WorldWideScience

Sample records for basidiomycete phanerochaete chrysosporium

  1. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The white-rot, basidiomycete fungus, Phanerochaete chrysosporium, has attracted .... with Congo red (1 mg/ml) solution, incubated at room temperature for 15 min and washed several times with sterile 1 .... white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis and regulation of differential expression.

  2. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  3. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  4. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  5. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  6. Genetic recombination in auxotrophic strains of Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Krejci, R.

    1987-01-01

    Four auxotrophic strains of ligninolytic basidiomycete Phanerochaete chrysosporium were obtained by UV mutagenesis. The heterokaryotic mycelium formed by complementation of different auxotrophic isolates was able to fruit and produce basidiospores. Prototrophic strains and strains with a recombined set of parental nutritional requirements were isolated from the basidiospore progeny of the heterokaryons. Genetic recombination hence takes place in fruit bodies produced by the heterokaryotic mycelium. (author). 3 tabs., 13 refs

  7. Bioremediation of textile effluent using Phanerochaete chrysosporium

    African Journals Online (AJOL)

    Bioremediation of textile effluent using Phanerochaete chrysosporium. ... African Journal of Biotechnology. Journal Home · ABOUT THIS ... The discharge of these waste residues into the environment eventually poison, damage or affect one or ...

  8. Laboratory studies of the degradation of chloropyrifos pesticide in soils supplemented by the fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Lopera Mesa, Margarita Maria; Penuela Mesa, Gustavo Antonio; Dominguez Gual, Maria Carolina; Mejia Zapata, Gloria Maria

    2005-01-01

    Degradation of the insecticide chloropyrifos was investigated in sterilized soil samples supplemented by the white rot basidiomycetes Phanerochaete chrysosporium. Degradation rates were measured during 21-day incubation at pesticide concentrations of 0,95, 5,3, and 9,41 μ/g. Phanerochaete chrysosporium showed ability to biodegrade the insecticide in values of 96,3%, 82,4% and 62,2%, respectively, followed by rapid degradation at low initial concentration of chloropyrifos

  9. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The aim of this study was to produce a secreted, heterologously expressed Phanerochaete chrysosporium cellobiohydrolase (CBHI.1) protein that required no in vitro chemical refolding and to investigate the cellulolytic activity of the clone expressing the glutathione S-transferase (GST) fused CBHI.1 protein. Plate enzyme ...

  10. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  11. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Science.gov (United States)

    Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen

    2012-01-01

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...

  12. Comparative transcriptome and secretome analysis of wood decay fungi Postia placenta and Phanerochaete chrysosporium

    Science.gov (United States)

    Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen

    2010-01-01

    Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...

  13. Metabolic regulation at the tricarboxylic acid and glyoxylate cycles of the lignin-degrading basidiomycete Phanerochaete chrysosporium against exogenous addition of vanillin.

    Science.gov (United States)

    Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki

    2005-10-01

    A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.

  14. Significant alteration of gene expression in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species

    Science.gov (United States)

    Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen

    2011-01-01

    Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...

  15. Recent advances in the molecular genetics of the lignin degrading fungus, phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Covert, S.F.

    1991-01-01

    During the past several years, molecular genetics research on phanerochaete chrysosporium, a white-rot basidiomycete, has increased dramatically. It is known that families of highly homologous, clustered genes encode the lignin peroxidases. The same appears to be true with the exocellobiohydrolase genes. Functional domains and active sites have been tentatively identified from the deduced amino acid sequences of these genes. Current investigations focus on elucidating the genomic organization of gene families, the mechanism(s) of gene regulation, and the role and interaction of specific gene products in lignocellulose degradation. (author)

  16. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Science.gov (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  17. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica; Floudas, Dimitrios; HIbbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Ruben; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavin, Jose L.; Oguiza, Jose A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kues, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan

    2011-12-06

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.

  18. Nitrate reductase gene involvement in hexachlorobiphenyl dechlorination by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    De, Supriyo; Perkins, Michael; Dutta, Sisir K.

    2006-01-01

    Polychlorobiphenyl (PCB) degradation usually occurs through reductive dechlorination under anaerobic conditions and phenolic ring cleavage under aerobic conditions. In this paper, we provide evidence of nitrate reductase (NaR) mediated dechlorination of hexachlorobiphenyl (PCB-153) in Phanerochaete chrysosporium under non-ligninolytic condition and the gene involved. The NaR enzyme and its cofactor, molybdenum (Mo), were found to mediate reductive dechlorination of PCBs even in aerobic condition. Tungsten (W), a competitive inhibitor of this enzyme, was found to suppress this dechlorination. Chlorine release assay provided further evidence of this nitrate reductase mediated dechlorination. Commercially available pure NaR enzyme from Aspergillus was used to confirm these results. Through homology search using TBLASTN program, NaR gene was identified, primers were designed and the RT-PCR product was sequenced. The NaR gene was then annotated in the P. chrysosporium genome (GenBank accession no. AY700576). This is the first report regarding the presence of nitrate reductase gene in this fungus with the explanation why this fungus can dechlorinate PCBs even in aerobic condition. These fungal inoculums are used commercially as pellets in sawdust for enhanced bioremediation of PCBs at the risk of depleting soil nitrates. Hence, the addition of nitrates to the pellets will reduce this risk as well as enhance its activity

  19. Ligninolytic system of Phanerochaete chrysosporium: inhibition by o-phthalate

    Energy Technology Data Exchange (ETDEWEB)

    Fenn, P.; Kirk, T.K.

    1979-01-01

    The degradation rate of (synthetic/sup 14/C)-lignin to /sup 14/CO/sub 2/ by Phanerochaete chrysosporium in cultures buffered with 0.01 M 2,2-dimethylsuccinate (DMS) was twice that in 0.01 M o-phthalate-buffered cultures. This difference could be totally accounted for by o-phthalate inhibition of the activity of the ligninolytic system. /sup 14/CO/sub 2/ production from ring-, sidechain-, and methoyxl-labled lignins was inhibited, the degree of inhibition being dependent on o-phthalate concentration. Oxidations of /sup 14/C-glucose, /sup 14/C-acetovanillone, and /sup 14/C-apocynol were not inhibited; thus o-phthalate is not a general inhibitor, and might inhibit activities involved in attach of the lignin polymer. DMS is a suitable buffer for the ligninolytic system. Degradation rates of ring-labeled lignin to /sup 14/CO/sub 2/ of 10 to 15% in 24 h were obtained consistently over the pH range 3.6 to 4.5, with an optimum near pH 4.0.

  20. Pyranose 2-oxidase from Phanerochaete chrysosporium--Expression in E.coli and Biochemical Characterization

    Czech Academy of Sciences Publication Activity Database

    Pisanelli, I.; Kujawa, M.; Spadiut, O.; Kittl, R.; Halada, Petr; Volc, Jindřich; Mozuch, M. D.; Kersten, P.; Haltrich, D.; Peterbauer, C.

    2009-01-01

    Roč. 142, č. 2 (2009), s. 97-106 ISSN 0168-1656 Institutional research plan: CEZ:AV0Z50200510 Keywords : Pyranose 2-oxidase * Phanerochaete chrysosporium * Lignocellulose degradation Subject RIV: CE - Biochemistry Impact factor: 2.881, year: 2009

  1. Influence of Populus Genotype on Gene Expression by the Wood Decay Fungus Phanerochaete chrysosporium

    Science.gov (United States)

    Jill Gaskell; Amber Marty; Michael Mozuch; Philip J. Kersten; Sandra Splinter Bondurant; Grzegorz Sabat; Ali Azarpira; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Dan Cullen

    2014-01-01

    We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba tremula) and syringyl (S)-rich transgenic derivatives. Acombination ofmicroarrays and liquid chromatography- tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793...

  2. Regulation of Gene Expression during the Onset of Ligninolytic Oxidation by Phanerochaete chrysosporium on Spruce Wood

    Science.gov (United States)

    Premsagar Korripally; Christopher G. Hunt; Carl J. Houtman; Don C. Jones; Peter J. Kitin; Dan Cullen; Kenneth E. Hammel; A. A. Brakhage

    2015-01-01

    Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in...

  3. Influence of gamma rays radiation on lignin degradation potency of phanerochaete chrysosporium and ganoderma lucidum

    International Nuclear Information System (INIS)

    Tri Retno DL; Nana Mulyana; Nurhasni; Uswatun Hasanah

    2016-01-01

    This research aims to increase the activity of extracellular enzymes lignolitik fungi phanerochaete chrysosporium and ganoderma lucidum to degrade lignocellulosic waste. Lignocellulosic difficult to degrade because it is composed of lignin, cellulose and hemicellulose. Phanerochaete chrysosporium and ganoderma lucidum group white rot fungi can degrade lignin because it is able to synthesize enzymes lignin peroxidase (LiP). Irradiation low dose gamma rays capable menstimulsi increase extracellular enzyme activity. Fungi phanerochaete chrysosporium and ganoderma lucidum in medium slent exposed to gamma irradiation at doses of 0 (control), 200, 400, 600, 800 and 1000 Gy. In a liquid medium containing Potatoes Dextrose Broth (PDB), mineral salts with the substrate lignin alkali 0 and 5 % w/v, fungi phanerochaete chrysosporium were exposed to a dose of 600 Gy of gamma rays have LiP activity (30 U/mL) by 2.5 times higher compared with controls (12 U/mL). While ganoderma lucidum that are exposed to gamma radiation at a dose of 800 Gy has LiP activity (34 U/mL) was 1.7 times higher than the control (20 U/mL). On a solid substrate fermentation of white teak powder (Gmelina arborea Roxb.) For 12 days at pH 6.4 and water content of 79 % by fungi phanerochaete chrysosporium were exposed to gamma ray dose of 600 Gy has an efficiency of lignin degradation by 42 %, whereas on fungi ganoderma lucidum that are exposed gamma ray dose of 800 Gy has an efficiency of lignin degradation by 21 % with optimal conditions of pH 7. And; water content of 71.3 %. (author)

  4. Caractérisation biochimique et fonctionnelle de glutathion-S-transferases (GSTs) chez Phanerochaete chrysosporium

    OpenAIRE

    Anak Ngadin , Andrew

    2011-01-01

    Phanerochaete chrysosporium is a ligninolytic fungus widely studied because of its capacities to degrade wood and xenobiotics through an extracellular enzymatic system. Its genome has been sequenced and has provided researchers with a complete inventory of the predicted proteins produced by this organism. This has allowed the description of many protein superfamilies. Among them, Glutathione S-transferases (GSTs) constitute a complex and widespread superfamily classified as enzymes of seconda...

  5. Delignification of Sawdust White Teak (Gmelina arborea Roxb. by Fungi Phanerochaete chrysosporium Irradiated Gamma Ray

    Directory of Open Access Journals (Sweden)

    Nurhasni Nurhasni

    2016-12-01

    Full Text Available Abstrak Biomassa lignoselulosa yang merupakan limbah pemanenan kayu harus dilakukan proses untuk memisahkan selulosa, hemiselulosa dan lignin sehingga dapat termanfaatkan. Penelitian ini bertujuan untuk mengetahui efektivitas inokulan fungi Phanerochaete chrysosporium iradiasi gamma dan pretreatment kimia terhadap percepatan delignifikasi serbuk kayu jati putih (Gmelina arborea Roxb. sehingga dapat dimanfaatkan dalam proses pulping. Pada penelitian ini dilakukan pretreatment substrat kayu jati putih (Gmelina arborea Roxb. menggunakan larutan NaOH 1% dan H2SO4 1% serta iradiasi gamma Co-60, yang mempunyai daya ionisasi kecil, daya tembus yang tinggi serta Co-60 dapat memancarkan sinar gamma dengan waktu paruh pendek. Penelitian ini dilakukan dalam dua tahap, tahap pertama penentuan dosis optimum iradiasi gamma terhadap fungi Phanerochaete chrysosporium (0 Gy, 200 Gy, 400 Gy, 600 Gy, 800 Gy, dan 1000 Gy dan tahap kedua analisis karakteristik substrat kayu jati putih yang telah di pretreatment dengan metode Solid State Fermentation (SSF selama 21 hari. Hasil penelitian menunjukkan bahwa dosis optimum pemberian iradiasi gamma pada fungi Phanerochaete chrysosporium yaitu pada dosis 600 Gy yang dapat meningkatkan aktivitas enzim lignin peroksidase (LiP sebesar 22.18 U/mL. Proses pretreatment kimia dengan menggunakan H2SO4 1% dapat mempercepat proses biodelignifikasi yang menghasilkan efisiensi degradasi lignin tertinggi yaitu sebesar 25.65%.   Kata kunci: Lignoselulosa, delignifikasi, Solid State Fermentation (SSF, Phanerochaete chrysosporium,iradiasi gamma.   Abstract   Lignocellulose biomass is waste wood harvesting should be a process for separating cellulose, hemicellulose and lignin that can be utilized. This study aims to determine the effectiveness of the inoculant fungi Phanerochaete chrysosphorium gamma irradiation and chemical pretreatment to accelerate delignification powder white teak (Gmelina arborea Roxb.. In this research

  6. Aqueous two-phase system purification for superoxide dismutase induced by menadione from Phanerochaete chrysosporium.

    Science.gov (United States)

    Kavakcıoğlu, Berna; Tongul, Burcu; Tarhan, Leman

    2017-03-01

    In the present work, the partitioning behavior of menadione-induced superoxide dismutase (SOD; EC 1.15.1.1), an antioxidant enzyme that has various applications in the medical and cosmetic industries, from the white rot fungus Phanerochaete chrysosporium has been characterized on different types of aqueous two-phase systems (ATPSs) (poly(ethylene glycol)/polypropylene glycol (PEG/PPG)-dextran, PEG-salt and PPG-salt). PEG-salt combinations were found most optimal systems for the purification of SOD. The best partition conditions were found using the PEG-3350 24% and K 2 HPO 4 5% (w/w) with pH 7.0 at 25 °C. The partition coefficient of total SOD activity and total protein concentration observed in this system were 0.17 and 6.65, respectively, with the recovery percentage as 78.90% in the bottom phase and 13.17% in the top phase. The highest purification fold for SOD from P. chrysosporium was found as 6.04 in the bottom phase of PEG 3350%24 - K 2 HPO 4 %5 (w/w) system with pH 7.0. SOD purified from P. chrysosporium was determined to be a homodimer in its native state with a molecular weight of 60  ± 4 kDa. Consequently, simple and only one step PEG-salt ATPS system was developed for SOD purification from P. chrysosporium.

  7. Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium

    KAUST Repository

    Espinosa-Ortiz, Erika J.

    2014-10-24

    The ability of Phanerochaete chrysosporium to reduce the oxidized forms of selenium, selenate and selenite, and their effects on the growth, substrate consumption rate, and pellet morphology of the fungus were assessed. The effect of different operational parameters (pH, glucose, and selenium concentration) on the response of P. chrysosporium to selenium oxyanions was explored as well. This fungal species showed a high sensitivity to selenium, particularly selenite, which inhibited the fungal growth and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency, whereas less than 10 % selenium removal was achieved for incubations with selenate. P. chrysosporium was found to be a selenium-reducing organism, capable of synthesizing elemental selenium from selenite but not from selenate. Analysis with transmission electron microscopy, electron energy loss spectroscopy, and a 3D reconstruction showed that elemental selenium was produced intracellularly as nanoparticles in the range of 30–400 nm. Furthermore, selenite influenced the pellet morphology of P. chrysosporium by reducing the size of the fungal pellets and inducing their compaction and smoothness.

  8. Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Hitoshi; MacDonald, Jacqueline; Syed, Khajamohiddin; Salamov, Asaf; Hori, Chiaki; Aerts, Andrea; Henrissat, Bernard; Wiebenga, Ad; vanKuyk, Patricia A.; Barry, Kerrie; Lindquist, Erika; LaButti, Kurt; Lapidus, Alla; Lucas, Susan; Coutinho, Pedro; Gong, Yunchen; Samejima, Masahiro; Mahadevan, Radhakrishnan; Abou-Zaid, Mamdouh; de Vries, Ronald P.; Igarashi, Kiyohiko; Yadav, Jagit S.; Grigoriev, Igor V.; Master, Emma R.

    2012-02-17

    Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s) among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.

  9. Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

    Science.gov (United States)

    Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

    2004-01-01

    Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

  10. Bioreduction of hexavalent chromium by live and active phanerochaete chrysosporium: kinetics and modeling

    Energy Technology Data Exchange (ETDEWEB)

    Murugavelh, Somasundaram; Mohanty, Kaustubha [Department of Chemical Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam (India)

    2012-07-15

    In this work the potential of live and active Phanerochaete chrysosporium, a white rot fungi, to remove lower Cr(VI) concentration from aqueous solutions was reported for the first time. A medium pH had significant effect on the growth of the fungus and bioremoval of Cr(VI). Substrate inhibition on the growth of Phanerochaete chrysosporium was evident beyond 20 g L{sup -1} of dextrose concentration. A maximum biomass concentration of 15.64 g L{sup -1} was obtained for an initial dextrose concentration of 20 g L{sup -1} in metal free medium at pH 6.0. An increase in Cr(VI) concentration beyond 10 mg L{sup -1} inhibited the growth of the fungi, thereby, reducing the chromium bioremoval efficiency. A maximum reduction efficiency of 98.92% was reported for an initial metal concentration of 10 mg L{sup -1}. A mathematical expression for the bioreduction of Cr(VI) considering the organic compounds in the cells was proposed. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Bioreduction of hexavalent chromium by live and active phanerochaete chrysosporium: kinetics and modeling

    International Nuclear Information System (INIS)

    Murugavelh, Somasundaram; Mohanty, Kaustubha

    2012-01-01

    In this work the potential of live and active Phanerochaete chrysosporium, a white rot fungi, to remove lower Cr(VI) concentration from aqueous solutions was reported for the first time. A medium pH had significant effect on the growth of the fungus and bioremoval of Cr(VI). Substrate inhibition on the growth of Phanerochaete chrysosporium was evident beyond 20 g L -1 of dextrose concentration. A maximum biomass concentration of 15.64 g L -1 was obtained for an initial dextrose concentration of 20 g L -1 in metal free medium at pH 6.0. An increase in Cr(VI) concentration beyond 10 mg L -1 inhibited the growth of the fungi, thereby, reducing the chromium bioremoval efficiency. A maximum reduction efficiency of 98.92% was reported for an initial metal concentration of 10 mg L -1 . A mathematical expression for the bioreduction of Cr(VI) considering the organic compounds in the cells was proposed. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. Simultaneous cadmium removal and 2,4-dichlorophenol degradation from aqueous solutions by Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Anwei; Zeng, Guangming; Chen, Guiqiu; Fan, Jiaqi; Zou, Zhengjun; Li, Hui; Hu, Xinjiang; Long, Fei [Hunan Univ., Changsha (China). College of Environmental Science and Engineering; Ministry of Education, Changsha (CN). Key Lab. of Environmental Biology and Pollution Control (Hunan Univ.)

    2011-08-15

    Phanerochaete chrysosporium has been recognised as an effective bioremediation agent due to its unique degradation to xenobiotic and biosorption ability to heavy metals. However, few studies have focused on the simultaneous removal of heavy metals and organic pollutants. The aim of this work was to study the feasibility of simultaneous cadmium removal and 2,4-dichlorophenol (2,4-DCP) degradation in P. chrysosporium liquid cultures. The removal efficiencies were pH dependent and the maximum removal efficiencies were observed at pH 6.5 under an initial cadmium concentration of 5 mg/L and an initial 2,4-DCP concentration of 20 mg/L. The removal efficiencies for cadmium and 2,4-DCP reached 63.62% and 83.90%, respectively, under the optimum conditions. The high production levels of lignin peroxidase (7.35 U/mL) and manganese peroxidase (8.30 U/mL) resulted in an increase in 2,4-DCP degradation. The protein content decreased with increasing cadmium concentration. The surface characteristics and functional groups of the biomass were studied by scanning electron microscopy and a Fourier-transformed infrared spectrometer. The results showed that the use of P. chrysosporium is promising for the simultaneous removal of cadmium and 2,4-DCP from liquid media. (orig.)

  13. Effect of peat extract on the hydrolytic enzymes of Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nawaz, M; Gunasekaran, M

    1988-08-01

    Peat, a partially decomposed plant material rich in minerals and lignocellulose was tested as a substrate for the growth and production of hydrolytic enzymes viz. cellulase, cellobiase and xylanase in Phanerochaete chrysosporium. Three types of peat extracts such as cold, hot water and autoclaved were prepared and tested. Among them, autoclaved extract supported the maximal growth. The intracellular enzyme activities peaked on the fifth day after inoculation irrespective of the media and enzyme tested. Addition of cellobiose and lactose in the medium induced the production of cellulase, xylanase and to a lesser extent cellobiase. Addition of glucose and sucrose to the media resulted in the suppression of all the extracellular enzymes tested. 18 refs., 5 figs.

  14. Caractérisation biochimique et fonctionnelle de glutathion-S-transferases (GSTs) chez Phanerochaete chrysosporium

    OpenAIRE

    Anak-Ngadin, Andrew

    2011-01-01

    Phanerochaete chrysosporium est un champignon ligninolytique largement étudié pour ses capacités à dégrader la lignine et certains xénobiotiques grâce à un important système d'enzymes extracellulaires. Son génome est entièrement séquencé et constitue un inventaire de séquences protéiques prédites qui a permis la description de nombreuses superfamilles de protéines. Parmi elles, les Glutathion S-transférases sont essentiellement impliquées dans le métabolisme secondaire du champignon. Cependan...

  15. Transport of Phanerochaete chrysosporium and Mucor hiemalis f. irnsingii spores through water-saturated quartz sands; Transport von Phanerochaete chrysosporium- und Mucor hiemalis f. irnsingii-Sporen durch wassergesaettigten Quarzsand

    Energy Technology Data Exchange (ETDEWEB)

    Hoque, E.; Klotz, D.; Teichmann, G.; Lang, H.; Wolf, M. [GSF - Forschungszentrum fuer Umwelt und Gesundheit GmbH, Neuherberg (Germany). Inst. fuer Hydrologie; Beisker, W. [GSF, Inst. fuer Pathologie (Germany)

    2001-11-01

    Just as bacteria so can aquatic fungi contribute effectively to pollutant elimination, at least in superficial groundwaters. However, very little is known about this. Nor is it known whether fungal spores are capable of being transported through sedimentary cavities. At least fungal spores are for some part of similar size as bacteria. We here report for the first time on a demonstration of the migration through quartz sand of spores of the two fungal species Phanerochaete chrysosporium and Mucor hiemalis f. irnsingii. [German] Neben Bakterien koennen auch aquatische Pilze, zumindest im oberflaechennahen Grundwasser, effiziente Beitraege zur Schadstoffentgiftung leisten. Darueber ist aber sehr wenig bekannt. Es ist auch nicht bekannt, ob ueberhaupt Pilzsporen durch Sedimenthohlraeume transportiert werden koennen, obwohl die Pilzsporen z.T. aehnliche Abmessungen wie Bakterien haben. Hier berichten wir erstmalig ueber den Nachweis der Migration von Sporen der beiden Pilzarten Phanerochaete chrysosporium und Mucor hiemalis f. irnsingii durch Quarzsand. (orig.)

  16. Degradation of Diuron by Phanerochaete chrysosporium: Role of Ligninolytic Enzymes and Cytochrome P450

    Directory of Open Access Journals (Sweden)

    Jaqueline da Silva Coelho-Moreira

    2013-01-01

    Full Text Available The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μg/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl-3-methylurea] and DCPU [(3,4-dichlorophenylurea], were detected in the culture medium at the concentrations of 0.74 μg/mL and 0.06 μg/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT, a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.

  17. Degradation of diuron by Phanerochaete chrysosporium: role of ligninolytic enzymes and cytochrome P450.

    Science.gov (United States)

    Coelho-Moreira, Jaqueline da Silva; Bracht, Adelar; de Souza, Aline Cristine da Silva; Oliveira, Roselene Ferreira; de Sá-Nakanishi, Anacharis Babeto; de Souza, Cristina Giatti Marques; Peralta, Rosane Marina

    2013-01-01

    The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μ g/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl)-3-methylurea] and DCPU [(3,4-dichlorophenyl)urea], were detected in the culture medium at the concentrations of 0.74 μ g/mL and 0.06 μ g/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT), a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.

  18. Degradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium grown in ammonium lignosulphonate media.

    Science.gov (United States)

    Aiken, B S; Logan, B E

    1996-06-01

    Removal and degradation of pentachlorophenol (PCP) by Phanerochaete chrysosporium in static flask cultures was studied using ammonium lignosulphonates (LS), a waste product of the papermill industry, as a carbon and nitrogen source. After 3 days, cultures of P. chrysosporium grown in either a 2% LS (nitrogen-sufficient) medium or a 0.23% LS and 2% glucose (nitrogen-deficient) medium removed 72 to 75% of PCP, slightly less than the 95% removal seen using nitrogen-deficient glucose and ammonia medium. PCP dehalogenation occurred despite the fact that extracellular enzyme (LiP) activity, measured by a veratryl alcohol oxidation assay and by PCP disappearance in cell-free extracts, was inhibited by LS. This inactivation of LiP likely contributed to the lower percent of PCP dehalogenation observed using the LS media. In order to better understand the relationship between PCP disappearance and dehalogenation, we measured the fate of the chlorine in PCP. After 13 days, only 1.8% of the initial PCP added was recoverable as PCP. The remainder of the PCP was either mineralized or transformed to breakdown intermediates collectively identified as organic halides. The largest fraction of the original chlorine (58%) was recovered as organic (non-PCP) halide, most of which (73%) was associated with the cell mass. Of the remaining chlorine, 40% was released as chloride ion, indicating a level of dehalogenation in agreement with previously reported values.

