents of coal were eliminated. 30 refs., 6 figs., 2 tabs.

  12. Fungal degradation of organophosphorous insecticides

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A. [Notre Dame Univ., IN (United States); Kakar, S.N.; Coleman, R.D. [Argonne National Lab., IL (United States)

    1992-07-01

    Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.

  13. Fungal degradation of organophosphorous insecticides

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A. (Notre Dame Univ., IN (United States)); Kakar, S.N.; Coleman, R.D. (Argonne National Lab., IL (United States))

    1992-01-01

    Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.

  14. [Effect of pretreatment by solid-state fermentation of sawdust on the pelletization and pellet's properties].

    Science.gov (United States)

    Guo, Jingjing; Yuan, Xingzhong; Li, Hui; Li, Changzhu; Xiao, Zhihong; Xiao, Zhihua; Jiang, Longbo; Zeng, Guangming

    2015-10-01

    We pretreated sawdust (Castanopsis fissa Rehd.et Wils) by solid state fermentation (SSF) with Phanerochaete chrysosporium, and then compressed it into pellets with the moisture content of 15% and the pressure of 98 MPa, to solve the problem of low density, low Meyer hardness, high water uptake, and short storage period of pellet in the woody pellet industry. We studied the effects of fermentation time on pelletization and pellets's characteristics (including energy consumption, density, Meyer hardness, and hydrophobicity). SSF affected the heating values of pellet. Compared with fresh sawdust, SSF consumed more energy at the maximal value by 6.98% but saved extrusion energy by 32.19% at the maximum. Meanwhile, SSF could improve the density, Meyer hardness and hydrophobicity of pellet. Pellet made of sawdust pretreated by SSF for 48 d had best quality, beneficial for long-term transportation and storage of pellets.

  15. Solubilization of Australian lignites by fungi and other microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Catcheside, D.E.A.; Mallett, K.J. (Flinders University, Bedford Park, SA (Australia). School of Biological Sciences)

    Lignites (brown coals) from the Latrobe Valley in Victoria are solubilized by {ital Coriolus versicolor}, {ital Phanerochaete chrysosporium}, and five other species known to be active on Leonardite and various acid-treated North America lignites. Run-of-mine coal from Morwell and Loy Yang is refractory but is soluble after pretreatment with acid. A weathered deposit at Loy Yang, like Leonardite, is susceptible to biosolubilization without pretreatment. The white rot fungi {ital Ganoderma applanatum}, {ital Perenniporia tephropora} ({ital Fomes lividus}), {ital Pleurotus ostreatus}, {ital Pycnoporus cinnabarinus}, {ital Rigidoporus ulmarius}, and {ital Xylaria hypoxylon} were found to be capable of solubilizing lignite. In contrast, brown rot fungi were weakly active or inactive under the same test conditions. Lignite-degrading fungi, actinomycetes, and other bacteria, including some active on untreated run-of-mine coal, were isolated from natural lignite exposures and mining sites. 15 refs., 5 tabs.

  16. Studies of cellulose binding by cellobiose dehydrogenase and a comparison with cellobiohydrolase 1.

    Science.gov (United States)

    Henriksson, G; Salumets, A; Divne, C; Pettersson, G

    1997-01-01

    The binding isotherm to cellulose of cellobiose dehydrogenase (CDH) from Phanerochaete chrysosporium has been compared with that of cellobiohydrolase 1 (CBH 1) from Trichoderma reesei. CDH binds more strongly but more sparsely to cellulose than does CBH 1. In a classical Scatchard analysis, a better fit to a one-site binding model was obtained for CDH than for CBH 1. The binding of both enzymes decreased in the presence of ethylene glycol, increased in the presence of ammonium sulphate and was unaffected by sodium chloride. Attempts to localize the cellulose-binding site on CDH have also been made by exposing enzymically digested CDH to cellulose and isolating the cellulose-bound peptides. The results suggest that the cellulose-binding site is located internally in the amino acid sequence of CDH. PMID:9210407

  17. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  18. Lanostane triterpenoids from the Sri Lankan basidiomycete Ganoderma applanatum.

    Science.gov (United States)

    de Silva, E Dilip; van der Sar, Sonia A; Santha, R G Lalith; Wijesundera, Ravi L C; Cole, Anthony L J; Blunt, John W; Munro, Murray H G

    2006-08-01

    Two new lanostane-type triterpenoids, 3alpha,16alpha-dihydroxylanosta-7,9(11),24-trien-21-oic acid (1) and 3alpha,16alpha,26-trihydroxylanosta-7,9(11),24-trien-21-oic acid (2), along with three known lanostanoids, 16alpha-hydroxy-3-oxolanosta-7,9(11),24-trien-21-oic acid (3), 3alpha-carboxyacetoxy-24-methylen-23-oxolanost-8-en-26-oic acid (4), and 3alpha-carboxyacetoxy-24-methyl-23-oxolanost-8-en-26-oic acid (5), have been isolated from the EtOAc extract of the fruiting body of Ganoderma applanatum. The structures of 1, 2, and 3 were determined directly by the interpretation of spectroscopic data, while the structures of 4 and 5 were assigned by comparison of spectroscopic data against literature values.

  19. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  20. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  1. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.

    2009-01-01

    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  2. Removal of cadmium by pleurotus sajor-caju basidiomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Cihangir, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Science; Saglam, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Education

    1999-11-01

    The bioaccumulation of cadmium by the white rot fungus Pleurotus sajor-caju onto dry biomass was investigated using aqueous media with concentrations in the range of 0.125 mM-1.0 mM. The highest cadmium uptake (between 88.9 and 91.8%) was observed with aerobic fungal biomass from the exponential growth phase. Up to 1.0 mM cadmium gradually inhibited mycelium development, but never blocked it completely. Freeze-dried, oven-dried and non-metabolizing live Pleurotus sajor-caju biomass types were tested for their capacity to adsorb the test ion Cd{sup 2+} within the pH range of 4.5 to 6.0. Freeze-dried biomass proved to be the most efficient biomass type for Cd{sup 2+} metal adsorption. Therefore, Pleurotus sajor-caju may be used for heavy metal removal and bioremediation. (orig.)

  3. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

    Science.gov (United States)

    Yitzhak Hadar; Daniel Cullen

    2013-01-01

    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  4. Revision of the genus Xerula Maire (Basidiomycetes, Agaricales in Poland

    Directory of Open Access Journals (Sweden)

    Anna Ronikier

    2011-01-01

    Full Text Available Data concerning morphology, ecology and distribution of Polish representatives of the genus Xerula Maire are discussed in the paper. All available specimens of X. pudens and X. melanotricha from Polish herbaria were reexamined to verify their identity and geographical distribution. Several new localities of X. melanotricha in the country are provided. A key to European taxa of the genus is proposed.

  5. A new species of Pleurocollybia (Tricholomataceae; Agaricales; Basidiomycetes) from Belize

    Science.gov (United States)

    T.J. Baroni; N. Bocsusis; D.J. Lodge; D.L. Lindner

    2008-01-01

    A new species, Pleurocollybia imbricata, is described from the Maya Mountains of Belize and a new combination in Pleurocollybia is proposed. A key to the known species of Pleurocollybia is also provided.

  6. Flagelloscypha minutissima (Basidiomycetes, a new for Poland minute cyphellaceous fungus

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2011-01-01

    Full Text Available The first records of Flagelloscypha minutissima (Burt Donk are reported from Poland, being easternmost on the European continent. A brief description and illustration of the species based on Polish specimens are given and its ecology, distribution, and taxonomy are surveyed.

  7. New taxa of Entoloma (Basidiomycetes, Agaricales) from Estonia and Karelia

    NARCIS (Netherlands)

    Noordeloos, Machiel E.; Liiv, Vello

    1992-01-01

    Nine new species of Entoloma are described from the Islands of Saaremaa and Vormsi, Estonia, viz. E. conocybecystis, E. leochromus, E. mutabilipes, E. ochromicaceum, E. politoflavipes, E. rhynchocystidiatum, E. roseotinctum, E. viiduense, and E. violaceozonatum. Entoloma lactarioides is described as

  8. Microsatellite markers for the diploid Basidiomycete fungus, Armillaria mellea

    Science.gov (United States)

    We isolated and characterized 13 microsatellite markers for two North American populations (California and Pennsylvania) of Armillaria mellea, a fungal root pathogen responsible for Armillaria root disease of numerous horticultural crops and forest trees. The frequency of alleles ranged from two to...

  9. Prevalence of transcription factors in ascomycete and basidiomycete fungi

    NARCIS (Netherlands)

    Todd, Richard B; Zhou, M.; Ohm, Robin A; Leeggangers, Hendrika A C F; Visser, Loek; de Vries, Ronald P; van den Brink, J.

    2014-01-01

    BACKGROUND: Gene regulation underlies fungal physiology and therefore is a major factor in fungal biodiversity. Analysis of genome sequences has revealed a large number of putative transcription factors in most fungal genomes. The presence of fungal orthologs for individual regulators has been

  10. Prevalence of transcription factors in ascomycete and basidiomycete fungi

    NARCIS (Netherlands)

    Todd, Richard B.; Zhou, Miaomiao; Ohm, Robin A.; Leeggangers, Melissa; Visser, Loek; Vries, De Ronald P.

    2014-01-01

    Gene regulation underlies fungal physiology and therefore is a major factor in fungal biodiversity. Analysis of genome sequences has revealed a large number of putative transcription factors in most fungal genomes. The presence of fungal orthologs for individual regulators has been analysed and

  11. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    pollution. Most of these dyes are stable to light, temperature, and highly resistant to degradation (O’Neill et al. 1999). Several physico-chemical methods such as adsorption, pre- cipitation, chemical oxidation, photodegradation, or membrane filtration have...), which are toxic, mutagenic, and possibly carcinogenic (Pinheiro et al. 2004). Several actinomycetes have been reported to decolor- ize reactive dyes, including anthraquinone, phthalo- cyanine, and azo dyes, through adsorption of the dyes to the cellular...

  12. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  13. Use of Fungi in Biodegradation of Basidiomycetes Textile Effluents

    OpenAIRE

    Souza, Aline Francisca; Universidade Estadual de Londrina; Rosado, Fábio Rogério; Cesumar

    2009-01-01

    Textile industries have contributed significantly to environmental contamination, due to the production of waste with low levels of degradation, including colors from the dyeing steps, effluent being discarded with intense color. This type of effluent has a very variable composition, due to the diversity of colors used daily. There are physical and chemical treatments for these wastes, however the biological treatments have been highlighting for being natural, not requiring the use of chemica...

  14. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  15. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  16. Improving production of laccase from novel basidiomycete with ...

    African Journals Online (AJOL)

    Three variables (sucrose, MgSO4 and CuSO4) were found to affect laccase production significantly by P-B screening. B-B design with three-factor at three levers was performed to explain the combined effects of the three medium constituents. The optimum medium consisted of sucrose (4.26 g/L), yeast powder (15 g/L), ...

  17. Studies on the genus Entoloma (Basidiomycetes, Agaricales) in Kerala State, India (Basidiomycetes, Agaricales) in Kerala State, India

    NARCIS (Netherlands)

    Manimohan, P.; Noordeloos, M.E.; Dhanya, A.M.

    2006-01-01

    Fifteen new taxa are described from Kerala State, India, based on collections made by the first author. Three taxa fit subgenus Pouzarella (E. testaceostrigosum, E. violaceovillosum, and E. dysthales var. keralense). Four species are described as having cuboid spores (E. albidoquadratum, E.

  18. Solubilization and Mineralization of Lignin by White Rot Fungi

    Science.gov (United States)

    Boyle, C. David; Kropp, Bradley R.; Reid, Ian D.

    1992-01-01

    The white rot fungi Lentinula edodes, Phanerochaete chrysosporium, Pleurotus sajor-caju, Flammulina velutipes, and Schizophyllum commune were grown in liquid media containing 14C-lignin-labelled wood, and the formation of water-soluble 14C-labelled products and 14CO2, the growth of the fungi, and the activities of extracellular lignin peroxidase, manganese peroxidase, and laccase were measured. Conditions that affect the rate of lignin degradation were imposed, and both long-term (0- to 16-day) and short-term (0- to 72-h) effects on the production of the two types of product and on the activities of the enzymes were monitored. The production of 14CO2-labelled products from the aqueous ones was also investigated. The short-term studies showed that the different conditions had different effects on the production of the two products and on the activities of the enzymes. Nitrogen sources inhibited the production of both products by all species when differences in growth could be discounted. Medium pH and manganese affected lignin degradation by the different species differently. With P. chrysosporium, the results were consistent, with lignin peroxidase playing a role in lignin solubilization and manganese peroxidase being important in subsequent CO2 production. PMID:16348781

  19. Fermented Apple Pomace as a Feed Additive to Enhance Growth Performance of Growing Pigs and Its Effects on Emissions

    Directory of Open Access Journals (Sweden)

    Chandran M. Ajila

    2015-06-01

    Full Text Available Apple pomace is a by-product from the apple processing industry and can be used for the production of many value-added compounds such as enzymes, proteins, and nutraceuticals, among others. An investigation was carried out to study the improvement in the protein content in apple pomace by solid-state fermentation using the fungus Phanerochaete chrysosporium by tray fermentation method. The effect of this protein in terms of how it enriched apple pomace as animal feed for pigs has also been studied. There was a 36% increase in protein content in the experimental diet with 5% w/w fermented apple pomace. The efficiency of conversion of ingested food was increased from 43.5 ± 2.5 to 83.1 ± 4.4 in the control group and the efficiency of conversion of feed increased from 55.4 ± 4.5 to 92.1 ± 3.6 in the experimental group during the animal feed experiment. Similarly, the effect of a protein enriched diet on odor emission and greenhouse gas emission has also been studied. The results demonstrated that the protein enrichment of apple pomace by solid state cultivation of the fungus P. chrysosporium makes it possible to use it as a dietary supplement for pigs.

  20. Biological Pretreatment of Oil Palm Frond Fiber Using White-Rot Fungi for Enzymatic Saccharification

    Directory of Open Access Journals (Sweden)

    Euis Hermiati

    2013-09-01

    Full Text Available Oil palm frond is one type of lignocellulosic biomass abundantly and daily available in Indonesia. It contains cellulose which can be converted to glucose, and further processed to produce different kinds of value –added products. The aim of this research is to study the effects of biological pretreatment of oil palm frond (OPF fiber using Phanerochaete chrysosporium and Trametes versicolor on the enzymatic saccharification of the biomass. The OPF fiber (40-60 mesh sizes was inoculated with cultures of the two fungi and incubated at 27 °C for 4 weeks. The samples were taken after 1, 2, 3, and 4 weeks of incubation. Chemical components of the biomass after pretreatment were analyzed. The saccharification of the pretreated samples using cellulase and β-glucosidase was performed in a water bath shaker at 50 °C for 48 hours. The concentration of reducing sugar increased with increasing of incubation time, either in those pretreated with culture of P. chrysosporium or with T. versicolor. Pretreatment of OPF fiber using single culture of T. versicolor for 4 weeks gave the highest reducing sugar yield (12.61% of dry biomass.

  1. Bioremediation of dyes by fungi isolated from contaminated dye effluent sites for bio-usability

    Science.gov (United States)

    Rani, Babita; Kumar, Vivek; Singh, Jagvijay; Bisht, Sandeep; Teotia, Priyanku; Sharma, Shivesh; Kela, Ritu

    2014-01-01

    Biodegradation and detoxification of dyes, Malachite green, Nigrosin and Basic fuchsin have been carried out using two fungal isolates Aspergillus niger, and Phanerochaete chrysosporium, isolated from dye effluent soil. Three methods were selected for biodegradation, viz. agar overlay and liquid media methods; stationary and shaking conditions at 25 °C. Aspergillus niger recorded maximum decolorization of the dye Basic fuchsin (81.85%) followed by Nigrosin (77.47%), Malachite green (72.77%) and dye mixture (33.08%) under shaking condition. Whereas, P. chrysosporium recorded decolorization to the maximum with the Nigrosin (90.15%) followed by Basic fuchsin (89.8%), Malachite green (83.25%) and mixture (78.4%). The selected fungal strains performed better under shaking conditions compared to stationary method; moreover the inoculation of fungus also brought the pH of the dye solutions to neutral from acidic. Seed germination bioassay study exhibited that when inoculated dye solutions were used, seed showed germination while uninoculated dyes inhibited germination even after four days of observation. Similarly, microbial growth was also inhibited by uninoculated dyes. The excellent performance of A. niger and P. chrysporium in the biodegradation of textile dyes of different chemical structures suggests and reinforces the potential of these fungi for environmental decontamination. PMID:25477943

  2. Regulation of coal polymer degradation by fungi. Tenth Quartery report, October 1996--December 1996

    Energy Technology Data Exchange (ETDEWEB)

    Irvine, R.L. [Univ. of Notre Dame, IN (United States). Dept. of Civil Engineering and Geological Sciences; Bumpus, J.A. [Univ. of Northern Iowa, Cedar Falls, IA (United States). Dept. of Chemistry

    1997-01-28

    It has long been known that low rank coal such as leonardite can be solubilized by strong base (>pH 12). Recent discoveries have also shown that leonardite is solubilized by Lewis bases at considerably lower pH values and by fungi that secrete certain Lewis bases (i.e., oxalate ion). During the current reporting period we have studied the ability of a strong base (sodium hydroxide, pH 12), and two fungi, Phanerochaete chrysosporium and Trametes versicolor, to solubilize Argonne Premium Coals. In general, Argonne Premium Coals were relatively resistant to base mediated solubilization. However, when these coals were preoxidized (150{degrees}C for seven days), substantial amounts of several coals were solubilized. Most affected were the Lewiston-Stockton bituminous coal, the Beulah-Zap lignite, the Wyodak-Anderson subbituminous coal and the Blind Canyon bituminous coal. Argonne Premium Coals were previously shown by us to be relatively resistant to solubilization by sodium oxalate. When preoxidized coals were treated with sodium oxalate, only the Beulah-Zap lignite was substantially solubilized. Although very small amounts of the other preoxidized coals were solubilized by treatment with oxalate, the small amount of solubilization that did take place was generally increased relative to that observed for coals that were not preoxidized. None of the Argonne Premium Coals were solubilized by P. chrysosporium or T. versicolor. Of considerable interest, however, is the observation that P. chrysosporium and T. versicolor mediated extensive solubilization of Lewiston-Stockton bituminous coal, the Beulah-Zap lignite and the Wyodak-Anderson subbituminous coal.