  19. Detoxification of corn stover and corn starch pyrolysis liquors by ligninolytic enzymes of Phanerochaete chrysosporium.

    Science.gov (United States)

    Khiyami, Mohammad A; Pometto, Anthony L; Brown, Robert C

    2005-04-20

    Phanerochaete chrysosporium (ATCC 24725) shake flask culture with 3 mM veratryl alcohol addition on day 3 was able to grow and detoxify different concentrations of diluted corn stover (Dcs) and diluted corn starch (Dst) pyrolysis liquors [10, 25, and 50% (v/v)] in defined media. GC-MS analysis of reaction products showed a decrease and change in some compounds. In addition, the total phenolic assay with Dcs samples demonstrated a decrease in the phenolic compounds. A bioassay employing Lactobacillus casei growth and lactic acid production was developed to confirm the removal of toxic compounds from 10 and 25% (v/v) Dcs and Dst by the lignolytic enzymes, but not from 50% (v/v) Dcs and Dst. The removal did not occur when sodium azide or cycloheximide was added to Ph. chrysosporium culture media, confirming the participation of lignolytic enzymes in the detoxification process. A concentrated enzyme preparation decreased the phenolic compounds in 10% (v/v) corn stover and corn starch pyrolysis liquors to the same extent as the fungal cultures.

  20. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhenzhen [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Zuo, Yanan; Guo, Zhi; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Song, Zhongxian [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming 650500 (China); Niu, Qiuya [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-05-30

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles.

  1. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    International Nuclear Information System (INIS)

    Huang, Zhenzhen; Chen, Guiqiu; Zeng, Guangming; Chen, Anwei; Zuo, Yanan; Guo, Zhi; Tan, Qiong; Song, Zhongxian; Niu, Qiuya

    2015-01-01

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles

  2. Degradation of wheat straw cell wall by white rot fungi Phanerochaete chrysosporium

    Science.gov (United States)

    Zeng, Jijiao

    The main aim of this dissertation research was to understand the natural microbial degradation process of lignocellulosic materials in order to develop a new, green and more effective pretreatment technology for bio-fuel production. The biodegradation of wheat straw by white rot fungi Phanerochaete chrysosporium was investigated. The addition of nutrients significantly improved the performance of P.chrysosporium on wheat straw degradation. The proteomic analysis indicated that this fungus produced various pepetides related to cellulose and lignin degradation while grown on the biomass. The structural analysis of lignin further showed that P.chrysosporium preferentially degraded hydroxycinnamtes in order to access cellulose. In details, the effects of carbon resource and metabolic pathway regulating compounds on manganeses peroxidase (MnP) were studied. The results indicated that MnP activity of 4.7 +/- 0.31 U mL-1 was obtained using mannose as a carbon source. The enzyme productivity further reached 7.36 +/- 0.05 U mL-1 and 8.77 +/- 0.23 U mL -1 when the mannose medium was supplemented with cyclic adenosine monophosphate (cAMP) and S-adenosylmethionine (SAM) respectively, revealing highest MnP productivity obtained by optimizing the carbon sources and supplementation with small molecules. In addition, the effects of nutrient additives for improving biological pretreatment of lignocellulosic biomass were studied. The pretreatment of wheat straw supplemented with inorganic salts (salts group) and tween 80 was examined. The extra nutrient significantly improved the ligninase expression leading to improve digestibility of lignocellulosic biomass. Among the solid state fermentation groups, salts group resulted in a substantial degradation of wheat straw within one week, along with the highest lignin loss (25 %) and ˜ 250% higher efficiency for the total sugar release through enzymatic hydrolysis. The results were correlated with pyrolysis GC-MS (Py

  3. Microbial pretreatment of corn stovers by solid-state cultivation of Phanerochaete chrysosporium for biogas production.

    Science.gov (United States)

    Liu, Shan; Wu, Shubiao; Pang, Changle; Li, Wei; Dong, Renjie

    2014-02-01

    The microbial pretreatment of corn stover and corn stover silage was achieved via the solid-state cultivation of Phanerochaete chrysosporium; pretreatment effects on the biodegradability and subsequent anaerobic production of biogas were investigated. The peak levels of daily biogas production and CH₄ yield from corn stover silage were approximately twice that of corn stover. Results suggested that ensiling was a potential pretreatment method to stimulate biogas production from corn stover. Surface morphology and Fourier-transform infrared spectroscopy analyses demonstrated that the microbial pretreatment of corn stover silage improved biogas production by 10.5 to 19.7% and CH4 yield by 11.7 to 21.2% because pretreatment could decrease dry mass loss (14.2%) and increase substrate biodegradability (19.9% cellulose, 32.4% hemicellulose, and 22.6% lignin). By contrast, the higher dry mass loss in corn stover (55.3%) after microbial pretreatment was accompanied by 54.7% cellulose, 64.0% hemicellulose, and 61.1% lignin degradation but did not significantly influence biogas production.

  4. ABILITY OF Phanerochaete chrysosporium AND Trametes versicolor TO REMOVE Zn2+, Cr3+, Pb2+ METAL IONS

    Directory of Open Access Journals (Sweden)

    Josué Solís Pacheco

    2015-07-01

    Full Text Available The use of fungal biomass as an alternative for removing heavy metals has become increasingly important in recent years, replacing conventional methods based on chemical physical processes. In this study, we evaluated the biosorption of Zn2+, Cr3+ and Pb2+, which were analyzed to determine their effect on growth kinetic parameters of Phanerochaete chrysosporium strain ATCC 32629 and Trametes versicolor ATCC 1267. Growth kinetics were performed in four liquid culture media: 1 Yeast Nitrogen Base (YNB used as control, 2 YNB medium plus Pb2+ (0.25, 1 and 2 mg L-1, 3 YNB medium plus Zn2+ (5, 10 and 20 mg L-1 and 4 YNB medium plus Cr3+ (0.5, 1 and 2 mg L-1. The flasks were incubated at 25 °C with shaking at 150 rpm. Metal concentrations were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AES with prior acid digestion of the sample. The results demonstrated that Phanerochaete chrysosporium ATCC 32629 and Trametes versicolor ATCC 12679 are able to grow in the culture medium with Pb2+, Zn2+ and Cr3+ ions at different concentrations. However, P. chrysosporium ATCC 32629 showed greater adaptability and ability to adsorb Cr3+ in the culture medium at concentrations of 0.5 and 1 mg L-1, whereas T. versicolor ATCC 12679 was capable of Pb2+ biosorption at concentrations of 0.25, 1 and 2 mg L-1.

  5. Comparative biodegradation of alkyl halide insecticides by the white rot fungus, Phanerochaete chrysosporium (BKM-F-1767)

    International Nuclear Information System (INIS)

    Kennedy, D.W.; Aust, S.D.; Bumpus, J.A.

    1990-01-01

    The ability of Phanerochaete chrysosporium to degrade six alkyl halide insecticides (aldrin, dieldrin, heptachlor, chlordane, lindane, and mirex) in liquid and soil-corncob matrices was compared by using 14 C-labeled compounds. Of these, only [ 14 C]lindane and [ 14 C]chlordane underwent extensive biodegradation, as evidenced by the fact that 9.4 to 23.4% of these compounds were degraded to 14 CO 2 in 30 days in liquid cultures and 60 days in soil-corncob cultures inoculated with P. chrysosporium. Although [ 14 C]aldrin, [ 14 C]dieldrin, [ 14 C]heptachlor, and [14D]mirex were poorly mineralized, substantial bioconversion occurred, as determined by substrate disappearance and metabolite formation. Nonbiological disappearance was observed only with chlordane and heptachlor

  6. Enhanced bioremediation of 4-nonylphenol and cadmium co-contaminated sediment by composting with Phanerochaete chrysosporium inocula.

    Science.gov (United States)

    Xu, Piao; Lai, Cui; Zeng, Guangming; Huang, Danlian; Chen, Ming; Song, Biao; Peng, Xin; Wan, Jia; Hu, Liang; Duan, Abing; Tang, Wangwang

    2018-02-01

    Composting is identified as an effective approach for solid waste disposal. The bioremediation of 4-nonylphenol (4NP) and cadmium (Cd) co-contaminated sediment was investigated by composting with Phanerochaete chrysosporium (P. chrysosporium) inocula. P. chrysosporium inocula and proper C/N ratios (25.51) accelerated the composting process accompanied with faster total organic carbon loss, 4NP degradation and Cd passivation. Microbiological analysis demonstrated that elevated activities of lignocellulolytic enzymes and sediment enzymes was conducive to organic chemical transformation. Bacterial community diversity results illustrated that Firmicutes and Proteobacteria were predominant species during the whole composting process. Aerobic cellulolytic bacteria and organic degrading species played significant roles. Toxicity characteristic leaching procedure (TCLP) extraction and germination indices results indicated the efficient detoxification of 4NP and Cd co-contaminated sediment after 120 days of composting. Overall, results demonstrated that P. chrysosporium enhanced composting was available for the bioremediation of 4NP and Cd co-contaminated sediment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Biodegradation of TNT (2,4,6-Trinitrotoluene) by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Fernando, T.; Bumpus, J.A.; Aust, S.D.

    1990-01-01

    Extensive biodegradation of TNT (2,4,6-trinitrotoluene) by the white rot fungus Phanerochaete chrysosporium was observed. At an initial concentration of 1.3 mg/liter, 35.4 ± 3.6% of the [ 14 C]TNT was degraded to 14 CO 2 in 18 days. The addition of glucose 12 days after the addition of TNT did not stimulate mineralization, and, after 18 days of incubation with TNT only, about 3.3% of the initial TNT could be recovered. Mineralization of [ 14 C]TNT absorbed on soil was also examined. Ground corncobs served as the nutrient for slow but sustained degradation of [ 14 C]TNT to 14 CO 2 such that 6.3 ± 0.6% of the [ 14 C]TNT initially present was converted to 14 CO 2 during the 30-day incubation period. Mass balance analysis of liquid cultures and of soil-corncob cultures revealed that polar [ 14 C]TNT metabolites are formed in both systems, and high-performance liquid chromatography analyses revealed that less then 5% of the radioactivity remained as undegraded [ 14 C]TNT following incubation with the fungus in soil and liquid cultures. When the concentration of TNT in cultures (both liquid and soil) was adjusted to contamination levels that might be found in the environment, i.e., 10,000 mg/kg in soil and 100 mg/liter in water, mineralization studies showed that 18.4 ± 2.9% and 19.6 ± 3.5% of the initial TNT was converted to 14 CO 2 in 90 days in soil and liquid cultures, respectively. In both cases (90 days in water at 100 mg/liter and in soil at 10,000 mg/kg) approximately 85% of the TNT was degraded. These results suggest that this fungus may be useful for the decontamination of sites in the environment contaminated with TNT

  8. Biological composting of petroleum waste organics using the white rot fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    McFarland, M.J.; Xiu J, Qiu; Aprill, W.A.; Sims, R.C.

    1990-01-01

    Environmental enrichment of the white rot fungus Phanerochaete chrysosporium in biological compost soil reactors was effective in enhancing the rates of Benzo(a)pyrene removal over that observed under natural soil conditions. In contaminated soil compost systems amended with fungal inoculum and primary substrate, maximum Benzo(a)pyrene removal rates of 0.31 mg B(a)p/kg compost material-day (0.25 mgB(a)p/kg soil-day) were observed while in unamended soil conditions, maximum removal rates of 0.13 mg B(a)p/kg soil-day were recorded. Additions of primary substrate without any fungal inoculum gave compound removal rates similar to soil only conditions (i.e., 14 mg B(a)p/kg soil-day). Differences in contaminant and radioactivity ( 14 C) removal rates indicated that Benzo(a)pyrene derived carbon was being incorporated into nonvolatile materials within the compost environment. Contaminated soil pH had a significant effect on Benzo(a)pyrene removal rates during composting treatment. With acid soils (pH-4.8), a maximum Benzo(a)pyrene removal rate of 0.11 mg B(a)p/kg compost material-day was determined compared to 0.31 mg B(a)p/kg compost material-day in alkaline (pH-8.0) soil. Oxygen availability appeared to be one of the most important process variables influencing both fungal growth and Benzo(a)pyrene removal. Periodic pulses of oxygen equivalent to a three volume turnover of reactor headspace every three days resulted in increasing the Benzo(a)pyrene removal rate from 0.31 mg B(a)p/kg compost material-day to 0.85 mg B(a)p/kg compost material day

  9. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes

    DEFF Research Database (Denmark)

    Manavalan, Arulmani

    2006-01-01

    Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production...

  10. EFFECTS OF CULTURE PARAMETERS ON DDT [1,1,1-TRICHLO- RO-2,2-BIS(4-CHLOROPHENYL) ETHANE] BIODEGRADATION BY PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    The lignin degrading system of the white rot fungus Phanerochaete chrysosporium is able to degrade a wide variety of structurally diverse organopollutants to carbon dioxide. Current research is focused on ways to increase or optimize rates of biodegradation in order to a...

  11. BIODEGRADATION OF DDT [1,1,1-TRICHLORO-2,2-BIS(4- CHLOROPHENYL) ETHANE] BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the form...

  12. Biotreatment of textile effluent in static bioreactor by Curvularia lunata URM 6179 and Phanerochaete chrysosporium URM 6181.

    Science.gov (United States)

    Miranda, Rita de Cássia M de; Gomes, Edelvio de Barros; Pereira, Nei; Marin-Morales, Maria Aparecida; Machado, Katia Maria Gomes; Gusmão, Norma Buarque de

    2013-08-01

    Investigations on biodegradation of textile effluent by filamentous fungi strains Curvularia lunata URM 6179 and Phanerochaete chrysosporium URM 6181 were performed in static bioreactors under aerated and non-aerated conditions. Spectrophotometric, HPLC/UV and LC-MS/MS analysis were performed as for to confirm, respectively, decolourisation, biodegradation and identity of compounds in the effluent. Enzymatic assays revealed higher production of enzymes laccase (Lac), lignin peroxidase (LiP) and manganese-dependent peroxidase (MnP) by P. chrysosporium URM 6181 in aerated bioreactor (2020; 39 and 392 U/l, respectively). Both strains decolourised completely the effluent after ten days and biodegradation of the most predominant indigo dye was superior in aerated bioreactor (96%). Effluent treated by P. chrysosporium URM 6181 accumulated a mutagenic metabolite derived from indigo. The C. lunata URM 6179 strain, showed to be more successful for assure the environmental quality of treated effluent. These systems were found very effective for efficient fungal treatment of textile effluent. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Activity of the ligninolytic enzymes of the Phanerochaete chrysosporium and its variation with the Mn+2 addition

    International Nuclear Information System (INIS)

    Jimenez T, Gloria Alicia; Mejia G, Amanda I; Lopez O, Betty Lucy

    1999-01-01

    The activity of the ligninolytic enzymes, lignin peroxidase (LiP), manganese peroxidase (MnP) and Laccase, in submerged cultures of Phanerochaete chrysosporium, with limited amounts of carbon and nitrogen, were affected by the addition of Mn+2. In cultures with o and 1,25 ppm of Mn+2, only the lip was detected and its higher activity level was observed in the cultures with 1.25 ppm of Mn+2. The cultures with 40 ppm of Mn+2 showed activities of lip, MnP and Laccase. The presence of the three enzymes in the same culture had not been reported and it is of great importance because is shows that the fungus and its lignolitic machinery can act sequentially

  14. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  15. Microbial pretreatment of cotton stalks by Phanerochaete chrysosporium for bioethanol production

    Science.gov (United States)

    Shi, Jian

    Lignocellulosic biomass has been recognized as a widespread, potentially low cost renewable source of mixed sugars for fermentation to fuel ethanol. Pretreatment, as the first step towards conversion of lignocellulose to ethanol, remains one of the main barriers to technical and commercial success of the processing technology. Existing pretreatment methods have largely been developed on the basis of physiochemical technologies which are considered relatively expensive and usually involve adverse environmental impacts. In this study, an environmentally benign alternative, microbial pretreatment using Phanerochaete chrysosporium, was explored to degrade lignin in cotton stalks and facilitate their conversion into ethanol. Two submerged liquid pretreatment techniques (SmC), shallow stationary and agitated cultivation, at three inorganic salt concentrations (no salts, modified salts without Mn2+, modified salts with Mn2+) were compared by evaluating their pretreatment efficiencies. Shallow stationary cultivation with no salt was superior to other pretreatment conditions and gave 20.7% lignin degradation along with 76.3% solids recovery and 29.0% carbohydrate availability over a 14 day period. The influence of substrate moisture content (65%, 75% and 80% M.C. wet-basis), inorganic salt concentration (no salts, modified salts without Mn2+ , modified salts with Mn2+) and culture time (0-14 days) on pretreatment effectiveness in solid state (SSC) systems was also examined. It was shown that solid state cultivation at 75% M.C. without salts was the most preferable pretreatment resulting in 27.6% lignin degradation, 71.1% solids recovery and 41.6% carbohydrate availability over a period of 14 days. A study on hydrolysis and fermentation of cotton stalks treated microbially using the most promising SmC (shallow stationary, no salts) and SSC (75% moisture content, no salts) methods resulted in no increase in cellulose conversion with direct enzyme application (10.98% and 3

  16. Transcript patterns of Phanerochaete chrysosporium genes in organopollutant contaminated soils and in wood

    Science.gov (United States)

    Amber. Vanden Wymelenberg; Bernard. Janse; Jill. Gaskell; Diane. Dietrich; Marcelo. Vallim; Dan. Cullen

    1998-01-01

    We describe here recent methods for quantitative assessment of specific P. chrysosporium mRNAs in organopollutant contaminated soils and in Aspen wood chips. Magnetic capture techniques were used to rapidly purify poly(A)-RNA, and quantitative RT-PCR protocols were developed for all known lignin peroxidase (lip) and cellobiohydrolase (cbh1) genes. The methodology is...

  17. Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

    Science.gov (United States)

    Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

    2009-04-01

    The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

  18. In vitro and in vivo inhibitory effects of some fungicides on catalase produced and purified from white-rot fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Kavakçıoğlu, Berna; Tarhan, Leman

    2014-10-01

    In this study, in vitro and in vivo effects of some commonly used fungicides, antibiotics, and various chemicals on isolated and purified catalase from Phanerochaete chrysosporium were investigated. The catalase was purified 129.10-fold by using 60% ammonium sulfate and 60% ethanol precipitations, DEAE-cellulose anion exchange and Sephacryl-S-200 gel filtration chromatographies from P. chrysosporium growth in carbon- and nitrogen-limited medium for 12 days. The molecular weight of native purified catalase from P. chrysosporium was found to be 290 ± 10 kDa, and sodium dodecyl sulfate (SDS)-PAGE results indicated that enzyme consisted of four apparently identical subunits, with a molecular weight of 72.5 ± 2.5 kDa. Kinetic characterization studies showed that optimum pH and temperature, Km and Vmax values of the purified catalase which were stable in basic region and at comparatively high temperatures were 7.5, 30°C, 289.86 mM, and 250,000 U/mg, respectively. The activity of purified catalase from P. chrysosporium was significantly inhibited by dithiothreitol (DTT), 2-mercaptoethanol, iodoacetamide, EDTA, and sodium dodecyl sulfate (SDS). It was found that while antibiotics had no inhibitory effects, 45 ppm benomyl, 144 ppm captan, and 47.5 ppm chlorothalonil caused 14.52, 10.82, and 38.86% inhibition of purified catalase, respectively. The inhibition types of these three fungicides were found to be non-competitive inhibition with the Ki values of 1.158, 0.638, and 0.145 mM and IC50 values of 0.573, 0.158, 0.010 mM, respectively. The results of in vivo experiments also showed that benomyl, captan and chlorothalonil caused 15.25, 1.96, and 36.70% activity decreases after 24-h treatments compared to that of the control.

  19. Evaluación de la degradación del plaguicida clorpirifos en muestras de suelo utilizando el hongo Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    Margarita María Lopera Mesa

    2005-01-01

    Full Text Available Se evaluó la degradación del insecticida clorpirifos en muestras de suelo durante 21 días, utilizando el hongo Phanerochaete chrysosporium. En los ensayos se obtuvieron porcentajes de degradación, en promedio, para las muestras con hongo, de 96,3, 82,4 y 62,2% cuando se trabajaron, respectivamente, con concentraciones iniciales de clorpirifos de 0,95, 5,3 y 9,4 µg/g. Igualmente, los porcentajes de degradación estuvieron acompañados del aumento en la velocidad de degradación, cuando se partió de la concentración inicial de 0,95 µg/g.

  20. Catabolic fate of Streptomyces viridosporus T7A-Produced, acid precipitable polymeric lignin upon incubation with ligninolytic Streptomyces species and Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Pometto, A.L. III; Crawford, D.L.

    1986-01-01

    Degradation of ground and hot-water-extracted corn stover (Zea mays) lignocellulose by Streptomyces viridosporus T7A generates a water-soluble lignin degradation intermediate termed acid-precipitable polymeric lignin (APPL). The further catabolism of T7A-APPL by S. viridosporus T7A, S. badius 252, and S. setonii75Vi2 was followed for 3 weeks. APPL catabolism by Phanerochaete chrysosporium was followed in stationary cultures in a low-nitrogen medium containing 1% (wt/vol) glucose and 0.05% (wt/vol) T7A-APPL. Metabolism of the APPL was followed by turbidometric assay (600 nm) and by direct measurement of APPL recoverable from the medium. Accumulation and disappearance of soluble low-molecular-weight products of APPL catabolism were followed by gas-liquid chromatography and by high-pressure liquid chromatography, utilizing a diode array detector. Mineralization of a [ 14 C-lignin]APPL was also followed. The percent 14 C recovered as 14 CO 2 , 14 C-APPL, 14 C-labeled water-soluble products, and cell mass-associated radioactivity, were determined for each microorganism after 1 and 3 weeks of incubation in bubbler tube cultures at 37 0 C. P. chrysosporium evolved the most 14 CO 2 , and S. viridosporus gave the greatest decrease in recoverable 14 C-APPL. The results show that S. badius was not able to significantly degrade the APPL, while the other microorganisms demonstrated various APPL-degrading abilities

  1. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    International Nuclear Information System (INIS)

    Zuo, Yanan; Chen, Guiqiu; Zeng, Guangming; Li, Zhongwu; Yan, Ming; Chen, Anwei; Guo, Zhi; Huang, Zhenzhen; Tan, Qiong

    2015-01-01

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag + and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag + to AgNPs

  2. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Zuo, Yanan [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li, Zhongwu; Yan, Ming [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Guo, Zhi; Huang, Zhenzhen; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-03-21

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag{sup +} and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag{sup +} to AgNPs.

  3. Mineralization of 2,4-Dichlorophenoxyacetic Acid (2,4-D) and Mixtures of 2,4-D and 2,4,5-Trichlorophenoxyacetic Acid by Phanerochaete chrysosporium

    Science.gov (United States)

    Yadav, J. S.; Reddy, C. A.

    1993-01-01

    Evidence is presented for mineralization of 2,4-dichlorophenoxyacetic acid (2,4-D) in nutrient-rich media (high-nitrogen and malt extract media) by wild-type Phanerochaete chrysosporium and by a peroxidase-negative mutant of this organism. Mass balance analysis of [U-ring-14C]2,4-D mineralization in malt extract cultures showed 82.7% recovery of radioactivity. Of this, 38.6% was released as 14CO2 and 27.0, 11.2, and 5.9% were present in the aqueous, methylene chloride, and mycelial fractions, respectively. 2,4-D and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) were simultaneously mineralized when presented as a mixture, and mutual inhibition of degradation was not observed. In contrast, a relatively higher rate of mineralization of 2,4-D and 2,4,5-T was observed when these compounds were tested as mixtures than when they were tested alone. PMID:16349039

  4. The putative endoglucanase PcGH61D from Phanerochaete chrysosporium is a metal-dependent oxidative enzyme that cleaves cellulose.

    Directory of Open Access Journals (Sweden)

    Bjørge Westereng

    Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.

  5. SACCHARIFICATION WITH Phanerochaete chrysosporium and ...

    African Journals Online (AJOL)

    cantocanche

    2011-05-09

    May 9, 2011 ... and Pleurotus ostreatus enzymatic extracts of pretreated banana ... reduction in the cost of production (Hahn-Hägerdal et al., ... economy, the saccharification of these materials is necessary ... To efficiently process lignocellulosic wastes, the lignin ..... industries depend on the success in saccharification.

  6. The effectiveness of arbuscular-mycorrhizal fungi and Aspergillus niger or Phanerochaete chrysosporium treated organic amendments from olive residues upon plant growth in a semi-arid degraded soil.