  3. Enhanced bioprocessing of lignocellulose: Wood-rot fungal saccharification and fermentation of corn fiber to ethanol

    Science.gov (United States)

    Shrestha, Prachand

    This research aims at developing a biorefinery platform to convert corn-ethanol coproduct, corn fiber, into fermentable sugars at a lower temperature with minimal use of chemicals. White-rot (Phanerochaete chrysosporium), brown-rot (Gloeophyllum trabeum) and soft-rot (Trichoderma reesei) fungi were used in this research to biologically break down cellulosic and hemicellulosic components of corn fiber into fermentable sugars. Laboratory-scale simultaneous saccharification and fermentation (SSF) process proceeded by in-situ cellulolytic enzyme induction enhanced overall enzymatic hydrolysis of hemi/cellulose from corn fiber into simple sugars (mono-, di-, tri-saccharides). The yeast fermentation of hydrolyzate yielded 7.1, 8.6 and 4.1 g ethanol per 100 g corn fiber when saccharified with the white-, brown-, and soft-rot fungi, respectively. The highest corn-to-ethanol yield (8.6 g ethanol/100 g corn fiber) was equivalent to 42 % of the theoretical ethanol yield from starch and cellulose in corn fiber. Cellulase, xylanase and amylase activities of these fungi were also investigated over a week long solid-substrate fermentation of corn fiber. G. trabeum had the highest activities for starch (160 mg glucose/mg protein.min) and on day three of solid-substrate fermentation. P. chrysosporium had the highest activity for xylan (119 mg xylose/mg protein.min) on day five and carboxymethyl cellulose (35 mg glucose/mg protein.min) on day three of solid-substrate fermentation. T. reesei showed the highest activity for Sigma cell 20 (54.8 mg glucose/mg protein.min) on day 5 of solid-substrate fermentation. The effect of different pretreatments on SSF of corn fiber by fungal processes was examined. Corn fiber was treated at 30 °C for 2 h with alkali [2% NaOH (w/w)], alkaline peroxide [2% NaOH (w/w) and 1% H2O 2 (w/w)], and by steaming at 100 °C for 2 h. Mild pretreatment resulted in improved ethanol yields for brown- and soft-rot SSF, while white-rot and Spezyme CP SSFs showed

  4. Vegetal waste degradation by microbial strains inoculation Degradación de residuos vegetales mediante inoculación con cepas microbianas

    Directory of Open Access Journals (Sweden)

    Nubia Grijalva Vallejos

    2013-06-01

    Full Text Available (Received: 2013/03/31 - Accepted: 2013/06/02Vegetal waste treatment product of urban, agricultural and industrial processes has severaltechnical problems and constitutes a significant environmental concern. Among them are thepersistence of crop protection products in high concentrations in plant material and the lack ofmicroorganisms that can tolerate such compounds and efficiently decompose the substrate.Bacteria and mainly white rot fungi are the main decomposers of lignin because of their ability tosynthesize extracellular hydrolytic and oxidative enzymes in large quantities. Trichodermareesei, Aspergillus niger, Penicillium sp. and Phanerochaete chrysosporium strains are modelstrains whose hight degradation efficiency with lignocellulose materials even in the presence ofpollutants has been proven. Several studies such as directed mutagenesis, co-culturing andheterologous expression have been done in order to improve the content of some enzymes(cellulase, xylanase, and β-glucosidase in model strains, additionally it has been done newgenetic searches to find other microorganisms with this potential. Its main applications are theindustrial production of ethanol and some seconday metabolites under controlled conditions infermentation processes. This review provides an overview about strategies and methodologiescurrently used for vegetal waste utilization by inoculation of microbial strains.(Recibido: 2013/03/31 - Aceptado: 2013/06/02El tratamiento de los residuos vegetales producto de desechos urbanos, procesos agrícolas eindustriales enfrenta varios problemas técnicos y constituye una preocupación ambientalimportante. Entre ellos se destacan la permanencia de productos fitosanitarios en altasconcentraciones en el material vegetal unido a la carencia de microorganismos que puedantolerar dichos compuestos y logren descomponer eficientemente el sustrato. Las bacterias yprincipalmente los hongos de la podredumbre blanca son los mejores

  5. A biodegradabilidade da blenda de poli(β-Hidroxibutirato-co-Valerato/amido anfótero na presença de microrganismos The Biodegradation of polyhydroxybutyrate-co-valerate/amphiprotic starch in the presence of microorganisms

    Directory of Open Access Journals (Sweden)

    Nadjane S. Coelho

    2008-09-01

    Full Text Available O crescimento do consumo de plásticos vem gerando grandes problemas ambientais, pois um polímero, uma vez descartado no ambiente, necessita de mais de cem anos para se degradar. O plástico ideal deve apresentar propriedades industriais desejáveis e, ao mesmo tempo ser degradável num período considerado satisfatório. Busca-se desenvolver plásticos com boas propriedades para embalagens e que possam ser biodegradados quando descartados ao ambiente. Neste trabalho avaliamos a biodegradação da blenda do copolímero poli(β-hidroxibutirato-co-valerato, PHB-HV, que é um termoplástico natural, biodegradável e biocompatível, e do amido anfótero, na proporção de 75 e 25% m/m, respectivamente. Os resultados foram obtidos através do teste de Sturm, uma metodologia para a avaliação da biodegradação na presença de uma cultura mista dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Os resultados evidenciam a biodegradação da blenda em função do tempo, de acordo com os resultados do teste de Sturm, com o aparecimento de grupos carboxílicos terminais. Foi detectado também o aparecimento de nova simetria cristalina na estrutura polimérica.The increasing consumption of plastics has generated environmental problems because it takes more than a hundred years for a discarded polymer to degrade. The ideal plastic should present desirable industrial properties and be degradable within a satisfactory time period. Researches is conducted to plastics with good properties for packaging, but that are biodegradable when discarded to the environment. In this work we evaluated the biodegradation of the blend of the copolymer poly(hydroxybutyrate-hydroxyvalerate, PHB-HV, which is a natural, biodegradable and biocompatible thermoplastic, and of the starch amphiprotic, in the proportion of 75 and 25% m/m, respectively. The results were obtained through the Sturm test, a methodology for the evaluation of biodegradation in the presence

  6. Evaluation of the types of starch for preparation of LDPE/starch blends

    Directory of Open Access Journals (Sweden)

    Glória Maria Vinhas

    2007-05-01

    Full Text Available This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In spite of the short time that the blends were exposed to the fungi, the microorganisms promoted physical and chemical changes in the structure of the blend, modifying its thermal and mechanical properties. The alteration of the degree of crystallinity and mechanical properties of the blends could be indications of the modification caused by the biodegradation process.Nesse trabalho foi realizado um estudo sobre diferentes tipos de amido quanto ao crescimento, e a atividade amilolítica de culturas mistas e isoladas dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Avaliaram-se também as propriedades térmicas e mecânicas das blendas de polietileno/amido anfótero (na proporção 80/20 (m/m antes e apos a inoculação das culturas mistas desses fungos.O amido regular Amidex 3 e o amido modificado Fox5901 foram os que se destacaram quanto ao crescimento celular e produção da enzima amilase. Apesar do pouco tempo de exposição dos filmes com os fungos, pode-se concluir que os microrganismos promovem mudanças físicas e químicas na estrutura da blenda, modificando suas propriedades térmicas e mecânicas. A alteração do grau de cristalinidade e das propriedades mecânicas das blendas podem ser indícios da modificação provocada pelo processo de biodegradação.

  7. Enzymantic Conversion of Coal to Liquid Fuels

    Energy Technology Data Exchange (ETDEWEB)

    Richard Troiano

    2011-01-31

    The work in this project focused on the conversion of bituminous coal to liquid hydrocarbons. The major steps in this process include mechanical pretreatment, chemical pretreatment, and finally solubilization and conversion of coal to liquid hydrocarbons. Two different types of mechanical pretreatment were considered for the process: hammer mill grinding and jet mill grinding. After research and experimentation, it was decided to use jet mill grinding, which allows for coal to be ground down to particle sizes of 5 {mu}m or less. A Fluid Energy Model 0101 JET-O-MIZER-630 size reduction mill was purchased for this purpose. This machine was completed and final testing was performed on the machine at the Fluid Energy facilities in Telford, PA. The test results from the machine show that it can indeed perform to the required specifications and is able to grind coal down to a mean particle size that is ideal for experimentation. Solubilization and conversion experiments were performed on various pretreated coal samples using 3 different approaches: (1) enzymatic - using extracellular Laccase and Manganese Peroxidase (MnP), (2) chemical - using Ammonium Tartrate and Manganese Peroxidase, and (3) enzymatic - using the live organisms Phanerochaete chrysosporium. Spectral analysis was used to determine how effective each of these methods were in decomposing bituminous coal. After analysis of the results and other considerations, such as cost and environmental impacts, it was determined that the enzymatic approaches, as opposed to the chemical approaches using chelators, were more effective in decomposing coal. The results from the laccase/MnP experiments and Phanerochaete chrysosporium experiments are presented and compared in this final report. Spectra from both enzymatic methods show absorption peaks in the 240nm to 300nm region. These peaks correspond to aromatic intermediates formed when breaking down the coal structure. The peaks then decrease in absorbance over time

  8. Microbial Biofertilizer Decreases Nicotine Content by Improving Soil Nitrogen Supply.

    Science.gov (United States)

    Shang, Cui; Chen, Anwei; Chen, Guiqiu; Li, Huanke; Guan, Song; He, Jianmin

    2017-01-01

    Biofertilizers have been widely used in many countries for their benefit to soil biological and physicochemical properties. A new microbial biofertilizer containing Phanerochaete chrysosporium and Bacillus thuringiensis was prepared to decrease nicotine content in tobacco leaves by regulating soil nitrogen supply. Soil NO 3 - -N, NH 4 + -N, nitrogen supply-related enzyme activities, and nitrogen accumulation in plant leaves throughout the growing period were investigated to explore the mechanism of nicotine reduction. The experimental results indicated that biofertilizer can reduce the nicotine content in tobacco leaves, with a maximum decrement of 16-18 % in mature upper leaves. In the meantime, the total nitrogen in mature lower and middle leaves increased with the application of biofertilizer, while an opposite result was observed in upper leaves. Protein concentration in leaves had similar fluctuation to that of total nitrogen in response to biofertilizer. NO 3 - -N content and nitrate reductase activity in biofertilizer-amended soil increased by 92.3 and 42.2 %, respectively, compared to those in the control, whereas the NH 4 + -N and urease activity decreased by 37.8 and 29.3 %, respectively. Nitrogen uptake was improved in the early growing stage, but this phenomenon was not observed during the late growth period. Nicotine decrease is attributing to the adjustment of biofertilizer in soil nitrogen supply and its uptake in tobacco, which result in changes of nitrogen content as well as its distribution in tobacco leaves. The application of biofertilizer containing P. chrysosporium and B. thuringiensis can reduce the nicotine content and improve tobacco quality, which may provide some useful information for tobacco cultivation.

  9. Structural, biochemical, and computational characterization of the glycoside hydrolase family 7 cellobiohydrolase of the tree-killing fungus Heterobasidion irregulare.

    Science.gov (United States)

    Momeni, Majid Haddad; Payne, Christina M; Hansson, Henrik; Mikkelsen, Nils Egil; Svedberg, Jesper; Engström, Åke; Sandgren, Mats; Beckham, Gregg T; Ståhlberg, Jerry

    2013-02-22

    Root rot fungi of the Heterobasidion annosum complex are the most damaging pathogens in temperate forests, and the recently sequenced Heterobasidion irregulare genome revealed over 280 carbohydrate-active enzymes. Here, H. irregulare was grown on biomass, and the most abundant protein in the culture filtrate was identified as the only family 7 glycoside hydrolase in the genome, which consists of a single catalytic domain, lacking a linker and carbohydrate-binding module. The enzyme, HirCel7A, was characterized biochemically to determine the optimal conditions for activity. HirCel7A was crystallized and the structure, refined at 1.7 Å resolution, confirms that HirCel7A is a cellobiohydrolase rather than an endoglucanase, with a cellulose-binding tunnel that is more closed than Phanerochaete chrysosporium Cel7D and more open than Hypocrea jecorina Cel7A, suggesting intermediate enzyme properties. Molecular simulations were conducted to ascertain differences in enzyme-ligand interactions, ligand solvation, and loop flexibility between the family 7 glycoside hydrolase cellobiohydrolases from H. irregulare, H. jecorina, and P. chrysosporium. The structural comparisons and simulations suggest significant differences in enzyme-ligand interactions at the tunnel entrance in the -7 to -4 binding sites and suggest that a tyrosine residue at the tunnel entrance of HirCel7A may serve as an additional ligand-binding site. Additionally, the loops over the active site in H. jecorina Cel7A are more closed than loops in the other two enzymes, which has implications for the degree of processivity, endo-initiation, and substrate dissociation. Overall, this study highlights molecular level features important to understanding this biologically and industrially important family of glycoside hydrolases.

  10. Biological treatment with fungi of olive mill wastewater pre-treated by photocatalytic oxidation with nanomaterials.

    Science.gov (United States)

    Nogueira, V; Lopes, I; Freitas, A C; Rocha-Santos, T A P; Gonçalves, F; Duarte, A C; Pereira, R

    2015-05-01

    Olive mill wastewater (OMW) still is a major environmental problem due to its high chemical oxygen demand (COD) and total phenolic content (TPC), contributing for the high toxicity and recalcitrant nature. Several attempts have been made for developing more efficient treatment processes, but no chemical or biological approaches were found to be totally effective, especially in terms of toxicity reduction. In this context, the main purpose of this study was to investigate the treatability of OMW by the combination of photocatalytic oxidation, using two nanomaterials as catalysts (TiO2 and Fe2O3), with biological degradation by fungi (Pleurotus sajor caju and Phanerochaete chrysosporium). Photocatalytic oxidation was carried out using different systems, nano-TiO2/UV, nano-Fe2O3/UV, nano-TiO2/H2O2/UV and nano-Fe2O3/H2O2/UV. The effectiveness of the treatment was assessed through color (465nm), aromatics (270nm), COD and TPC reductions, as well as by the decrease in toxicity using the bacterium Vibrio fischeri. The chemical treatment with the system nano-TiO2/H2O2/UV promoted 43%, 14%, 38% and 31% reductions in color, aromatics content, COD and TPC, respectively. However no toxicity reduction was observed. The combination with a biological treatment increased the reduction of COD and TPC as well as a reduction in toxicity. The treatment with P. chrysosporium promoted the highest reduction in toxicity, but P. sajor caju was responsible for the best reduction in COD and TPC. However, the biological treatment was more effective when no hydrogen peroxide was used in the pre-treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Nutritional Qualities of Cocoa Pod Husk Treated with Bioconversion and or Provision of Nitrogen Sources in the Rumen

    Directory of Open Access Journals (Sweden)

    Syahrir Syahrir

    2017-12-01

    Full Text Available The objective of this study was to investigate the effects of bioconversion using Phanerochaete chrysosporium and Pleurotus ostreatus and or inclusion of Moringa oleifera leaves and urea in the rumen on cocoa pod husk digestibility and fermentation in the rumen. There were 4 treatments tested: (1 100% untreated cocoa pod husk (UCPH, (2 55% UCPH + 43.7% M. oleifera + 1.30% urea (UCPHMU, (3 100% bioconverted cocoa pod husk (BCPH, and (4 55% BCPH + 44.5 M. oleifera + 0.5% urea (BCPHMU. Each of the treatments was replicated three times. Variables observed were dry matter and organic matter digestibilities and degradabilities, rumen VFA and ammonia concentrations, gas production, and calculated microbial biomass yields. Results indicated that the treatment increased dry matter (P<0.001 and organic matter (P<0.01 digestibility, with the highest for the BCPHMU and the lowest for the UCPH. The treatments also increased dry matter and organic matter degradability in the rumen (P<0.001, with the highest for the BCPHMU, followed by the UCPHMU, and then by the BCPH and the lowest was UCPH. The treatment affected rumen ammonia concentration (P=0.01, the highest value was found for the BCPHMU followed with UCPHMU and BCPH. Microbial biomass synthesis was affected (P<0.001 by the treatment and it was always higher when nitrogen was provided (UCPHMU and BCPHMU. Total VFA concentration or total gas production was higher for BCPHMU compared to other treatments. It can be concluded that nutritional quality of cocoa pod husk can be improved by either bioconversion with P. chrysosporium and P. ostreatus or inclusion of M. oleifera and urea in the rumen, but the best improvement can be obtained by the combination of bioconversion and provision of the nitrogen sources in the rumen.

  12. Improving Nutritional Quality of Cocoa Pod ( through Chemical and Biological Treatments for Ruminant Feeding: and Evaluation

    Directory of Open Access Journals (Sweden)

    Erika B. Laconi

    2015-03-01

    Full Text Available Cocoa pod is among the by-products of cocoa (Theobroma cacao plantations. The aim of this study was to apply a number of treatments in order to improve nutritional quality of cocoa pod for feeding of ruminants. Cocoa pod was subjected to different treatments, i.e. C (cocoa pod without any treatment or control, CAm (cocoa pod+1.5% urea, CMo (cocoa pod+3% molasses, CRu (cocoa pod+3% rumen content and CPh (cocoa pod+3% molasses+Phanerochaete chrysosporium inoculum. Analysis of proximate and Van Soest’s fiber fraction were performed on the respective treatments. The pods were then subjected to an in vitro digestibility evaluation by incubation in rumen fluid-buffer medium, employing a randomized complete block design (n = 3 replicates. Further, an in vivo evaluation of the pods (35% inclusion level in total mixed ration was conducted by feeding to young Holstein steers (average body weight of 145±3.6 kg with a 5×5 latin square design arrangement (n = 5 replicates. Each experimental period lasted for 30 d; the first 20 d was for feed adaptation, the next 3 d was for sampling of rumen liquid, and the last 7 d was for measurements of digestibility and N balance. Results revealed that lignin content was reduced significantly when cocoa pod was treated with urea, molasses, rumen content or P. chrysosporium (pCAm>CRu>CMo. Among all treatments, CAm and CPh treatments significantly improved the in vitro dry matter and organic matter digestibility (p<0.05 of cocoa pod. Average daily gain of steers receiving CAm or CPh treatment was significantly higher than that of control (p<0.01 with an increase of 105% and 92%, respectively. Such higher daily gain was concomitant with higher N retention and proportion of N retention to N intake in CAm and CPh treatments than those of control (p<0.05. It can be concluded from this study that treatment with either urea or P. chrysosporium is effective in improving the nutritive value of cocoa pod.

  13. Characterization of cell wall degrading enzymes from Chrysosporium lucknowense C1 and their use to degrade sugar beet pulp

    NARCIS (Netherlands)

    Kühnel, S.

    2011-01-01

    Key words: Pectin, arabinan, biorefinery, mode of action, branched arabinose oligomers, ferulic acid esterase, arabinohydrolase, pretreatment Sugar beet pulp is the cellulose and pectin-rich debris remaining after sugar extraction from sugar beets. In order to use sugar beet pulp for biorefinery

  14. Characterization of cell wall degrading enzymes from Chrysosporium lucknowense C1 and their use to degrade sugar beet pulp

    NARCIS (Netherlands)

    Kühnel, S.

    2011-01-01

    Key words: Pectin, arabinan, biorefinery, mode of action, branched arabinose oligomers, ferulic acid esterase, arabinohydrolase, pretreatment

    Sugar beet pulp is the cellulose and pectin-rich debris remaining after sugar extraction from sugar beets. In order to use sugar beet pulp for

  15. White-rot fungi capable of decolourising textile dyes under alkaline conditions.

    Science.gov (United States)

    Ottoni, Cristiane A; Santos, Cledir; Kozakiewicz, Zofia; Lima, Nelson

    2013-05-01

    Twelve white-rot fungal strains belonging to seven different species were screened on plates under alkaline condition to study the decolourisation of the textile dyes Reactive Black 5 and Poly R-478. Three strains of Trametes versicolor (Micoteca da Universidade do Minho (MUM) 94.04, 04.100 and 04.101) and one strain of Phanerochaete chrysosporium (MUM 94.15) showed better decolourisation results. These four strains were used for decolourisation studies in liquid culture medium. All four selected strains presented more efficient decolourisation rates on Reactive Black 5 than on Poly R-478. For both dyes on solid and liquid culture media, the decolourisation capability exhibited by these strains depended on dye concentration and pH values of the media. Finally, the decolourisation of Reactive Black 5 by T. versicolor strains MUM 94.04 and 04.100 reached 100 %. In addition, the highest white-rot fungi ligninolytic enzyme activities were found for these two strains.

  16. Manganese peroxidase h4 isozyme mediated degradation and detoxification of triarylmethane dye malachite green: optimization of decolorization by response surface methodology.

    Science.gov (United States)

    Saravanakumar, Thiyagarajan; Palvannan, Thayumanavan; Kim, Dae-Hyuk; Park, Seung-Moon

    2013-11-01

    A cDNA encoding for manganese peroxidase isozyme H4 (MnPH4), isolated from Phanerochaete chrysosporium, was expressed in Pichia pastoris, under the control of alcohol oxidase I promoter. The recombinant MnPH4 was efficiently secreted onto media supplemented with hemin at a maximum concentration of 500 U/L, after which purified rMnPH4 was used to decolorize the triarylmethane dye malachite green (MG). Response surface methodology (RSM) was employed to optimize three different operational parameters for the decolorization of MG. RSM showed that the optimized variables of enzyme (0.662 U), MnSO4 (448 μM), and hydrogen peroxide (159 μM) decolorized 100 mg/L of MG completely at 3 h. Additionally, UV-VIS spectra, high-performance liquid chromatography, gas chromatography-mass spectrometry, and liquid chromatography-electrospray ionization/mass spectrometry analysis confirmed the degradation of MG by the formation of main metabolites 4-dimethylamino-benzophenone hydrate, N, N-dimethylaniline (N,N-dimethyl-benzenamine), and methylbenzaldehyde. Interestingly, it was found that rMnPH4 mediates hydroxyl radical attack on the central carbon of MG. Finally, rMnPH4 degraded MG resulted in the complete removal of its toxicity, which was checked under in vitro conditions.

  17. Microsomal transformation of organophosphorus pesticides by white rot fungi.

    Science.gov (United States)

    Jauregui, Juan; Valderrama, Brenda; Albores, Arnulfo; Vazquez-Duhalt, Rafael

    2003-12-01

    The enzymatic mechanism for the transformation of organophosphorus pesticides (OPPs) by different white-rot fungi strains was studied. With the exception of Ganoderma applanatum 8168, all strains from a collection of 17 different fungi cultures were able to deplete parathion. Three strains showing the highest activities were selected for further studies: Bjerkandera adusta 8258, Pleurotus ostreatus 7989 and Phanerochaete chrysosporium 3641. These strains depleted 50 to 96% of terbufos, azinphos-methyl, phosmet and tribufos after four-days exposure to the pesticides. In order to identify the cellular localization of the transformation activity, the extracellular and microsomal fractions of Pleuronts ostreatus 7989 were evaluated in vitro. While the activities of ligninolytic enzymes (lignin peroxidase, manganese peroxidase and laccase) were detected in the extracellular fraction, no enzymatic modification of any of the five pesticides tested could be found, suggesting the intracellular origin of the transformation activity. In accordance with this observation the microsomal fraction was found able to transform three OPPs with the following rates: 10 micromol mg prot(-1) h(-1) for phosmet, 5.7 micromol mg prot(-1) h(-1) for terbufos, and 2.2 micromol mg prot(-1) h(-1) for azinphos-methyl. The products from these reactions and from the transformation of trichlorfon and malathion, were identified by mass-spectrometry. These results, supported by specific inhibition experiments and the stringent requirement for NADPH during the in vitro assays suggest the involvement of a cytochrome P450.

  18. Endophytic Fungi Associated With Turmeric (Curcuma longa L. Can Inhibit Histamine-Forming Bacteria in Fish

    Directory of Open Access Journals (Sweden)

    Eris Septiana

    2017-01-01

    Full Text Available Turmeric (Curcuma longa L. is a medicinal plant that is commonly used as spice and preservative. Many types of endophytic fungi have been reported as being associated with medicinal plants and able to synthesize secondary metabolites. In this study, endophytic fungi were isolated from all plant parts of turmeric plants. Identification of the endophytic fungi was done using morphological characteristics and sequencing of the internal transcribed spacer (ITS region of ribosomal DNA. The dual culture method was used for screening antibacterial activity of the endophytic fungi against Morganella morganii, a common histamine-producing bacteria. The disc diffusion method was used to test the ability of water fractions of selected endophytic fungi to inhibit M. morganii growth. Two-dimensional thin layer chromatography was used to determine the fungal extract inhibition activity on histamine formation. In total, 11 endophytic fungi were successfully isolated and identified as Arthrobotrys foliicola, Cochliobolus kusanoi, Daldinia eschscholzii, Fusarium oxysporum, Fusarium proliferatum, Fusarium solani, Fusarium verticillioides, Phanerochaete chrysosporium, and Phaeosphaeria ammophilae. Five isolates showed inhibition activity against M. morganii in the dual culture tests. Based on the disc diffusion assay, A. foliicola and F. verticillioides inhibited the growth of M. morganii as a histamine-producing bacteria, and inhibiting histamine formation in fish. The best effects in inhibiting growth of the histamine-producing bacteria and histamine formation inhibition in fish were produced with F. verticillioides water fraction at 0°C incubation.

  19. Bio-liquefaction/solubilization of low-rank Turkish lignites and characterization of the products

    Energy Technology Data Exchange (ETDEWEB)

    Yesim Basaran; Adil Denizli; Billur Sakintuna; Alpay Taralp; Yuda Yurum [Hacettepe University, Ankara (Turkey). Department of Environmental Sciences

    2003-08-01

    The effect of some white-rot fungi on the bio-liquefaction/solubilization of two low-rank Turkish coals and the chemical composition of the liquid products and the microbial mechanisms of coal conversion were investigated. Turkish Elbistan and Beypazari lignites were used in this study. The white-rot fungi received from various laboratories used in the bio-liquefaction/solubilization of the lignites were Pleurotus sajor-caju, Pleurotus sapidus, Pleurotus florida, Pleurotus ostreatus, Phanerochaete chrysosporium, and Coriolus versicolor. FT-IR spectra of raw and treated coal samples were measured, and bio-liquefied/solubilized coal samples were investigated by FT-IR and LC-MS techniques. The Coriolus versicolor fungus was determined to be most effective in bio-liquefying/solubilizing nitric acid-treated Elbistan lignite. In contrast, raw and nitric acid-treated Beypazari lignite seemed to be unaffected by the action of any kind of white-rot fungi. The liquid chromatogram of the water-soluble bio-liquefied/solubilized product contained four major peaks. Corresponding mass spectra of each peak indicated the presence of very complicated structures. 17 refs., 9 figs., 2 tabs.

  20. Biodelignification of lignocellulose substrates: An intrinsic and sustainable pretreatment strategy for clean energy production.

    Science.gov (United States)

    Chandel, Anuj K; Gonçalves, Bruna C M; Strap, Janice L; da Silva, Silvio S

    2015-01-01

    Lignocellulosic biomass (LB) is a promising sugar feedstock for biofuels and other high-value chemical commodities. The recalcitrance of LB, however, impedes carbohydrate accessibility and its conversion into commercially significant products. Two important factors for the overall economization of biofuel production is LB pretreatment to liberate fermentable sugars followed by conversion into ethanol. Sustainable biofuel production must overcome issues such as minimizing water and energy usage, reducing chemical usage and process intensification. Amongst available pretreatment methods, microorganism-mediated pretreatments are the safest, green, and sustainable. Native biodelignifying agents such as Phanerochaete chrysosporium, Pycnoporous cinnabarinus, Ceriporiopsis subvermispora and Cyathus stercoreus can remove lignin, making the remaining substrates amenable for saccharification. The development of a robust, integrated bioprocessing (IBP) approach for economic ethanol production would incorporate all essential steps including pretreatment, cellulase production, enzyme hydrolysis and fermentation of the released sugars into ethanol. IBP represents an inexpensive, environmentally friendly, low energy and low capital approach for second-generation ethanol production. This paper reviews the advancements in microbial-assisted pretreatment for the delignification of lignocellulosic substrates, system metabolic engineering for biorefineries and highlights the possibilities of process integration for sustainable and economic ethanol production.

  1. Fungal Biodegradative Oxidants in Lignocellulose: Fluorescence Mapping and Correlation With Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Hammel, Kenneth E. [Univ. of Wisconsin, Madison, WI (United States); Ralph, John [Univ. of Wisconsin, Madison, WI (United States); Hunt, Christopher G. [U.S. Forest Products Lab., Madison, WI (United States); Houtman, Carl J. [U.S. Forest Products Lab., Madison, WI (United States)

    2016-09-06

    This work focused on new methods for the detection of oxidation in natural substrates during the deconstruction of lignocellulose by microoganisms. Oxidation was the focus because all known biological systems that degrade lignin are oxidative. The detection methods involved the used of (a) micrometer-scale beads carrying a fluorescent dye that is sensitive to oxidation, (b) 13C-labeled synthetic lignins whose breakdown products can be assessed using mass spectrometry and nuclear magnetic resonance spectroscopy, and (c) a fluorometric stain that is highly sensitive to incipient oxidation during microbial attack. The results showed (a) that one white rot fungus, Phanerochaete chrysosporium, produces diffusible oxidants on wood, and that the onset of oxidation is coincident with the marked up-regulation of genes that encode ligninolytic peroxidases and auxiliary oxidative enzymes; (b) that a more selectively ligninolytic white rot fungus, Ceriporiopsis subvermispora, produces a highly diastereoselective oxidative system for attack on lignin; (c) that a brown rot fungus, Serpula lacrymans, uses extracellular hydroquinone metabolites to drive the production of lignocellulose-oxidizing free radicals; (d) that both white rot and brown rot fungi produce highly diffusible mild oxidants that modify lignocellulose at the earliest stage of substrate deconstruction; and (e) that lignin degradation in a tropical soil is not inhibited as much as expected during periods of flooding-induced hypoxia, which indicates that unknown mechanisms for attack on lignin remain to be discovered.

  2. Fungal treatment of humic-rich industrial wastewater: application of white rot fungi in remediation of food-processing wastewater.

    Science.gov (United States)

    Zahmatkesh, Mostafa; Spanjers, Henri; van Lier, Jules B

    2017-11-01

    This paper presents the results of fungal treatment of a real industrial wastewater (WW), providing insight into the main mechanisms involved and clarifying some ambiguities and uncertainties in the previous reports. In this regard, the mycoremediation potentials of four strains of white rot fungi (WRF): Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus and Pleurotus pulmonarius were tested to remove humic acids (HA) from a real humic-rich industrial treated WW of a food-processing plant. The HA removal was assessed by color measurement and size-exclusion chromatography (SEC) analysis. T. versicolor showed the best decolorization efficiency of 90% and yielded more than 45% degradation of HA, which was the highest among the tested fungal strains. The nitrogen limitation was studied and results showed that it affected the fungal extracellular laccase and manganese peroxidase (MnP) activities. The results of the SEC analysis revealed that the mechanism of HA removal by WRF involves degradation of large HA molecules to smaller molecules, conversion of HA to fulvic acid-like molecules and also biosorption of HA by fungal mycelia. The effect of HS on the growth of WRF was investigated and results showed that the inhibition or stimulation of growth differs among the fungal strains.

  3. Solid-state fermentation of rice straw residues for its use as growing medium in ornamental nurseries

    Science.gov (United States)

    Belal, Elsayed B.; El-Mahrouk, M. E.

    2010-11-01

    This work was conducted at a private nursery in Kafr El-Sheikh governorate to investigate the bioconversion of rice straw into a soil-like substrate (SLS) by Phanerochaete chrysosporium and Trichoderma hazianum and the possibility of using rice straw compost in ornamental nurseries as a partial or total replacement of coconut peat (CP) and vermiculite (V) in the growing medium. The results showed that rice straw could be treated better by aerobic fermentation. The authors used five mixtures as follows: (1) Control (CP+V at 1:1 v/v), (2) SLS (100%), (3) SLS+CP (1:1 v/v), (4) SLS+V (1:1 v/v), and (5) SLS+CP+V (1:1:1 v/v/v). Data were recorded as seedling height, no. of leaves, shoot fresh and dry weights, root length and root fresh and dry weights in order to assess the quality of both transplants of Althea rosea (hollyhock) and Calendula officinalis (scotch marigold). Hollyhock seedlings grown in medium containing a mixture of SLS+CP+V displayed quality traits similar to those recorded from the control treatment, while scotch marigold seedlings in the same medium followed the control medium in quality.

  4. Exploitation of Trametes versicolor for bioremediation of endocrine disrupting chemicals in bioreactors.

    Science.gov (United States)

    Pezzella, Cinzia; Macellaro, Gemma; Sannia, Giovanni; Raganati, Francesca; Olivieri, Giuseppe; Marzocchella, Antonio; Schlosser, Dietmar; Piscitelli, Alessandra

    2017-01-01

    Endocrine disrupting chemicals (EDCs) are environmental contaminants causing increasing concerns due to their toxicity, persistence and ubiquity. In the present study, degradative capabilities of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium to act on five EDCs, which represent different classes of chemicals (phenols, parabens and phthalate) and were first applied as single compounds, were assessed. T. versicolor was selected due to its efficiency against target EDCs and its potentialities were exploited against a mixture of EDCs in a cost-effective bioremediation process. A fed-batch approach as well as a starvation strategy were applied in order to reduce the need for input of 'fresh' biomass, and avoid the requirement for external nutrients. The fungus was successfully operated in two different bioreactors over one week. Semi-batch cultures were carried out by daily adding a mixture of EDCs to the bioreactors in a total of five consecutive degradation cycles. T. versicolor was able to efficiently remove all compounds during each cycle converting up to 21 mg L-1 day-1 of the tested EDCs. The maintained ability of T. versicolor to remove EDCs without any additional nutrients represents the main outcome of this study, which enables to forecast its application in a water treatment process.

  5. Exploitation of Trametes versicolor for bioremediation of endocrine disrupting chemicals in bioreactors.

    Directory of Open Access Journals (Sweden)

    Cinzia Pezzella

    Full Text Available Endocrine disrupting chemicals (EDCs are environmental contaminants causing increasing concerns due to their toxicity, persistence and ubiquity. In the present study, degradative capabilities of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium to act on five EDCs, which represent different classes of chemicals (phenols, parabens and phthalate and were first applied as single compounds, were assessed. T. versicolor was selected due to its efficiency against target EDCs and its potentialities were exploited against a mixture of EDCs in a cost-effective bioremediation process. A fed-batch approach as well as a starvation strategy were applied in order to reduce the need for input of 'fresh' biomass, and avoid the requirement for external nutrients. The fungus was successfully operated in two different bioreactors over one week. Semi-batch cultures were carried out by daily adding a mixture of EDCs to the bioreactors in a total of five consecutive degradation cycles. T. versicolor was able to efficiently remove all compounds during each cycle converting up to 21 mg L-1 day-1 of the tested EDCs. The maintained ability of T. versicolor to remove EDCs without any additional nutrients represents the main outcome of this study, which enables to forecast its application in a water treatment process.

  6. Widespread Polycistronic Transcripts in Fungi Revealed by Single-Molecule mRNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Sean P Gordon

    Full Text Available Genes in prokaryotic genomes are often arranged into clusters and co-transcribed into polycistronic RNAs. Isolated examples of polycistronic RNAs were also reported in some higher eukaryotes but their presence was generally considered rare. Here we developed a long-read sequencing strategy to identify polycistronic transcripts in several mushroom forming fungal species including Plicaturopsis crispa, Phanerochaete chrysosporium, Trametes versicolor, and Gloeophyllum trabeum. We found genome-wide prevalence of polycistronic transcription in these Agaricomycetes, involving up to 8% of the transcribed genes. Unlike polycistronic mRNAs in prokaryotes, these co-transcribed genes are also independently transcribed. We show that polycistronic transcription may interfere with expression of the downstream tandem gene. Further comparative genomic analysis indicates that polycistronic transcription is conserved among a wide range of mushroom forming fungi. In summary, our study revealed, for the first time, the genome prevalence of polycistronic transcription in a phylogenetic range of higher fungi. Furthermore, we systematically show that our long-read sequencing approach and combined bioinformatics pipeline is a generic powerful tool for precise characterization of complex transcriptomes that enables identification of mRNA isoforms not recovered via short-read assembly.

  7. Biomimetic solubilization of a low rank coal: implications for its use in methane production

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A.; Senko, J.; Lynd, G.; Morgan, R.; Sturm, K.; Stimpson, J.; Roe, S. [University of Northern Iowa, Cedar Falls, IA (United States). Dept. of Chemistry

    1998-07-01

    The wood-rotting fungi Trametes versicolor and Phanerochaete chrysosporium are known to be able to solubilize extensively an oxidized North Dakota lignite (leonardite). A biomimetic approach has been used to study oxalate-mediated solubilization of this low rank coal. A concentration of approximately 75 mM sodium oxalate was found to be near optimal for leonardite solubilization when the initial concentration of leonardite was 2 mg/mL. This is of importance because oxalate concentrations in liquid cultures of wood-rotting fungi are typically well below this concentration. Nevertheless, substantial leonardite solubilization was also observed at oxalate concentrations more typical of those found in these fungi. The effect of pH was also studied. It was found that oxalate-mediated leonardite solubilization increased with increasing pH and appeared to be a function of divalent oxalate ion concentration. Similar results were found for dihydrogen phosphate/hydrogen phosphate/phosphate and bicarbonate/carbonate ions. If the solubilized coal macromolecule from leonardite becomes a viable carbon source for use in anaerobic methane production, these studies suggest that chemical solubilization by common inexpensive Lewis bases would likely be more cost competitive than fungal solubilization processes. 33 refs., 9 figs.

  8. Current trends in trichloroethylene biodegradation: a review.

    Science.gov (United States)

    Shukla, Awadhesh Kumar; Upadhyay, Siddh Nath; Dubey, Suresh Kumar

    2014-06-01

    Over the past few years biodegradation of trichloroethylene (TCE) using different microorganisms has been investigated by several researchers. In this review article, an attempt has been made to present a critical summary of the recent results related to two major processes--reductive dechlorination and aerobic co-metabolism used for TCE biodegradation. It has been shown that mainly Clostridium sp. DC-1, KYT-1, Dehalobacter, Dehalococcoides, Desulfuromonas, Desulfitobacterium, Propionibacterium sp. HK-1, and Sulfurospirillum bacterial communities are responsible for the reductive dechlorination of TCE. Efficacy of bacterial communities like Nitrosomonas, Pseudomonas, Rhodococcus, and Xanthobacter sp. etc. for TCE biodegradation under aerobic conditions has also been examined. Mixed cultures of diazotrophs and methanotrophs have been used for TCE degradation in batch and continuous cultures (biofilter) under aerobic conditions. In addition, some fungi (Trametes versicolor, Phanerochaete chrysosporium ME-446) and Actinomycetes have also been used for aerobic biodegradation of TCE. The available information on kinetics of biofiltration of TCE and its degradation end-products such as CO2 are discussed along with the available results on the diversity of bacterial community obtained using molecular biological approaches. It has emerged that there is a need to use metabolic engineering and molecular biological tools more intensively to improve the robustness of TCE degrading microbial species and assess their diversity.

  9. Enzymatic hydrolysis and characterization of waste lignocellulosic biomass produced after dye bioremediation under solid state fermentation.