    Science.gov (United States)

    Medina, A; Roldán, A; Azcón, R

    2010-12-01

    Arbuscular mycorrhizal (AM) fungi and a residue from dry olive cake (DOC) supplemented with rock phosphate (RP) and treated with either Aspergillus niger (DOC-A) or Phanerochaete chrysosporium (DOC-P), were assayed in a natural, semi-arid soil using Trifolium repens or Dorycnium pentaphyllum plants. The effects of the AM fungi and/or DOC-A were compared with P-fertilisation (P) over eleven successive harvests to evaluate the persistence of the effectiveness of the treatments. The biomass of dually-treated plants after four successive harvests was greater than that obtained for non-treated plants or those receiving the AM inoculum or DOC-A treatments after eleven yields. The AM inoculation was critical for obtaining plant growth benefit from the application of fermented DOC-A residue. The abilities of the treatments to prevent plant drought stress were also assayed. Drought-alleviating effects were evaluated in terms of plant growth, proline and total sugars concentration under alternative drought and re-watering conditions (8th and 9th harvests). The concentrations of both compounds in plant biomass increased under drought when DOC-A amendment and AM inoculation were employed together: they reinforced the plant drought-avoidance capabilities and anti-oxidative defence. Water stress was less compensated in P-fertilised than in DOC-A-treated plants. DOC-P increased D. pentaphyllum biomass, shoot P content, nodule number and AM colonisation, indicating the greater DOC-transforming ability of P. chrysosporium compared to A. niger. The lack of AM colonisation and nodulation in this soil was compensated by the application of DOC-P, particularly with AM inoculum. The management of natural resources (organic amendments and soil microorganisms) represents an important strategy that assured the growth, nutrition and plant establishment in arid, degraded soils, preventing the damage that arises from limited water and nutrient supply. Copyright © 2010 Elsevier Ltd. All rights

  7. Characterisation of a chimeric Phanerochaete chrysosporium ...

    African Journals Online (AJOL)

    Fred

    soaked tissue paper, the lid of the plastic box was closed and the reaction were incubated at 37oC for 3–4 days. The plastic box with soaked tissue paper provided a humid environment that prevented the media from drying-out. After incubation, the plates were ... cbhI.1 when it was cloned into a pET vector to generate.

  8. Cloning and expression of Phanerochaete chrysosporium ...

    African Journals Online (AJOL)

    Owner

    various industries such as chemicals, fuel, food, brewery and wine, animal-feed, .... and transformed into competent E. coli BL21 cells for vector amplification, repurified ..... Hydrolysis of lignocellulose material for ethanol production: A Review: ...

  9. Saccharification with Phanerochaete chrysosporium and Pleurotus ...

    African Journals Online (AJOL)

    Lignocellulosic biomass has a great potential as raw material for second and third generation biofuels since it is the most abundant carbohydrate on earth and the main component of agricultural waste; however, saccharification of lignocellulosic biomass is crucial for the establishment of a carbohydratebased economy.

  10. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  11. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K

    1978-01-01

    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  12. by Phanerochaete chrysosporium from a binary metal system

    African Journals Online (AJOL)

    drinie

    2001-01-01

    Jan 1, 2001 ... metal concentrations (Ci) increased, independent of initial pH (pHi) and generally the metal with ... The results also show that some portion of the metal ions sorbed by P. ... mechanisms, mainly ion exchange, chelation, adsorption, and ..... YU Q and KAEWSARN P (1999) Binary adsorption of copper(II) and.

  13. Bioreduction of selenite and tellurite by Phanerochaete chrysosporium

    NARCIS (Netherlands)

    Espinosa‐Ortiz, E.J.

    2015-01-01

    Selenium (Se) and tellurium (Te) are elements, they are part of the chalcogens (VI‐A group of the periodic table) and share common properties. These metalloids are of commercial interest due to their physicochemical properties, and they have been used in a broad range of applications in advanced

  14. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  15. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  16. Potensi kapang pelapuk putih Phanerochaeta chrysosporium dalam pengolahan limbah industri tekstil

    Directory of Open Access Journals (Sweden)

    Yulinah Trihadiningrum

    2012-02-01

    Full Text Available Phanerochaete chrysosporium was known as white rot mold which could biodegrade persistent organic pollutants. In this researchthe ability of the mold in biodegrading textile dye direct orange S and rhemazol yellow, which contained naphtol functional group, wasstudied. This research included characterization of the waste water and determination of optimum concentration of the waste water forbiodegradation. The optimum concentration for biodegradation was determined by measuring the radial growth of the mold in agarmedium containing various concentrations of textile dye. The final stage was the application of the mold for biodegrading the textiledye in aerobic batch reactor using the selected concentration.This research showed that P. chrysosporium could grow satisfactorily in minimum medium containing synthetic textile wastewaterin various concentrations. The highest colour removal efficiency of 93% was achieved in 3 days in the waste water with highest colorintensity (absorbance value l520 = 4.00, and 48% in the waste water with absorbance value l520 = 1.22. COD removal efficiency of87% was achieved within 12 days in the wastewater of 30% concentration, and 83% in the waste water of 100% concentration. The pHvalues decreased to 3.23 in the waste water with lower dye concentration and to 3.42 in the higher color intensity, from the initialvalues of 5.0-6.0. This research concluded that P. chrysosporium was capable to biodegrade naphtol textile dye with reasonably highefficiency.

  17. Fungicide selective for basidiomycetes.

    Science.gov (United States)

    Edgington, L V; Walton, G S; Miller, P M

    1966-07-15

    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  18. Heterologous Expression of Phanerochaete chrysoporium Glyoxal Oxidase and its Application for the Coupled Reaction with Manganese Peroxidase to Decolorize Malachite Green

    Science.gov (United States)

    Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing

    2012-01-01

    cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052

  19. Biodegradation of degradable plastic polyethylene by phanerochaete and streptomyces species.

    Science.gov (United States)

    Lee, B; Pometto, A L; Fratzke, A; Bailey, T B

    1991-03-01

    The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placing a sheet of plastic into a drying oven at 70 degrees C under atmospheric pressure and air for 0, 4, 8, 12, 16, or 20 days. The effect of 2-, 4-, and 8-week longwave UV irradiation at 365 nm on plastic biodegradability was also investigated. For shake flask cultures, plastics were chemically disinfected and incubated-shaken at 125 rpm at 37 degrees C in 0.6% yeast extract medium (pH 7.1) for Streptomyces spp. and at 30 degrees C for the fungus in 3% malt extract medium (pH 4.5) for 4 weeks along with an uninoculated control for each treatment. Weight loss data were inconclusive because of cell mass accumulation. For almost every 70 degrees C heat-treated film, the Streptomyces spp. demonstrated a further reduction in percent elongation and polyethylene molecular weight average when compared with the corresponding uninoculated control. Significant (P < 0.05) reductions were demonstrated for the 4- and 8-day heat-treated films by all three bacteria. Heat-treated films incubated with P. chrysosporium consistently demonstrated higher percent elongation and molecular weight average than the corresponding uninoculated controls, but were lower than the corresponding zero controls (heat-treated films without 4-week incubation). The 2- and 4-week UV-treated films showed the greatest biodegradation by all three bacteria. Virtually no degradation by the fungus was observed. To our knowledge, this is the first report demonstrating bacterial degradation of these oxidized polyethylenes in

  20. The genus Phanerochaete (Corticiaceae, Basidiomycotina) sensu lato in Uruguay

    Science.gov (United States)

    Sebastian Martinez; Karen K. Nakasone

    2005-01-01

    Eight species of Phanerochaete are reported from Uruguay for the first time, including a new species, P. vesiculosa. Phanerochaete vesiculosa is characterized by thin-walled, clavate to cylindrical vesicles embedded in the subiculum. A key to the known species of Phanerochaete from Uruguay is provided.

  1. Understanding LiP Promoters from Phanerochaete chrysosporium: A Bioinformatic Analysis

    Science.gov (United States)

    Sergio Lobos; Rubén Polanco; Mario Tello; Dan Cullen; Daniela Seelenfreund; Rafael. Vicuña

    2011-01-01

    DNA contains the coding information for the entire set of proteins produced by an organism. The specific combination of proteins synthesized varies with developmental, metabolic and environmental circumstances. This variation is generated by regulatory mechanisms that direct the production of messenger ribonucleic acid (mRNA) and subsequent translation of the...

  2. Exploring the Synergy between Cellobiose Dehydrogenase from Phanerochaete chrysosporium and Cellulase from Trichoderma reesei

    OpenAIRE

    Wang, Min; Lu, Xuefeng

    2016-01-01

    Recent demands for the production of lignocellulose biofuels boosted research on cellulase. Hydrolysis efficiency and production cost of cellulase are two bottlenecks in biomass to biofuels process. The Trichoderma cellulase mixture is one of the most commonly used enzymes for cellulosic hydrolysis. During hydrolytic process cellobiose accumulation causes feedback inhibition against most cellobiohydrolases and endoglucanases. In this study, we demonstrated the synergism effects between cellob...

  3. and Pb(ii) by Phanerochaete chrysosporium from a binary metal ...

    African Journals Online (AJOL)

    drinie

    2001-01-01

    Jan 1, 2001 ... Kinetic studies revealed that biosorption takes place in two stages: a rapid surface adsorption, within the ... With the help of multi-metal biosorption studies, these complex ..... bioreactor for color removal from bleach effluents.

  4. Oxidative cleavage of a phenolic diarylpropane lignin model dimer by manganese peroxidase from Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Wariishi, Hiroyuki; Valli, K.; Gold, M.H.

    1989-01-01

    In the presence of Mn II and H 2 O 2 , homogeneous manganese peroxidase oxidized 1-(3,5-dimethoxy-4-hydroxyphenyl)-2-(4-methoxyphenyl)-1,3-dihydroxypropane (I) to yield 1-(3,5-dimethoxy-4-hydroxyphenyl)-2-(4-methoxyphenyl)-1-oxo-3-hydroxypropane (II), 2,6-dimethoxy-1,4-benzoquinone (III), 2,6-dimethoxy-1,4-dihydroxybenzene (IV), 1-(4-methoxyphenyl)-1-oxo-2-hydroxyethane (V), 1-(4-methoxyphenyl)-1,2-dihydroxyethane (VI), syringaldehyde (VIII), and 2-(4-methoxyphenyl)-3-hydroxypropanal (IX). Chemically prepared manganese(III) malonate catalyzed the same reactions. Oxidation of I in H 2 18 O under argon resulted in >80% incorporation of 18 O into the phenylglycol VI, the hydroquinone IV, and the quinone III. Oxidation of I in H 2 18 O under aerobic conditions resulted in 40% incorporation of 18 O into VI but no 18 O incorporation into V. Finally, oxidation of I under 18 O 2 resulted in 89% and 28% incorporation of 18 O into V and VI, respectively. These results are explained by mechanisms involving the one-electron oxidation of the substrate I by enzyme-generated Mn III to produce a phenoxy radical intermediate I'. Subsequent C α -C β bond cleavage of the radical intermediate yields syringaldehyde (VIII) and a C 6 -C 2 benzylic radical. Syringaldehyde is oxidized by Mn III in several steps to a cyclohexadiene cation intermediate I double-prime, which is attacked by water to yield the benzoquinone III. The C 6 -C 2 radical is scavenged by O 2 to form a peroxy radical that decomposes to V and VI. In these reactions, Mn III generated by manganese peroxidase catalyzes both formation of the substrate phenoxy radical and oxidation of carbon-centered radical intermediates, to yield reactive cations

  5. Differential expression in Phanerochaete chrysosporium of membrane- associated proteins relevant to lignin degradation

    Science.gov (United States)

    Semarjit Shary; Alexander N. Kapich; Ellen A. Panisko; Jon K. Magnuson; Daniel Cullen; Kenneth E. Hammel

    2008-01-01

    Fungal lignin-degrading systems likely include membrane-associated proteins that participate in diverse processes such as uptake and oxidation of lignin fragments, production of ligninolytic secondary metabolites, and defense of the mycelium against ligninolytic oxidants. Little is known about the nature or regulation of these membrane-associated components. We grew...

  6. Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium

    KAUST Repository

    Espinosa-Ortiz, Erika J.; Gonzalez-Gil, Graciela; Saikaly, Pascal; van Hullebusch, Eric D.; Lens, Piet N L

    2014-01-01

    and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency

  7. A series of Xerophilic Chrysosporium species

    DEFF Research Database (Denmark)

    Skou, Jens-Peder

    1992-01-01

    Xerophilic Chrysosporium species related to C. farinicola were often isolated from uneaten provisions (pollen-and-nectar mixture) of mason bees (Osmia spp.). The fungi have an optimal growth rate on media which are 2 to 3 molar in regard to glucose, exhibit some growth up to 3.6 molar glucose...

  8. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  9. Bio-softening of mature coconut husk for facile coir recovery.

    Science.gov (United States)

    Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

    2007-06-01

    Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

  10. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  11. Biodegradation of Degradable Plastic Polyethylene by Phanerochaete and Streptomyces Species †

    Science.gov (United States)

    Lee, Byungtae; Pometto, Anthony L.; Fratzke, Alfred; Bailey, Theodore B.

    1991-01-01

    The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placing a sheet of plastic into a drying oven at 70°C under atmospheric pressure and air for 0, 4, 8, 12, 16, or 20 days. The effect of 2-, 4-, and 8-week longwave UV irradiation at 365 nm on plastic biodegradability was also investigated. For shake flask cultures, plastics were chemically disinfected and incubated-shaken at 125 rpm at 37°C in 0.6% yeast extract medium (pH 7.1) for Streptomyces spp. and at 30°C for the fungus in 3% malt extract medium (pH 4.5) for 4 weeks along with an uninoculated control for each treatment. Weight loss data were inconclusive because of cell mass accumulation. For almost every 70°C heat-treated film, the Streptomyces spp. demonstrated a further reduction in percent elongation and polyethylene molecular weight average when compared with the corresponding uninoculated control. Significant (P < 0.05) reductions were demonstrated for the 4- and 8-day heat-treated films by all three bacteria. Heat-treated films incubated with P. chrysosporium consistently demonstrated higher percent elongation and molecular weight average than the corresponding uninoculated controls, but were lower than the corresponding zero controls (heat-treated films without 4-week incubation). The 2- and 4-week UV-treated films showed the greatest biodegradation by all three bacteria. Virtually no degradation by the fungus was observed. To our knowledge, this is the first report demonstrating bacterial degradation of these oxidized polyethylenes in pure culture. PMID:16348434

  12. Phylogenetic relationships of the genus Phanerochaete inferred from the internal transcribed spacer region

    Science.gov (United States)

    Theodorus H. de Koker; Karen K. Nakasone; Jacques Haarhof; Harold H. Burdsall; Bernard J.H. Janse

    2003-01-01

    Phanerochaete is a genus of resupinate homobasidiomycetes that are saprophytic on woody debris and logs. Morphological studies in the past indicated that Phanerochaete is a heterogeneous assemblage of species. In this study the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was used to test the monophyly of the genus Phanerochaete and to infer...

  13. Purification of bioactive phenolics from Phanerochaete chysosporium biomass extract on selected macroporous resins

    Science.gov (United States)

    Idris, Z. M.; Dzahir, M. I. H. M.; Jamal, P.; Barkat, A. A.; Xian, R. L. W.

    2017-06-01

    In this study, two different types of macroporous resins known as XAD-7HP and HP-20 were evaluated for the adsorption and desorption properties against bioactive phenolics extracted from Phanerochaete chrysosporium. From the previous static sorption studies, it was found that the adsorption capacity for both resins had has no significant difference. Then, the kinetic adsorption data were analyzed with both pseudo-first-order and pseudo-second-order equations and the later performed better. The adsorption isotherm data were fitted well by both Langmuir and Freundlich models. Meanwhile in desorption study, HP-20 and XAD-7HP gave 90.52% and 88.28% recoveries, respectively. Considering the desorption results of the macroporous resins, HP-20 and XAD-7HP were packed in chromatography column to further purify the phenolics. For dynamic adsorption, breakthrough capacity of HP-20 (0.522) was found to be higher than XAD-7HP (0.131). Different ethanol concentrations (30% to 50% (v/v)) were investigated at fixed flowrate (1 ml/min) on phenolics recovery from both types of resins. The highest recovery of bioactive phenolics was 94.3% using XAD-7HP resins at 50% (v/v) of ethanol. Only 77.1% of bioactive phenolics were recovered using HP-20 resin at the same experimental conditions. The purified extract subsequently was analyzed using HPLC. The results showed that three phenolics (gallic acid 3,4-dihydroxybenzoic acid and 4-hydroxybenzoic acid) were identified with higher concentrations as compared to non-purified extract. Finally, the purified extract was tested for scavenging activity against DPPH, and it showed that the activity increased significantly to 90.80% from 59.94% in non-purified extract.

  14. Gene expression patterns of wood decay fungi Postia placenta and Phanerochaete chrysosporium are influenced by wood substrate composition during degradation

    Science.gov (United States)

    Oleksandr Skyba; Daniel Cullen; Carl J. Douglas; Shawn D. Mansfield

    2016-01-01

    Identification of the specific genes and enzymes involved in the fungal degradation of lignocellulosic biomass derived from feedstocks with various compositions is essential to the development of improved bioenergy processes. In order to elucidate the effect of substrate composition on gene expression in wood-rotting fungi, we employed microarrays based on the...

  15. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

    Science.gov (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

    2014-01-01

    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  16. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  17. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  18. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  19. In vitro effect of Chrysosporium indicum and Chrysosporium keratinophylum on Toxocara canis eggs.

    Science.gov (United States)

    Bojanich, María V; Basualdo, Juan A; Giusiano, Gustavo

    2017-12-05

    The degree of antagonism exercised by fungi on geohelminth development varies according to the morphological alterations caused by different fungal species. Saprophytic fungi may exert ovicidal or ovistatic effects. The aim of this study was to apply scanning electron microscopy (SEM) to observe the action of two soil saprophytic species of Chrysosporium (C. indicum and C. keratinophylum) on Toxocara canis eggs. The fungal strains to be tested were incubated for 28 days at 28°C in 2% water agar with a suspension of unembryonated T. canis eggs. A suspension of T. canis eggs in 2% water agar was used as control group. The assay was done in triplicate for each fungus and the control group. SEM observations were performed on the 4th, 7th, 14th, 21st, and 28th day after inoculation. The effect of the fungi on eggs was evaluated in accordance with the alterations observed on the surface and the changes in the normal characteristics of the eggs. Hyphae around the eggs, appresoria penetrating the shell and changes in the typical egg membrane were observed in this assay. Type 3 effect (alterations that occur both in the embryo and the shell, and hyphal penetration of the eggs) was the prevalent effect. SEM allowed us to observe clearly the morphological alterations in T. canis eggs due to the effect of C. indicum and C. keratinophylum. Both saprophytic species of Chrysosporium alter the egg structure and alterations increase as exposure increases. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2

  1. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  2. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  3. Fatal cutaneous mycosis in tentacled snakes caused by the chrysosporium anamorph of nannizziposis vriesii

    DEFF Research Database (Denmark)

    Bertelsen, Mads Frost; Crawshaw, Graham J.; Sigler, Lynne

    2005-01-01

    The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes......The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes...

  4. Influence Of Chrysosporium Spp. In The Prevalence Of Dermatophytes in Soil

    Directory of Open Access Journals (Sweden)

    Shankar Gokul S

    2001-01-01

    Full Text Available Eighty two soil samples were screened for the prevalence of Chrysosporium and dermatophytes. Out of the 75 positive samples 2 were M. gypseum and 73 were Chrysosporium spp.None of the soil samples yielded both Chrysosporium spp. and M. gypseum. The co- inoculation of Chrysosporium spp. with different species of dermatophytes (T. rubrum. T. Mentagrophytes. E. floccosum and M. gypseum in sterilized soil revealed that none of the dermatophytes except M. gypseum could be recovered after the 15th day of co- inoculation. Whereas, these organisms when inoculated alone in sterilized soil, could be recovered even upto 25 days. In the light of the above finding, we suggest that Chrysosporium spp. might pose a definite challenge to dermatophytes in their saprophytic existence in soil.

  5. Components of the ligninolytic system of Fusarium oxysporum and Trichoderma atroviride

    Energy Technology Data Exchange (ETDEWEB)

    Moenkemann, H.; Hoelker, U.; Hoefer, M. [Universitaet Bonn, Bonn (Germany). Botanisches Institut

    1997-11-01

    The ligninolytic system in the two deuteromycetous fungi Fusarium oxysporum and Trichoderma atroviride, which are able to solubilize low-rank coal, has been proved to have several components. Analysis of the chromosomal DNA of these fungi revealed distinct bands with probes coding for three ligninase isoenzymes, glyoxal oxidase and arylalcohol dehydrogenase of the basidiomycete Phanerochaete chrysosporium. These data constitute a strong indication for the existence in F. oxysporum and T. atroviride of a ligninolytic system comparable to that in P. chrysosporium that may be involved in the process of coal solubilization. 11 refs., 3 figs.

  6. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  7. Structure, computational and biochemical analysis of PcCel45A endoglucanase from Phanerochaete chrysosporium and catalytic mechanisms of GH45 subfamily C members

    DEFF Research Database (Denmark)

    Godoy, Andre S.; Pereira, Caroline S.; Ramia, Marina Paglione

    2018-01-01

    The glycoside hydrolase family 45 (GH45) of carbohydrate modifying enzymes is mostly comprised of ß-1,4-endoglucanases. Significant diversity between the GH45 members has prompted the division of this family into three subfamilies: A, B and C, which may differ in terms of the mechanism, general a...

  8. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  10. Chrysosporium guarroi sp. nov. a new emerging pathogen of pet green iguanas (Iguana iguana).

    Science.gov (United States)

    Abarca, M L; Castellá, G; Martorell, J; Cabañes, F J

    2010-03-01

    Chrysosporium guarroi sp. nov. represented by five strains isolated from cases of dermatomycosis in pet green iguanas (Iguana iguana) in Spain, is described and illustrated. This taxon is characterized by its ability to grow at temperatures from 15 to 37 degrees C and by the presence of arthroconidia and aleurioconidia. The latter are unicellular, smooth, pyriform or clavate, sessile or borne at the ends of narrow stalks. The analysis of the sequences of the D1/D2 and ITS regions confirm the separation of this new species from others of the genus Chrysosporium.

  11. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  12. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  13. Infection with Devriesea agamarum and Chrysosporium guarroi in an inland bearded dragon (Pogona vitticeps).

    Science.gov (United States)

    Schmidt-Ukaj, Silvana; Loncaric, Igor; Klang, Andrea; Spergser, Joachim; Häbich, Annett-Carolin; Knotek, Zdenek

    2014-12-01

    Description of clinical, microbiological and histopathological findings in a case of deep dermatitis in an inland bearded dragon (Pogona vitticeps) caused by Devriesea agamarum and Chrysosporium guarroi. A 4-year-old male inland bearded dragon, weighing 497 g, was presented at the clinic because the animal was suffering from dysecdysis and chronic skin lesions. Large numbers of bacilli, cocci and hyphal elements were diagnosed during the microscopic examination of the wound exudate. Microbiological analysis of a skin specimen revealed a moderate growth of Enterococcus sp. and D. agamarum. The condition of the bearded dragon improved with combined therapy consisting of ceftiofur hydrochloride, voriconazole and meloxicam. However, 3 months later recrudescence was observed. This time, Clostridium sp. and Chrysosporium sp. were isolated in large numbers. The bearded dragon was euthanized. Histopathology confirmed a severe granulomatous dermatitis with associated fungal hyphae and a severe granulomatous hepatitis with intralesional hyphae. Chrysosporium guarroi was identified by PCR and sequencing in two organs (skin and liver). This is the first case of an infection with D. agamarum and C. guarroi in an inland bearded dragon (P. vitticeps). It emphasizes the importance of mycological cultures and specific treatment. Samples of suspected Chrysosporium sp. should be cultured at 30°C for 10-14 days. Early antifungal treatment is necessary to prevent systemic and potentially fatal infection with C. guarroi. © 2014 ESVD and ACVD.

  14. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  15. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  16. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    Energy Technology Data Exchange (ETDEWEB)

    Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.

    2009-07-01

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  17. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  18. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    OpenAIRE

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-01-01

    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  19. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

    Science.gov (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

    2007-04-01

    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  20. Dermatomycosis in a pet inland bearded dragon (Pogona vitticeps) caused by a Chrysosporium species related to Nannizziopsis vriesii.

    Science.gov (United States)

    Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J

    2009-08-01

    A Chrysosporium sp. related to Nannizziopsis vriesii was isolated in pure culture from squames and biopsies of facial lesions in a pet inland bearded dragon (Pogona vitticeps) in Spain. The presence in histological sections of morphologically consistent fungal elements strongly incriminates this fungus as the aetiological agent of infection. Lesions regressed following treatment with oral ketoconazole and topical chlorhexidine and terbinafine until the lizard was lost to follow up 1 month later. The ITS-5.8S rRNA gene of the isolate was sequenced and a search on the GenBank database revealed a high match with the sequences of two Chrysosporium sp. strains recently isolated from green iguanas (Iguana iguana) with dermatomycosis, also in Spain. Phylogenetic analysis of the sequences revealed that all these strains are related to N. vriesii. This is the first report of dermatomycoses caused by a Chrysosporium species related to N. vriesii in a bearded dragon outside North America.

  1. SOLID-PHASE TREATMENT OF A PENTACHLOROPHENOL- CONTAMINATED SOIL USING LIGNIN-DEGRADING FUNGI

    Science.gov (United States)

    The abilities of three lignin-degrading fungi, Phanerochaete chrysosporium, Phanerochaete sordida, and Trametes hirsuta, to deplete pentachlorophenol (PCP) from soil contaminated with PCP and creosote were evaluated. A total of seven fungal and three control treatments ...

  2. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Characterization and mode of action of two acetyl xylan esterases from Chrysosporium lucknowense C1 active towards acetylated xylans

    NARCIS (Netherlands)

    Pouvreau, L.A.M.; Jonathan, M.C.; Kabel, M.A.; Hinz, S.W.A.; Gruppen, H.; Schols, H.A.