    Science.gov (United States)

    Waghmare, Pankajkumar R; Kadam, Avinash A; Saratale, Ganesh D; Govindwar, Sanjay P

    2014-09-01

    Sugarcane bagasse (SCB) adsorbes 60% Reactive Blue172 (RB172). Providensia staurti EbtSPG able to decolorize SCB adsorbed RB172 up to 99% under solid state fermentation (SSF). The enzymatic saccharification efficiency of waste biomass after bioremediation of RB172 process (ddSCB) has been evaluated. The cellulolyitc crude enzyme produced by Phanerochaete chrysosporium used for enzymatic hydrolysis of native SCB and ddSCB which produces 0.08 and 0.3 g/L of reducing sugars respectively after 48 h of incubation. The production of hexose and pentose sugars during hydrolysis was confirmed by HPTLC. The effect of enzymatic hydrolysis on SCB and ddSCB has been evaluated by FTIR, XRD and SEM analysis. Thus, during dye biodegradation under SSF causes biological pretreatment of SCB which significantly enhanced its enzymatic saccharification. Adsorption of dye on SCB, its bioremediation under SSF produces wastes biomass and which further utilized for enzymatic saccharification for biofuel production. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Performa Kambing yang Diberi Kulit Buah Kakao Terfermentasi

    Directory of Open Access Journals (Sweden)

    Suparjo

    2011-04-01

    Full Text Available Utilization of cocoa pod husk (CPH as feedstuff needs pretreatment to increase its nutrients availability. Bioconversion with Phanerochaete chrysosporium changes its structure by breaking down the linkage between lignin and structural carbohydrates. This experiment was aimed to evaluate the quality of fermented CPH biomass as feed for goats. The experimental treatments i.e.: A= 30% of fresh napier grass (RG + 50% of dried RG + 20% of concentrate; B= 30% of fresh RG + 30% of dried RG + 40% of concentrate; C= 30% of fresh RG + 30% of CPH + 40% of concentrate; D= 30% of fresh RG + 30% of fermented CPH + 40% of concentrate and E= 30% of fresh RG + 50% of fermented CPH + 20% of concentrate. The treatments were allocated in a randomized block design with three replications. Feed intake, body weight gain and ration efficiency were measured. The use of fermented CPH at the level of 30% had higher (P<0.05 feed intake (560.33 g day-1, body weight gain (101.79 g head-1 day-1, and feed conversion (5.50 compared to other treatments. In conclusion that the use of 30% fermented CPH in the ration showed the best body weight gain and feed efficiency.

  11. [Induction and measurement of cytochrome P450 in white rot fungi].

    Science.gov (United States)

    Ning, Da-liang; Wang, Hui; Li, Dong

    2009-08-15

    The induction and measurement of cytochrome P450 in white rot fungus Phanerochaete chrysosporium were studied in this work. The spectrophotometric results demonstrated that n-hexane was able to induce the fungal P450 to high level, which facilitated isolation and measurement of microsomal P450. The highest concentration of microsomal P450 could reach 140-160 pmol/mg after 6-h-induction by addition of 2 microL/mL hexane each hour, and the concentration of hexane and incubation time had significant effect on the induction of P450s. After effective induction, the method for isolation and measurement of microsomal P450 with CO difference spectrum was studied and the optimized method was obtained as followed. High-speed disperser and glass homogenizer were used to disrupt cells, which obtained higher amount of microsomal P450 than those from cells disrupted by glass homogenizer, ultrasonicator and bead-beater respectively. To record CO difference spectrum,the sample was bubbled with CO for 40 s at a rate of 3 mL/min (300 microL sample), and the reference cuvette was bubbled with N2 to the same extent. Then, the reducer sodium dithionite was added to a concentration 0.4 mol/L.

  12. Cellulolytic enzymes production by utilizing agricultural wastes under solid state fermentation and its application for biohydrogen production.

    Science.gov (United States)

    Saratale, Ganesh D; Kshirsagar, Siddheshwar D; Sampange, Vilas T; Saratale, Rijuta G; Oh, Sang-Eun; Govindwar, Sanjay P; Oh, Min-Kyu

    2014-12-01

    Phanerochaete chrysosporium was evaluated for cellulase and hemicellulase production using various agricultural wastes under solid state fermentation. Optimization of various environmental factors, type of substrate, and medium composition was systematically investigated to maximize the production of enzyme complex. Using grass powder as a carbon substrate, maximum activities of endoglucanase (188.66 U/gds), exoglucanase (24.22 U/gds), cellobiase (244.60 U/gds), filter paperase (FPU) (30.22 U/gds), glucoamylase (505.0 U/gds), and xylanase (427.0 U/gds) were produced under optimized conditions. The produced crude enzyme complex was employed for hydrolysis of untreated and mild acid pretreated rice husk. The maximum amount of reducing sugar released from enzyme treated rice husk was 485 mg/g of the substrate. Finally, the hydrolysates of rice husk were used for hydrogen production by Clostridium beijerinckii. The maximum cumulative H2 production and H2 yield were 237.97 mL and 2.93 mmoL H2/g of reducing sugar, (or 2.63 mmoL H2/g of cellulose), respectively. Biohydrogen production performance obtained from this work is better than most of the reported results from relevant studies. The present study revealed the cost-effective process combining cellulolytic enzymes production under solid state fermentation (SSF) and the conversion of agro-industrial residues into renewable energy resources.

  13. Xylose and cellulose fractionation from corncob with three different strategies and separate fermentation of them to bioethanol.

    Science.gov (United States)

    Chen, Yefu; Dong, Boyu; Qin, Weijun; Xiao, Dongguang

    2010-09-01

    To the aim of efficient utilization of both of xylose and cellulose, a laboratory xylose/cellulose fractionation and separate fermentation (XCFSF) bioethanol process was performed. Three xylose/cellulose fractionation strategies: (A) dilute sulfur acid hydrolysis and detoxification, (B) lime pretreatment and xylanase hydrolysis, (C) bio-treatment with Phanerochaete chrysosporium and xylanase hydrolysis were applied to corn cobs. As a result, the maximum xylose yields obtained from A, B and C fractionation methods were 78.47%, 57.84% and 42.54%, respectively, and 96.81%, 92.14% and 80.34% of cellulose were preserved in the corresponding solid residues. The xylose dissolved in acid and enzymatic hydrolysates was fermented to ethanol by Candida shahatae and the cellulose remaining in solid residues was converted to ethanol by simultaneous saccharification and fermentation (SSF) with Saccharomyces cerevisiae. Finally, for A, B, C fractionation methods, 70.40%, 52.87%, 39.22% of hemicellulose and 89.77%, 84.30%, 71.90% of cellulose in corn cobs was converted to ethanol, respectively. Copyright 2010 Elsevier Ltd. All rights reserved.

  14. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90 ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  15. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  16. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi

    Science.gov (United States)

    Dana L. Richter; Jessie A. Glaeser

    2015-01-01

    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  17. Biological pretreatment of sugarcane bagasse with basidiomycetes producing varied patterns of biodegradation.

    Science.gov (United States)

    Machado, Angela da Silva; Ferraz, André

    2017-02-01

    This work evaluated sugarcane bagasse pretreatment with wood-decay fungi, producing varied patterns of biodegradation. The overall mass balance of sugars released after pretreatment and enzymatic hydrolysis indicated that a selective white-rot was necessary to provide glucose yields similar to the ones observed from leading physico-chemical pretreatment technologies. The selective white-rot Ceriporiopsis subvermispora was selective for lignin degradation in the lignocellulosic material, preserved most of the glucan fraction, and increased the cellulose digestibility of biotreated material. Glucose mass balances indicated that of the potential glucose of untreated bagasse, 47% was recovered as sugar-rich syrup after C. subvermispora biotreatment for 60days followed by enzymatic digestion of the pretreated material. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. The multigene family of fungal laccases and their expression in the white rot basidiomycete Flammulina velutipes.

    Science.gov (United States)

    Wang, Wei; Liu, Fang; Jiang, Yuji; Wu, Guangmei; Guo, Lixian; Chen, Renliang; Chen, Bingzhi; Lu, Yuanping; Dai, Yucheng; Xie, Baogui

    2015-06-01

    Fungal laccases play important roles in matrix degradation. Eleven laccase genes, including three novel ones (designated lac1, lac2 and lac4) were identified after sequencing the entire genome of the edible, white-rot fungus Flammulina velutipes. Analysis using bioinformatics revealed that all of the laccases, except lac3, possess a signal peptide. These laccase proteins consist of 502-670 amino acids and have predicted molecular weights ranging from 55kDa to 74kDa. These proteins each contain four copper-binding sites, except for Lac10. Transcriptomes were sequenced at different developmental stages and in different fruiting body tissues to analyze if there was differential expression of laccase genes. The novel laccase gene lac4 exhibited the highest expression levels among all of the observed laccases at every developmental stage and in all fruiting body tissues examined. We conclude that laccases in F. velutipes play a role not only in lignin degradation, but also in fruiting body formation and development. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Genetic resources and mycelial characteristics of several medicinal polypore mushrooms (Polyporales, Basidiomycetes).

    Science.gov (United States)

    Badalyan, Susanna M; Shnyreva, Alla V; Iotti, Mirco; Zambonelli, Alessandra

    2015-01-01

    Mycelial characteristics of dikaryotic collections of 6 medicinal polypore mushrooms (Fomes fomentarius, Fomitopsis pinicola, Ganoderma adspersum, G. applanatum, G. lucidum, and G. resinaceum) with different geographical origins (Armenia, China, France, Iran, Italy, and Russia) were screened. A total of 42 polypore collections were molecularly identified by sequencing the internal transcribed spacer region of the ribosomal RNA genes' cluster, and a phylogenetic tree was constructed. Morphological characteristics of 37 cultures were observed on agar media (malt extract agar, potato dextrose agar) at different temperatures (25, 30, 35, and 38°C) at a pH of 6.0. Colony morphology, pigmentation of mycelium and agar, mycelial growth rate, in vitro teleomorph formation, and other macromorphological characteristics were thoroughly described and illustrated. Micromorphological features of mycelia, such as different hyphal structures, clamp cells, presence and type of asexual sporulation, chlamydospores, and others were observed. The taxonomic significance of the mycelial characteristics revealed was estimated. The obtained results will assist further biotechnological cultivation of medicinal polypore mushrooms to develop novel health care biotechnological products.

  20. Effects of Selenium Presence in Mycelia of Ganoderma species (Higher Basidiomycetes) on Their Medicinal Properties.

    Science.gov (United States)

    Milovanović, Ivan; Stajić, Mirjana; Stanojković, Tatjana; Knežević, Aleksandar; Vukojević, Jelena

    2015-01-01

    This study aimed to research the antifungal, antioxidant, and cytotoxic potential of Ganoderma applanatum and Ganoderma lucidum mycelial extracts as well as the possible effect of Se enrichment on these activities. Both Se-enriched and nonenriched extracts of G. applanatum and G. lucidum showed fungi static activity, while a fungicidal effect was not noted. The extracts exhibited significant 1,1-diphenyl-2-picryl-hydrazil radical scavenging capacity, while the effect of Se on this potential was stimulatory in G. applanatum (1.3%-33.9% without Se and 3.1%-67.1% in Se enrichment) and inhibitory in G. lucidum (1.4%-71.6% and 1.3%-48.6% without and with Se, respectively). Only phenols in G. applanatum and phenols and flavonoids in G. lucidum were holders of antioxidant activity. Cytotoxic activity against both HeLa and LS174 cell lines was very low in comparison with cis-diamminedichloroplatinum.

  1. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  2. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  3. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.

    2017-01-01

    canopy gaps in oak forests. In one of the last remaining Quercus ilex L. old-growth forests (on the island of Corsica, western Mediterranean basin), we systematically recorded and conducted molecular analyses of X. subpileatus basidiomes in 80 dated natural canopy gaps representing a 45-year long...... sequence of residence time of tree logs on the forest floor. Xylobolus subpileatus fruited exclusively on Q. ilex logs. The probability of fruiting of X. subpileatus significantly increases during the process of wood decomposition to reach its maximum in the oldest gaps, approximately 40 years after......Documenting succession in forest canopy gaps provides insights into the ecological processes governing the temporal dynamics of species within communities. We analyzed the fruiting patterns of a rare but widely distributed saproxylic macromycete, Xylobolus subpileatus, during the ageing of natural...

  4. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.

    2009-01-01

    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  5. Molecular data show that Omphalina foliacea is a lichen-forming basidiomycete

    Czech Academy of Sciences Publication Activity Database

    Palice, Zdeněk; Schmitt, I.; Lumbsch, H. T.

    2005-01-01

    Roč. 109, č. 4 (2005), s. 447-451 ISSN 0953-7562 Institutional research plan: CEZ:AV0Z60050516 Keywords : basidiolichens * molecular phylogeny * LSU DNA Subject RIV: EF - Botanics Impact factor: 1.572, year: 2005

  6. The histogenesis of Bulb and trama tissue of the higher Basidiomycetes and its phylogenetic implications

    NARCIS (Netherlands)

    Reijnders, A.F.M.

    1977-01-01

    At the base of the stipe in Agaricales basal plectenchyma is found which may enlarge to form a bulb. This tissue is not homogeneous. It is characterized by peculiar configurations: free tips of branches, sinuous hyphae, loops, spirals and rings (sometimes enclosing another hypha) and hyphal knots.

  7. Gerronema wildpretii sp. nov. (Agaricales, Basidiomycetes) a new species from the Canary Islands.

    Science.gov (United States)

    Bañares, Angel; Beltrán, Esperanza; Bon, Marcel

    2006-01-01

    Gerronema wildpretii, collected in climactic sites of the monteverde forest of the Canary Islands is described and illustrated. Its macro- and microscopic features delimit this taxon as a new species.

  8. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  9. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455 ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  10. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80 ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  11. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  12. The community structure of macroscopic basidiomycetes (Fungi in Brazilian mangroves influenced by temporal and spatial variations

    Directory of Open Access Journals (Sweden)

    Georgea Santos Nogueira-Melo

    2014-12-01

    Full Text Available Mangroves are transitional ecosystems between terrestrial and marine environments, and are distinguished by a high abundance of animals, plants, and fungi. Although macrofungi occur in different types of habitat, including mangroves, little is known about their community structure and dynamic. Therefore the aim of this study was to analyze the diversity of macrofungi in a number of Brazilian mangroves, and the relationship between such diversity, precipitation and area of collection. A total of 32 field trips were undertaken from 2009 to 2010, and macrofungi were studied in four 250×40m transects: Timbó and Santa Cruz Channel on the Northern coast, and Maracaípe and Ariquindá on the Southern coast. All basidiomata found along the transects were placed in paper bags, air-dried and identified using existing literature. It was found that Northern areas predominantly featured Avicennia schaueriana mangroves, while Rhizophora mangle dominated in Southern transects. A total of 275 specimens were collected, and 33 species, 28 genera, 14 families and six orders were represented. Overall abundance and species richness did not vary significantly among areas, but varied according to time, being higher during the rainy season. Subtle differences in composition were observed over time and between areas, probably due to variations in plant species occurrence. Further studies with collections during months of greater precipitation in transects dominated by different mangrove species of the same ecosystem are suggested to assess the overall diversity of mycobiota in these ecosystems.

  13. Basidiomycetes capability to degrade endosulfan and chlorpyrifos in a complex matrix

    OpenAIRE

    Niell, Silvina; Heinzen, Horacio; Cesio, Verónica; Rivero, Anisleidy; Pareja, Lucía; Cerdeiras, M. Pía

    2012-01-01

    Los hongos de la podredumbre blanca y marrón de la madera han demostrado presentar una alta capacidad para degradar compuestos xenobióticos. Estas propiedades están determinadas por la batería de enzimas extracelulares que pueden transformar los compuestos a CO2 y H2O. Compuestos como el endosulfán y el clorpirifós han sido considerados en Uruguay de importancia dado su uso indiscriminado en los cultivos agrícolas como la soja, cereales, frutas, entre otros. Estos compuestos son considerados ...

  14. Activities of chitinolytic enzymes during primary and secondary colonization of wood by basidiomycetous fungi.

    Science.gov (United States)

    Lindahl, Björn D; Finlay, Roger D

    2006-01-01

    The nitrogen (N) content of wood is usually suboptimal for fungal colonization. During decomposition of wood, an increasing fraction of the N becomes incorporated into fungal mycelium. Between 5 and 50% of the N in wood-degrading mycelium may be incorporated into chitin. Chitinolytic enzymes render this N available for re-utilization. Here, the activities of chitinolytic enzymes produced by wood-rotting fungi during degradation of spruce (Picea abies) wood were quantified in situ using fluorogenic 4-methylumbelliferyl substrates. A new method was developed that enables spatial quantification of enzyme activities on solid surfaces. All of the three tested fungi produced endochitinases, chitobiosidases and N-acetylhexosaminidases during colonization of wood. N-acetylhexosaminidase activity, and in some cases also chitobiosidase and endochitinase activities, were higher during secondary overgrowth of another fungus than during primary colonization of noncolonized wood. The results suggest that wood-degrading fungi degrade their own cell walls as well as the hyphae of earlier colonizers. Recycling of cell wall material within single mycelia and between fungal individuals during succession may lead to retention of N within woody debris.

  15. Evidence of natural hybridization among homothallic members of the basidiomycete Armillaria mellea

    Science.gov (United States)

    Populations of Armillaria mellea (Basidiomycota, Agaricales, Physalacriaceae) across much of its geographic range are heterothallic; homothallic populations are reported only from Africa (A. mellea ssp. africana), China [China Biological Species (CBS) G], and Japan (A. mellea ssp. nipponica). Monos...

  16. Antioxidant Properties of the Edible Basidiomycete Armillaria mellea in Submerged Cultures

    Directory of Open Access Journals (Sweden)

    Ming-Yeou Lung

    2011-09-01

    Full Text Available Antioxidant components, ascorbic acid, total flavonoids and total phenols are produced effectively by Armillaria mellea submerged cultures. Dried mycelia and mycelia-free broths obtained by A. mellea submerged cultures are extracted with methanol and hot water and investigated for antioxidant properties. Methanolic extracts from dried mycelia (MEM and mycelia-free broth (MEB and hot water extracts from dried mycelia (HWEM by A. mellea submerged cultures show good antioxidant properties as evidenced by low EC50 values (< 10 mg/mL. Total flavonoid is mainly found in hot water extracts; however, total phenol is rich in methanol and hot water extracts from mycelia. Ascorbic acid and total phenol contents are well correlated with the reducing power and the scavenging effect on superoxide anions. Total flavonoid content is dependent on the antioxidant activity and the chelating effect on ferrous ions. Total antioxidant component contents are closely related to the antioxidant activity and the scavenging superoxide anion ability. Results confirm that extracts with good antioxidant properties from fermenting products by A. mellea are potential good substitutes for synthetic antioxidants and can be applied to antioxidant-related functional food and pharmaceutical industries.

  17. Biodegradation and metabolite transformation of pyrene by basidiomycetes fungal isolate Armillaria sp. F022.

    Science.gov (United States)

    Hadibarata, Tony; Kristanti, Risky Ayu

    2013-04-01

    Armillaria sp. F022 is a white-rot fungus isolated from a tropical rain forest in Indonesia that is capable of utilizing pyrene as a source of carbon and energy. Enzymes production during the degradation process by Armillaria sp. F022 was certainly related to the increase in biomass. In the first week after incubation, the growth rate rapidly increased, but enzyme production decreased. After 7 days of incubation, rapid growth was observed, whereas, the enzymes were produced only after a good amount of biomass was generated. About 63 % of pyrene underwent biodegradation when incubated with this fungus in a liquid medium on a rotary shaker (120 rpm, 25 °C) for 30 days; during this period, pyrene was transformed to five stable metabolic products. These metabolites were extracted in ethyl acetate, isolated by column chromatography, and then identified using thin layer chromatography (TLC) and gas chromatography-mass spectrometry (GC-MS). 1-Hydroxypyrene was directly identified by GC-MS, while 4-phenanthroic acid, 1-hydroxy-2-naphthoic acid, phthalic acid, and protocatechuic acid were identified to be present in their derivatized forms (methylated forms and silylated forms). Protocatechuic acid was the end product of pyrene degradation by Armillaria sp. F022. Dynamic profiles of two key enzymes, namely laccase and 1,2-dioxygenase, were revealed during the degradation process, and the results indicated the presence of a complicated mechanism in the regulation of pyrene-degrading enzymes. In conclusion, Armillaria sp. F022 is a white-rot fungus with potential for application in the degradation of polycyclic aromatic hydrocarbons such as pyrene in the environment.

  18. Evidence of natural hybridization among homothallic members of the basidiomycete Armillaria mellea sensu stricto.

    Science.gov (United States)

    Baumgartner, Kendra; Baker, Bethany R; Korhonen, Kari; Zhao, Jun; Hughes, Karen W; Bruhn, Johann; Bowman, Tiffany S; Bergemann, Sarah E

    2012-06-01

    Populations of Armillaria mellea (Basidiomycota, Agaricales) across much of its range are heterothallic; homothallic populations occur only in Africa (A. mellea ssp. africana), China (China Biological Species CBS G), and Japan (A. mellea ssp. nipponica). Monosporous isolates of heterothallic A. mellea are haploid and their mating behaviour is consistent with the requirement of two different alleles at two mating-type loci (tetrapolar mating system) to create a diploid individual. In contrast, monosporous isolates of homothallic A. mellea are putatively diploid; they bypass the haploid phase by undergoing karyogamy in the basidium (a unique type of secondary homothallism/pseudohomothallism). In order to determine the genetic origin of this homothallism, we analyzed genetic variation of 47 heterothallic isolates from China, Europe, and North America, and 14 homothallic isolates from Africa, China, and Japan. Gene trees and mutational networks were constructed for partial mitochondrial gene ATP synthase subunit 6 (ATP6) and for the following nuclear genes: actin (ACTIN), elongation factor subunit 1-alpha (EFA), glyceraldehyde 3-phosphate dehydrogenase (GPD), and the RNA polymerase subunit II (RPB2). Homothallic isolates from Africa and Japan shared a common mitochondrial ATP6 haplotype with homothallic isolates from China, and are likely introductions. Homothallic isolates from China that shared a common mitochondrial haplotype with all European isolates did not share European nuclear haplotypes, as revealed by median-joining networks, but instead clustered with haplotypes from China or were intermediate between those of China and Europe. Such mitochondrial-nuclear discordance in homothallic isolates from China is indicative of hybridization between lineages originating from China and Europe. Copyright © 2012 British Mycological Society. All rights reserved.

  19. Antioxidant properties of the edible Basidiomycete Armillaria mellea in submerged cultures.

    Science.gov (United States)

    Lung, Ming-Yeou; Chang, Yu-Cheng

    2011-01-01

    Antioxidant components, ascorbic acid, total flavonoids and total phenols are produced effectively by Armillaria mellea submerged cultures. Dried mycelia and mycelia-free broths obtained by A. mellea submerged cultures are extracted with methanol and hot water and investigated for antioxidant properties. Methanolic extracts from dried mycelia (MEM) and mycelia-free broth (MEB) and hot water extracts from dried mycelia (HWEM) by A. mellea submerged cultures show good antioxidant properties as evidenced by low EC(50) values (<10 mg/mL). Total flavonoid is mainly found in hot water extracts; however, total phenol is rich in methanol and hot water extracts from mycelia. Ascorbic acid and total phenol contents are well correlated with the reducing power and the scavenging effect on superoxide anions. Total flavonoid content is dependent on the antioxidant activity and the chelating effect on ferrous ions. Total antioxidant component contents are closely related to the antioxidant activity and the scavenging superoxide anion ability. Results confirm that extracts with good antioxidant properties from fermenting products by A. mellea are potential good substitutes for synthetic antioxidants and can be applied to antioxidant-related functional food and pharmaceutical industries.

  20. Chemical constituents of Stereum subtomentosum and two other birch-associated basidiomycetes: An interspecies comparative study

    Czech Academy of Sciences Publication Activity Database

    Hybelbauerová, S.; Sejbal, J.; Dračínský, Martin; Hahnová, H.; Koutek, Bohumír

    2008-01-01

    Roč. 5, č. 5 (2008), s. 743-750 ISSN 1612-1872 Institutional research plan: CEZ:AV0Z40550506 Keywords : Stereum subtomentosum * Trametes versicolor * Piptoporus betulinus * steroids * saccharides Subject RIV: CC - Organic Chemistry Impact factor: 1.659, year: 2008

  1. Cryptococcus spencermartinsiae sp. nov., a basidiomycetous yeast isolated from glacial waters and apple fruits.

    Science.gov (United States)

    de García, Virginia; Brizzio, Silvia; Russo, Gabriel; Rosa, Carlos A; Boekhout, Teun; Theelen, Bart; Libkind, Diego; van Broock, María

    2010-03-01

    Seven strains representing a novel yeast species belonging to the genus Cryptococcus were isolated from different substrates from Patagonia, Argentina, and The Netherlands. Three strains were isolated from a meltwater river draining from the Frias glacier at Mount Tronador situated in Nahuel Huapi National Park (Patagonia) and four were isolated from apple surfaces in Randwijk, The Netherlands. Analysis of the D1/D2 large-subunit rRNA gene and ITS region sequences indicated that these strains represent a single species that is distinct from other species of the Tremellales clade. The name Cryptococcus spencermartinsiae sp. nov. is proposed to accommodate these strains. The type strain is CRUB 1230(T) (=CBS 10760(T) =DBVPG 8010(T)).

  2. Cryptococcus spencermartinsiae sp. nov., a basidiomycetous yeast isolated from glacial waters and apple fruits

    NARCIS (Netherlands)

    de Garcia, V.; Brizzio, S.; Russo, G.; Rosa, C.A.; Boekhout, T.; Theelen, B.J.F.; Libkind, D.; van Broock, M.

    2010-01-01

    Seven strains representing a novel yeast species belonging to the genus Cryptococcus were isolated from different substrates from Patagonia Argentina and The Netherlands. Three strains were isolates from a meltwater river draining from the Frias glacier at Mount Tronador situated in Nahuel Huapi

  3. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance

    Science.gov (United States)

    Dolores Linde; Francisco J. Ruiz-Dueñas; Elena Fernández-Fueyo; Victor Guallar; Kenneth E. Hammel; Rebecca Pogni; Angel T. Martínez

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus...

  4. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  5. Cd and Zn interactions and toxicity in ectomycorrhizal basidiomycetes in axenic culture

    Directory of Open Access Journals (Sweden)

    Vinicius H. De Oliveira

    2018-03-01

    Full Text Available Background Metal contamination in soils affects both above- and belowground communities, including soil microorganisms. Ectomycorrhizal (ECM fungi are an important component in belowground community and tolerant strains have great potential in enhancing plant-based remediation techniques. We assessed cadmium and zinc toxicity in five ECM species in liquid media (Hebeloma subsaponaceum; H. cylindrosporum; H. crustuliniforme; Scleroderma sp.; Austroboletus occidentalis and investigated the potential of Zn to alleviate Cd toxicity. Due to highly divergent results reported in the literature, liquid and solid media were compared experimentally for the first time in terms of differential toxicity thresholds in Cd and Zn interactions. Methods A wide range of Cd and Zn concentrations were applied to ectomycorrhizal fungi in axenic cultures (in mg L−1: 0; 1; 3; 9; 27; 81; 243 for the Cd treatments, and 0; 1; 30; 90; 270; 810; 2,430 for Zn. Combined Zn and Cd treatments were also applied to H. subsaponaceum and Scleroderma sp. Dry weight was recorded after 30 days, and in case of solid medium treatments, radial growth was also measured. Results and Discussion All species were adversely affected by high levels of Cd and Zn, and A. occidentalis was the most sensitive, with considerable biomass decrease at 1 mg L−1 Cd, while Scleroderma sp. and H. subsaponaceum were the most tolerant, which are species commonly found in highly contaminated sites. Cd was generally 10 times more toxic than Zn, which may explain why Zn had little impact in alleviating Cd effects. In some cases, Cd and Zn interactions led to a synergistic toxicity, depending on the concentrations applied and type of media used. Increased tolerance patterns were detected in fungi grown in solid medium and may be the cause of divergent toxicity thresholds found in the literature. Furthermore, solid medium allows measuring radial growth/mycelial density as endpoints which are informative and in this case appeared be related to the high tolerance indices found in H. subsaponaceum.

  6. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes).

    Science.gov (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik

    2009-09-01

    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  7. Copper sorption by native and modified pellets of wood-rotting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Baldrian, Petr; Hladíková, K.; Háková, M.

    2001-01-01

    Roč. 32, - (2001), s. 194-198 ISSN 0266-8254 R&D Projects: GA ČR GA204/99/1528 Institutional research plan: CEZ:A53/98:Z5-020-9ii Subject RIV: EE - Microbiology , Virology Impact factor: 1.151, year: 2001

  8. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    .0°N latitude, 72.0° to 73.0°E longitude) off the west coast of India in the Arabian Sea. Within 2 h after collection, discs (0.5-cm diameter) cut from the sea grass leaves were surface sterilized in 0.5% sodium hypochlorite for 3 min (42), washed... components of low-nitrogen (LN) medium (13), 1.5 g of Instant Ocean (IO) salts (24) (Instant Ocean of Aquarium System, Mentor, Ohio),2gofBacto Agar (Difco), 0.02% Poly-R, 10,000 U of sodium benzylpenicillin, and 0.05 g of streptomycin sulfate. One of the Poly...

  9. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  10. Evaluation of Anticholinesterase and Inflammation Inhibitory Activity of Medicinal Mushroom Phellinus pini (Basidiomycetes) Fruiting Bodies.

    Science.gov (United States)

    Im, Kyung Hoan; Nguyen, Trung Kien; Kim, Jae Kwang; Choi, Jae-Hyuk; Lee, Tae Soo

    2016-01-01

    Phellinus pini, a medicinal mushroom, has been used as folk medicine in Asian countries for treating ailments such as cancer and gastrointestinal diseases. In this study we evaluated in vitro the antidementia and anti-inflammatory activities of Ph. Pini fruiting bodies. Eleven phenol compounds were detected by high-performance liquid chromatography analysis. Acetylcholinesterase and butyrylcholinesterase inhibitory effects of a methanol extract and a hot water extract were moderate and comparable with those of galanthamine, the standard drug used to treat the early stages of Alzheimer's disease. The methanol extract had a neuroprotective effect against glutamate-induced cytotoxicity on PC-12 cells at concentration ranging from 20 to 40 µg/mL. The mushroom extracts also inhibited the production of nitric oxide and the expression of inducible nitric oxide synthase in lipopolysaccharide-induced RAW 264.7 macrophages, and they significantly inhibited in vivo carrageenan-induced hind-paw edema in rats. Therefore, it is suggested that Ph. Pini fruiting bodies possess anticholinesterase and anti-inflammatory effects.

  11. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products.

    Science.gov (United States)

    Uhnáková, Bronislava; Ludwig, Roland; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, Daniela; Křen, Vladimír; Haltrich, Dietmar; Martínková, Ludmila

    2011-10-01

    Tetrabromobisphenol A (TBBPA) degradation was investigated using white rot fungi and their oxidative enzymes. Strains of the Trametes, Pleurotus, Bjerkandera and Dichomitus genera eliminated almost 1 mM TBBPA within 4 days. Laccase, whose role in TBBPA degradation was demonstrated in fungal cultures, was applied to TBBPA degradation alone and in combination with cellobiose dehydrogenase from Sclerotium rolfsii. Purified laccase from Trametes versicolor degraded approximately 2 mM TBBPA within 5 h, while the addition of cellobiose dehydrogenase increased the degradation rate to almost 2.5 mM within 3 h. Laccase was used to prepare TBBPA metabolites 2,6-dibromo-4-(2-hydroxypropane-2-yl) phenol (1), 2,6-dibromo-4-(2-methoxypropane-2-yl) phenol (2) and 1-(3,5-dibromo-4-hydroxyphen-1-yl)-2,2',6,6'-tetrabromo-4,4'-isopropylidene diphenol (3). As compounds 1 and 3 were identical to the TBBPA metabolites prepared by using rat and human liver fractions (Zalko et al., 2006), laccase can provide a simple means of preparing these metabolites for toxicity studies. Products 1 and 2 exhibited estrogenic effects, unlike TBBPA, but lower cell toxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Decomposition, nitrogen and phosphorus mineralization from beech leaf litter colonized with ectomycorrhizal or litter decomposing basidiomycetes

    OpenAIRE

    COLPAERT, Jan; VAN TICHELEN, Katia

    1996-01-01

    The decomposition and the nitrogen and phosphorus mineralization of fresh beech (Fagus sylvatica L.) leaf litter are described. Leaves were buried for up to 6 months in plant containers in which Scots pine (Pinus sylvestris L.) seedlings were cultivated at a low rate of nutrient addition. The saprotrophic abilities of three ectomycorrhizal fungi, Thelephora terrestris Ehrh.: Fr., Suillus bovinus (L.: Fr.) O. Kuntze and Paxillus involutes (Batsch: Fr) Fr., were compared with the degradation ca...

  13. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415 ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  15. Effects of tertiary treatment by fungi on organic compounds in a kraft pulp mill effluent.

    Science.gov (United States)

    Rocha-Santos, Teresa; Ferreira, Filipe; Silva, Lurdes; Freitas, Ana Cristina; Pereira, Ruth; Diniz, Mário; Castro, Luísa; Peres, Isabel; Duarte, Armando Costa

    2010-05-01

    Pulp and paper mills generate a plethora of pollutants depending upon the type of pulping process. Efforts to mitigate the environmental impact of such effluents have been made by developing more effective biological treatment systems in terms of biochemical oxygen demand, chemical oxygen demand, colour and lignin content. This study is the first that reports an evaluation of the effects of a tertiary treatment by fungi (Pleurotus sajor caju, Trametes versicolor and Phanerochaete chrysosporium and Rhizopus oryzae) on individual organic compounds of a Eucalyptus globulus bleached kraft pulp and paper mill final effluent after secondary treatment (final effluent). The tertiary treatment with P. sajor caju, T. versicolor and P. chrysosporium and R. oryzae was performed in batch reactors, which were inoculated with separate fungi species and monitored throughout the incubation period. Samples from effluent after secondary and after tertiary treatment with fungi were analysed for both absorbance and organic compounds. The samples were extracted for organic compounds using solid-phase extraction (SPE) and analysed by gas chromatography-mass spectrometry (GC/MS). The efficiencies of the SPE procedure was evaluated by recovery tests. A total of 38 compounds (carboxylic acids, fatty alcohols, phenolic compounds and sterols) were identified and quantified in the E. globulus bleached kraft pulp mill final effluent after secondary treatment. Recoveries from the extraction procedure were between 98.2% and 99.9%. The four fungi species showed an adequate capacity to remove organic compounds and colour. Tertiary treatment with R. oryzae was able to remove 99% of organic compounds and to reduce absorbance on 47% (270 nm) and 74% (465 nm). P. sajor caju, T. versicolor and P. chrysosporium were able to remove 97%, 92% and 99% of organic compounds, respectively, and reduce 18% (270 nm) to 77% (465 nm), 39% (270 nm) to 58% (465 nm) and 31% (270 nm) to 10% (465 nm) of absorbance

  16. Decomposição fúngica de ácido tânico e outros compostos em efluente agroindustrial = Fungic decomposition of tannic acid and other compounds from agri-industrial effluent

    Directory of Open Access Journals (Sweden)

    Natalino Perovano Filho

    2011-04-01

    production of enzymes that degrade tannic acid, such as laccase, while Mucor sp. was better to remove the Chemical Oxygen Demand (COD and the total phenol content, followed by Cladosporium sp., Phanerochaete chrysosporium and Geotrichum candidum.

  17. Effects of pH and Temperature on Recombinant Manganese Peroxidase Production and Stability

    Science.gov (United States)

    Jiang, Fei; Kongsaeree, Puapong; Schilke, Karl; Lajoie, Curtis; Kelly, Christine

    The enzyme manganese peroxidase (MnP) is produced by numerous white-rot fungi to overcome biomass recalcitrance caused by lignin. MnP acts directly on lignin and increases access of the woody structure to synergistic wood-degrading enzymes such as cellulases and xylanases. Recombinant MnP (rMnP) can be produced in the yeast Pichia pastoris αMnP1-1 in fed-batch fermentations. The effects of pH and temperature on recombinant manganese peroxidase (rMnP) production by P. pastoris αMnP1-1 were investigated in shake flask and fed-batch fermentations. The optimum pH and temperature for a standardized fed-batch fermentation process for rMnP production in P. pastoris ctMnP1-1 were determined to be pH 6 and 30 °C, respectively. P. pastoris αMnP1-1 constitutively expresses the manganese peroxidase (mnp1) complementary DNA from Phanerochaete chrysosporium, and the rMnP has similar kinetic characteristics and pH activity and stability ranges as the wild-type MnP (wtMnP). Cultivation of P. chrysosporium mycelia in stationary flasks for production of heme peroxidases is commonly conducted at low pH (pH 4.2). However, shake flask and fed-batch fermentation experiments with P. pastoris αMnP1-1 demonstrated that rMnP production is highest at pH 6, with rMnP concentrations in the medium declining rapidly at pH less than 5.5, although cell growth rates were similar from pH 4-7. Investigations of the cause of low rMnP production at low pH were consistent with the hypothesis that intracellular proteases are released from dead and lysed yeast cells during the fermentation that are active against rMnP at pH less than 5.5.