    2011-01-01

    Two novel acetyl xylan esterases, Axe2 and Axe3, from Chrysosporium lucknowense (C1), belonging to the carbohydrate esterase families 5 and 1, respectively, were purified and biochemically characterized. Axe2 and Axe3 are able to hydrolyze acetyl groups both from simple acetylated

  4. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

    Science.gov (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

    2008-07-01

    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

  5. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  6. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  7. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  8. Dermatitis and cellulitis in leopard geckos (Eublepharis macularius) caused by the Chrysosporium anamorph of Nannizziopsis vriesii.

    Science.gov (United States)

    Toplon, D E; Terrell, S P; Sigler, L; Jacobson, E R

    2013-07-01

    An epizootic of ulcerative to nodular ventral dermatitis was observed in a large breeding colony of 8-month to 5-year-old leopard geckos (Eublepharis macularius) of both sexes. Two representative mature male geckos were euthanized for diagnostic necropsy. The Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was isolated from the skin lesions, and identification was confirmed by sequencing of the internal transcribed spacer region of the rRNA gene. Histopathology revealed multifocal to coalescing dermal and subcutaneous heterophilic granulomas that contained septate fungal hyphae. There was also multifocal epidermal hyperplasia with hyperkeratosis, and similar hyphae were present within the stratum corneum, occasionally with terminal chains of arthroconidia consistent with the CANV. In one case, there was focal extension of granulomatous inflammation into the underlying masseter muscle. This is the first report of dermatitis and cellulitis due to the CANV in leopard geckos.

  9. Cellulase enzyme production during continuous culture growth of Sporotrichum (Chrysosporium) thermophile

    Energy Technology Data Exchange (ETDEWEB)

    Cossar, D; Canevascini, G

    1986-07-01

    The cellulolytic fungus Sporotrichum (Chrysosporium) thermophile produces an extracellular cellobiose dehydrogenase during batch culture on cellulose or cellobiose. In chemostat culture at pH 5.6 on cellobiose this enzyme was produced in parallel with endo-cellulase. At pH 5.0 in continuous or fed-batch culture such a pattern was not evident. At constant growth rate in a chemostat with varying pH, activity of these enzymes was found to be poorly correlated. Thus the induction of cellobiose dehydrogenase shows a dependence on pH and cellobiose concentration which is different to that for endo-cellulase. The natural inducer of these enzymes and the role of cellubiose dehydrogenase remain to be elucidated.

  10. Cutaneous hyalohyphomycosis caused by a Chrysosporium species related to Nannizziopsis vriesii in two green iguanas (Iguana iguana).

    Science.gov (United States)

    Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J

    2008-06-01

    This report describes the first isolation of a Chrysosporium species as the etiological agent of dermatomycosis in two green iguanas (Iguana iguana). The ITS-5.8S rRNA gene of the two strains was sequenced and a search on the GenBank database revealed that the closest match was Nannizziopsis vriesii. Treatment with oral ketoconazole, in combination with topical 2% chlorhexidine solution and terbinafine resulted in clinical cure.

  11. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  12. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

    Science.gov (United States)

    Terekhova, V A; Semenova, T A

    2005-01-01

    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  13. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  14. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  15. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  16. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  17. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  18. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  20. Bioremediation of the neonicotinoid insecticide clothianidin by the white-rot fungus Phanerochaete sordida.

    Science.gov (United States)

    Mori, Toshio; Wang, Jianqiao; Tanaka, Yusuke; Nagai, Kaoru; Kawagishi, Hirokazu; Hirai, Hirofumi

    2017-01-05

    Clothianidin (CLO) is a member of the neonicotinoid pesticides, which have been widely used worldwide over the last two decades. However, its toxicity for bees and neurological toxicity for humans are urgent problems. Here, the degradation of CLO by the white-rot fungus Phanerochaete sordida was examined in nitrogen-limited liquid medium. After incubation for 20days at 30°C, 37% of CLO was degraded in the cultures. High-resolution ESI-MS and NMR analyses of the culture supernatant identified N-(2-chlorothiazol-5-yl-methyl)-N'-methylurea (TZMU) as a metabolite of CLO degradation. The addition of cytochrome P450 inhibitors to the culture medium markedly reduced the degradation of CLO by P. sordida. And manganese peroxidase, a major ligninolytic enzyme secreted by this fungus, were not carried out CLO degradation. The effects of CLO and TZMU on the viability of the neuronal cell line Neuro2a demonstrated that P. sordida effectively degrades CLO into a metabolite that lacks neurotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  2. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  3. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  4. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  5. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  6. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  7. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  8. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

    Science.gov (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

    2004-01-01

    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  9. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  10. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  11. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  12. Mn(II) regulation of lignin peroxidases and manganese-dependent peroxidases from lignin-degrading white rot fungi

    International Nuclear Information System (INIS)

    Bonnarme, P.; Jeffries, T.W.

    1990-01-01

    Two families of peroxidases-lignin peroxidase (LiP) and manganese-dependent lignin peroxidase (MnP)-are formed by the lignin-degrading white rot basidiomycete Phanerochaete chrysosporium and other white rot fungi. Isoenzymes of these enzyme families carry out reactions important to the biodegradation of lignin. This research investigated the regulation of LiP and MnP production by Mn(II). In liquid culture, LiP titers varied as an inverse function of and MnP titers varied as a direct function of the Mn(II) concentration. The extracellular isoenzyme profiles differed radically at low and high Mn(II) levels, whereas other fermentation parameters, including extracellular protein concentrations, the glucose consumption rate, and the accumulation of cell dry weight, did not change significantly with the Mn(II) concentration. In the absence of Mn(II), extracellular LiP isoenzymes predominated, whereas in the presence of Mn(II), MnP isoenzymes were dominant. The release of 14 CO 2 from 14 C-labeled dehydrogenative polymerizate lignin was likewise affected by Mn(II). The rate of 14 CO 2 release increased at low Mn(II) and decreased at high Mn(II) concentrations. This regulatory effect of Mn(II) occurred with five strains of P. chrysosporium, two other species of Phanerochaete, three species of Phlebia, Lentinula edodes, and Phellinus pini

  13. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

    Science.gov (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

    2017-08-25

    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  14. Purification, cloning and characterisation of two forms of thermostable and highly active cellobiohydrolase I (Cel7A) produced by the industrial strain of Chrysosporium lucknowense

    NARCIS (Netherlands)

    Gusakov, A.V.; Sinitsyn, A.P.; Salanovich, T.N.; Bukhtojarov, F.E.; Markov, A.V.; Ustinov, B.B.; Zeijl, C.V.; Punt, P.; Burlingame, R.

    2005-01-01

    Two forms of cellobiohydrolase I (CBH I, Cel7A) were purified from the culture ultrafiltrate of a mutant strain of the fungus Chrysosporium lucknowense, an industrial producer of cellulases and hemicellulases. The enzymes had different molecular masses (52 and 65 kDa, SDS-PAGE data) but the same pI

  15. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  16. Molecular characterization of reptile pathogens currently known as members of the chrysosporium anamorph of Nannizziopsis vriesii complex and relationship with some human-associated isolates.

    Science.gov (United States)

    Sigler, Lynne; Hambleton, Sarah; Paré, Jean A

    2013-10-01

    In recent years, the Chrysosporium anamorph of Nannizziopsis vriesii (CANV), Chrysosporium guarroi, Chrysosporium ophiodiicola, and Chrysosporium species have been reported as the causes of dermal or deep lesions in reptiles. These infections are contagious and often fatal and affect both captive and wild animals. Forty-nine CANV isolates from reptiles and six isolates from human sources were compared with N. vriesii based on their cultural characteristics and DNA sequence data. Analyses of the sequences of the internal transcribed spacer and small subunit of the nuclear ribosomal gene revealed that the reptile pathogens and human isolates belong in well-supported clades corresponding to three lineages that are distinct from all other taxa within the family Onygenaceae of the order Onygenales. One lineage represents the genus Nannizziopsis and comprises N. vriesii, N. guarroi, and six additional species encompassing isolates from chameleons and geckos, crocodiles, agamid and iguanid lizards, and humans. Two other lineages comprise the genus Ophidiomyces, with the species Ophidiomyces ophiodiicola occurring only in snakes, and Paranannizziopsis gen. nov., with three new species infecting squamates and tuataras. The newly described species are Nannizziopsis dermatitidis, Nannizziopsis crocodili, Nannizziopsis barbata, Nannizziopsis infrequens, Nannizziopsis hominis, Nannizziopsis obscura, Paranannizziopsis australasiensis, Paranannizziopsis californiensis, and Paranannizziopsis crustacea. Chrysosporium longisporum has been reclassified as Paranannizziopsis longispora. N. guarroi causes yellow fungus disease, a common infection in bearded dragons and green iguanas, and O. ophiodiicola is an emerging pathogen of captive and wild snakes. Human-associated species were not recovered from reptiles, and reptile-associated species were recovered only from reptiles, thereby mitigating concerns related to zoonosis.

  17. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  18. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.

    1980-01-01

    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  19. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

    OpenAIRE

    Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

    2006-01-01

    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  20. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  1. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  2. Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii in captive coastal bearded dragons (Pogona barbata).

    Science.gov (United States)

    Johnson, R S P; Sangster, C R; Sigler, L; Hambleton, S; Paré, J A

    2011-12-01

    Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was diagnosed in a group of coastal bearded dragons (Pogona barbata). The outbreak extended over a 6-month period, with four of six lizards from the same zoological outdoor enclosure succumbing to infection. A fifth case of dermatomycosis was identified in a pet lizard originally sourced from the wild. Diagnosis of infection with the CANV was based on similar clinical signs and histopathology in all animals and confirmed by culture and sequencing of the fungus from one animal. This is the first report of the CANV causing disease in a terrestrial reptile species in Australia and the first in the coastal bearded dragon. © 2011 The Authors. Australian Veterinary Journal © 2011 Australian Veterinary Association.

  3. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  4. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  5. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  6. [Oil degradation by basidiomycetes in soil and peat at low temperatures].

    Science.gov (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

    2016-01-01

    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  7. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  8. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  9. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  10. Voriconazole, a safe alternative for treating infections caused by the Chrysosporium anamorph of Nannizziopsis vriesii in bearded dragons (Pogona vitticeps).

    Science.gov (United States)

    Van Waeyenberghe, L; Baert, K; Pasmans, F; van Rooij, P; Hellebuyck, T; Beernaert, L; de Backer, P; Haesebrouck, F; Martel, A

    2010-09-01

    Dermal and systemic infections caused by the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) are highly prevalent in reptiles and may result in severe disease and high mortality. Due to the high incidence of therapeutic failures, optimizing treatment is required. We first determined in this study the minimal inhibitory concentrations (MIC) of itraconazole, voriconazole, amphotericin B and terbinafine against 32 CANV isolates. For voriconazole, amphotericin B and terbinafine a monomodal MIC distribution was seen, whereas a bimodal MIC distribution was present for itraconazole, indicating acquired resistance in one isolate. Fourteen naturally-infected bearded dragons (Pogona vitticeps), from the same owner, were treated orally with either itraconazole (5 mg/kg q24h) or voriconazole (10 mg/kg q24h). The clinical condition, drug plasma concentrations and the presence of CANV in skin samples were followed. The animals were treated until complete clearance of the fungus. The plasma concentrations of voriconazole and itraconazole exceeded the minimal inhibitory concentrations of the CANV isolates. Elimination of CANV was achieved on average after 27 and 47 days of treatment with itraconazole and voriconazole, respectively. Whereas only 2 out of 7 survived after itraconazole treatment, only a single animal died in the voriconazole treated group. In conclusion, based on a limited number of animals, voriconazole applied at a regimen of 10 mg/kg bodyweight (BW) q24h seems to be a safe and effective antimycotic drug to eliminate CANV infections in bearded dragons.

  11. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  12. Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20)

    OpenAIRE

    Karakaya, Pelin; Christodoulatos, Christos; Koutsospyros, Agamemnon; Balas, Wendy; Nicolich, Steve; Sidhoum, Mohammed

    2009-01-01

    The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the...

  13. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  14. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  15. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    Science.gov (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  16. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze

    2016-09-01

    Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  18. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  19. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  20. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  1. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  2. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  3. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  4. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

    Science.gov (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

    2018-05-03

    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  5. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  6. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  7. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  8. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  9. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.

    1981-01-01

    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  10. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  11. Pretreatment of lignocellulosic material with fungi capable of higher lignin degradation and lower carbohydrate degradation improves substrate acid hydrolysis and the eventual conversion to ethanol

    Energy Technology Data Exchange (ETDEWEB)

    Kuhar, S.; Nair, L.M.; Kuhad, R.C. [Delhi Univ., New Delhi (India). Dept. of Microbiology, Lignocellulose Biotechnology Laboratory

    2008-04-15

    Lignocellulosic biomass is the most abundant energy resource in the world and is a potential source of carbon substrate for the production of ethanol via fermentation. However, the presence of lignin restricts access to holocellulose. It is necessary to break or remove the lignin in plant residues prior to their hydrolysis. Pretreatment is needed to liberate cellulose and hemicellulose from the lignins. This paper discussed a biological delignification method that avoided the use of toxic and corrosive chemicals. The in situ microbial delignification process used white rot fungi as a basidiomycetes for biological pretreatment. The study examined the capability of 4 basidiomycetes fungi, notably: (1) Phanerochaete chrysosporium; (2) Pycnoporus cinnabarinus; (3) fungal isolate RCK-1; and (4) fungal isolate RCK-3. The fungi were used to delignify wheat straw and improve hydrolysis procedures. Attempts were also made to ferment the acid hydrolysates from fungal-pretreated lignocellulosic materials. Results of the experiment showed that higher yields of ethanol were obtained using selective lignin-degrading fungi as a pretreatment method. 39 refs., 3 tabs., 4 figs.

  12. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    Science.gov (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  13. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  14. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

    Science.gov (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

    2015-01-01

    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  15. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  16. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  17. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

    2003-07-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  18. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  19. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  20. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  1. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A

    2000-12-01

    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  2. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner

    2013-01-01

    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  3. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  4. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  5. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

    1990-01-01

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  6. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  7. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  8. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina

    2017-05-01

    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  9. Biotechnological modification of lignin

    Energy Technology Data Exchange (ETDEWEB)

    1989-01-01

    A literature search of organisms capable of degrading lignin was conducted. Four fungi were selected for study and these were Phanerochaete chrysosporium, Chrysosporium pruinosum, Phlebia tremellosus and Trametes versicolor. Other organisms, Pleurotus ostreatus, Pleurotus florida and Lentinus edodes were also tested in preliminary experiments. All cultures were screened for their ability to degrade the lignin component of aspen sawdust and also lignin extracted from steam-exploded wood. This type of screen was followed by analysis of culture filtrates for the presence of ligninase, the marker enzyme for lignin degradation. Phanerochaete chrysosporium and consequently chosen for further studies in fermentors. Considerable efforts were directed to production of ligninase in fermentors. Only when Chrysosporium pruinosum was pre-cultured in a shake flask for 4 days and then transferred to a fermentor could ligninase activity be detected. The enzyme from shake flasks has been concentrated ready for use in bench-scale studies on cell-free depolymerization of lignin. 13 refs., 8 tabs.

  10. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  11. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  12. Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, J R; An, C H; Yuan, J M

    2005-01-01

    The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

  13. Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, Jianrong

    2003-01-15

    The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

  14. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  15. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  16. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  17. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  18. The biodiversity of microbial cytochromes P450.

    Science.gov (United States)

    Kelly, Steven L; Lamb, David C; Jackson, Colin J; Warrilow, Andrew G; Kelly, Diane E

    2003-01-01

    The cytochrome P450 (CYP) superfamily of genes and proteins are well known for their involvement in pharmacology and toxicology, but also increasingly for their importance and diversity in microbes. The extent of diversity has only recently become apparent with the emergence of data from whole genome sequencing projects and the coming years will reveal even more information on the diversity in microbial eukaryotes. This review seeks to describe the historical development of these studies and to highlight the importance of the genes and proteins. CYPs are deeply involved in the development of strategies for deterrence and attraction as well as detoxification. As such, there is intense interest in pathways of secondary metabolism that include CYPs in oxidative tailoring of antibiotics, sometimes influencing potency as bioactive compounds. Further to this is interest in CYPs in metabolism of xenobiotics for use as carbon sources for microbial growth and as biotransformation agents or in bioremediation. CYPs are also current and potential drug targets; compounds inhibiting CYP are antifungal and anti-protozoan agents, and potentially similar compounds may be useful against some bacterial diseases such as tuberculosis. Of note is the diversity of CYP requirements within an organism, ranging from Escherichia coli that has no CYPs as in many bacteria, to Mycobacterium smegmatis that has 40 representing 1% of coding genes. The basidiomycete fungus Phanerochaete chrysosporium surprised all when it was found to contain a hundred or more CYPs. The functional genomic investigation of these orphan CYPs is a major challenge for the future.

  19. Computational studies on LiP H isolated from Ganoderma lucidum GD88

    Directory of Open Access Journals (Sweden)

    Parambayil Nayana

    2015-01-01

    Full Text Available Ganoderma lucidum is a basidiomycete fungus that produces ligninase for the modification of lignin. Lignin peroxidase (LiP is a glycoprotein that acts on the recalcitrant cell wall component lignin. In the present study, the phylogenetic analysis of Ganoderma lucidum GD88 with the partial coding sequence (cds of other LiP isoforms was performed using MEGA6. After determination of the open reading frame, the +3 frame nucleotide sequence was converted to protein using the EMBOSS Transseq and the secondary structure was predicted using the Chou and Fasman Secondary Structure Prediction server (CFSSP. Protein modeling was also performed by SWISS-MODEL. The obtained result shows that the lipH partial cds of Ganoderma lucidum GD88 is homologous to the lipD gene of Phanerochaete chrysosporium. The secondary structure prediction result revealed that the percent content of the helix (67 is higher than the percent contents of sheet (53.4 and turns (13.6. According to the generated model, LiP H protein is a homodimer with chains A and B. The heme acts as a ligand and plays a major role in structure stabilization.

  20. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  1. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

    Science.gov (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

    2017-04-01

    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  2. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  3. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  4. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  5. A new mechanism of biopulping : attachment of acid groups on fiber

    Science.gov (United States)

    William R. Kenealy; Chris Hunt; Eric Horn; Carl Houtman

    2004-01-01

    We analyzed the physical properties of wood chips incubated with Ceriporiopsis subvermispora and cultural parameters of biopulping incubations of Phanerochaete chrysosporium and C. subvermispora. Dynamic mechanical analyses indicated a reduction in the modulus of elasticity (MOE) and loss modulus of spruce during the time where the biopulping energy savings effect...

  6. Immobilization of Irpex lacteus to liquid-core alginate beads and their application to degradation of pollutants

    Czech Academy of Sciences Publication Activity Database

    Šíma, J.; Milne, R.; Novotný, Čeněk; Hasal, P.

    2017-01-01

    Roč. 62, č. 4 (2017), s. 335-342 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGI * ROTATING BIOLOGICAL CONTACTOR * PHANEROCHAETE-CHRYSOSPORIUM Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.521, year: 2016

  7. Effect of metal ions on autofluorescence of the dry rot fungus Serpula lacrymans grown on spruce wood

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Žižka, Zdeněk; Švec, Karel; Nasswettrová, A.; Šmíra, P.; Kofroňová, Olga; Benada, Oldřich

    2016-01-01

    Roč. 61, č. 2 (2016), s. 119-128 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : HEAVY-METALS * CELL-WALL * PHANEROCHAETE-CHRYSOSPORIUM Subject RIV: EE - Microbiology, Virology Impact factor: 1.521, year: 2016

  8. Biosorption characteristics of Aspergillus fumigatus in removal of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... in growth medium, thus about 20% of the isolates can grow up to 50 mg Cd/100 ml medium and only ... have the highest Cd biosorption, compared to yeast malt extract (YM) and sabourad (Sb) media. ... chemical parameters of the solution, say, temperature, ...... inactivated Phanerochaete chrysosporium.

  9. Biodegradation of Phenol Adsorbed on Soil in the Presence of Polycyclic Aromatic Hydrocarbons.

    Czech Academy of Sciences Publication Activity Database

    Maléterová, Ywetta; Matějková, Martina; Demnerová, K.; Stiborová, H.; Kaštánek, František; Šolcová, Olga

    2016-01-01

    Roč. 3, č. 1 (2016), s. 87-98 ISSN 2397-2076 R&D Projects: GA TA ČR TA04020700 Institutional support: RVO:67985858 Keywords : polycyclic artomatic hydrocarbons * phenol * bioremediation * candida tropicalis * phanerochaete chrysosporium Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  10. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    International Nuclear Information System (INIS)

    Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.

    2009-01-01

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  11. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    Energy Technology Data Exchange (ETDEWEB)

    Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.

    2009-07-01

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  12. CYP63A2, a catalytically versatile fungal P450 monooxygenase capable of oxidizing higher-molecular-weight polycyclic aromatic hydrocarbons, alkylphenols, and alkanes

    Science.gov (United States)

    Cytochrome P450 monooxygenases (P450s) are known to oxidize hydrocarbons albeit with limited substrate specificity across classes of these compounds. Here we report a P450 monooxygenase (CYP63A2) from the model ligninolytic white rot fungus Phanerochaete chrysosporium that was fo...

  13. Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

    Science.gov (United States)

    Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

    2013-06-01

    Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

  14. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  15. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

    Science.gov (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

    2017-10-01

    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Solid State production of manganese peroxidases using arecanut husk as substrate

    Directory of Open Access Journals (Sweden)

    Akhila Rajan

    2010-06-01

    Full Text Available The lignocellulosic biomass from arecanut husk (Areca catechu Linnaeus was evaluated as a new substrate for cultivation of Phanerochaete chrysosporium and Phanerochaete sp for solid state fermentation of manganese peroxidase (MnP. Arecanut had a moisture content of 79.84 % for ripe nut husk whereas green nut husk had 68.39 % moisture and a pH of 5.0, 3.0 and 7.0 for raw, ripe and dry husk. Reducing sugar content was 14.31, 19.21 and 1.77(mg/g of husk for raw, ripe and dry nut husk, respectively. Non reducing sugar was 1.04(mg/g of husk for raw and 0.68 (mg/g of husk for dry husk. Solid state fermentation carried out at different pH showed optimum enzyme production at pH 6.0 (52.60 IU/g for P.chrysosporium and pH 5.0 (44.08 IU/g for Phanerochaete sp. Optimum temperature was 30 ± 2º C for both the organisms. Lower concentration of MnSO4 (0.1 mM MnSO4 induced maximum enzyme production in P.chrysosporium whereas Phanerochaete sp. required 1 mM MnSO4 for induction. Absence of carbon and nitrogen stimulated enzyme production in P.chrysosporium while Phanerochaete sp. needed nitrogen. Enzyme was partially purified by ammonium sulphate precipitation followed by ion exchange chromatography.

  18. Survey and analysis of simple sequence repeats in the Laccaria bicolor genome, with development of microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2011-01-01

    It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.

  19. A novel combined thermometric and amperometric biosensor for lactose determination based on immobilised cellobiose dehydrogenase.

    Science.gov (United States)

    Yakovleva, Maria; Buzas, Orsolya; Matsumura, Hirotoshi; Samejima, Masahiro; Igarashi, Kiyohiko; Larsson, Per-Olof; Gorton, Lo; Danielsson, Bengt

    2012-01-15

    A novel method for lactose determination in milk is proposed. It is based on oxidation of lactose by cellobiose dehydrogenase (CDH) from the basidiomycete Phanerochaete chrysosporium, immobilised in an enzyme reactor. The reactor was prepared by cross-linking CDH onto aminopropyl-silanised controlled pore glass (CPG) beads using glutaraldehyde. The combined biosensor worked in flow injection analysis (FIA) mode and was developed for simultaneous monitoring of the thermometric signal associated with the enzymatic oxidation of lactose using p-benzoquinone as electron acceptor and the electrochemically generated current associated with the oxidation of the hydroquinone formed. A highly reproducible linear response for lactose was obtained between 0.05 mM and 30 mM. For a set of more than 500 samples an R.S.D. of less than 10% was achieved. The assay time was ca. 2 min per sample. The sensor was applied for the determination of lactose in dairy milk samples (milk with a fat content of 1.5% or 3% and also "lactose free" milk). No sample preparation except dilution with buffer was needed. The proposed method is rapid, suitable for repeated use and allows the possibility to compare results from two different detection methods, thus providing a built-in quality assurance. Some differences in the response observed between the methods indicate that the dual approach can be useful in mechanistic studies of redox enzymes. In addition, a dual system opens up interesting possibilities for studies of enzyme properties and mechanisms. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2007-08-01

    Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

  1. Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20

    Directory of Open Access Journals (Sweden)

    Steve Nicolich

    2009-04-01

    Full Text Available The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the CL-20 concentration; levels of carbon (as glycerol and ammonium sulfate and yeast extract as sources of nitrogen. Cultures that received CL-20 at the time of inoculation transformed CL-20 completely under all nutrient conditions studied. When CL-20 was added to pre-grown cultures, degradation was limited. The extent of mineralization was monitored by the 14CO2 time evolution; up to 51% mineralization was achieved when the fungus was incubated with [14C]-CL-20. The kinetics of CL-20 biodegradation by Phanerochaete chrysosporium follows the logistic kinetic growth model.

  2. Type studies in Basidiomycetes. X

    NARCIS (Netherlands)

    Singer, R.