  18. CHARACTERIZATION OF THE OXIDATIVE ENZYME POTENTIAL IN WILD WHITE ROT FUNGI FROM MISIONES (ARGENTINA

    Directory of Open Access Journals (Sweden)

    Maria Isabel FONSECA

    2015-01-01

    Full Text Available This research aimed to evaluate the potential of several native white rot fungi (WRF isolated from subtropical environments of Misiones (Argentina to produce different ligninolytic enzymes. Coriolus versicolor f. antarcticus BAFC 266, Pycnoporus sanguineus BAFC 2126 and Phlebia brevispora BAFC 633 showed the highest phenoloxidase activity. Ganoderma applanatum strain E, P. sanguineus BAFC 2126 and P. brevispora BAFC 633 revealed marked laccase and peroxidase activity. C. versicolor f. antarcticus, G. applanatum (strain A and Trametes villosa, gave high positive reactions with 2,6-dimethoxyphenol oxidation at the lowest tested pH. C. versicolor f. antarcticus, G. applanatum strains D and F, T. elegans BAFC 2127and T. villosa, showed the highest manganese peroxidase activity. C. versicolor f. antarcticus also produced the highest lignin peroxidase activity. Tyrosinase activity was mostly evident in G. applanatum strains (D and F and Phanerochaete chrysosporium HHB 11741. Kraft liquor decolorization results were variable and depended on the fungus and the liquor concentration. Some fungi with moderate ligninolytic activity showed high decolorization rates (e.g. Pleurotus sajor-caju and Steccherinium sp. BAFC 1171 indicating the significance of additional approach to evaluate a potential biotechnological application.  Caracterización del potencial enzimático oxidativo de cepas nativas de hongos de pudrición blanca de la selva subtropical de Misiones (Argentina El objetivo de este trabajo fue evaluar el potencial para producir enzimas ligninolíticas de diversas cepas de hongos de pudrición blanca, nativas de la Provincia de Misiones (Argentina. Coriolus versicolor v. antarcticus BAFC 266, Pycnoporus sanguineus BAFC 2126 y Phlebia brevispora BAFC 633 mostraron un gran potencial para producir fenoloxidasas. En Ganoderma applanatum cepa E, P. sanguineus BAFC 2126  y P. brevispora BAFC 633 se observó una marcada actividad lacasa y peroxidasa. C

  19. ISOLASI DAN KARAKTERISASI JAMUR PENDEGRADASI ZAT PEWARNA TEKSTIL (Isolation and Characterization of dye-degrading Fungi

    Directory of Open Access Journals (Sweden)

    Erni Martani

    2011-07-01

    Full Text Available ABSTRAK Industri tekstil tidak saja menghasilkan sandang yang merupakan kebutuhan primer manusia, tetapi juga mengeluarkan limbah yang berpotensi sebagai penyebab pencemaran lingkungan. Komponen utama limbah industri ini adalah berbagai jenis zat pewarna tekstil. Penelitian ini bertujuan untuk memperoleh isolat-isolat jamur yang mampu mendegradasi beberapa jenis zat pewarna tekstil. Isolasi dilakukan menggunakan metode surface plating di atas medium Potato Dextrose Agar, dan seleksi kemampuan degradasi pewarna berdasarkan atas toleransi terhadap konsentrasi zat pewarna, serta besar dan kecepatan dekolorisasi beberapa jenis zat pewarna. Sebagai parameter awal digunakan enam zat pewarna tekstil. Isolat-isolat unggul kemudian diidentifikasi awal berdasar atas morfologi mikroskopis terhadap miseliumnya. Dalam penelitian ini juga digunakan beberapa kultur murni jamur pembusuk putih sebagai pembanding. Dalam penelitian ini digunakan limbah cair dan padat beberapa industri tekstil dan industri pulp & paper, tanah gambut dari Kalimantan Tengah dan Riau, tanah sekitar Tempat Pembuangan Sampah Akhir, serta tanah seresah hutan. Dari berbagai sumber tersebut diperoleh 101 isolat jamur. Uji dekolorisasi kualitatif terhadap 6 zat pewarna menghasilkan 6 isolat unggul yang mampu mendekolorisasi lebih dari tiga jenis pewarna dengan kecepatan relatif tinggi. Masing-masing isolat unggul memiliki spesifikasi dalam daya dekolorisasi terhadap ke 6 jenis pewarna. Identifikasi awal terhadap isolat unggul menunjukkan bahwa mereka berasal dari genus Aspergillus, Cladosporium, Penicillium dan Stachybotrys. Sedangkan uji terhadap kultur jamur pembusuk putih sebagai pembanding menghasilkan 2 kultur unggul, yaitu: Phanerochaete chrysosporium dan Pleurotus ostreatus. Secara umum kemampuan dekolorisasi isolat-isolat jamur kebanyakan masih di bawah kemampuan kedua kultur murni tersebut, namun beberapa isolat justru memiliki kemampuan lebih tinggi dibandingkan kultur pembanding

  20. Microbial liquefaction of peat for the production of synthetic fuels

    Energy Technology Data Exchange (ETDEWEB)

    Gunasekaran, M.

    1988-01-01

    Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungi were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.

  1. Comparative Analysis of Secretome Profiles of Manganese(II)-Oxidizing Ascomycete Fungi.

    Science.gov (United States)

    Zeiner, Carolyn A; Purvine, Samuel O; Zink, Erika M; Paša-Tolić, Ljiljana; Chaput, Dominique L; Haridas, Sajeet; Wu, Si; LaButti, Kurt; Grigoriev, Igor V; Henrissat, Bernard; Santelli, Cara M; Hansel, Colleen M

    2016-01-01

    Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II)-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a). We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.

  2. Extracellular oxidative metabolism of wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Daniel Cullen

    2010-04-21

    Substantial progress has been made toward understanding the fundamental physiology and genetics of wood decay fungi, microbes that are capable of degrading all major components of plant cell walls. Efficient utilization of lignocellulosic biomass has been hampered in part by limitations in our understanding of enzymatic mechanisms of plant cell wall degradation. This is particularly true of woody substrates where accessibility and high lignin content substantially complicate enzymatic 'deconstruction'. The interdisciplinary research has illuminated enzymatic mechanisms essential for the conversion of lignocellulosics to simple carbohydrates and other small molecular weight products. Progress was in large part dependent on substantial collaborations with the Department of Energy's Joint Genome Institute (JGI) in Walnut Creek and Los Alamos, as well as the Catholic University, Santiago, Chile, the Royal Institute of Technology, Stockholm, the University of Minnesota, St. Paul, and colleagues at the University of Wisconsin and the Forest Products Laboratory. Early accomplishments focused on the development of experimental tools (2, 7, 22, 24-26, 32) and characterization of individual genes and enzymes (1, 3-5, 8, 9, 11, 14, 15, 17, 18, 23, 27, 33). In 2004, the genome of the most intensively studied lignin-degrading fungus, Phanerochaete chrysosporium, was published (21). This milestone lead to additional progress on this important model system (6, 10, 12, 13, 16, 28-31) and was further complemented by genome analysis of other important cellulose-degrading fungi (19, 20). These accomplishments have been highly cited and have paved the way for whole new research areas.

  3. Systematic screening of glycosylation- and trafficking-associated gene knockouts in Saccharomyces cerevisiae identifies mutants with improved heterologous exocellulase activity and host secretion.

    Science.gov (United States)

    Wang, Tzi-Yuan; Huang, Chih-Jen; Chen, Hsin-Liang; Ho, Po-Chun; Ke, Huei-Mien; Cho, Hsing-Yi; Ruan, Sz-Kai; Hung, Kuo-Yen; Wang, I-Li; Cai, Ya-Wun; Sung, Huang-Mo; Li, Wen-Hsiung; Shih, Ming-Che

    2013-09-03

    As a strong fermentator, Saccharomyces cerevisiae has the potential to be an excellent host for ethanol production by consolidated bioprocessing. For this purpose, it is necessary to transform cellulose genes into the yeast genome because it contains no cellulose genes. However, heterologous protein expression in S. cerevisiae often suffers from hyper-glycosylation and/or poor secretion. Thus, there is a need to genetically engineer the yeast to reduce its glycosylation strength and to increase its secretion ability. Saccharomyces cerevisiae gene-knockout strains were screened for improved extracellular activity of a recombinant exocellulase (PCX) from the cellulose digesting fungus Phanerochaete chrysosporium. Knockout mutants of 47 glycosylation-related genes and 10 protein-trafficking-related genes were transformed with a PCX expression construct and screened for extracellular cellulase activity. Twelve of the screened mutants were found to have a more than 2-fold increase in extracellular PCX activity in comparison with the wild type. The extracellular PCX activities in the glycosylation-related mnn10 and pmt5 null mutants were, respectively, 6 and 4 times higher than that of the wild type; and the extracellular PCX activities in 9 protein-trafficking-related mutants, especially in the chc1, clc1 and vps21 null mutants, were at least 1.5 times higher than the parental strains. Site-directed mutagenesis studies further revealed that the degree of N-glycosylation also plays an important role in heterologous cellulase activity in S. cerevisiae. Systematic screening of knockout mutants of glycosylation- and protein trafficking-associated genes in S. cerevisiae revealed that: (1) blocking Golgi-to-endosome transport may force S. cerevisiae to export cellulases; and (2) both over- and under-glycosylation may alter the enzyme activity of cellulases. This systematic gene-knockout screening approach may serve as a convenient means for increasing the extracellular

  4. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, T.P.S., E-mail: pgalindo@ua.pt [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Pereira, R. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto (Portugal); Freitas, A.C.; Santos-Rocha, T.A.P. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Rasteiro, M.G.; Antunes, F. [Department of Chemical Engineering, University of Coimbra, 3030-290 Coimbra (Portugal); Rodrigues, D. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Soares, A.M.V.M.; Gonçalves, F. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); and others

    2013-08-01

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP.

  5. Genome, transcriptome, and secretome analysis of wood decay fungus postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego [Los Alamos National Laboratory; Challacombe, Jean F [Los Alamos National Laboratory; Misra, Monica [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Brettin, Thomas [Los Alamos National Laboratory; Morgenstern, Ingo [CLARK UNIV; Hibbett, David [CLARK UNIV.; Schmoll, Monika [UNIV WIEN; Kubicek, Christian P [UNIV WIEN; Ferreira, Patricia [CIB, CSIC, MADRID; Ruiz - Duenase, Francisco J [CIB, CSIC, MADRID; Martinez, Angel T [CIB, CSIC, MADRID; Kersten, Phil [FOREST PRODUCTS LAB; Hammel, Kenneth E [FOREST PRODUCTS LAB; Vanden Wymelenberg, Amber [U. WISCONSIN; Gaskell, Jill [FOREST PRODUCTS LAB; Lindquist, Erika [DOE JGI; Sabati, Grzegorz [U. WISCONSIN; Bondurant, Sandra S [U. WISCONSIN; Larrondo, Luis F [U. CATHOLICA DE CHILE; Canessa, Paulo [U. CATHOLICA DE CHILE; Vicunna, Rafael [U. CATHOLICA DE CHILE; Yadavk, Jagiit [U. CINCINATTI; Doddapaneni, Harshavardhan [U. CINCINATTI; Subramaniank, Venkataramanan [U. CINCINATTI; Pisabarro, Antonio G [PUBLIC U. NAVARRE; Lavin, Jose L [PUBLIC U. NAVARRE; Oguiza, Jose A [PUBLIC U. NAVARRE; Master, Emma [U. TORONTO; Henrissat, Bernard [CNRS, MARSEILLE; Coutinho, Pedro M [CNRS, MARSEILLE; Harris, Paul [NOVOZYMES, INC.; Magnuson, Jon K [PNNL; Baker, Scott [PNNL; Bruno, Kenneth [PNNL; Kenealy, William [MASCOMA, INC.; Hoegger, Patrik J [GEORG-AUGUST-U.; Kues, Ursula [GEORG-AUGUST-U; Ramaiva, Preethi [NOVOZYMES, INC.; Lucas, Susan [DOE JGI; Salamov, Asaf [DOE JGI; Shapiro, Harris [DOE JGI; Tuh, Hank [DOE JGI; Chee, Christine L [UNM; Teter, Sarah [NOVOZYMES, INC.; Yaver, Debbie [NOVOZYMES, INC.; James, Tim [MCMASTER U.; Mokrejs, Martin [CHARLES U.; Pospisek, Martin [CHARLES U.; Grigoriev, Igor [DOE JGI; Rokhsar, Dan [DOE JGI; Berka, Randy [NOVOZYMES; Cullen, Dan [FOREST PRODUCTS LAB

    2008-01-01

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative {beta}-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC{center_dot}MSIMS). Also upregulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H202. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H202 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons to the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost.

  6. SCHEMA recombination of a fungal cellulase uncovers a single mutation that contributes markedly to stability.

    Science.gov (United States)

    Heinzelman, Pete; Snow, Christopher D; Smith, Matthew A; Yu, Xinlin; Kannan, Arvind; Boulware, Kevin; Villalobos, Alan; Govindarajan, Sridhar; Minshull, Jeremy; Arnold, Frances H

    2009-09-25

    A quantitative linear model accurately (R(2) = 0.88) describes the thermostabilities of 54 characterized members of a family of fungal cellobiohydrolase class II (CBH II) cellulase chimeras made by SCHEMA recombination of three fungal enzymes, demonstrating that the contributions of SCHEMA sequence blocks to stability are predominantly additive. Thirty-one of 31 predicted thermostable CBH II chimeras have thermal inactivation temperatures higher than the most thermostable parent CBH II, from Humicola insolens, and the model predicts that hundreds more CBH II chimeras share this superior thermostability. Eight of eight thermostable chimeras assayed hydrolyze the solid cellulosic substrate Avicel at temperatures at least 5 degrees C above the most stable parent, and seven of these showed superior activity in 16-h Avicel hydrolysis assays. The sequence-stability model identified a single block of sequence that adds 8.5 degrees C to chimera thermostability. Mutating individual residues in this block identified the C313S substitution as responsible for the entire thermostabilizing effect. Introducing this mutation into the two recombination parent CBH IIs not featuring it (Hypocrea jecorina and H. insolens) decreased inactivation, increased maximum Avicel hydrolysis temperature, and improved long time hydrolysis performance. This mutation also stabilized and improved Avicel hydrolysis by Phanerochaete chrysosporium CBH II, which is only 55-56% identical to recombination parent CBH IIs. Furthermore, the C313S mutation increased total H. jecorina CBH II activity secreted by the Saccharomyces cerevisiae expression host more than 10-fold. Our results show that SCHEMA structure-guided recombination enables quantitative prediction of cellulase chimera thermostability and efficient identification of stabilizing mutations.

  7. Perspectives on the use of transcriptomics to advance biofuels

    Directory of Open Access Journals (Sweden)

    Siseon Lee

    2015-11-01

    Full Text Available As a field within the energy research sector, bioenergy is continuously expanding. Although much has been achieved and the yields of both ethanol and butanol have been improved, many avenues of research to further increase these yields still remain. This review covers current research related with transcriptomics and the application of this high-throughput analytical tool to engineer both microbes and plants with the penultimate goal being better biofuel production and yields. The initial focus is given to the responses of fermentative microbes during the fermentative production of acids, such as butyric acid, and solvents, including ethanol and butanol. As plants offer the greatest natural renewable source of fermentable sugars within the form of lignocellulose, the second focus area is the transcriptional responses of microbes when exposed to plant hydrolysates and lignin-related compounds. This is of particular importance as the acid/base hydrolysis methods commonly employed to make the plant-based cellulose available for enzymatic hydrolysis to sugars also generates significant amounts of lignin-derivatives that are inhibitory to fermentative bacteria and microbes. The article then transitions to transcriptional analyses of lignin-degrading organisms, such as Phanerochaete chrysosporium, as an alternative to acid/base hydrolysis. The final portion of this article will discuss recent transcriptome analyses of plants and, in particular, the genes involved in lignin production. The rationale behind these studies is to eventually reduce the lignin content present within these plants and, consequently, the amount of inhibitors generated during the acid/base hydrolysis of the lignocelluloses. All four of these topics represent key areas where transcriptomic research is currently being conducted to identify microbial genes and their responses to products and inhibitors as well as those related with lignin degradation/formation.

  8. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    International Nuclear Information System (INIS)

    Galindo, T.P.S.; Pereira, R.; Freitas, A.C.; Santos-Rocha, T.A.P.; Rasteiro, M.G.; Antunes, F.; Rodrigues, D.; Soares, A.M.V.M.; Gonçalves, F.

    2013-01-01

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP

  9. Evaluation of lignin-based black liquor decolorization by Trametes versicolor U 80

    Science.gov (United States)

    Amriani, Feni; Sari, Ajeng Arum; R. Irni Fitria, A.; Abimanyu, Haznan; Tachibana, Sanro

    2017-01-01

    Bioethanol second generation (G-2) production process generated black liquor that need to treat before the disposal to prevent environmental pollution. Usually, coagulation technology using polyaluminium chloride was employed to precipitate dissolved lignin and intended to decolorize black liquor. However, this single work is not effective to treat black liquor, so that it requires another work to treat remain brownish liquor. Isolated fungal strain from Japan Trametes versicolor U 80 and Phanerochaete chrysosporium are white rot fungi that are known in ligninolytic enzymes secretion to biodegrade soluble lignin. Decolorization of black and brownish liquor is an indicator of fungi works since lignin is known as the colour agent in liquor colouration. This work evaluated black and brownish liquor decolorization using both fungi that correspond to fungal growth. Liquor toxicity was observed based on mycelial dry weight after 30 days incubation as the presumption of the connection of fungal growth and decolorization. The biosorption from the dead cell was also evaluated for fungal adsorption capability in black and brownish decolorization. As the result, T. versicolor U 80 was able to decolorize brownish liquor 51.5% after 21 days incubation and 68.6% black liquor at 15 days incubation. MnP and Laccase enzymes activity in 15 and 21 days are correlated to those decolorized results. The dead cell was also able to decolorize 67.3% brownish liquor and 25.1% black liquor after 15 days incubation as biosorption mechanism. This research described fungal potential in decolorization as the simple black liquor treatment technology and gave valuable information related to environmental friendly decolorization process.

  10. Disruption of seven hypothetical aryl alcohol dehydrogenase genes from Saccharomyces cerevisiae and construction of a multiple knock-out strain.

    Science.gov (United States)

    Delneri, D; Gardner, D C; Bruschi, C V; Oliver, S G

    1999-11-01

    By in silicio analysis, we have discovered that there are seven open reading frames (ORFs) in Saccharomyces cerevisiae whose protein products show a high degree of amino acid sequence similarity to the aryl alcohol dehydrogenase (AAD) of the lignin-degrading fungus Phanerochaete chrysosporium. Yeast cultures grown to stationary phase display a significant aryl alcohol dehydrogenase activity by degrading aromatic aldehydes to the corresponding alcohols. To study the biochemical and the biological role of each of the AAD genes, a series of mutant strains carrying deletion of one or more of the AAD-coding sequences was constructed by PCR-mediated gene replacement, using the readily selectable marker kanMX. The correct targeting of the PCR-generated disruption cassette into the genomic locus was verified by analytical PCR and by pulse-field gel electrophoresis (PFGE) followed by Southern blot analysis. Double, triple and quadruple mutant strains were obtained by classical genetic methods, while the construction of the quintuple, sextuple and septuple mutants was achieved by using the marker URA3 from Kluyveromyces lactis, HIS3 from Schizosaccharomyces pombe and TRP1 from S. cerevisiae. None of the knock-out strains revealed any mutant phenotype when tested for the degradation of aromatic aldehydes using both spectrophotometry and high performance liquid chromatography (HPLC). Specific tests for changes in the ergosterol and phospholipids profiles did not reveal any mutant phenotype and mating and sporulation efficiencies were not affected in the septuple deletant. Compared to the wild-type strain, the septuple deletant showed an increased resistance to the anisaldehyde, but there is a possibility that the nutritional markers used for gene replacement are causing this effect. Copyright 1999 John Wiley & Sons, Ltd.

  11. Comparative Analysis of Secretome Profiles of Manganese(II-Oxidizing Ascomycete Fungi.

    Directory of Open Access Journals (Sweden)

    Carolyn A Zeiner

    Full Text Available Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a. We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.

  12. Comparative Analysis of Secretome Profiles of Manganese(II)-Oxidizing Ascomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Zeiner, Carolyn A.; Purvine, Samuel O.; Zink, Erika M.; Paša-Tolić, Ljiljana; Chaput, Dominique L.; Haridas, Sajeet; Wu, Si; LaButti, Kurt; Grigoriev, Igor V.; Henrissat, Bernard; Santelli, Cara M.; Hansel, Colleen M.; Pöggeler, Stefanie

    2016-07-19

    Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II)-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a). We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.

  13. Ethanol production from lignocellulosic materials. Fermentation and on-line analysis

    Energy Technology Data Exchange (ETDEWEB)

    Olsson, L.