    1961-01-01

    For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The

  3. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    Science.gov (United States)

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  4. A kingdom-specific protein domain HMM library for improved annotation of fungal genomes

    Directory of Open Access Journals (Sweden)

    Oliver Stephen G

    2007-04-01

    Full Text Available Abstract Background Pfam is a general-purpose database of protein domain alignments and profile Hidden Markov Models (HMMs, which is very popular for the annotation of sequence data produced by genome sequencing projects. Pfam provides models that are often very general in terms of the taxa that they cover and it has previously been suggested that such general models may lack some of the specificity or selectivity that would be provided by kingdom-specific models. Results Here we present a general approach to create domain libraries of HMMs for sub-taxa of a kingdom. Taking fungal species as an example, we construct a domain library of HMMs (called Fungal Pfam or FPfam using sequences from 30 genomes, consisting of 24 species from the ascomycetes group and two basidiomycetes, Ustilago maydis, a fungal pathogen of maize, and the white rot fungus Phanerochaete chrysosporium. In addition, we include the Microsporidion Encephalitozoon cuniculi, an obligate intracellular parasite, and two non-fungal species, the oomycetes Phytophthora sojae and Phytophthora ramorum, both plant pathogens. We evaluate the performance in terms of coverage against the original 30 genomes used in training FPfam and against five more recently sequenced fungal genomes that can be considered as an independent test set. We show that kingdom-specific models such as FPfam can find instances of both novel and well characterized domains, increases overall coverage and detects more domains per sequence with typically higher bitscores than Pfam for the same domain families. An evaluation of the effect of changing E-values on the coverage shows that the performance of FPfam is consistent over the range of E-values applied. Conclusion Kingdom-specific models are shown to provide improved coverage. However, as the models become more specific, some sequences found by Pfam may be missed by the models in FPfam and some of the families represented in the test set are not present in FPfam

  5. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  6. Photochemical and microbial degradation technologies to remove toxic chemicals

    International Nuclear Information System (INIS)

    Matsumura, F.; Katayama, A.

    1992-01-01

    An effort was made to apply photochemical degradation technology on biodegradation processes to increase the bioremediation potential of microbial actions. For this purpose, we have chosen Phanerochaete chrysosporium, a wood decaying white-rot fungus and a variety of chlorinated pesticides and aromatics as study materials. By using UV-irradiation and benomyl (a commonly used fungicide) as selection methods, a strain of UV-resistant P. chrysosporium was developed. This strain was found to be capable of rapidly degrading these chlorinated chemicals when they were incubated in N-deficient medium which received 1 hr/day of UV-irradiation. UV-irradiation either at 300 or 254 nm showed the beneficial effect of speeding up the rate of degradation on most of test chemicals with the exception of toxaphene and HCH (hexachlorocyclohexane). By adding fresh glucose to the medium it was possible to maintain high degradation capacity for several weeks

  7. Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

    International Nuclear Information System (INIS)

    Luey, J.; Brouns, T.M.; Elliott, M.L.

    1990-11-01

    The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT ampersand E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable for the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs

  8. Photochemical and microbial degradation technologies to remove toxic chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Matsumura, F.; Katayama, A.

    1992-07-01

    An effort was made to apply photochemical degradation technology on biodegradation processes to increase the bioremediation potential of microbial actions. For this purpose, we have chosen Phanerochaete chrysosporium, a wood decaying white-rot fungus and a variety of chlorinated pesticides and aromatics as study materials. By using UV-irradiation and benomyl (a commonly used fungicide) as selection methods, a strain of UV-resistant P. chrysosporium was developed. This strain was found to be capable of rapidly degrading these chlorinated chemicals when they were incubated in N-deficient medium which received 1 hr/day of UV-irradiation. UV-irradiation either at 300 or 254 nm showed the beneficial effect of speeding up the rate of degradation on most of test chemicals with the exception of toxaphene and HCH (hexachlorocyclohexane). By adding fresh glucose to the medium it was possible to maintain high degradation capacity for several weeks.

  9. Animal bioavailability of defined xenobiotic lignin metabolites

    International Nuclear Information System (INIS)

    Sandermann, H. Jr.; Arjmand, M.; Gennity, I.; Winkler, R.; Struble, C.B.; Aschbacher, P.W.

    1990-01-01

    Lignin has been recognized as a major component of bound pesticide residues in plants and is thought to be undigestible in animals. Two defined ring-U- 14 C-labeled chloroaniline/lignin metabolites have now been fed to rats, where a release of ∼66% of the bound xenobiotic occurred in the form of simple chloroaniline derivatives. The observed high degree of bioavailability indicates that bound pesticidal residues may possess ecotoxicological significance. In parallel studies, the white-rot fungus Phanerochaete chrysosporium was more efficient, and a soil system was much less efficient, in the degradation of the [ring-U- 14 C]chloroaniline/lignin metabolites

  10. Biotransformations of organic energetic materials

    International Nuclear Information System (INIS)

    Matousek, J.

    2001-01-01

    This paper reviews data on the acute eco-toxicity and delayed effects (mutagenicity) of the model substance (TNT) and of a wide spectrum of its biodegradation products in the wastewaters. It also suggests main metabolic pathways of biotransformation, involving biological reduction. Some possibilities of remediation of contaminated soils utilising microbial catabolic pathways leading to the hydroxy derivatives and up to the cleavage of the aromatic ring system in the presence of the soil bacteria Pseudomonas fluorescens are shown, as well as the practical utilisation of fungi Phanerochaete chrysosporium under aerobic conditions

  11. Fiscal 2000 achievement report on the venture business assisting type regional consortium - Core industry creation type. Research and development of energy conservation oriented collective detoxification system for dioxins and toxic heavy metals in fly ash and soil; 2000 nendo chiiki consortium kenkyu kaihatsu jigyo seika hokokusho. Hibai dojochu no dioxin rui yugai jukinzoku no sho energy gata ikkatsu mugaika shori system ni kansuru kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Efforts are made to develop a system to collectively detoxify dioxins and heavy metals in incinerator fly ash or in polluted soil using microbes and/or chemicals. In the use of chemicals, verification tests are conducted for a system to detoxify dioxins and toxic heavy metals simultaneously. In the use of microbes, an effort is made to develop a low cost energy conservation type treatment system based on what is provided by the study of microbes such as Phanerochaete chrysosporium. As for the treatment of fly ash, an effort is made to recycle it into resources usable in the development of marketable products. For the detoxification of dioxins using chemicals, they are dechlorinated in a chemical reduction reaction. For their detoxification with help of microbes, it is found in an experiment of ash fly dioxin decomposition using Phanerochaete chrysosporium that the microbe reduces dioxins in both liquid phase and solid phase systems. The result of verification tests using chemicals shows that the reference level of 3ng-TEQ/g is easily cleared in the treatment of high concentration ash fly. In the detoxification of heavy metals, data is obtained indicating that the elution level of lead in ash fly is found reduced by 70-85% after treatment. (NEDO)

  12. Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

    Science.gov (United States)

    Koutrotsios, Georgios; Zervakis, Georgios I.

    2014-01-01

    Olive mill wastewater (OMW) constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water) resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent's decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64%) followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW's phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment. PMID:24987685

  13. Enhancement of Cotton Stalks Composting with Certain Microbial Inoculations

    Directory of Open Access Journals (Sweden)

    Osama Abdel-Twab Seoudi

    2013-01-01

    Full Text Available Effect of inoculation with Phanerochaete chrysosporium and Azotobacter chrococcum microbes on cotton stalks composting was studied in an attempt to achieve rapid maturity and desirable characteristics of produced compost. Composting process was maintained for 16 weeks under aerobic conditions with proper moisture content and turning piles. The C/N ratio of the mixtures was adjusted to about 30:1 before composting using chicken manure. Temperature evolution and its profile were monitored throughout the composting period. Mineralization rates of organic matter and changes in nitrogen content during composting stages were evaluated. Total plate count of mesophilic and thermophilic bacteria, cellulose decomposers and Azotobacter were determined during composting periods. The treatment of cotton stalks inoculated with both P. chrysosporium and Azotobacter gave the most desirable characteristics of the final product with respect to the narrow C/N ratio, high nitrogen content and high numbers of Azotobacter. The phytotoxicity test of compost extracts was evaluated. The use of P. chrysosporium in composting accelerated markedly decomposition process, so that 16 weeks composting enough to produce a stable and mature compost suitable for use as fertilizer while the fertilizer obtained by composting cotton stalks mixed with chicken manure and inoculated with microorganisms is highest quality Compost.

  14. Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

    Directory of Open Access Journals (Sweden)

    Georgios Koutrotsios

    2014-01-01

    Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.

  15. Utilization of fruit peels as carbon source for white rot fungi biomass production under submerged state bioconversion

    Directory of Open Access Journals (Sweden)

    Olorunnisola Kola Saheed

    2016-04-01

    Full Text Available The present generation of nutrient rich waste streams within the food and hospitality industry is inevitable and remained a matter of concern to stakeholders. Three white rot fungal strains were cultivated under submerged state bioconversion (SmB. Fermentable sugar conversion efficiency, biomass production and substrate utilization constant were indicators used to measure the success of the process. The substrates – banana peel (Bp, pineapple peel (PAp and papaya peel (Pp were prepared in wet and dried forms as substrates. Phanerochaete chrysosporium (P. chrysosporium, Panus tigrinus M609RQY, and RO209RQY were cultivated on sole fruit wastes and their composites. All fungal strains produced profound biomass on dry sole wet substrates, but wet composite substrates gave improved results. P. tigrinus RO209RQY was the most efficient in sugar conversion (99.6% on sole substrates while P. tigrinus M609RQY was efficient on composite substrates. Elevated substrate utilization constant (Ku and biomass production heralded wet composite substrates. P. chrysosporium was the most performing fungal strain for biomass production, while PApBp was the best composite substrate.

  16. Biomass pyrolysis liquid to citric acid via 2-step bioconversion.

    Science.gov (United States)

    Yang, Zhiguang; Bai, Zhihui; Sun, Hongyan; Yu, Zhisheng; Li, Xingxing; Guo, Yifei; Zhang, Hongxun

    2014-12-31

    The use of fossil carbon sources for fuels and petrochemicals has serious impacts on our environment and is unable to meet the demand in the future. A promising and sustainable alternative is to substitute fossil carbon sources with microbial cell factories converting lignocellulosic biomass into desirable value added products. However, such bioprocesses require tolerance to inhibitory compounds generated during pretreatment of biomass. In this study, the process of sequential two-step bio-conversion of biomass pyrolysis liquid containing levoglucosan (LG) to citric acid without chemical detoxification has been explored, which can greatly improve the utilization efficiency of lignocellulosic biomass. The sequential two-step bio-conversion of corn stover pyrolysis liquid to citric acid has been established. The first step conversion by Phanerochaete chrysosporium (P. chrysosporium) is desirable to decrease the content of other compounds except levoglucosan as a pretreatment for the second conversion. The remaining levoglucosan in solution was further converted into citric acid by Aspergillus niger (A. niger) CBX-209. Thus the conversion of cellulose to citric acid is completed by both pyrolysis and bio-conversion technology. Under experimental conditions, levoglucosan yield is 12% based on the feedstock and the citric acid yield can reach 82.1% based on the levoglucosan content in the pyrolysis liquid (namely 82.1 g of citric acid per 100 g of levoglucosan). The study shows that P. chrysosporium and A. niger have the potential to be used as production platforms for value-added products from pyrolyzed lignocellulosic biomass. Selected P. chrysosporium is able to decrease the content of other compounds except levoglucosan and levoglucosan can be further converted into citric acid in the residual liquids by A. niger. Thus the conversion of cellulose to citric acid is completed by both pyrolysis and bio-conversion technology.

  17. Extracellular oxidases and the transformation of solubilised low-rank coal by wood-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ralph, J.P. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Graham, L.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Catcheside, D.E.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences

    1996-12-31

    The involvement of extracellular oxidases in biotransformation of low-rank coal was assessed by correlating the ability of nine white-rot and brown-rot fungi to alter macromolecular material in alkali-solubilised brown coal with the spectrum of oxidases they produce when grown on low-nitrogen medium. The coal fraction used was that soluble at 3.0{<=}pH{<=}6.0 (SWC6 coal). In 15-ml cultures, Gloeophyllum trabeum, Lentinus lepideus and Trametes versicolor produced little or no lignin peroxidase, manganese (Mn) peroxidase or laccase activity and caused no change to SWC6 coal. Ganoderma applanatum and Pycnoporus cinnabarinus also produced no detectable lignin or Mn peroxidases or laccase yet increased the absorbance at 400 nm of SWC6 coal. G. applanatum, which produced veratryl alcohol oxidase, also increased the modal apparent molecular mass. SWC6 coal exposed to Merulius tremellosus and Perenniporia tephropora, which secreted Mn peroxidases and laccase and Phanerochaete chrysosporium, which produced Mn and lignin peroxidases was polymerised but had unchanged or decreased absorbance. In the case of both P. chrysosporium and M. tremellosus, polymerisation of SWC6 coal was most extensive, leading to the formation of a complex insoluble in 100 mM NaOH. Rigidoporus ulmarius, which produced only laccase, both polymerised and reduced the A{sub 400} of SWC6 coal. P. chrysosporium, M. tremellosus and P. tephropora grown in 10-ml cultures produced a spectrum of oxidases similar to that in 15-ml cultures but, in each case, caused more extensive loss of A{sub 400}, and P. chrysosporium depolymerised SWC6 coal. It is concluded that the extracellular oxidases of white-rot fungi can transform low-rank coal macromolecules and that increased oxygen availability in the shallower 10-ml cultures favours catabolism over polymerisation. (orig.)

  18. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  19. Synergism between ultrasonic pretreatment and white rot fungal enzymes on biodegradation of wheat chaff.

    Science.gov (United States)

    Sabarez, Henry; Oliver, Christine Maree; Mawson, Raymond; Dumsday, Geoff; Singh, Tanoj; Bitto, Natalie; McSweeney, Chris; Augustin, Mary Ann

    2014-11-01

    Lignocellulosic biomass samples (wheat chaff) were pretreated by ultrasound (US) (40kHz/0.5Wcm(-2)/10min and 400kHz/0.5Wcm(-2)/10min applied sequentially) prior to digestion by enzyme extracts obtained from fermentation of the biomass with white rot fungi (Phanerochaete chrysosporium or Trametes sp.). The accessibility of the cellulosic components in wheat chaff was increased, as demonstrated by the increased concentration of sugars produced by exposure to the ultrasound treatment prior to enzyme addition. Pretreatment with ultrasound increased the concentration of lignin degradation products (guaiacol and syringol) obtained from wheat chaff after enzyme addition. In vitro digestibility of wheat chaff was also enhanced by the ultrasonics pretreatment in combination with treatment with enzyme extracts. Degradation was enhanced with the use of a mixture of the enzyme extracts compared to that for a single enzyme extract. Copyright © 2014. Published by Elsevier B.V.

  20. Direct Surface Analysis of Fungal Species by Matrix-assisted Laser Desorption/Ionization Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Valentine, Nancy B.(BATTELLE (PACIFIC NW LAB)); Wahl, Jon H.(BATTELLE (PACIFIC NW LAB)); Kingsley, Mark T.(BATTELLE (PACIFIC NW LAB)); Wahl, Karen L.(BATTELLE (PACIFIC NW LAB))

    2001-12-01

    Intact spores and/or hyphae of Aspergillus niger, Rhizopus oryzae, Trichoderma reesei and Phanerochaete chrysosporium are analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). This study investigates various methods of sample preparation and matrices to determine optimum collection and analysis criteria for fungal analysis by MALDI-MS. Fungi are applied to the MALDI sample target as untreated, sonicated, acid/heat treated, or blotted directly from the fungal culture with double-stick tape. Ferulic acid or sinapinic acid matrix solution is layered over the dried samples and analyzed by MALDI-MS. Statistical analysis of the data show that simply using double stick tape to collect and transfer to a MALDI sample plate typically worked as well as the other preparation methods, but requires the least sample handling.

  1. Fungal degradation of organophosphorous insecticides

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A. [Notre Dame Univ., IN (United States); Kakar, S.N.; Coleman, R.D. [Argonne National Lab., IL (United States)

    1992-07-01

    Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.

  2. Fungal degradation of organophosphorous insecticides

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A. (Notre Dame Univ., IN (United States)); Kakar, S.N.; Coleman, R.D. (Argonne National Lab., IL (United States))

    1992-01-01

    Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.

  3. Improving the yield and quality of DNA isolated from white-rot fungi.

    Science.gov (United States)

    Kuhad, R C; Kapoor, R K; Lal, R

    2004-01-01

    A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.

  4. Solubilization of Australian lignites by fungi and other microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Catcheside, D.E.A.; Mallett, K.J. (Flinders University, Bedford Park, SA (Australia). School of Biological Sciences)

    Lignites (brown coals) from the Latrobe Valley in Victoria are solubilized by {ital Coriolus versicolor}, {ital Phanerochaete chrysosporium}, and five other species known to be active on Leonardite and various acid-treated North America lignites. Run-of-mine coal from Morwell and Loy Yang is refractory but is soluble after pretreatment with acid. A weathered deposit at Loy Yang, like Leonardite, is susceptible to biosolubilization without pretreatment. The white rot fungi {ital Ganoderma applanatum}, {ital Perenniporia tephropora} ({ital Fomes lividus}), {ital Pleurotus ostreatus}, {ital Pycnoporus cinnabarinus}, {ital Rigidoporus ulmarius}, and {ital Xylaria hypoxylon} were found to be capable of solubilizing lignite. In contrast, brown rot fungi were weakly active or inactive under the same test conditions. Lignite-degrading fungi, actinomycetes, and other bacteria, including some active on untreated run-of-mine coal, were isolated from natural lignite exposures and mining sites. 15 refs., 5 tabs.

  5. Enhanced bioremediation of PAH contaminated soils from coal processing sites

    International Nuclear Information System (INIS)

    Joshi, M.M.; Lee, S.

    1995-01-01

    The polycyclic aromatic hydrocarbons (PAH) are a potential hazard to health due to their carcinogenic, mutagenic nature and acute toxicity and there is an imminent need for remediation of PAH contaminated soils abounding the several coke oven and town gas sites. Aerobic biological degradation of PAHs is an innovative technology and has shown high decontamination efficiencies, complete mineralization of contaminants, and is environmentally safe. The present study investigates the remediation of PAH contaminated soils achieved using Acinetobacter species and fungal strain Phanerochaete Chrysosporium. The soil used for the experiments was an industrially contaminated soil obtained from Alberta Research Council (ARC) primary cleanup facility, Alberta, Canada. Soil characterization was done using High Performance Liquid Chromatography (HPLC) to qualitatively and quantitatively determine the contaminants in the soil. Artificially contaminated soil was also used for some experiments. All the experiments were conducted under completely mixed conditions with suitable oxygen and nutrient amendments. The removal efficiency obtained for various PAHs using the two microorganisms was compared

  6. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  7. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  8. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    of their ability to degrade xenobiotic compounds. Owing to extra- cellular non-specific free-radical-based ligninolytic system of WRF, they can completely eliminate a variety of xenobiotics, including synthetic dyes, giving rise to non-toxic compounds (Kuhad et al... and decolorization and ligninolytic enzymes activity was determined in the cell-free supernatant (CS). 2.5 Decolorization Assays The fungal biomass from each 250-ml Erlenmeyer flask was taken after respective incubation period. It was crushed into a paste...

  9. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.

    1996-05-01

    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  10. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  11. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.

    2009-01-01

    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  12. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

    Science.gov (United States)

    Yitzhak Hadar; Daniel Cullen

    2013-01-01

    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  13. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  14. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  15. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  16. Sequential low and medium frequency ultrasound assists biodegradation of wheat chaff by white rot fungal enzymes.

    Science.gov (United States)

    Oliver, Christine M; Mawson, Raymond; Melton, Laurence D; Dumsday, Geoff; Welch, Jessica; Sanguansri, Peerasak; Singh, Tanoj K; Augustin, Mary Ann

    2014-10-13

    The consequences of ultrasonic pre-treatment using low (40 kHz) and medium (270 kHz) frequency (40 kHz followed by 270 kHz) on the degradation of wheat chaff (8 g 100ml(-1) acetate buffer, pH 5) were evaluated. In addition, the effects of the ultrasonic pre-treatment on the degradation of the wheat chaff when subsequently exposed to enzyme extracts from two white rot fungi (Phanerochaete chrysosporium and Trametes sp.) were investigated. Pre-treatment by sequential low and medium frequency ultrasound had a disruptive effect on the lignocellulosic matrix. Analysis of the phenolic-derived volatiles after enzymatic hydrolysis showed that biodegradation with the enzyme extract obtained from P. chrysosporium was more pronounced compared to that of the Trametes sp. The efficacy of the ultrasonic pre-treatment was attributed to increased enzyme accessibility of the cellulose fibrils due to sonication-induced disruption of the plant surface structure, as shown by changes in the microstructure. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Differential proteomic analysis of the secretome of Irpex lacteus and other white-rot fungi during wheat straw pretreatment.

    Science.gov (United States)

    Salvachúa, Davinia; Martínez, Angel T; Tien, Ming; López-Lucendo, María F; García, Francisco; de Los Ríos, Vivian; Martínez, María Jesús; Prieto, Alicia

    2013-08-10

    Identifying new high-performance enzymes or enzyme complexes to enhance biomass degradation is the key for the development of cost-effective processes for ethanol production. Irpex lacteus is an efficient microorganism for wheat straw pretreatment, yielding easily hydrolysable products with high sugar content. Thus, this fungus was selected to investigate the enzymatic system involved in lignocellulose decay, and its secretome was compared to those from Phanerochaete chrysosporium and Pleurotus ostreatus which produced different degradation patterns when growing on wheat straw. Extracellular enzymes were analyzed through 2D-PAGE, nanoLC/MS-MS, and homology searches against public databases. In wheat straw, I. lacteus secreted proteases, dye-decolorizing and manganese-oxidizing peroxidases, and H2O2 producing-enzymes but also a battery of cellulases and xylanases, excluding those implicated in cellulose and hemicellulose degradation to their monosaccharides, making these sugars poorly available for fungal consumption. In contrast, a significant increase of β-glucosidase production was observed when I. lacteus grew in liquid cultures. P. chrysosporium secreted more enzymes implicated in the total hydrolysis of the polysaccharides and P. ostreatus produced, in proportion, more oxidoreductases. The protein pattern secreted during I. lacteus growth in wheat straw plus the differences observed among the different secretomes, justify the fitness of I. lacteus for biopretreatment processes in 2G-ethanol production. Furthermore, all these data give insight into the biological degradation of lignocellulose and suggest new enzyme mixtures interesting for its efficient hydrolysis.

  18. Fungal biodegradation of anthracene-polluted cork: A comparative study.

    Science.gov (United States)

    Jové, Patrícia; Olivella, Maria À; Camarero, Susana; Caixach, Josep; Planas, Carles; Cano, Laura; De Las Heras, Francesc X

    2016-01-01

    The efficiency of cork waste in adsorbing aqueous polycyclic aromatic hydrocarbons (PAHs) has been previously reported. Biodegradation of contaminated cork using filamentous fungi could be a good alternative for detoxifying cork to facilitate its final processing. For this purpose, the degradation efficiency of anthracene by three ligninolytic white-rot fungi (Phanerochaete chrysosporium, Irpex lacteus and Pleurotus ostreatus) and three non-ligninolytic fungi which are found in the cork itself (Aspergillus niger, Penicillium simplicissimum and Mucor racemosus) are compared. Anthracene degradation by all fungi was examined in solid-phase cultures after 0, 16, 30 and 61 days. The degradation products of anthracene by P. simplicissimum and I. lacteus were also identified by GC-MS and a metabolic pathway was proposed for P. simplicissimum. Results show that all the fungi tested degraded anthracene. After 61 days of incubation, approximately 86%, 40%, and 38% of the initial concentration of anthracene (i.e., 100 µM) was degraded by P. simplicissimum, P. chrysosporium and I. lacteus, respectively. The rest of the fungi degraded anthracene to a lesser extent (cork itself, could be used as an efficient degrader of PAH-contaminated cork.

  19. Fermented Apple Pomace as a Feed Additive to Enhance Growth Performance of Growing Pigs and Its Effects on Emissions

    Directory of Open Access Journals (Sweden)

    Chandran M. Ajila

    2015-06-01

    Full Text Available Apple pomace is a by-product from the apple processing industry and can be used for the production of many value-added compounds such as enzymes, proteins, and nutraceuticals, among others. An investigation was carried out to study the improvement in the protein content in apple pomace by solid-state fermentation using the fungus Phanerochaete chrysosporium by tray fermentation method. The effect of this protein in terms of how it enriched apple pomace as animal feed for pigs has also been studied. There was a 36% increase in protein content in the experimental diet with 5% w/w fermented apple pomace. The efficiency of conversion of ingested food was increased from 43.5 ± 2.5 to 83.1 ± 4.4 in the control group and the efficiency of conversion of feed increased from 55.4 ± 4.5 to 92.1 ± 3.6 in the experimental group during the animal feed experiment. Similarly, the effect of a protein enriched diet on odor emission and greenhouse gas emission has also been studied. The results demonstrated that the protein enrichment of apple pomace by solid state cultivation of the fungus P. chrysosporium makes it possible to use it as a dietary supplement for pigs.

  20. Evaluation of Potential Fungal Species for the in situ Simultaneous Saccharification and Fermentation (SSF of Cellulosic Material

    Directory of Open Access Journals (Sweden)

    Leeuwen, J.

    2011-01-01

    Full Text Available Three fungal species were evaluated for their abilities to saccharify pure cellulose. The three species chosen represented three major wood-rot molds; brown rot (Gloeophyllum trabeum, white rot (Phanerochaete chrysosporium and soft rot (Trichoderma reesei. After solid state fermentation of the fungi on the filter paper for four days, the saccharified cellulose was then fermented to ethanol by using Saccharomyces cerevisiae. The efficiency of the fungal species in saccharifying the filter paper was compared against a low dose (25 FPU/g cellulose of a commercial cellulase. Total sugar, cellobiose and glucose were monitored during the fermentation period, along with ethanol, acetic acid and lactic acid. Results indicated that the most efficient fungal species in saccharifying the filter paper was T. reesei with 5.13 g/100 g filter paper of ethanol being produced at days 5, followed by P. chrysosporium at 1.79 g/100 g filter paper. No ethanol was detected for the filter paper treated with G. trabeum throughout the five day fermentation stage. Acetic acid was only produced in the sample treated with T. reesei and the commercial enzyme, with concentration 0.95 and 2.57 g/100 g filter paper, respectively at day 5. Lactic acid production was not detected for all the fungal treated filter paper after day 5. Our study indicated that there is potential in utilizing in situ enzymatic saccharification of biomass by using T. reesei and P. chrysosporium that may lead to an economical simultaneous saccharification and fermentation process for the production of fuel ethanol.

  1. Removal of Cr(VI) from aqueous solution by fungal biomass

    Energy Technology Data Exchange (ETDEWEB)

    Ahluwalia, Sarabjeet Singh [Department of Biotechnology, General Shivdev Singh Diwan Gurbachan Singh Khalsa College, Patiala, Punjab (India); Goyal, Dinesh [Department of Biotechnology and Environmental Sciences, Thapar University, Patiala, Punjab (India)

    2010-10-15

    Chromium compounds are released by industrial processes including leather production, mining, petroleum refining, in textile industry and dyeing. They are a significant threat to the environment and public health because of their toxicity. Removal of hexavalent chromium by living biomass of different fungi was effective in the order of Aspergillus terricola>Aspergillus niger>Acremonium strictum>Aureobasidium pullulans>Paecilomyces variotii>Aspergillus foetidus>Cladosporium resinae>Phanerochaete chrysosporium. Non-living dried fungal biomass showed higher potential for metal removal than living cells. Among all fungi dead biomass of P. chrysosporium, C. resinae and P. variotii had the maximum specific chromium uptake capacity, which was 11.02, 10.69 and 10.35 mg/g of dry biomass respectively at pH 4.0-5.0 in batch sorption. Removal of Cr(VI) by P. chrysosporium from multi-metallic synthetic solution as well as chrome effluent was significant by bringing down the residual concentration to 0.1 mg/L in the effluent, which falls within the permissible range and its removal was not affected by the presence of other metal ions such as Fe, Zn and Ni. Fourier transform infrared spectral analysis revealed the presence of carboxylate (C=O) and amine (-NH{sup +}{sub 3}-NH{sup +}{sub 2}) functional groups commonly present on the cell surface of all fungi, with possible involvement in chromium binding. The result indicates that non-living fungal biomass either obtained as a by-product of fermentation industry or mass produced using inexpensive culture media can be used for bioremediation of Cr(VI) from chrome effluent on large scale. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  2. Enhanced bioprocessing of lignocellulose: Wood-rot fungal saccharification and fermentation of corn fiber to ethanol

    Science.gov (United States)

    Shrestha, Prachand

    This research aims at developing a biorefinery platform to convert corn-ethanol coproduct, corn fiber, into fermentable sugars at a lower temperature with minimal use of chemicals. White-rot (Phanerochaete chrysosporium), brown-rot (Gloeophyllum trabeum) and soft-rot (Trichoderma reesei) fungi were used in this research to biologically break down cellulosic and hemicellulosic components of corn fiber into fermentable sugars. Laboratory-scale simultaneous saccharification and fermentation (SSF) process proceeded by in-situ cellulolytic enzyme induction enhanced overall enzymatic hydrolysis of hemi/cellulose from corn fiber into simple sugars (mono-, di-, tri-saccharides). The yeast fermentation of hydrolyzate yielded 7.1, 8.6 and 4.1 g ethanol per 100 g corn fiber when saccharified with the white-, brown-, and soft-rot fungi, respectively. The highest corn-to-ethanol yield (8.6 g ethanol/100 g corn fiber) was equivalent to 42 % of the theoretical ethanol yield from starch and cellulose in corn fiber. Cellulase, xylanase and amylase activities of these fungi were also investigated over a week long solid-substrate fermentation of corn fiber. G. trabeum had the highest activities for starch (160 mg glucose/mg protein.min) and on day three of solid-substrate fermentation. P. chrysosporium had the highest activity for xylan (119 mg xylose/mg protein.min) on day five and carboxymethyl cellulose (35 mg glucose/mg protein.min) on day three of solid-substrate fermentation. T. reesei showed the highest activity for Sigma cell 20 (54.8 mg glucose/mg protein.min) on day 5 of solid-substrate fermentation. The effect of different pretreatments on SSF of corn fiber by fungal processes was examined. Corn fiber was treated at 30 °C for 2 h with alkali [2% NaOH (w/w)], alkaline peroxide [2% NaOH (w/w) and 1% H2O 2 (w/w)], and by steaming at 100 °C for 2 h. Mild pretreatment resulted in improved ethanol yields for brown- and soft-rot SSF, while white-rot and Spezyme CP SSFs showed

  3. A biodegradabilidade da blenda de poli(β-Hidroxibutirato-co-Valerato/amido anfótero na presença de microrganismos The Biodegradation of polyhydroxybutyrate-co-valerate/amphiprotic starch in the presence of microorganisms

    Directory of Open Access Journals (Sweden)

    Nadjane S. Coelho

    2008-09-01

    Full Text Available O crescimento do consumo de plásticos vem gerando grandes problemas ambientais, pois um polímero, uma vez descartado no ambiente, necessita de mais de cem anos para se degradar. O plástico ideal deve apresentar propriedades industriais desejáveis e, ao mesmo tempo ser degradável num período considerado satisfatório. Busca-se desenvolver plásticos com boas propriedades para embalagens e que possam ser biodegradados quando descartados ao ambiente. Neste trabalho avaliamos a biodegradação da blenda do copolímero poli(β-hidroxibutirato-co-valerato, PHB-HV, que é um termoplástico natural, biodegradável e biocompatível, e do amido anfótero, na proporção de 75 e 25% m/m, respectivamente. Os resultados foram obtidos através do teste de Sturm, uma metodologia para a avaliação da biodegradação na presença de uma cultura mista dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Os resultados evidenciam a biodegradação da blenda em função do tempo, de acordo com os resultados do teste de Sturm, com o aparecimento de grupos carboxílicos terminais. Foi detectado também o aparecimento de nova simetria cristalina na estrutura polimérica.The increasing consumption of plastics has generated environmental problems because it takes more than a hundred years for a discarded polymer to degrade. The ideal plastic should present desirable industrial properties and be degradable within a satisfactory time period. Researches is conducted to plastics with good properties for packaging, but that are biodegradable when discarded to the environment. In this work we evaluated the biodegradation of the blend of the copolymer poly(hydroxybutyrate-hydroxyvalerate, PHB-HV, which is a natural, biodegradable and biocompatible thermoplastic, and of the starch amphiprotic, in the proportion of 75 and 25% m/m, respectively. The results were obtained through the Sturm test, a methodology for the evaluation of biodegradation in the presence

  4. Evaluation of the types of starch for preparation of LDPE/starch blends

    Directory of Open Access Journals (Sweden)

    Glória Maria Vinhas

    2007-05-01

    Full Text Available This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In spite of the short time that the blends were exposed to the fungi, the microorganisms promoted physical and chemical changes in the structure of the blend, modifying its thermal and mechanical properties. The alteration of the degree of crystallinity and mechanical properties of the blends could be indications of the modification caused by the biodegradation process.Nesse trabalho foi realizado um estudo sobre diferentes tipos de amido quanto ao crescimento, e a atividade amilolítica de culturas mistas e isoladas dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Avaliaram-se também as propriedades térmicas e mecânicas das blendas de polietileno/amido anfótero (na proporção 80/20 (m/m antes e apos a inoculação das culturas mistas desses fungos.O amido regular Amidex 3 e o amido modificado Fox5901 foram os que se destacaram quanto ao crescimento celular e produção da enzima amilase. Apesar do pouco tempo de exposição dos filmes com os fungos, pode-se concluir que os microrganismos promovem mudanças físicas e químicas na estrutura da blenda, modificando suas propriedades térmicas e mecânicas. A alteração do grau de cristalinidade e das propriedades mecânicas das blendas podem ser indícios da modificação provocada pelo processo de biodegradação.

  5. Vegetal waste degradation by microbial strains inoculation Degradación de residuos vegetales mediante inoculación con cepas microbianas

    Directory of Open Access Journals (Sweden)

    Nubia Grijalva Vallejos

    2013-06-01

    Full Text Available (Received: 2013/03/31 - Accepted: 2013/06/02Vegetal waste treatment product of urban, agricultural and industrial processes has severaltechnical problems and constitutes a significant environmental concern. Among them are thepersistence of crop protection products in high concentrations in plant material and the lack ofmicroorganisms that can tolerate such compounds and efficiently decompose the substrate.Bacteria and mainly white rot fungi are the main decomposers of lignin because of their ability tosynthesize extracellular hydrolytic and oxidative enzymes in large quantities. Trichodermareesei, Aspergillus niger, Penicillium sp. and Phanerochaete chrysosporium strains are modelstrains whose hight degradation efficiency with lignocellulose materials even in the presence ofpollutants has been proven. Several studies such as directed mutagenesis, co-culturing andheterologous expression have been done in order to improve the content of some enzymes(cellulase, xylanase, and β-glucosidase in model strains, additionally it has been done newgenetic searches to find other microorganisms with this potential. Its main applications are theindustrial production of ethanol and some seconday metabolites under controlled conditions infermentation processes. This review provides an overview about strategies and methodologiescurrently used for vegetal waste utilization by inoculation of microbial strains.(Recibido: 2013/03/31 - Aceptado: 2013/06/02El tratamiento de los residuos vegetales producto de desechos urbanos, procesos agrícolas eindustriales enfrenta varios problemas técnicos y constituye una preocupación ambientalimportante. Entre ellos se destacan la permanencia de productos fitosanitarios en altasconcentraciones en el material vegetal unido a la carencia de microorganismos que puedantolerar dichos compuestos y logren descomponer eficientemente el sustrato. Las bacterias yprincipalmente los hongos de la podredumbre blanca son los mejores

  6. Pretreatment of lignocellulosic material with fungi capable of higher lignin degradation and lower carbohydrate degradation improves substrate acid hydrolysis and the eventual conversion to ethanol.

    Science.gov (United States)

    Kuhar, Sarika; Nair, Lavanya M; Kuhad, Ramesh Chander

    2008-04-01

    Phanerochaete chrysosporium, Pycnoporus cinnabarinus,and fungal isolates RCK-1 and RCK-3 were tested for their lignin degradation abilities when grown on wheat straw (WS) and Prosopis juliflora (PJ) under solid-state cultivation conditions. Fungal isolate RCK-1 degraded more lignin in WS (12.26% and 22.64%) and PJ (19.30% and 21.97%) and less holocellulose in WS (6.27% and 9.39%) and PJ (3.01% and 4.58%) after 10 and 20 days, respectively, than other fungi tested. Phanerochaete chrysosporium caused higher substrate mass loss and degraded more of holocellulosic content (WS: 55.67%; PJ: 48.89%) than lignin (WS: 18.89%; PJ: 20.20%) after 20 days. The fungal pretreatment of WS and PJ with a high-lignin-degrading and low-holocellulose-degrading fungus (fungal isolate RCK-1) for 10 days resulted in (i) reduction in acid load for hydrolysis of structural polysaccharides (from 3.5% to 2.5% in WS and from 4.5% to 2.5% in PJ), (ii) an increase in the release of fermentable sugars (from 30.27 to 40.82 g L(-1) in WS and from 18.18 to 26.00 g L(-1) in PJ), and (iii) a reduction in fermentation inhibitors (total phenolics) in acid hydrolysate of WS (from 1.31 to 0.63 g L(-1)) and PJ (from 2.05 to 0.80 g L(-1)). Ethanol yield and volumetric productivity from RCK-1-treated WS (0.48 g g(-1) and 0.54 g L(-1) h(-1), respectively) and PJ (0.46 g g(-1) and 0.33 g L(-1) h(-1), respectively) were higher than untreated WS (0.36 g g(-1) and 0.30 g L(-1) h(-1), respectively) and untreated PJ (0.42 g g(-1) and 0.21 g L(-1) h(-1), respectively).

  7. Inmovilización de hongos ligninolíticos para la remoción del colorante negro reactivo 5

    Directory of Open Access Journals (Sweden)

    Jorge Andrés Fernández

    2009-01-01

    Full Text Available La presencia de colorantes azoicos en aguas residuales de la industria textil es un problema ambiental y sanitario, porque muchos de estos compuestos son cancerígenos. Los tratamientos biológicos son una alternativa para la remoción de ese tipo de colorantes. En el presente trabajo se evaluó el efecto de tres hongos de podredumbre blanca, Trametes versicolor, Pleurotus ostreatus y Phanerochaete chrysosporium sobre la decoloración de un agua que contiene colorante negro reactivo 5 (NR5, ampliamente usado en la industria textil. Se estudió la inmovilización de estos hongos en dos soportes, espuma de poliuretano y estropajo (L. cylíndrica para seleccionar el mejor soporte y el hongo con mayor capacidad para la decoloración. Ambos soportes fueron igualmente efectivos, pero se seleccionó estropajo por ser un producto natural. El hongo que generó los mayores porcentajes de decoloración en 4 días fue Trametes versicolor, con 96%, 98% y 98% para agua con concentración de NR5 300 ppm, 150 ppm y 75 ppm, respectivamente. La actividad lacasa para cada concentración de NR5 fue 8 U L-1, 7 U L-1 y 5 U L-1. Waste water from the textile industry represents a major environmental and health problem because it contains azo dyes whose carcirogenic effect has been tested in research. Biological treatment represents a valuable alternative for removing these dyes. The effect of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium rot fungi on decoloration of water containing reactive black five (NR5 textile dye was evaluated in this work. Immobilising the fungi on polyurethane foam and luffa sponge (Luffa cylindrica supports was studied in order to select the best support and the fungi having the best decolorisation. Both supports were equally effective; however, the luffa sponge was selected as being a natural product. Trametes versicolor produced the highest decolorisation percentages in four days (96%, 98% and 98% for 300 ppm, 150

  8. Improving Nutritional Quality of Cocoa Pod (Theobroma cacao) through Chemical and Biological Treatments for Ruminant Feeding: In vitro and In vivo Evaluation.

    Science.gov (United States)

    Laconi, Erika B; Jayanegara, Anuraga

    2015-03-01

    Cocoa pod is among the by-products of cocoa (Theobroma cacao) plantations. The aim of this study was to apply a number of treatments in order to improve nutritional quality of cocoa pod for feeding of ruminants. Cocoa pod was subjected to different treatments, i.e. C (cocoa pod without any treatment or control), CAm (cocoa pod+1.5% urea), CMo (cocoa pod+3% molasses), CRu (cocoa pod+3% rumen content) and CPh (cocoa pod+3% molasses+Phanerochaete chrysosporium inoculum). Analysis of proximate and Van Soest's fiber fraction were performed on the respective treatments. The pods were then subjected to an in vitro digestibility evaluation by incubation in rumen fluid-buffer medium, employing a randomized complete block design (n = 3 replicates). Further, an in vivo evaluation of the pods (35% inclusion level in total mixed ration) was conducted by feeding to young Holstein steers (average body weight of 145±3.6 kg) with a 5×5 latin square design arrangement (n = 5 replicates). Each experimental period lasted for 30 d; the first 20 d was for feed adaptation, the next 3 d was for sampling of rumen liquid, and the last 7 d was for measurements of digestibility and N balance. Results revealed that lignin content was reduced significantly when cocoa pod was treated with urea, molasses, rumen content or P. chrysosporium (pCAm>CRu>CMo. Among all treatments, CAm and CPh treatments significantly improved the in vitro dry matter and organic matter digestibility (pcocoa pod. Average daily gain of steers receiving CAm or CPh treatment was significantly higher than that of control (pcocoa pod.

  9. Biodegradation of volatile organic compounds by five fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Qi, B.; Moe, W.M. [Dept. of Civil and Environmental Engineering, Louisiana State Univ., Baton Rouge, LA (United States); Kinney, K.A. [Dept. of Civil Engineering, Univ. of Texas, Austin (United States)

    2002-07-01

    Five fungal species, Cladosporium resinae (ATCC 34066), Cladosporium sphaerospermum (ATCC 200384), Exophiala lecanii-corni (CBS 102400), Mucor rouxii (ATCC 44260), and Phanerochaete chrysosporium (ATCC 24725), were tested for their ability to degrade nine compounds commonly found in industrial off-gas emissions. Fungal cultures inoculated on ceramic support media were provided with volatile organic compounds (VOCs) via the vapor phase as their sole carbon and energy sources. Compounds tested included aromatic hydrocarbons (benzene, ethylbenzene, toluene, and styrene), ketones (methyl ethyl ketone, methyl isobutyl ketone, and methyl propyl ketone), and organic acids (n-butyl acetate, ethyl 3-ethoxypropionate). Experiments were conducted using three pH values ranging from 3.5 to 6.5. Fungal ability to degrade each VOC was determined by observing the presence or absence of visible growth on the ceramic support medium during a 30-day test period. Results indicate that E. lecanii-corni and C. sphaerospermum can readily utilize each of the nine VOCs as a sole carbon and energy source. P. chrysosporium was able to degrade all VOCs tested except for styrene under the conditions imposed. C. resinae was able to degrade both organic acids, all of the ketones, and some of the aromatic compounds (ethylbenzene and toluene); however, it was not able to grow utilizing benzene or styrene under the conditions tested. With the VOCs tested, M. rouxii produced visible growth only when supplied with n-butyl acetate or ethyl 3-ethoxypropionate. Maximum growth for most fungi was observed at a pH of approximately 5.0. The experimental protocol utilized in these studies is a useful tool for assessing the ability of different fungal species to degrade gas-phase VOCs under conditions expected in a biofilter application. (orig.)

  10. Microbial Biofertilizer Decreases Nicotine Content by Improving Soil Nitrogen Supply.

    Science.gov (United States)

    Shang, Cui; Chen, Anwei; Chen, Guiqiu; Li, Huanke; Guan, Song; He, Jianmin

    2017-01-01

    Biofertilizers have been widely used in many countries for their benefit to soil biological and physicochemical properties. A new microbial biofertilizer containing Phanerochaete chrysosporium and Bacillus thuringiensis was prepared to decrease nicotine content in tobacco leaves by regulating soil nitrogen supply. Soil NO 3 - -N, NH 4 + -N, nitrogen supply-related enzyme activities, and nitrogen accumulation in plant leaves throughout the growing period were investigated to explore the mechanism of nicotine reduction. The experimental results indicated that biofertilizer can reduce the nicotine content in tobacco leaves, with a maximum decrement of 16-18 % in mature upper leaves. In the meantime, the total nitrogen in mature lower and middle leaves increased with the application of biofertilizer, while an opposite result was observed in upper leaves. Protein concentration in leaves had similar fluctuation to that of total nitrogen in response to biofertilizer. NO 3 - -N content and nitrate reductase activity in biofertilizer-amended soil increased by 92.3 and 42.2 %, respectively, compared to those in the control, whereas the NH 4 + -N and urease activity decreased by 37.8 and 29.3 %, respectively. Nitrogen uptake was improved in the early growing stage, but this phenomenon was not observed during the late growth period. Nicotine decrease is attributing to the adjustment of biofertilizer in soil nitrogen supply and its uptake in tobacco, which result in changes of nitrogen content as well as its distribution in tobacco leaves. The application of biofertilizer containing P. chrysosporium and B. thuringiensis can reduce the nicotine content and improve tobacco quality, which may provide some useful information for tobacco cultivation.

  11. Improving Nutritional Quality of Cocoa Pod ( through Chemical and Biological Treatments for Ruminant Feeding: and Evaluation

    Directory of Open Access Journals (Sweden)

    Erika B. Laconi

    2015-03-01

    Full Text Available Cocoa pod is among the by-products of cocoa (Theobroma cacao plantations. The aim of this study was to apply a number of treatments in order to improve nutritional quality of cocoa pod for feeding of ruminants. Cocoa pod was subjected to different treatments, i.e. C (cocoa pod without any treatment or control, CAm (cocoa pod+1.5% urea, CMo (cocoa pod+3% molasses, CRu (cocoa pod+3% rumen content and CPh (cocoa pod+3% molasses+Phanerochaete chrysosporium inoculum. Analysis of proximate and Van Soest’s fiber fraction were performed on the respective treatments. The pods were then subjected to an in vitro digestibility evaluation by incubation in rumen fluid-buffer medium, employing a randomized complete block design (n = 3 replicates. Further, an in vivo evaluation of the pods (35% inclusion level in total mixed ration was conducted by feeding to young Holstein steers (average body weight of 145±3.6 kg with a 5×5 latin square design arrangement (n = 5 replicates. Each experimental period lasted for 30 d; the first 20 d was for feed adaptation, the next 3 d was for sampling of rumen liquid, and the last 7 d was for measurements of digestibility and N balance. Results revealed that lignin content was reduced significantly when cocoa pod was treated with urea, molasses, rumen content or P. chrysosporium (pCAm>CRu>CMo. Among all treatments, CAm and CPh treatments significantly improved the in vitro dry matter and organic matter digestibility (p<0.05 of cocoa pod. Average daily gain of steers receiving CAm or CPh treatment was significantly higher than that of control (p<0.01 with an increase of 105% and 92%, respectively. Such higher daily gain was concomitant with higher N retention and proportion of N retention to N intake in CAm and CPh treatments than those of control (p<0.05. It can be concluded from this study that treatment with either urea or P. chrysosporium is effective in improving the nutritive value of cocoa pod.

  12. An amperometric enzyme biosensor for real-time measurements of cellobiohydrolase activity on insoluble cellulose

    DEFF Research Database (Denmark)

    Cruys-Bagger, Nicolaj; Guilin, Ren; Tatsumi, Hirosuke

    2012-01-01

    An amperometric enzyme biosensor for continuous detection of cellobiose has been implemented as an enzyme assay for cellulases. We show that the initial kinetics for cellobiohydrolase I, Cel7A from Trichoderma reesei, acting on different types of cellulose substrates, semi-crystalline and amorphous......, can be monitored directly and in real-time by an enzyme-modified electrode based on cellobiose dehydrogenase (CDH) from Phanerochaete chrysosporium (Pc). PcCDH was cross-linked and immobilized on the surface of a carbon paste electrode which contained a mediator, benzoquinone. An oxidation current...... of the reduced mediator, hydroquinone, produced by the CDH-catalyzed reaction with cellobiose, was recorded under constant-potential amperometry at +0.5 V (vs. Ag/AgCl). The CDH-biosensors showed high sensitivity (87.7 µA mM−1 cm−2), low detection limit (25 nM), and fast response time (t95% ∼ 3 s...

  13. Direct Succinic Acid Production from Minimally Pretreated Biomass Using Sequential Solid-State and Slurry Fermentation with Mixed Fungal Cultures

    Directory of Open Access Journals (Sweden)

    Jerico Alcantara

    2017-06-01

    Full Text Available Conventional bio-based succinic acid production involves anaerobic bacterial fermentation of pure sugars. This study explored a new route for directly producing succinic acid from minimally-pretreated lignocellulosic biomass via a consolidated bioprocessing technology employing a mixed lignocellulolytic and acidogenic fungal co-culture. The process involved a solid-state pre-fermentation stage followed by a two-phase slurry fermentation stage. During the solid-state pre-fermentation stage, Aspergillus niger and Trichoderma reesei were co-cultured in a nitrogen-rich substrate (e.g., soybean hull to induce cellulolytic enzyme activity. The ligninolytic fungus Phanerochaete chrysosporium was grown separately on carbon-rich birch wood chips to induce ligninolytic enzymes, rendering the biomass more susceptible to cellulase attack. The solid-state pre-cultures were then combined in a slurry fermentation culture to achieve simultaneous enzymatic cellulolysis and succinic acid production. This approach generated succinic acid at maximum titers of 32.43 g/L after 72 h of batch slurry fermentation (~10 g/L production, and 61.12 g/L after 36 h of addition of fresh birch wood chips at the onset of the slurry fermentation stage (~26 g/L production. Based on this result, this approach is a promising alternative to current bacterial succinic acid production due to its minimal substrate pretreatment requirements, which could reduce production costs.

  14. Solid-state fermentation of rice straw residues for its use as growing medium in ornamental nurseries

    Science.gov (United States)

    Belal, Elsayed B.; El-Mahrouk, M. E.