    1994-04-01

    The fermentation performance of bacteria, yeast and fungi was investigated in lignocellulosic hydrolysates with the aim of finding microorganisms which both withstand the inhibitors and that have the ability to ferment pentoses. Firstly, the performance of Saccharomyces cidri, Saccharomyces cerevisiae, Lactobacillus brevis, Lactococcus lactis ssp lactis, Escherichia coli and Zymomonas mobilis was investigated in spent sulphite liquor and enzymatic hydrolysate of steam-pretreated willow. Secondly, the performance of natural and recombinant E. coli, Pichia stipitis, recombinant S. cerevisiae, S. cerevisiae in combination with xylose isomerase and Fusarium oxysporum was investigated in a xylose-rich acid hydrolysate of corn cob. Recombinant E. coli was the best alternative for fermentation of lignocellulosic hydrolysates, giving both high yields and productivities. The main drawback was that detoxification was necessary. The kinetics of the fermentation with recombinant E. coli KO11 was investigated in the condensate of steam-pretreated willow. A cost analysis of the ethanol production from willow was made, which predicted an ethanol production cost of 3.9 SEK/l for the pentose fermentation. The detoxification cost constituted 22% of this cost. The monitoring of three monosaccharides and ethanol in lignocellulosic hydro lysates is described. The monosaccharides were determined using immobilized pyranose oxidase in an on-line amperometric analyser. Immobilization and characterization of pyranose oxidase from Phanerochaete chrysosporium is also described. The ethanol was monitored on-line using a micro dialysis probe as an in situ sampling device. The dialysate components were then separated in a column liquid chromatographic system and the ethanol was selectively detected by an amperometric alcohol bio sensor. The determinations with on-line analysis methods agreed well with off-line methods. 248 refs, 4 figs, 12 tabs

  14. Bio-ethanol production from waste biomass of Pogonatherum crinitum phytoremediator: an eco-friendly strategy for renewable energy.

    Science.gov (United States)

    Waghmare, Pankajkumar R; Watharkar, Anuprita D; Jeon, Byong-Hun; Govindwar, Sanjay P

    2018-03-01

    In this study, we have described three steps to produce ethanol from Pogonatherum crinitum , which was derived after the treatment of textile wastewater. (a) Production of biomass: biomass samples collected from a hydroponic P. crinitum phytoreactor treating dye textile effluents and augmented with Ca-alginate immobilized growth-promoting bacterium, Bacillus pumilus strain PgJ (consortium phytoreactor), and waste sorghum husks were collected and dried. Compositional analysis of biomass (consortium phytoreactor) showed that the concentration of cellulose, hemicelluloses and lignin was 42, 30 and 17%, respectively, whereas the biomass samples without the growth-promoting bacterium (normal phytoreactor) was slightly lower, 40, 29 and 16%, respectively. (b) Hydrolysate (sugar) production: a crude sample of the fungus, Phanerochaete chrysosporium containing hydrolytic enzymes such as endoglucanase (53.25 U/ml), exoglucanase (8.38 U/ml), glucoamylase (115.04 U/ml), xylanase (83.88 U/ml), LiP (0.972 U/ml) and MnP (0.459 U/ml) was obtained, and added to consortium, normal and control phytoreactor derived biomass supplemented with Tween-20 (0.2% v/v). The hydrolysate of biomass from consortium phytoreactor produced maximum reducing sugar (0.93 g/l) than hydrolysates of normal phytoreactor biomass (0.82 g/l) and control phytoreactor biomass (0.79 g/l). FTIR and XRD analysis confirmed structural changes in treated biomass. (c) Ethanol production: the bioethanol produced from enzymatic hydrolysates of waste biomass of consortium and normal phytoreactor using Saccharomyces cerevisiae (KCTC 7296) was 42.2 and 39.4 g/l, respectively, while control phytoreactor biomass hydrolysate showed only 25.5 g/l. Thus, the amalgamation of phytoremediation and bioethanol production can be the truly environment-friendly way to eliminate the problem of textile dye along with bioenergy generation.

  15. Irradiation of Liquid Fungi Isolated Media from Contaminated Sources with Heavy Metals Additive

    International Nuclear Information System (INIS)

    Tawfiq, E.; Mohamed, A.A.; El-Kabbany, H.M.

    2012-01-01

    Occupational lead exposure is an important health issue in Egyptian workers, employees of paint factories, workers of copying centres, drivers, and tile making factories are in higher risk of lead toxicity. Wastewater, particularly from electroplating, paint, leather, metal and tanning industries, contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and bio sorption at low cost and in eco-friendly way. Low level lead exposure can significantly induce motor dis functions and cognitive impairment in children. Seventy six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspergillus awamori, Aspergillus flavus, Trichoderma viride) were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi with respect to Pb, Cd, Cr and Ni with maximum uptake of 59.67, 16.25, 0.55 and 0.55 mg/g by fungi Pb 3 (Aspergillus terreus), Trichoderma viride, C r 8 (Trichoderma longibrachiatum), and isolate Ni 27 (A. niger), respectively. This indicated the potential of these fungi as bio sorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. The F-ratio was 0.55 and gives non-significant as irradiated

  16. Mycodiversity of xylophilous basidiomycetes (Basidiomycota, Fungi in Mondaí, Santa Catarina, Brazil II: A new addition

    Directory of Open Access Journals (Sweden)

    Marisa de Campos-Santana

    2010-04-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2010v23n1p13 Micodiversidade de basidiomicetes (Fungi xilófilos para Mondaí, Santa Catarina, Brasil, II: Nova contribuição. Um levantamento recente da micodiversidade de basidiomicetes xilófilos (Basidiomycota, Fungi no município de Mondaí (Santa Catarina, Brasil resultou na identificação de 15 espécies não registradas anteriormente para a área de estudo; todas elas são causadoras de podridão branca na madeira.

  17. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  18. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  19. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  20. Mycelial growth rate and macro- and micromorphological characteristics of medicinal species of genus Ganoderma (higher Basidiomycetes) from Iran.

    Science.gov (United States)

    Keypour, Somayeh; Riahi, Hossein; Safaie, Naser; Borhani, Ali

    2014-01-01

    Mycelial growth rate is a distinguishing quality that demonstrates continuous variation in different isolates collected from various hosts and locations. The objectives of this research were (1) to reinvestigate the previous identification of Iranian species, and (2) to recognize the best native isolate(s) for cultivation of different Ganoderma species. Of 78 samples collected from different hosts and sites, only 43 mycelia could be purified and examined for further study. Growth rate (GR; Δd/Δt) and growth coefficient (GC; dgh/t) were analyzed by growing isolate culture on 2% malt-extract agar medium (pH 5.5) incubated at 25°C. Macro- and micromorphological studies on mycelia and fruiting bodies such as basidiospore and cutis microcharacters as well as fruiting body quality were used for precise identification. Results revealed that samples belonged to 4 species: G. lucidum, G. applanatum, G. resinaceum, and G. australe. Among all samples, the isolate morphologically identified as G. applanatum showed the best GR (12 mm/day) and good GC (128 mm/day), followed by the 2 other isolates identified as G. resinaceum (GRs and GCs of 11 and 55 mm/day and 10.9 and 43.6 mm/day, respectively).

  1. Anti-inflammatory effect, total polysaccharide, total phenolics content and antioxidant activity of the aqueous extract of three basidiomycetes

    Directory of Open Access Journals (Sweden)

    M. Vazirian

    2014-01-01

    Full Text Available Inflammation is a part of the non-specific immune response which occurs in reaction to any type of injury. Medicinal mushrooms have had application in various disorders including cancer, liver injuries, inflammation and diabetes. In the present study, the anti-inflammatory effects of the aqueous extracts of medicinal mushrooms (Fomes fomentarius, Ganoderma applanatum and Trametes hirsuta were evaluated using carrageenan method. In addition, total polysaccharide, total phenolics contents and the radical scavenging activity of the extracts have also been examined. Mushrooms were extracted with distilled water in 100 °C for 4 hours and then the extracts were freeze dried. Indomethacin was considered as the positive control in the anti-inflammatory evaluation. Polysaccharide contents of F. fomentarius, G. applanatum, and T. hirsuta extracts were assessed as 53.3±0.2, 31.7±0.03, and 19.1±0.6 glucose equivalent µg/100 µgEXT and total phenolic contents of them were successfully revealed as 9.9±0.2, 8.2±0.1, and 8.8±0.2 µgGAE/100 µgEXT, respectively. Furthermore, the IC50 values for F. fomentarius, G. applanatum, and T. hirsuta extracts in DPPH assay, were calculated as 90.9, 108.6, and 908.3 µg/mL, respectively. The results of the experiment showed that the extracts possessed potent anti-inflammatory effect which was comparable to indomethacin.

  2. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  3. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Helbert David Siabatto F.

    2005-07-01

    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  4. Multidimensional NMR analysis reveals truncated lignin structures in wood decayed by the brown rot basidiomycete Postia placenta

    Science.gov (United States)

    Daniel J. Yelle; Dongsheng Wei; John Ralph; Kenneth E. Hammel

    2011-01-01

    Lignocellulose biodegradation, an essential step in terrestrial carbon cycling, generally involves removal of the recalcitrant lignin barrier that otherwise prevents infiltration by microbial polysaccharide hydrolases. However, fungi that cause brown rot of wood, a major route for biomass recycling in coniferous forests, utilize wood polysaccharides efficiently while...

  5. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660 ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  6. Armillaridin, a Honey Medicinal Mushroom, Armillaria mellea (Higher Basidiomycetes) Component, Inhibits Differentiation and Activation of Human Macrophages.

    Science.gov (United States)

    Liu, Tsang-Pai; Chen, Chien-Chih; Shiao, Pei-Yu; Shieh, Hui-Ru; Chen, Yu-Yawn; Chen, Yu-Jen

    2015-01-01

    Armillaridin (AM) is an aromatic ester compound isolated from honey medicinal mushroom, Armillaria mellea, which has anti-cancer potential. This study was designed to examine the effects of AM on differentiation and activation macrophages, the major ontogeny of innate immunity. Macrophages were derived from CD14+ monocytes which were sorted from human peripheral blood mononuclear cells. Cell viability was assessed by trypan blue exclusion test. Cells were stained with Liu's dye for observation of morphology. Expression of surface antigens was examined by flow cytometric analysis. Phagocytosis and generation of reactive oxygen species (ROS), as functional assays, were evaluated by counting engulfed yeasts and DCFH-DA reaction. The viability of macrophages was not significantly reduced by AM. AM at nontoxic concentrations markedly increased cytoplasmic vacuoles. The expression of surface CD14, CD16, CD36, and HLA-DR was suppressed. The phagocytosis function, but not ROS production, of macrophages was inhibited by AM. Armillaridin could inhibit the differentiation and activation of human macrophages. It may have potential to be developed as a biological response modifier for inflammatory diseases.

  7. Effect of surfactants and identification of metabolites on the biodegradation of fluoranthene by basidiomycetes fungal isolate Armillaria sp. F022.

    Science.gov (United States)

    Hadibarata, Tony; Kristanti, Risky Ayu

    2014-04-01

    The effects of structure and concentration of surfactants on the biodegradation of fluoranthene, a three rings polycyclic aromatic hydrocarbon in the aqueous phase, as well as their effects on the biodegradation and enzyme activity were investigated. The toxicity ranking of studied surfactants is: non-ionic Tween 80 Armillaria sp. F022 (>4,500 mg/L) was showed by Tween 80 (10 mg/L) culture, manifesting that the non-ionic surfactant present in the culture were beneficial to the fungal growth. Laccase showed the highest enzymes activity in all surfactants culture. Non-ionic Tween 80 showed a significant result for laccase activity (1,902 U/L) in the Armillaria sp. F022 culture. The increased enzymes cumulative activity may stem directly from the rising fluoranthene biodegradability as addition of appropriate surfactants. The biotransformation of fluoranthene was greatly improved by Tween 80, and totally fluoranthene degradation was obtained as Tween 80 was 10 mg/L. Two fluoranthene metabolites were isolated from the culture medium and analyzed by a thin layer chromatography, UV visible spectrometer and gas chromatography-mass spectrometry (GC-MS). The oxidation of fluoranthene is initiated by oxygenation at the C-2,3 positions resulting 9-fluorenone. At the end of experiment, one metabolite was detected in the culture extract and identified as phthalic acid. Evidently, Armillaria sp. F022 seems efficient, high effective and deserves further application on the enhanced bioremediation technologies for the treatment of fluoranthene-contaminated soil.

  8. Mating tests among geographically separated collections of the Trametes versicolor (Fr.) Pilát (Basidiomycetes, Polyporales) group

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 79, 3-4 (2004), s. 425-431 ISSN 0029-5035 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : trametes versicolor * mating tests Subject RIV: EE - Microbiology, Virology Impact factor: 0.594, year: 2004

  9. Physiological Peculiarities of Lignin-Modifying Enzyme Production by the White-Rot Basidiomycete Coriolopsis gallica Strain BCC 142

    Directory of Open Access Journals (Sweden)

    Vladimir Elisashvili

    2017-11-01

    Full Text Available Sixteen white-rot Basidiomycota isolates were screened for production of lignin-modifying enzymes (LME in glycerol- and mandarin peel-containing media. In the synthetic medium, Cerrena unicolor strains were the only high laccase (Lac (3.2–9.4 U/mL and manganese peroxidase (MnP (0.56–1.64 U/mL producers while one isolate Coriolopsis gallica was the only lignin peroxidase (LiP (0.07 U/mL producer. Addition of mandarin peels to the synthetic medium promoted Lac production either due to an increase in fungal biomass (Funalia trogii, Trametes hirsuta, and T. versicolor or enhancement of enzyme production (C. unicolor, Merulius tremellosus, Phlebia radiata, Trametes ochracea. Mandarin peels favored enhanced MnP and LiP secretion by the majority of the tested fungi. The ability of LiP activity production by C. gallica, C. unicolor, F. trogii, T. ochracea, and T. zonatus in the medium containing mandarin-peels was reported for the first time. Several factors, such as supplementation of the nutrient medium with a variety of lignocellulosic materials, nitrogen source or surfactant (Tween 80, Triton X-100 significantly influenced production of LME by a novel strain of C. gallica. Moreover, C. gallica was found to be a promising LME producer with a potential for an easy scale up cultivation in a bioreactor and high enzyme yields (Lac-9.4 U/mL, MnP-0.31 U/mL, LiP-0.45 U/mL.

  10. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. Copyright © 2010 John Wiley & Sons, Ltd.

  11. Genome sequence of the basidiomycetous fungus Pseudozyma aphidis DSM70725, an efficient producer of biosurfactant mannosylerythritol lipids

    OpenAIRE

    Lorenz, Stefan; Günther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  12. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants.

  13. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-02-13

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  14. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots

    NARCIS (Netherlands)

    Tagu, D; De Bellis, R; Balestrini, R; De Vries, OMH; Piccoli, G; Stocchi, [No Value; Bonfante, P; Martin, F

    The immunolocalization of one of the hydrophobins of Pisolithus tinctorius (HYDPt-1) is reported. Hydrophobin proteins play key roles in adhesion and aggregation of fungal hyphae, and it is already known that formation of ectomycorrhizas on eucalypt roots enhances the accumulation of hydrophobin

  15. Anxiolytic Effects of Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) on Ischemia-Induced Anxiety in Rats.

    Science.gov (United States)

    Zhang, Chunjing; Gao, Xiulan; Sun, Yan; Sun, Xiaojie; Wu, Yanmin; Liu, Ying; Yu, Haitao; Cui, Guangcheng

    2015-01-01

    We investigated the anxiolytic effects Agaricus brasiliensis extract (AbSE) on ischemia-induced anxiety using the plus-maze test and the social interaction test. The animals were treated orally with AbSE (4, 8, and 10 mg/kg/d, respectively) for 30 d, followed by middle cerebral artery occlusion-induced cerebral ischemia. Levels of noradrenaline, dopamine, and serotonin in the cerebral cortex of rats, as well as oxidative stress and plasma corticosterone levels were analyzed, respectively. The rota-rod test was carried out to exclude any false positive results in experimental procedures related to anxiety disorders, and the catalepsy test was carried out to investigate whether AbSE induces catalepsy. Our results demonstrate that oral administration of AbSE presented anxiolytic-like effects in the elevated plus-maze test and the social interaction test. Furthermore, AbSE did not induce extrapyramidal symptoms in the catalepsy test. The mechanism underlying the anxiolytic effect of AbSE might be increased brain monoamine levels and plasma corticosterone levels and decreased oxidative stress in cerebral ischemia/reperfusion rats.

  16. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  17. Antigenotoxic potential of aqueous extracts from the chanterelle mushroom, Cantharellus cibarius (higher Basidiomycetes), on human mononuclear cell cultures.

    Science.gov (United States)

    Mendez-Espinoza, Claudia; Garcia-Nieto, Edelmira; Esquivel, Adriana Montoya; Gonzalez, Monica Montiel; Bautista, Efrain Velasco; Ezquerro, Carmen Calderon; Santacruz, Libertad Juarez

    2013-01-01

    Cantharellus cibarius is one of the most important wild, edible, and ectomycorrhizal mushrooms growing at La Malinche National Park, Tlaxcala, Mexico; therefore, the assessment of its biological properties is of great interest to know its potential as an alternative treatment to chemopreventive strategies when it is consumed as part of a diet. Comet assay was used to evaluate the antigenotoxic properties of several concentrations of aqueous extracts (0.0125, 0.025, 0.05, 0.1, and 0.2% w/v) prepared at room temperature (22 ± 2°C). As a test system we used human mononuclear cells exposed to methyl methanesulphonate (MMS) in vitro according to 3 different protocols: previous, simultaneous, and posterior. Previous (0.0125%) and simultaneous (0.1%) treatments resulted in the highest inhibitory efficiency. In the former, the cells assessed showed a tail length of 94.9 ± 64 µm; in the latter, the tails measured 106.2 ± 40 µm. Resulting percentages of reduction in damage were 236% and 196.1%, respectively. We did not obtain a dose-dependent response. The mean tail length for each protocol (previous, 133.1 ± 80 µm; simultaneous, 127.8 ± 57 µm; posterior, 146.3 ± 74 µm) was statistically significant with regard to the positive control (MMS).

  18. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    of Kaiserslautern (Germany).The ML algorithm employed the GTRGAMMAI model and bootstrapping was performed with 1000 replicates. Additionally, Neighbour Joining (NJ) trees were constructed in SeaView version 4. Robustness of NJ trees in the analyses... was assessedwith 1000 NJ bootstrap replicates.The alignments (including individual gene alignments) are deposited in TreeBase under submission ID 14277. 6 3. Results 3.1 Phylogenetic analyses Without exception and with significant support, phylogenetic...

  19. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  20. Polypores and genus concepts in Phanerochaetaceae (Polyporales, Basidiomycota

    Directory of Open Access Journals (Sweden)

    Otto Miettinen

    2016-12-01

    Full Text Available We explored whether DNA-phylogeny-based and morphology-based genus concepts can be reconciled in the basidiomycete family Phanerochaetaceae. Our results show that macromorphology of fruiting bodies and hymenophore construction do not reflect monophyletic groups. However, by integrating micromorphology and re-defining genera, harmonization of DNA phylogeny and morphological genus concepts is possible in most cases. In the case of one genus (Phlebiopsis, our genetic markers could not resolve genus limits satisfactorily and a clear morphological definition could not be identified. We combine extended species sampling, microscopic studies of fruiting bodies and phylogenetic analyses of ITS, nLSU and rpb1 to revise genus concepts. Three new polypore genera are ascribed to the Phanerochaetaceae: Oxychaete gen. nov. (type Oxyporus cervinogilvus, Phanerina gen. nov. (type Ceriporia mellea, and Riopa (including Ceriporia metamorphosa and Riopa pudens sp. nov.. Phlebiopsis is extended to include Dentocorticium pilatii, further species of Hjortstamia and the monotypic polypore genus Castanoporus. The polypore Ceriporia inflata is combined into Phanerochaete. The identity of the type species of the genus Riopa, R. davidii, has been misinterpreted in the current literature. The species has been included in Ceriporia as a species of its own or placed in synonymy with Ceriporia camaresiana. The effort to properly define R. davidii forced us to study Ceriporia more widely. In the process we identified five closely related Ceriporia species that belong to the true Ceriporia clade (Irpicaceae. We describe those species here, and introduce the Ceriporia pierii group. We also select a lectotype and an epitype for Riopa metamorphosa and neotypes for Sporotrichum aurantiacum and S. aurantium, the type species of the anamorphic genus Sporotrichum, and recommend that teleomorphic Riopa is conserved against it.