    2010-11-01

    This work was conducted at a private nursery in Kafr El-Sheikh governorate to investigate the bioconversion of rice straw into a soil-like substrate (SLS) by Phanerochaete chrysosporium and Trichoderma hazianum and the possibility of using rice straw compost in ornamental nurseries as a partial or total replacement of coconut peat (CP) and vermiculite (V) in the growing medium. The results showed that rice straw could be treated better by aerobic fermentation. The authors used five mixtures as follows: (1) Control (CP+V at 1:1 v/v), (2) SLS (100%), (3) SLS+CP (1:1 v/v), (4) SLS+V (1:1 v/v), and (5) SLS+CP+V (1:1:1 v/v/v). Data were recorded as seedling height, no. of leaves, shoot fresh and dry weights, root length and root fresh and dry weights in order to assess the quality of both transplants of Althea rosea (hollyhock) and Calendula officinalis (scotch marigold). Hollyhock seedlings grown in medium containing a mixture of SLS+CP+V displayed quality traits similar to those recorded from the control treatment, while scotch marigold seedlings in the same medium followed the control medium in quality.

  15. Endophytic Fungi Associated With Turmeric (Curcuma longa L. Can Inhibit Histamine-Forming Bacteria in Fish

    Directory of Open Access Journals (Sweden)

    Eris Septiana

    2017-01-01

    Full Text Available Turmeric (Curcuma longa L. is a medicinal plant that is commonly used as spice and preservative. Many types of endophytic fungi have been reported as being associated with medicinal plants and able to synthesize secondary metabolites. In this study, endophytic fungi were isolated from all plant parts of turmeric plants. Identification of the endophytic fungi was done using morphological characteristics and sequencing of the internal transcribed spacer (ITS region of ribosomal DNA. The dual culture method was used for screening antibacterial activity of the endophytic fungi against Morganella morganii, a common histamine-producing bacteria. The disc diffusion method was used to test the ability of water fractions of selected endophytic fungi to inhibit M. morganii growth. Two-dimensional thin layer chromatography was used to determine the fungal extract inhibition activity on histamine formation. In total, 11 endophytic fungi were successfully isolated and identified as Arthrobotrys foliicola, Cochliobolus kusanoi, Daldinia eschscholzii, Fusarium oxysporum, Fusarium proliferatum, Fusarium solani, Fusarium verticillioides, Phanerochaete chrysosporium, and Phaeosphaeria ammophilae. Five isolates showed inhibition activity against M. morganii in the dual culture tests. Based on the disc diffusion assay, A. foliicola and F. verticillioides inhibited the growth of M. morganii as a histamine-producing bacteria, and inhibiting histamine formation in fish. The best effects in inhibiting growth of the histamine-producing bacteria and histamine formation inhibition in fish were produced with F. verticillioides water fraction at 0°C incubation.

  16. Biodelignification of lignocellulose substrates: An intrinsic and sustainable pretreatment strategy for clean energy production.

    Science.gov (United States)

    Chandel, Anuj K; Gonçalves, Bruna C M; Strap, Janice L; da Silva, Silvio S

    2015-01-01

    Lignocellulosic biomass (LB) is a promising sugar feedstock for biofuels and other high-value chemical commodities. The recalcitrance of LB, however, impedes carbohydrate accessibility and its conversion into commercially significant products. Two important factors for the overall economization of biofuel production is LB pretreatment to liberate fermentable sugars followed by conversion into ethanol. Sustainable biofuel production must overcome issues such as minimizing water and energy usage, reducing chemical usage and process intensification. Amongst available pretreatment methods, microorganism-mediated pretreatments are the safest, green, and sustainable. Native biodelignifying agents such as Phanerochaete chrysosporium, Pycnoporous cinnabarinus, Ceriporiopsis subvermispora and Cyathus stercoreus can remove lignin, making the remaining substrates amenable for saccharification. The development of a robust, integrated bioprocessing (IBP) approach for economic ethanol production would incorporate all essential steps including pretreatment, cellulase production, enzyme hydrolysis and fermentation of the released sugars into ethanol. IBP represents an inexpensive, environmentally friendly, low energy and low capital approach for second-generation ethanol production. This paper reviews the advancements in microbial-assisted pretreatment for the delignification of lignocellulosic substrates, system metabolic engineering for biorefineries and highlights the possibilities of process integration for sustainable and economic ethanol production.

  17. Reduced toxicity of malachite green decolorized by laccase produced from Ganoderma sp. rckk-02 under solid-state fermentation.

    Science.gov (United States)

    Sharma, Abha; Shrivastava, Bhuvnesh; Kuhad, Ramesh Chander

    2015-10-01

    Statistical designs were applied for optimizing laccase production from a white-rot fungus, Ganoderma sp. rckk-02 under solid-state fermentation (SSF). Compared to unoptimized conditions [2,154 U/gds (Unit per gram of dry substrate)], the optimization process resulted in a 17.3-fold increase in laccase production (37,423 U/gds). The laccase produced was evaluated for its potential to decolorize a recalcitrant synthetic dye, malachite green. Laccase at dosage of 30 U/ml in presence of 1 mM of 1-hydroxybenzotriazole (HBT) almost completely decolorized 100 and 200 mg/l of malachite green in 16 and 20 h, respectively, at 30 °C, pH 5.5 and 150 rpm. While, higher dyes concentrations of 300, 400 and 500 mg/l were decolorized to 72, 62 and 55 % in 24, 28 and 32 h, respectively, under similar conditions. Furthermore, it was observed that the decolorized malachite green was less toxic towards the growth of five white-rot fungi tested viz. Crinipellis sp. RCK-1, Ganoderma sp. rckk-02, Coriolopsis Caperata RCK 2011, Phanerochaete chrysosporium K3 and Pycnoporous cinnabarinus PB. The present study demonstrates the potential of Ganoderma sp. rckk-02 to produce high titres of laccase under SSF, which can be exploited in conjunction with redox mediator for the decolorization of high concentrations of malachite green from water bodies.

  18. Fungal Biodegradative Oxidants in Lignocellulose: Fluorescence Mapping and Correlation With Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Hammel, Kenneth E. [Univ. of Wisconsin, Madison, WI (United States); Ralph, John [Univ. of Wisconsin, Madison, WI (United States); Hunt, Christopher G. [U.S. Forest Products Lab., Madison, WI (United States); Houtman, Carl J. [U.S. Forest Products Lab., Madison, WI (United States)

    2016-09-06

    This work focused on new methods for the detection of oxidation in natural substrates during the deconstruction of lignocellulose by microoganisms. Oxidation was the focus because all known biological systems that degrade lignin are oxidative. The detection methods involved the used of (a) micrometer-scale beads carrying a fluorescent dye that is sensitive to oxidation, (b) 13C-labeled synthetic lignins whose breakdown products can be assessed using mass spectrometry and nuclear magnetic resonance spectroscopy, and (c) a fluorometric stain that is highly sensitive to incipient oxidation during microbial attack. The results showed (a) that one white rot fungus, Phanerochaete chrysosporium, produces diffusible oxidants on wood, and that the onset of oxidation is coincident with the marked up-regulation of genes that encode ligninolytic peroxidases and auxiliary oxidative enzymes; (b) that a more selectively ligninolytic white rot fungus, Ceriporiopsis subvermispora, produces a highly diastereoselective oxidative system for attack on lignin; (c) that a brown rot fungus, Serpula lacrymans, uses extracellular hydroquinone metabolites to drive the production of lignocellulose-oxidizing free radicals; (d) that both white rot and brown rot fungi produce highly diffusible mild oxidants that modify lignocellulose at the earliest stage of substrate deconstruction; and (e) that lignin degradation in a tropical soil is not inhibited as much as expected during periods of flooding-induced hypoxia, which indicates that unknown mechanisms for attack on lignin remain to be discovered.

  19. Winery biomass waste degradation by sequential sonication and mixed fungal enzyme treatments.

    Science.gov (United States)

    Karpe, Avinash V; Dhamale, Vijay V; Morrison, Paul D; Beale, David J; Harding, Ian H; Palombo, Enzo A

    2017-05-01

    To increase the efficiency of winery-derived biomass biodegradation, grape pomace was ultrasonicated for 20min in the presence of 0.25M, 0.5Mand1.0MKOH and 1.0MNaOH. This was followed by treatment with a 1:1 (v/v) mix of crude enzyme preparation derived from Phanerochaete chrysosporium and Trametes versicolor for 18h and a further 18h treatment with a 60:14:4:2 percent ratio combination of enzymes derived from Aspergillus niger: Penicillium chrysogenum: Trichoderma harzianum: P. citrinum, repsectively. Process efficiency was evaluated by its comparison to biological only mixed fungal degradation over 16days. Ultrasonication treatment with 0.5MKOH followed by mixed enzyme treatment yielded the highest lignin degradation of about 13%. Cellulase, β-glucosidase, xylanase, laccase and lignin peroxidase activities of 77.9, 476, 5,390.5, 66.7 and 29,230.7U/mL, respectively, were observed during biomass degradation. Gas chromatography-mass spectrometry (GC-MS) analysis of the degraded material identified commercially important compounds such as gallic acid, lithocholic acid, glycolic acid and lactic acid which were generated in considerable quantities. Thus, the combination of sonication pre-treatment and enzymatic degradation has the potential to considerably improve the breakdown of agricultural biomass and produce commercially useful compounds in markedly less time (<40h) with respect to biological only degradation (16days). Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Fungal treatment of humic-rich industrial wastewater: application of white rot fungi in remediation of food-processing wastewater.

    Science.gov (United States)

    Zahmatkesh, Mostafa; Spanjers, Henri; van Lier, Jules B

    2017-11-01

    This paper presents the results of fungal treatment of a real industrial wastewater (WW), providing insight into the main mechanisms involved and clarifying some ambiguities and uncertainties in the previous reports. In this regard, the mycoremediation potentials of four strains of white rot fungi (WRF): Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus and Pleurotus pulmonarius were tested to remove humic acids (HA) from a real humic-rich industrial treated WW of a food-processing plant. The HA removal was assessed by color measurement and size-exclusion chromatography (SEC) analysis. T. versicolor showed the best decolorization efficiency of 90% and yielded more than 45% degradation of HA, which was the highest among the tested fungal strains. The nitrogen limitation was studied and results showed that it affected the fungal extracellular laccase and manganese peroxidase (MnP) activities. The results of the SEC analysis revealed that the mechanism of HA removal by WRF involves degradation of large HA molecules to smaller molecules, conversion of HA to fulvic acid-like molecules and also biosorption of HA by fungal mycelia. The effect of HS on the growth of WRF was investigated and results showed that the inhibition or stimulation of growth differs among the fungal strains.

  1. Toxicity profile of choline chloride-based deep eutectic solvents for fungi and Cyprinus carpio fish.

    Science.gov (United States)

    Juneidi, Ibrahim; Hayyan, Maan; Mohd Ali, Ozair

    2016-04-01

    An investigation on the toxicological assessment of 10 choline chloride (ChCl)-based deep eutectic solvents (DESs) towards four fungi strains and Cyprinus carpio fish was conducted. ChCl was combined with materials from different chemical groups such as alcohols, sugars, acids and others to form DESs. The study was carried out on the individual DES components, their aqueous mixture before DES formation and their formed DESs. The agar disc diffusion method was followed to investigate their toxicity on four fungi strains selected as a model of eukaryotic microorganisms (Phanerochaete chrysosporium, Aspergillus niger, Lentinus tigrinus and Candida cylindracea). Among these DESs, ChCl:ZnCl2 exhibited the highest inhibition zone diameter towards the tested fungi growth in vitro, followed by the acidic group (malonic acid and p-toluenesulfonic acid). Another study was conducted to test the acute toxicity and determine the lethal concentration at 50 % (LC50) of the same DESs on C. carpio fish. The inhibition range and LC50 of DESs were found to be different from their individual components. DESs were found to be less toxic than their mixture or individual components. The LC50 of ChCl:MADES is much higher than that of ChCl:MAMix. Moreover, the DESs acidic group showed a lower inhibition zone on fungi growth. Thus, DESs should be considered as new components with different physicochemical properties and toxicological profiles, and not merely compositions of compounds.

  2. Exploitation of Trametes versicolor for bioremediation of endocrine disrupting chemicals in bioreactors.

    Directory of Open Access Journals (Sweden)

    Cinzia Pezzella

    Full Text Available Endocrine disrupting chemicals (EDCs are environmental contaminants causing increasing concerns due to their toxicity, persistence and ubiquity. In the present study, degradative capabilities of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium to act on five EDCs, which represent different classes of chemicals (phenols, parabens and phthalate and were first applied as single compounds, were assessed. T. versicolor was selected due to its efficiency against target EDCs and its potentialities were exploited against a mixture of EDCs in a cost-effective bioremediation process. A fed-batch approach as well as a starvation strategy were applied in order to reduce the need for input of 'fresh' biomass, and avoid the requirement for external nutrients. The fungus was successfully operated in two different bioreactors over one week. Semi-batch cultures were carried out by daily adding a mixture of EDCs to the bioreactors in a total of five consecutive degradation cycles. T. versicolor was able to efficiently remove all compounds during each cycle converting up to 21 mg L-1 day-1 of the tested EDCs. The maintained ability of T. versicolor to remove EDCs without any additional nutrients represents the main outcome of this study, which enables to forecast its application in a water treatment process.

  3. Biodegradation of Aged Residues of Atrazine and Alachlor in a Mix-Load Site Soil by Fungal Enzymes

    Directory of Open Access Journals (Sweden)

    Anastasia E. M. Chirnside

    2011-01-01

    Full Text Available Soils from bulk pesticide mixing and loading (mix-load sites are often contaminated with a complex mixture of pesticides, herbicides, and other organic compounds used in pesticide formulations that limits the success of remediation efforts. Therefore, there is a need to find remediation strategies that can successfully clean up these mix-load site soils. This paper examined the degradation of atrazine (2-chloro-4-ethylamino-6-isopropylamino-S-triazine; AT and alachlor (2-chloro-2, 6-diethyl-N-[methoxymethyl]-acetanilide in contaminated mix-load site soil utilizing an extracellular fungal enzyme solution derived from the white rot fungus, Phanerochaete chrysosporium, grown in a packed bed bioreactor. Thirty-two percent of AT and 54% of AL were transformed in the biometers. The pseudo first-order rate constant for AT and AL biodegradation was 0.0882 d−1 and 0.2504 d−1, respectively. The half-life (1/2 for AT and AL was 8.0 and 3.0 days, respectively. Compared to AT, the initial disappearance of AL proceeded at a faster rate and resulted in a greater amount of AL transformed. Based on the net Co2 evolved from the biometers, about 4% of the AT and AL initially present in the soil was completely mineralized.

  4. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  5. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.

    2017-01-01

    Documenting succession in forest canopy gaps provides insights into the ecological processes governing the temporal dynamics of species within communities. We analyzed the fruiting patterns of a rare but widely distributed saproxylic macromycete, Xylobolus subpileatus, during the ageing of natura...

  6. Hydrophobins in the Life Cycle of the Ectomycorrhizal Basidiomycete Tricholoma vaccinum.

    Directory of Open Access Journals (Sweden)

    Dominik Sammer

    Full Text Available Hydrophobins-secreted small cysteine-rich, amphipathic proteins-foster interactions of fungal hyphae with hydrophobic surfaces, and are involved in the formation of aerial hyphae. Phylogenetic analyses of Tricholoma vaccinum hydrophobins showed a grouping with hydrophobins of other ectomycorrhizal fungi, which might be a result of co-evolution. Further analyses indicate angiosperms as likely host trees for the last common ancestor of the genus Tricholoma. The nine hydrophobin genes in the T. vaccinum genome were investigated to infer their individual roles in different stages of the life cycle, host interaction, asexual and sexual development, and with respect to different stresses. In aerial mycelium, hyd8 was up-regulated. In silico analysis predicted three packing arrangements, i.e., ring-like, plus-like and sheet-like structure for Hyd8; the first two may assemble to rodlets of hydrophobin covering aerial hyphae, whereas the third is expected to be involved in forming a two-dimensional network of hydrophobins. Metal stress induced hydrophobin gene hyd5. In early steps of mycorrhization, induction of hyd4 and hyd5 by plant root exudates and root volatiles could be shown, followed by hyd5 up-regulation during formation of mantle, Hartig' net, and rhizomorphs with concomitant repression of hyd8 and hyd9. During fruiting body formation, mainly hyd3, but also hyd8 were induced. Host preference between the compatible host Picea abies and the low compatibility host Pinus sylvestris could be linked to a stronger induction of hyd4 and hyd5 by the preferred host and a stronger repression of hyd8, whereas the repression of hyd9 was comparable between the two hosts.

  7. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415 ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  8. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi

    Science.gov (United States)

    Dana L. Richter; Jessie A. Glaeser

    2015-01-01

    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  9. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  11. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    seen, but LIP production either was not seen or was minimal. LME rpoduction was also seen in media prepared with artificial seawater. Fast rpotein liquid chromatography and isoelectric focusing resolved LMEs into four isozymes each of MNP and LIP, while...

  12. Cd and Zn interactions and toxicity in ectomycorrhizal basidiomycetes in axenic culture

    Directory of Open Access Journals (Sweden)

    Vinicius H. De Oliveira

    2018-03-01

    Full Text Available Background Metal contamination in soils affects both above- and belowground communities, including soil microorganisms. Ectomycorrhizal (ECM fungi are an important component in belowground community and tolerant strains have great potential in enhancing plant-based remediation techniques. We assessed cadmium and zinc toxicity in five ECM species in liquid media (Hebeloma subsaponaceum; H. cylindrosporum; H. crustuliniforme; Scleroderma sp.; Austroboletus occidentalis and investigated the potential of Zn to alleviate Cd toxicity. Due to highly divergent results reported in the literature, liquid and solid media were compared experimentally for the first time in terms of differential toxicity thresholds in Cd and Zn interactions. Methods A wide range of Cd and Zn concentrations were applied to ectomycorrhizal fungi in axenic cultures (in mg L−1: 0; 1; 3; 9; 27; 81; 243 for the Cd treatments, and 0; 1; 30; 90; 270; 810; 2,430 for Zn. Combined Zn and Cd treatments were also applied to H. subsaponaceum and Scleroderma sp. Dry weight was recorded after 30 days, and in case of solid medium treatments, radial growth was also measured. Results and Discussion All species were adversely affected by high levels of Cd and Zn, and A. occidentalis was the most sensitive, with considerable biomass decrease at 1 mg L−1 Cd, while Scleroderma sp. and H. subsaponaceum were the most tolerant, which are species commonly found in highly contaminated sites. Cd was generally 10 times more toxic than Zn, which may explain why Zn had little impact in alleviating Cd effects. In some cases, Cd and Zn interactions led to a synergistic toxicity, depending on the concentrations applied and type of media used. Increased tolerance patterns were detected in fungi grown in solid medium and may be the cause of divergent toxicity thresholds found in the literature. Furthermore, solid medium allows measuring radial growth/mycelial density as endpoints which are informative and in this case appeared be related to the high tolerance indices found in H. subsaponaceum.

  13. Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.

    Science.gov (United States)

    Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina

    2011-01-01

    Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

  14. Cytotoxic activity of methanol extracts from Basidiomycete mushrooms on murine cancer cell lines.

    Science.gov (United States)

    Tomasi, S; Lohézic-Le Dévéhat, F; Sauleau, P; Bézivin, C; Boustie, J

    2004-04-01

    Crude methanol extracts of 58 mushroom species were screened for their cytotoxic activities against two murine cancer cell lines, L1210 and 3LL, using the tetrazolium assay. A majority of extracts (74%) exhibited IC50 > 100 microg/ml against both cell lines. A most marked activity against one of the cell lines was noted for nine species (14% of the tested species). While Amanitales and Russulales tested were not found active, Polyporales and Boletales gave better results. Four species exhibited a significant cytotoxic activity (IC50 Suillus granulatus, S. luteus). The last one had never been investigated for its cytotoxic compounds before.

  15. Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes.

    Science.gov (United States)

    Shi, Liang; Chen, Dongdong; Xu, Chao; Ren, Ang; Yu, Hanshou; Zhao, Mingwen

    2017-07-11

    Flammulina velutipes is a well-known edible mushroom cultivated all over the world. However, because of the low transformation frequency, the expensive instruments required, and the complicated, time-consuming procedures necessary, there is insufficient genetic research on F. velutipes. In this study, we report a liposome-mediated transformation (LMT) system for the genetic transformation of F. velutipes. Using the LMT system, we obtained 82 ± 4 stable F. velutipes transformants per 10 5 protoplasts, which is a clear increase in transformation frequency compared to the other methods used. We were able to detect the expression of an EGFP reporter gene in the F. velutipes transformants using fluorescence imaging assays. Furthermore, we used this method to transfer the laccase gene into F. velutipes and found that the transcriptional level and enzymatic activity increased in these transformants. Mitotic stability analysis showed that all of the selected transformants remained mitotically stable, even after five successive rounds of sub-culturing. These results demonstrate a new transgenic approach that will facilitate F. velutipes research.

  16. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete

    OpenAIRE

    Kerem, Zohar; Bao, Wuli; Hammel, Kenneth E.

    1998-01-01

    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes....

  17. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete.

    Science.gov (United States)

    Kerem, Z; Bao, W; Hammel, K E

    1998-09-01

    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes. Analyses of degraded PEOs by gel permeation chromatography showed that the fungus cleaved PEO rapidly by an endo route. 13C NMR analyses of unlabeled and perdeuterated PEOs recovered from G. trabeum cultures showed that a major route for depolymerization was oxidative C---C bond cleavage, a reaction diagnostic for hydrogen abstraction from a PEO methylene group by a radical oxidant. Fenton reagent (Fe(II)/H2O2) oxidized PEO by the same route in vitro and therefore might account for PEO biodegradation if it is produced by the fungus, but the data do not rule out involvement of less reactive radicals. The reactivity and extrahyphal location of this PEO-degrading system suggest that its natural function is to participate in the brown rot of wood and that it may enable brown-rot fungi to degrade recalcitrant organopollutants.

  18. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  19. Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi.

    Science.gov (United States)

    Upadhyay, R C; Hofrichter, M

    1993-01-01

    Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.

  20. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

    Science.gov (United States)

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

    2015-07-01

    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  1. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes).

    Science.gov (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik

    2009-09-01

    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  2. Concentration and behavior of radiocesium in higher basidiomycetes in some Kanto and the Koshin districts, Japan

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Iwashima, Kiyoshi; Shibata, Hisashi.

    1990-01-01

    Concentration of 137 Cs, 134 Cs and potassium were measured in several higher fungi and in substrates, soils, woods and litters in some Kanto and the Koshin districts, Japan, following the Chernobyl accident during October to November 1989. 137 Cs concentrations in fungi were in the range of 0.7-101 Bq kg -1 · fresh. Maximum 137 Cs level in them was observed in Boletopsis leucomelas (Pers.: Fr.) Fayod. Significantly higher levels of concentration ratios of 137 Cs in fungi to substrates (e.g.; 137 Cs concentration · fresh in fungus/ 137 Cs concentration · dry in soil), 10 -1 to 10 x 10 -1 , were found nearly 10 to 1000 times as much as leaf vegetables, root crops and potatoes to substrates. It was confirmed that levels of concentration ratios of potassium were similar to those of 137 Cs. In all fungi, 134 Cs which released from the Chernobyl accident and is not present in nuclear weapons fallout was not detected. (author)

  3. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.

    2009-01-01

    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  4. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90 ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  5. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  6. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455 ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  7. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80 ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  8. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  9. Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth.

    Science.gov (United States)

    Mata, Juan Luis; Mishra, Nutan Tulapurkar

    2015-01-01

    Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

  10. Cellulase production by white-rot basidiomycetous fungi: solid-state versus submerged cultivation

    DEFF Research Database (Denmark)

    Bentil, Joseph A.; Thygesen, Anders; Mensah, Moses

    2018-01-01

    fungi for improved enzyme expression, as well as on-site approaches for production of enzyme blends for industrial biomass conversion. The quantitative comparisons made have implications for selection of the most appropriate cultivation method for WRB fungi for attaining maximal cellulase production....... on different biomass residues in SSC or SmC systems. Although some variation in cellulase production yields have been reported for certain substrates, the analysis convincingly shows that SmC is generally more efficient than SSC for obtaining high cellulase production yields and high cellulase production rates......) or submerged cultivation (SmC) systems. In this review, we quantitatively assess the data available in the literature on cellulase production yields by WRB fungi cultivated by SSC or SmC. The review also assesses cellulolytic enzyme production rates and enzyme recovery when WRB fungi are cultivated...

  11. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  12. Decomposition, nitrogen and phosphorus mineralization from beech leaf litter colonized with ectomycorrhizal or litter decomposing basidiomycetes

    OpenAIRE

    COLPAERT, Jan; VAN TICHELEN, Katia

    1996-01-01

    The decomposition and the nitrogen and phosphorus mineralization of fresh beech (Fagus sylvatica L.) leaf litter are described. Leaves were buried for up to 6 months in plant containers in which Scots pine (Pinus sylvestris L.) seedlings were cultivated at a low rate of nutrient addition. The saprotrophic abilities of three ectomycorrhizal fungi, Thelephora terrestris Ehrh.: Fr., Suillus bovinus (L.: Fr.) O. Kuntze and Paxillus involutes (Batsch: Fr) Fr., were compared with the degradation ca...