  1. Inducción fúngica de la biorremediación de suelos contaminados con combustibles

    Directory of Open Access Journals (Sweden)

    Mary Lopretti

    2011-04-01

    Full Text Available La biorremediación de suelos ha sido en los últimos años una de las aplicaciones de los procesos de la biotecnología industrial que se ha desarrollado en busca de soluciones  naturales y eficientes al problema de la contaminación.Varios son los microorganismos que viven en condiciones extremas, desarrollando estrategias metabólicas que les permiten tener sus vías metabólicas aptas para vivir y reproducirse. Dentro de estas estrategias  se encuentra la acción de enzimas hidrolíticas, oxidativas y depolimerizantes que permiten modificar sustratos complejos como lo son los derivados del petróleo  y entre ellos los combustibles.En el presente trabajo se estudió la acción de dos hongos Gloeophylum trabeum y Phanerochaetes chrysosporium actuando en forma consorcial sobre sustratos  contaminados con gasoil y nafta.Se prepararon 4 reactores de fermentación sólida: dos de ellos blanco, contaminados sin inducción, y de los otros dos uno con nafta y el otro con gasoil inoculados ambos con 100cc de medio de propagación con micelios de P.chrysosporium y 50cc de medio de crecimiento con pellets de G. trabeum. Se extrajeron muestras cada 15 días y se evaluó  en el material de cada reactor características fisicoquímicas como %C, humedad y pH.También se realizó la evaluación microbiológica por siembra en placa y dilución en placa con agar malta al 1,25%. En todos los casos se obtuvieron micelios.Por último se determinó la actividad de enzimas lacasa  y peroxidasa. La actividad lacasa se determinó por espectrometría usando 0.5mM de ABTS como sustrato en 0,1M de buffer acetato de sodio pH5 y 1 ml de extracto obtenido por extracción salina. La determinación de actividad Mn peroxidasa se realizó con 0.01% de rojo fenol como sustrato en buffer succinato de sodio 0.1M en presencia de 1 ml de extracto enzimático, MnSO4 0.1M y H2O2 0.1M.Las actividad  de éstas enzimas permitió obtener moléculas mas pequeñas producto de la

  2. Genetic transformation of lignin degrading fungi facilitated by Agrobacterium tumefaciens

    Science.gov (United States)

    2010-01-01

    Background White-rot fungi are primarily the major degraders of lignin, a major obstacle for commercial exploitation of plant byproducts to produce bioethanol and other industrially important products. However, to improve their efficacy for lignin degradation, it has become necessary to genetically modify these organisms using appropriate vectors. Agrobacterium tumefaciens, a soil phytopathogenic bacterium, generally transforms plants by delivering a portion of the resident Ti- plasmid, the T-DNA (transfer DNA). The trans-Kingdom gene transfer is initiated by the activity of Ti-plasmid encoded vir (virulence) genes in response to low-molecular-mass phenolic compounds such as acetosyringone. A. tumefaciens played a major role in plant genetic engineering and basic research in molecular biology, accounting for nearly 80% of the transgenic plants produced so far. Initially, it was believed that only dicotyledons, gymnosperms and a few monocotyledonous species could be transformed by this bacterium; but recent reports have totally changed this scenario by demonstrating that many 'recalcitrant' species not included in its natural host range can also be transformed, especially filamentous fungi. Results This paper describes an efficient and convenient Agrobacterium-mediated gene transformation system for successful delivery of T-DNA, carrying the genes coding for β-glucuronidase (uidA), green fluorescent protein (gfp) and hygromycin phosphotransferase (hpt) to the nuclear genome of lignin degrading white-rot fungi such as Phanerochaete chrysosporium, Ganoderma sp. RCKK-02, Pycnoporous cinnabarinus, Crinipellis sp. RCK-1, Pleurotus sajor-caju and fungal isolate BHR-UDSC without supplementation of acetosyringone. The fungal transformants were confirmed by PCR and Southern hybridization. The expression vector pCAMBIA 1304-RCKK was constructed by the addition of GPD promoter from plasmid p416 to the binary vector backbone pCAMBIA1304, which controls uidA and gfp gene

  3. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    Energy Technology Data Exchange (ETDEWEB)

    Haritash, A.K., E-mail: akharitash@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India); Kaushik, C.P. [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India)

    2009-09-30

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H{sub 2}O, CO{sub 2} (aerobic) or CH{sub 4} (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions

  4. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    International Nuclear Information System (INIS)

    Haritash, A.K.; Kaushik, C.P.

    2009-01-01

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H 2 O, CO 2 (aerobic) or CH 4 (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions and the rate can

  5. A fungal P450 (CYP5136A3 capable of oxidizing polycyclic aromatic hydrocarbons and endocrine disrupting alkylphenols: role of Trp(129 and Leu(324.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available The model white rot fungus Phanerochaete chrysosporium, which is known for its versatile pollutant-biodegradation ability, possesses an extraordinarily large repertoire of P450 monooxygenases in its genome. However, the majority of these P450s have hitherto unknown function. Our initial studies using a genome-wide gene induction strategy revealed multiple P450s responsive to individual classes of xenobiotics. Here we report functional characterization of a cytochrome P450 monooxygenase, CYP5136A3 that showed common responsiveness and catalytic versatility towards endocrine-disrupting alkylphenols (APs and mutagenic/carcinogenic polycyclic aromatic hydrocarbons (PAHs. Using recombinant CYP5136A3, we demonstrated its oxidation activity towards APs with varying alkyl side-chain length (C3-C9, in addition to PAHs (3-4 ring size. AP oxidation involves hydroxylation at the terminal carbon of the alkyl side-chain (ω-oxidation. Structure-activity analysis based on a 3D model indicated a potential role of Trp(129 and Leu(324 in the oxidation mechanism of CYP5136A3. Replacing Trp(129 with Leu (W129L and Phe (W129F significantly diminished oxidation of both PAHs and APs. The W129L mutation caused greater reduction in phenanthrene oxidation (80% as compared to W129F which caused greater reduction in pyrene oxidation (88%. Almost complete loss of oxidation of C3-C8 APs (83-90% was observed for the W129L mutation as compared to W129F (28-41%. However, the two mutations showed a comparable loss (60-67% in C9-AP oxidation. Replacement of Leu(324 with Gly (L324G caused 42% and 54% decrease in oxidation activity towards phenanthrene and pyrene, respectively. This mutation also caused loss of activity towards C3-C8 APs (20-58%, and complete loss of activity toward nonylphenol (C9-AP. Collectively, the results suggest that Trp(129 and Leu(324 are critical in substrate recognition and/or regio-selective oxidation of PAHs and APs. To our knowledge, this is the first

  6. Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter

    Energy Technology Data Exchange (ETDEWEB)

    Hashida, Shin-nosuke; Yoshihara, Toshihiro [Environmental Science Research Laboratory, Central Research Institute of Electric Power Industry, Abiko 1646, Abiko-shi, Chiba (Japan)

    2014-07-01

    .e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)

  7. Biotransformation of Domestic Wastewater Treatment Plant Sludge by Two-Stage Integrated Processes -Lsb & Ssb

    Directory of Open Access Journals (Sweden)

    Md. Zahangir Alam, A. H. Molla and A. Fakhru’l-Razi

    2012-10-01

    Full Text Available The study of biotransformation of domestic wastewater treatment plant (DWTP sludge was conducted in laboratory-scale by two-stage integrated process i.e. liquid state bioconversion (LSB and solid state bioconversion (SSB processes. The liquid wastewater sludge [4% w/w of total suspended solids (TSS] was treated by mixed filamentous fungi Penicillium corylophilum and Aspergillus niger, isolated, screened and mixed cultured in terms of their higher biodegradation potential to wastewater sludge. The biosolids was increased to about 10% w/w. Conversely, the soluble [i.e. Total dissolve solid (TDS] and insoluble substances (TSS in treated supernatant were decreased effectively in the LSB process. In the developed LSB process, 93.8 g kg-1of biosolids were enriched with fungal biomass protein and nutrients (NPK, and 98.8% of TSS, 98.2% of TDS, 97.3% of turbidity, 80.2% of soluble protein, 98.8% of reducing sugar and 92.7% of chemical oxygen demand (COD in treated sludge supernatant were removed after 8 days of treatment. Specific resistance to filtration (1.39x1012 m/kg was decreased tremendously by the microbial treatment of DWTP sludge after 6 days of fermentation. The treated biosolids in DWTP sludge was considered as pretreated resource materials for composting and converted into compost by SSB process. The SSB process was evaluated for composting by monitoring the microbial growth and its subsequent roles in biodegradation in composting bin (CB. The process was conducted using two mixed fungal cultures, Trichoderma harzianum with Phanerochaete chrysosporium 2094 and (T/P and T. harzianum and Mucor hiemalis (T/M; and two bulking materials, sawdust (SD and rice straw (RS. The most encouraging results of microbial growth and subsequent solid state bioconversion were exhibited in the RS than the SD. Significant decrease of the C/N ratio and germination index (GI were attained as well as the higher value of glucosamine was exhibited in compost; which

  8. A Fungal P450 (CYP5136A3) Capable of Oxidizing Polycyclic Aromatic Hydrocarbons and Endocrine Disrupting Alkylphenols: Role of Trp129 and Leu324

    Science.gov (United States)

    Syed, Khajamohiddin; Porollo, Aleksey; Lam, Ying Wai; Yadav, Jagjit S.

    2011-01-01

    The model white rot fungus Phanerochaete chrysosporium, which is known for its versatile pollutant-biodegradation ability, possesses an extraordinarily large repertoire of P450 monooxygenases in its genome. However, the majority of these P450s have hitherto unknown function. Our initial studies using a genome-wide gene induction strategy revealed multiple P450s responsive to individual classes of xenobiotics. Here we report functional characterization of a cytochrome P450 monooxygenase, CYP5136A3 that showed common responsiveness and catalytic versatility towards endocrine-disrupting alkylphenols (APs) and mutagenic/carcinogenic polycyclic aromatic hydrocarbons (PAHs). Using recombinant CYP5136A3, we demonstrated its oxidation activity towards APs with varying alkyl side-chain length (C3-C9), in addition to PAHs (3–4 ring size). AP oxidation involves hydroxylation at the terminal carbon of the alkyl side-chain (ω-oxidation). Structure-activity analysis based on a 3D model indicated a potential role of Trp129 and Leu324 in the oxidation mechanism of CYP5136A3. Replacing Trp129 with Leu (W129L) and Phe (W129F) significantly diminished oxidation of both PAHs and APs. The W129L mutation caused greater reduction in phenanthrene oxidation (80%) as compared to W129F which caused greater reduction in pyrene oxidation (88%). Almost complete loss of oxidation of C3-C8 APs (83–90%) was observed for the W129L mutation as compared to W129F (28–41%). However, the two mutations showed a comparable loss (60–67%) in C9-AP oxidation. Replacement of Leu324 with Gly (L324G) caused 42% and 54% decrease in oxidation activity towards phenanthrene and pyrene, respectively. This mutation also caused loss of activity towards C3-C8 APs (20–58%), and complete loss of activity toward nonylphenol (C9-AP). Collectively, the results suggest that Trp129 and Leu324 are critical in substrate recognition and/or regio-selective oxidation of PAHs and APs. To our knowledge, this is the first

  9. Gold nanoparticles/water-soluble carbon nanotubes/aromatic diamine polymer composite films for highly sensitive detection of cellobiose dehydrogenase gene

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Guangming, E-mail: zgming@hnu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li Zhen, E-mail: happylizhen@yeah.ne [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Tang Lin; Wu Mengshi; Lei Xiaoxia; Liu Yuanyuan; Liu Can; Pang Ya; Zhang Yi [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2011-05-01

    Highlights: > Gold nanoparticles/multiwalled carbon nanotubes/poly (1,5-naphthalenediamine) modified electrode was fabricated. > The sensor was applied for the detection of cellobiose dehydrogenase genes. > An effective method to distribute MWCNTs and attach to the electrode was proposed. > The composite films greatly improved the sensitivity and enhanced the DNA immobilization. > The DNA biosensor exhibited fairly high sensitivity and quite low detection limit. - Abstract: An electrochemical sensor based on gold nanoparticles (GNPs)/multiwalled carbon nanotubes (MWCNTs)/poly (1,5-naphthalenediamine) films modified glassy carbon electrode (GCE) was fabricated. The effectiveness of the sensor was confirmed by sensitive detection of cellobiose dehydrogenase (CDH) gene which was extracted from Phanerochaete chrysosporium using polymerase chain reaction (PCR). The monomer of 1,5-naphthalenediamine was electropolymerized on the GCE surface with abundant free amino groups which enhanced the stability of MWCNTs modified electrode. Congo red (CR)-functionalized MWCNTs possess excellent conductivity as well as high solubility in water which enabled to form the uniform and stable network nanostructures easily and created a large number of binding sites for electrodeposition of GNPs. The continuous GNPs together with MWCNTs greatly increased the surface area, conductivity and electrocatalytic activity. This electrode structure significantly improved the sensitivity of sensor and enhanced the DNA immobilization and hybridization. The thiol modified capture probes were immobilized onto the composite films-modified GCE by a direct formation of thiol-Au bond and horseradish peroxidase-streptavidin (HRP-SA) conjugates were labeled to the biotinylated detection probes through biotin-streptavidin bond. Scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were used to investigate the film assembly and DNA hybridization processes

  10. Effect of introns and AT-rich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Scholtmeijer, K; Wosten, HAB; Springer, J; Wessels, JGH

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation

  11. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  12. Pleurotus opuntiae (Durieu et Lév.) Sacc. (higher Basidiomycetes) and other species related to Agave and Opuntia plants in Mexico-taxonomy, distribution, and applications.

    Science.gov (United States)

    Camacho, Marcelo; Guzmán, Gastón; Guzmán-Dávalos, Laura

    2012-01-01

    Pleurotus opuntiae is an important mushroom from xerophytic temperate regions of Mexico, as parasite or saprobe on Agave and Opuntia. Discussions on the taxonomic relationships of P opuntiae with P djamor, P. agaves, P. levis, and P. yuccae are presented, of which P. agaves is a synonym of P. opuntiae, and P. yuccae is a synonym of P. djamor. This latter and P levis are close species of P. opuntiae. The traditional uses of P opuntiae and P. djamor as food and remedy for several health problems, and also to get a traditional alcoholic drink from the Agave, are also considered.

  13. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  14. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  15. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages.

    Science.gov (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie

    2015-01-01

    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  16. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes).

    Science.gov (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin

    2017-01-01

    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  17. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  18. Characterization of interspecific hybrid dikaryons of the oyster mushrooms, Pleurotus florida PAU-5 and P. sajor-caju PAU-3 (higher Basidiomycetes) from India.

    Science.gov (United States)

    Jaswal, Ravinder Kumar; Sodhi, Harpreet Singh; Sharma, Shivani

    2014-01-01

    Five Pleurotus hybrid dikaryons, developed through cross-breeding of P. florida PAU-5 (PF-5) and P. sajor-caju PAU-3 (PSC-3) were characterized with respect to textural properties, color, and enzymatic and genetic variability. Texture profile revealed significant differences in springiness, resilience, cohesiveness, and chewiness between all hybrids compared to the parents. Among the hybrid cultures, maximum whiteness was reported in hybrid 37, whereas hybrid 8 had minimum whiteness. Three hybrids (16, 37, 42) showed an increased linear growth rate in relation to PF-5, whereas no hybrid showed a higher growth rate than PSC-3. Maximum endoglucanase and xylanase activity was observed in hybrid 46, whereas minimum activity occurred in hybrid 42. Laccase and protease activity was higher in hybrid 37 and 46, respectively. Four hybrids (16, 37, 42, 46) showed increased peroxidase activity in relation to PF-5, whereas hybrid 46 showed activity higher than the parent PSC-3. Comparison of isozyme patterns confirmed the hybrid nature of hybrid 16. The large variation in the intensity of bands could be a result of recombination. Sodium dodecyl sulfate polyacrylamide gel electrophoresis of extracellular enzymes revealed 60.3- and 43-KDa bands in all the hybrids. An additional 25-KDa band was reported in hybrids 37, 42, and 46 and the parent PF-5, indicating their close relatedness. Parental strains showed higher divergence in small-subunit ribosomal DNA region compared with the internal transcribed spacer region, indicating their significance in varietal discrimination. Hybrid 46 had a small-subunit ribosomal DNA region more similar to that of PSC-3 compared with PF-5, whereas the internal transcribed spacer region of hybrids 42 and 46 revealed close resemblance to that of PF-5 and PSC-3, respectively.

  19. Antioxidant activities and bioactive compound determination from caps and stipes of specialty medicinal mushrooms Calocybe indica and Pleurotus sajor-caju (higher Basidiomycetes) from India.

    Science.gov (United States)

    Mishra, Krishna Kant; Pal, Ramesh Singh; Arunkumar, Raja

    2014-01-01

    In this study, we evaluated total phenolics, condensed tannins, ascorbic acid, lycopene, β-carotene, total antioxidant activity, reducing power, ferric-reducing antioxidant power, and radical scavenging activity (RSA) on ABTS and DPPH as well as metal chelating activity of methanolic and aqueous extract from caps and stipes of Calocybe indica and Pleurotus sajor-caju mushrooms. Per gram of extract, the different mushroom extracts contained 18.09-27.47 mg gallic acid equivalent of phenolics, 5.06-8.89 mg catechins of tannins, and 0.15-0.21 mg ascorbic acid. Principal component analysis (PCA) revealed that methanolic extract from caps of C. indica and P. sajor-caju contained higher ascorbic acid, total antioxidant activity, β-carotene and radical scavenging activity (RSA) on 2,2-diphenyl-1-picrylhydrazyl (DPPH) than did the stipes. The aqueous extract from cap and stipe of P. sajor-caju had higher total phenolics and RSA on 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) as well as higher metal-chelating activity and ferric-reducing antioxidant power. The antioxidant potential is higher in the caps of P. sajor-caju and C. indica than in the stipes; the cap contributes most to antioxidant activity.

  20. Enhanced mycelial biomass production of the hairy bracket mushroom, Trametes hirsuta (Higher Basidiomycetes), by optimizing medium component with Plackett-Burman design and response surface methodology.

    Science.gov (United States)

    Yang, Rongling; Liu, Xueming; Zhao, Xiangjie; Xu, Yujuan; Ma, Rongxia

    2013-01-01

    Statistical analyses based on experimental designs were applied to optimize the medium components for mycelial biomass production by Trametes hirsuta in shake flask cultivation. First, the effects of different carbon resources (glucose, sucrose, lactose, maltose, fructose, soluble starch and potato), nitrogen resources (yeast extract, peptone, (NH4)2SO4, NH4NO3, NH4Cl, peanut powder, soybean powder) and mineral elements (CaCl2, ZnSO4·7H2O, FeSO4·7H2O, MnSO4·H2O, CuSO4·7H2O) on mycelial biomass production were investigated using a univariate design. Second, a Plackett-Burman design was applied to identify the significant variables that principally influenced the mycelial biomass production, and the path of steepest ascent was pursued to approach the regions of optimal value of the significant variables. Subsequently, these significant variables were optimized using the Box-Behnken design of response surface methodology. Ultimately, the optimized medium conditions were composed of sucrose 25.65 g·L-1, MgSO4·7H2O 1.24 g·L-1, and FeSO4·7H2O 3.36 g·L-1, and the yield of mycelial biomass reached 15.45 g·L-1, which represents an approximately 1.6-fold increase above the initial yield.