  13. Effects of pH and Temperature on Recombinant Manganese Peroxidase Production and Stability

    Science.gov (United States)

    Jiang, Fei; Kongsaeree, Puapong; Schilke, Karl; Lajoie, Curtis; Kelly, Christine

    The enzyme manganese peroxidase (MnP) is produced by numerous white-rot fungi to overcome biomass recalcitrance caused by lignin. MnP acts directly on lignin and increases access of the woody structure to synergistic wood-degrading enzymes such as cellulases and xylanases. Recombinant MnP (rMnP) can be produced in the yeast Pichia pastoris αMnP1-1 in fed-batch fermentations. The effects of pH and temperature on recombinant manganese peroxidase (rMnP) production by P. pastoris αMnP1-1 were investigated in shake flask and fed-batch fermentations. The optimum pH and temperature for a standardized fed-batch fermentation process for rMnP production in P. pastoris ctMnP1-1 were determined to be pH 6 and 30 °C, respectively. P. pastoris αMnP1-1 constitutively expresses the manganese peroxidase (mnp1) complementary DNA from Phanerochaete chrysosporium, and the rMnP has similar kinetic characteristics and pH activity and stability ranges as the wild-type MnP (wtMnP). Cultivation of P. chrysosporium mycelia in stationary flasks for production of heme peroxidases is commonly conducted at low pH (pH 4.2). However, shake flask and fed-batch fermentation experiments with P. pastoris αMnP1-1 demonstrated that rMnP production is highest at pH 6, with rMnP concentrations in the medium declining rapidly at pH less than 5.5, although cell growth rates were similar from pH 4-7. Investigations of the cause of low rMnP production at low pH were consistent with the hypothesis that intracellular proteases are released from dead and lysed yeast cells during the fermentation that are active against rMnP at pH less than 5.5.

  14. ISOLASI DAN KARAKTERISASI JAMUR PENDEGRADASI ZAT PEWARNA TEKSTIL (Isolation and Characterization of dye-degrading Fungi

    Directory of Open Access Journals (Sweden)

    Erni Martani

    2011-07-01

    Full Text Available ABSTRAK Industri tekstil tidak saja menghasilkan sandang yang merupakan kebutuhan primer manusia, tetapi juga mengeluarkan limbah yang berpotensi sebagai penyebab pencemaran lingkungan. Komponen utama limbah industri ini adalah berbagai jenis zat pewarna tekstil. Penelitian ini bertujuan untuk memperoleh isolat-isolat jamur yang mampu mendegradasi beberapa jenis zat pewarna tekstil. Isolasi dilakukan menggunakan metode surface plating di atas medium Potato Dextrose Agar, dan seleksi kemampuan degradasi pewarna berdasarkan atas toleransi terhadap konsentrasi zat pewarna, serta besar dan kecepatan dekolorisasi beberapa jenis zat pewarna. Sebagai parameter awal digunakan enam zat pewarna tekstil. Isolat-isolat unggul kemudian diidentifikasi awal berdasar atas morfologi mikroskopis terhadap miseliumnya. Dalam penelitian ini juga digunakan beberapa kultur murni jamur pembusuk putih sebagai pembanding. Dalam penelitian ini digunakan limbah cair dan padat beberapa industri tekstil dan industri pulp & paper, tanah gambut dari Kalimantan Tengah dan Riau, tanah sekitar Tempat Pembuangan Sampah Akhir, serta tanah seresah hutan. Dari berbagai sumber tersebut diperoleh 101 isolat jamur. Uji dekolorisasi kualitatif terhadap 6 zat pewarna menghasilkan 6 isolat unggul yang mampu mendekolorisasi lebih dari tiga jenis pewarna dengan kecepatan relatif tinggi. Masing-masing isolat unggul memiliki spesifikasi dalam daya dekolorisasi terhadap ke 6 jenis pewarna. Identifikasi awal terhadap isolat unggul menunjukkan bahwa mereka berasal dari genus Aspergillus, Cladosporium, Penicillium dan Stachybotrys. Sedangkan uji terhadap kultur jamur pembusuk putih sebagai pembanding menghasilkan 2 kultur unggul, yaitu: Phanerochaete chrysosporium dan Pleurotus ostreatus. Secara umum kemampuan dekolorisasi isolat-isolat jamur kebanyakan masih di bawah kemampuan kedua kultur murni tersebut, namun beberapa isolat justru memiliki kemampuan lebih tinggi dibandingkan kultur pembanding

  15. Bio-Remediation of Acid Mine Drainage in the Sarcheshmeh Porphyry Copper Mine by Fungi: Batch and Fixed Bed Process

    Directory of Open Access Journals (Sweden)

    Hanieh Soleimanifar

    2012-12-01

    Full Text Available Acid mine drainage (AMD containing high concentrations of iron and sulphate, low pH and variableconcentrations of heavy metals leads to many environmental problems. The concentrations of Cu and Mnare high in the AMD of the Sarcheshmeh porphyry copper mine, Kerman province, south of Iran. In thisstudy, the bio-remediation of Cu and Mn ions from acid mine drainage was investigated using two nativefungi called Aspergillus niger and Phanerochaete chrysosporium which were extracted from the soil andsediment samples of the Shour River at the Sarcheshmeh mine. The live fungi was first harvested andthen killed by boiling in 0.5 N NaOH solution. The biomass was finally dried at 60 C for 24 h andpowdered. The optimum biosorption parameters including pH, temperature, the amount of biosorbent andcontact time were determined in a batch system. The optimum pH varied between 5 and 6. It was foundthat the biosorption process increased with an increase in temperature and the amount of biosorbent.Biosorption data were attempted by Langmuir and Freundlich isotherm models and showed a good match.Kinetic studies were also carried out in the present study. The results show that the second-order kineticsmodel fits well the experimental data. The biosorption experiments were further investigated with acontinuous system to compare the biosorption capacities of two systems. The results show thatbiosorption process using a continuous system increases efficiency up to 99%. A desorption process waseventually performed in order to recover Copper and Manganese ions. This process was successful andfungi could be used again.

  16. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    International Nuclear Information System (INIS)

    Galindo, T.P.S.; Pereira, R.; Freitas, A.C.; Santos-Rocha, T.A.P.; Rasteiro, M.G.; Antunes, F.; Rodrigues, D.; Soares, A.M.V.M.; Gonçalves, F.

    2013-01-01

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP

  17. Comparative Analysis of Secretome Profiles of Manganese(II-Oxidizing Ascomycete Fungi.

    Directory of Open Access Journals (Sweden)

    Carolyn A Zeiner

    Full Text Available Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a. We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.

  18. Perspectives on the use of transcriptomics to advance biofuels

    Directory of Open Access Journals (Sweden)

    Siseon Lee

    2015-11-01

    Full Text Available As a field within the energy research sector, bioenergy is continuously expanding. Although much has been achieved and the yields of both ethanol and butanol have been improved, many avenues of research to further increase these yields still remain. This review covers current research related with transcriptomics and the application of this high-throughput analytical tool to engineer both microbes and plants with the penultimate goal being better biofuel production and yields. The initial focus is given to the responses of fermentative microbes during the fermentative production of acids, such as butyric acid, and solvents, including ethanol and butanol. As plants offer the greatest natural renewable source of fermentable sugars within the form of lignocellulose, the second focus area is the transcriptional responses of microbes when exposed to plant hydrolysates and lignin-related compounds. This is of particular importance as the acid/base hydrolysis methods commonly employed to make the plant-based cellulose available for enzymatic hydrolysis to sugars also generates significant amounts of lignin-derivatives that are inhibitory to fermentative bacteria and microbes. The article then transitions to transcriptional analyses of lignin-degrading organisms, such as Phanerochaete chrysosporium, as an alternative to acid/base hydrolysis. The final portion of this article will discuss recent transcriptome analyses of plants and, in particular, the genes involved in lignin production. The rationale behind these studies is to eventually reduce the lignin content present within these plants and, consequently, the amount of inhibitors generated during the acid/base hydrolysis of the lignocelluloses. All four of these topics represent key areas where transcriptomic research is currently being conducted to identify microbial genes and their responses to products and inhibitors as well as those related with lignin degradation/formation.

  19. Irradiation of Liquid Fungi Isolated Media from Contaminated Sources with Heavy Metals Additive

    International Nuclear Information System (INIS)

    Tawfiq, E.; Mohamed, A.A.; El-Kabbany, H.M.

    2012-01-01

    Occupational lead exposure is an important health issue in Egyptian workers, employees of paint factories, workers of copying centres, drivers, and tile making factories are in higher risk of lead toxicity. Wastewater, particularly from electroplating, paint, leather, metal and tanning industries, contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and bio sorption at low cost and in eco-friendly way. Low level lead exposure can significantly induce motor dis functions and cognitive impairment in children. Seventy six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspergillus awamori, Aspergillus flavus, Trichoderma viride) were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi with respect to Pb, Cd, Cr and Ni with maximum uptake of 59.67, 16.25, 0.55 and 0.55 mg/g by fungi Pb 3 (Aspergillus terreus), Trichoderma viride, C r 8 (Trichoderma longibrachiatum), and isolate Ni 27 (A. niger), respectively. This indicated the potential of these fungi as bio sorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. The F-ratio was 0.55 and gives non-significant as irradiated

  20. Extracellular oxidative metabolism of wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Daniel Cullen

    2010-04-21

    Substantial progress has been made toward understanding the fundamental physiology and genetics of wood decay fungi, microbes that are capable of degrading all major components of plant cell walls. Efficient utilization of lignocellulosic biomass has been hampered in part by limitations in our understanding of enzymatic mechanisms of plant cell wall degradation. This is particularly true of woody substrates where accessibility and high lignin content substantially complicate enzymatic 'deconstruction'. The interdisciplinary research has illuminated enzymatic mechanisms essential for the conversion of lignocellulosics to simple carbohydrates and other small molecular weight products. Progress was in large part dependent on substantial collaborations with the Department of Energy's Joint Genome Institute (JGI) in Walnut Creek and Los Alamos, as well as the Catholic University, Santiago, Chile, the Royal Institute of Technology, Stockholm, the University of Minnesota, St. Paul, and colleagues at the University of Wisconsin and the Forest Products Laboratory. Early accomplishments focused on the development of experimental tools (2, 7, 22, 24-26, 32) and characterization of individual genes and enzymes (1, 3-5, 8, 9, 11, 14, 15, 17, 18, 23, 27, 33). In 2004, the genome of the most intensively studied lignin-degrading fungus, Phanerochaete chrysosporium, was published (21). This milestone lead to additional progress on this important model system (6, 10, 12, 13, 16, 28-31) and was further complemented by genome analysis of other important cellulose-degrading fungi (19, 20). These accomplishments have been highly cited and have paved the way for whole new research areas.

  1. Potential for bioremediation of agro-industrial effluents with high loads of pesticides by selected fungi.

    Science.gov (United States)

    Karas, Panagiotis A; Perruchon, Chiara; Exarhou, Katerina; Ehaliotis, Constantinos; Karpouzas, Dimitrios G

    2011-02-01

    Wastewaters from the fruit packaging industry contain a high pesticide load and require treatment before their environmental discharge. We provide first evidence for the potential bioremediation of these wastewaters. Three white rot fungi (WRF) (Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus) and an Aspergillus niger strain were tested in straw extract medium (StEM) and soil extract medium (SEM) for degrading the pesticides thiabendazole (TBZ), imazalil (IMZ), thiophanate methyl (TM), ortho-phenylphenol (OPP), diphenylamine (DPA) and chlorpyrifos (CHL). Peroxidase (LiP, MnP) and laccase (Lac) activity was also determined to investigate their involvement in pesticide degradation. T. versicolor and P. ostreatus were the most efficient degraders and degraded all pesticides (10 mg l⁻¹) except TBZ, with maximum efficiency in StEM. The phenolic pesticides OPP and DPA were rapidly degraded by these two fungi with a concurrent increase in MnP and Lac activity. In contrast, these enzymes were not associated with the degradation of CHL, IMZ and TM implying the involvement of other enzymes. T. versicolor degraded spillage-level pesticide concentrations (50 mg l⁻¹) either fully (DPA, OPP) or partially (TBZ, IMZ). The fungus was also able to rapidly degrade a mixture of TM/DPA (50 mg l⁻¹), whereas it failed to degrade IMZ and TBZ when supplied in a mixture with OPP. Overall, T. versicolor and P. ostreatus showed great potential for the bioremediation of wastewaters from the fruit packaging industry. However, degradation of TBZ should be also achieved before further scaling up.

  2. Ethanol production from lignocellulosic materials. Fermentation and on-line analysis

    Energy Technology Data Exchange (ETDEWEB)

    Olsson, L.

    1994-04-01

    The fermentation performance of bacteria, yeast and fungi was investigated in lignocellulosic hydrolysates with the aim of finding microorganisms which both withstand the inhibitors and that have the ability to ferment pentoses. Firstly, the performance of Saccharomyces cidri, Saccharomyces cerevisiae, Lactobacillus brevis, Lactococcus lactis ssp lactis, Escherichia coli and Zymomonas mobilis was investigated in spent sulphite liquor and enzymatic hydrolysate of steam-pretreated willow. Secondly, the performance of natural and recombinant E. coli, Pichia stipitis, recombinant S. cerevisiae, S. cerevisiae in combination with xylose isomerase and Fusarium oxysporum was investigated in a xylose-rich acid hydrolysate of corn cob. Recombinant E. coli was the best alternative for fermentation of lignocellulosic hydrolysates, giving both high yields and productivities. The main drawback was that detoxification was necessary. The kinetics of the fermentation with recombinant E. coli KO11 was investigated in the condensate of steam-pretreated willow. A cost analysis of the ethanol production from willow was made, which predicted an ethanol production cost of 3.9 SEK/l for the pentose fermentation. The detoxification cost constituted 22% of this cost. The monitoring of three monosaccharides and ethanol in lignocellulosic hydro lysates is described. The monosaccharides were determined using immobilized pyranose oxidase in an on-line amperometric analyser. Immobilization and characterization of pyranose oxidase from Phanerochaete chrysosporium is also described. The ethanol was monitored on-line using a micro dialysis probe as an in situ sampling device. The dialysate components were then separated in a column liquid chromatographic system and the ethanol was selectively detected by an amperometric alcohol bio sensor. The determinations with on-line analysis methods agreed well with off-line methods. 248 refs, 4 figs, 12 tabs

  3. Genome, transcriptome, and secretome analysis of wood decay fungus postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego [Los Alamos National Laboratory; Challacombe, Jean F [Los Alamos National Laboratory; Misra, Monica [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Brettin, Thomas [Los Alamos National Laboratory; Morgenstern, Ingo [CLARK UNIV; Hibbett, David [CLARK UNIV.; Schmoll, Monika [UNIV WIEN; Kubicek, Christian P [UNIV WIEN; Ferreira, Patricia [CIB, CSIC, MADRID; Ruiz - Duenase, Francisco J [CIB, CSIC, MADRID; Martinez, Angel T [CIB, CSIC, MADRID; Kersten, Phil [FOREST PRODUCTS LAB; Hammel, Kenneth E [FOREST PRODUCTS LAB; Vanden Wymelenberg, Amber [U. WISCONSIN; Gaskell, Jill [FOREST PRODUCTS LAB; Lindquist, Erika [DOE JGI; Sabati, Grzegorz [U. WISCONSIN; Bondurant, Sandra S [U. WISCONSIN; Larrondo, Luis F [U. CATHOLICA DE CHILE; Canessa, Paulo [U. CATHOLICA DE CHILE; Vicunna, Rafael [U. CATHOLICA DE CHILE; Yadavk, Jagiit [U. CINCINATTI; Doddapaneni, Harshavardhan [U. CINCINATTI; Subramaniank, Venkataramanan [U. CINCINATTI; Pisabarro, Antonio G [PUBLIC U. NAVARRE; Lavin, Jose L [PUBLIC U. NAVARRE; Oguiza, Jose A [PUBLIC U. NAVARRE; Master, Emma [U. TORONTO; Henrissat, Bernard [CNRS, MARSEILLE; Coutinho, Pedro M [CNRS, MARSEILLE; Harris, Paul [NOVOZYMES, INC.; Magnuson, Jon K [PNNL; Baker, Scott [PNNL; Bruno, Kenneth [PNNL; Kenealy, William [MASCOMA, INC.; Hoegger, Patrik J [GEORG-AUGUST-U.; Kues, Ursula [GEORG-AUGUST-U; Ramaiva, Preethi [NOVOZYMES, INC.; Lucas, Susan [DOE JGI; Salamov, Asaf [DOE JGI; Shapiro, Harris [DOE JGI; Tuh, Hank [DOE JGI; Chee, Christine L [UNM; Teter, Sarah [NOVOZYMES, INC.; Yaver, Debbie [NOVOZYMES, INC.; James, Tim [MCMASTER U.; Mokrejs, Martin [CHARLES U.; Pospisek, Martin [CHARLES U.; Grigoriev, Igor [DOE JGI; Rokhsar, Dan [DOE JGI; Berka, Randy [NOVOZYMES; Cullen, Dan [FOREST PRODUCTS LAB

    2008-01-01

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative {beta}-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC{center_dot}MSIMS). Also upregulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H202. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H202 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons to the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost.

  4. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, T.P.S., E-mail: pgalindo@ua.pt [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Pereira, R. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto (Portugal); Freitas, A.C.; Santos-Rocha, T.A.P. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Rasteiro, M.G.; Antunes, F. [Department of Chemical Engineering, University of Coimbra, 3030-290 Coimbra (Portugal); Rodrigues, D. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Soares, A.M.V.M.; Gonçalves, F. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); and others

    2013-08-01

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP.

  5. H2O2 recycling during oxidation of the arylglycerol beta-aryl ether lignin structure by lignin peroxidase and glyoxal oxidase.

    Science.gov (United States)

    Hammel, K E; Mozuch, M D; Jensen, K A; Kersten, P J

    1994-11-15

    Oxidative C alpha-C beta cleavage of the arylglycerol beta-aryl ether lignin model 1-(3,4-dimethoxy-phenyl)-2-phenoxypropane-1,3-diol (I) by Phanerochaete chrysosporium lignin peroxidase in the presence of limiting H2O2 was enhanced 4-5-fold by glyoxal oxidase from the same fungus. Further investigation showed that each C alpha-C beta cleavage reaction released 0.8-0.9 equiv of glycolaldehyde, a glyoxal oxidase substrate. The identification of glycolaldehyde was based on 13C NMR spectrometry of reaction product obtained from beta-, gamma-, and beta,gamma-13C-substituted I, and quantitation was based on an enzymatic NADH-linked assay. The oxidation of glycolaldehyde by glyoxal oxidase yielded 0.9 oxalate and 2.8 H2O2 per reaction, as shown by quantitation of oxalate as 2,3-dihydroxyquinoxaline after derivatization with 1,2-diaminobenzene and by quantitation of H2O2 in coupled spectrophotometric assays with veratryl alcohol and lignin peroxidase. These results suggest that the C alpha-C beta cleavage of I by lignin peroxidase in the presence of glyoxal oxidase should regenerate as many as 3 H2O2. Calculations based on the observed enhancement of LiP-catalyzed C alpha-C beta cleavage by glyoxal oxidase showed that approximately 2 H2O2 were actually regenerated per cleavage of I when both enzymes were present. The cleavage of arylglycerol beta-aryl ether structures by ligninolytic enzymes thus recycles H2O2 to support subsequent cleavage reactions.

  6. Bio-ethanol production from waste biomass of Pogonatherum crinitum phytoremediator: an eco-friendly strategy for renewable energy.

    Science.gov (United States)

    Waghmare, Pankajkumar R; Watharkar, Anuprita D; Jeon, Byong-Hun; Govindwar, Sanjay P

    2018-03-01

    In this study, we have described three steps to produce ethanol from Pogonatherum crinitum , which was derived after the treatment of textile wastewater. (a) Production of biomass: biomass samples collected from a hydroponic P. crinitum phytoreactor treating dye textile effluents and augmented with Ca-alginate immobilized growth-promoting bacterium, Bacillus pumilus strain PgJ (consortium phytoreactor), and waste sorghum husks were collected and dried. Compositional analysis of biomass (consortium phytoreactor) showed that the concentration of cellulose, hemicelluloses and lignin was 42, 30 and 17%, respectively, whereas the biomass samples without the growth-promoting bacterium (normal phytoreactor) was slightly lower, 40, 29 and 16%, respectively. (b) Hydrolysate (sugar) production: a crude sample of the fungus, Phanerochaete chrysosporium containing hydrolytic enzymes such as endoglucanase (53.25 U/ml), exoglucanase (8.38 U/ml), glucoamylase (115.04 U/ml), xylanase (83.88 U/ml), LiP (0.972 U/ml) and MnP (0.459 U/ml) was obtained, and added to consortium, normal and control phytoreactor derived biomass supplemented with Tween-20 (0.2% v/v). The hydrolysate of biomass from consortium phytoreactor produced maximum reducing sugar (0.93 g/l) than hydrolysates of normal phytoreactor biomass (0.82 g/l) and control phytoreactor biomass (0.79 g/l). FTIR and XRD analysis confirmed structural changes in treated biomass. (c) Ethanol production: the bioethanol produced from enzymatic hydrolysates of waste biomass of consortium and normal phytoreactor using Saccharomyces cerevisiae (KCTC 7296) was 42.2 and 39.4 g/l, respectively, while control phytoreactor biomass hydrolysate showed only 25.5 g/l. Thus, the amalgamation of phytoremediation and bioethanol production can be the truly environment-friendly way to eliminate the problem of textile dye along with bioenergy generation.

  7. Microbial liquefaction of peat for the production of synthetic fuels

    Energy Technology Data Exchange (ETDEWEB)

    Gunasekaran, M.

    1988-01-01

    Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungi were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.

  8. Comparative Analysis of Secretome Profiles of Manganese(II)-Oxidizing Ascomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Zeiner, Carolyn A.; Purvine, Samuel O.; Zink, Erika M.; Paša-Tolić, Ljiljana; Chaput, Dominique L.; Haridas, Sajeet; Wu, Si; LaButti, Kurt; Grigoriev, Igor V.; Henrissat, Bernard; Santelli, Cara M.; Hansel, Colleen M.; Pöggeler, Stefanie

    2016-07-19

    Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II)-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a). We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.

  9. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  10. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p < 0.01). A positive correlation existed between the phenolic content and antioxidant activity. Our results indicated that fruiting bodies of G. lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application.

  11. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  12. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  13. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  14. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  15. Effect of cultural conditions on antrodin C production by basidiomycete Antrodia camphorata in solid-state fermentation.

    Science.gov (United States)

    Xia, Yongjun; Wang, Yuanlong; Zhang, Bobo; Xu, Ganrong; Ai, Lianzhong

    2014-01-01

    Antrodia camphorata is a medicinal fungus and antrodin C is one of the main bioactive components of A. camphorata in the submerged fermentation (SmF). To optimize the culture conditions, the factors influencing the production of antrodin C by A. camphorata under solid-state fermentation (SSF) were investigated in this study. Different solid substrates and external nitrogen sources were tested for their efficiency in producing antrodin C. The response surface methodology was applied to evaluate the influence of several variables, namely, the concentrations of soybean meal, initial moisture content, and inoculum density on antrodin C production in solid-state fermentation. The experimental results show that the optimum fermentation medium for antrodin C production by A. camphorata was composed of 0.578 g soybean meal, 0.05 g Na2 HPO4 , 0.05 g MgSO4 for 100 g rice, with 51.83% initial moisture content, 22 day culture time, 28 °C culture temperature, and 35.54% inoculum density. At optimized conditions, 6,617.36 ± 92.71 mg kg(-1) yield of antrodin C was achieved. Solid-state fermentation is one good cultural method to improve the production of antrodin C by A. camphorata. © 2014 International Union of Biochemistry and Molecular Biology, Inc.

  16. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Helbert David Siabatto F.

    2005-07-01

    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  17. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  18. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  19. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  20. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots

    NARCIS (Netherlands)

    Tagu, D; De Bellis, R; Balestrini, R; De Vries, OMH; Piccoli, G; Stocchi, [No Value; Bonfante, P; Martin, F

    The immunolocalization of one of the hydrophobins of Pisolithus tinctorius (HYDPt-1) is reported. Hydrophobin proteins play key roles in adhesion and aggregation of fungal hyphae, and it is already known that formation of ectomycorrhizas on eucalypt roots enhances the accumulation of hydrophobin

  1. Cryptococcus haglerorum, sp. nov., an anamorphic basidiomycetous yeast isolated from nests of the leaf-cutting ant Atta sexdens.

    NARCIS (Netherlands)

    Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.

    2003-01-01

    A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus

  2. Immunomodulatory activities of different solvent extracts from Tricholoma matsutake (S. Ito et S. Imai) singer (higher basidiomycetes) on normal mice.

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Jiang, Zhonghai

    2012-01-01

    The immunomodulatory activities of different solvent extracts from the culinary-medicinal mushroom Tricholoma matsutake were studied in vivo in normal mice. The extracts were prepared using different solvents in an order of increasing polarity. The immunomodulatory activities were investigated by measuring the thymus and spleen index, phagocytic rate of macrophage phagocytosis, delayed-type hypersensitivity, plaque-forming cell, and proliferation of splenocytes. Results demonstrated that water extract (WE) and n-butyl alcohol extract (BAE) of T. matsutake could enhance the immunity of mice significantly compared with the control group. Main components of WE and BAE were polysaccharides, proteins, and flavonoids; we presume that these may be the main immunomodulating and immuno-enhancing agents in T. matsutake.

  3. Extraction, Antimicrobial, and Antioxidant Activities of Crude Polysaccharides from the Wood Ear Medicinal Mushroom Auricularia auricula-judae (Higher Basidiomycetes).

    Science.gov (United States)

    Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long

    2015-01-01

    In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.

  4. Mating tests among geographically separated collections of the Trametes versicolor (Fr.) Pilát (Basidiomycetes, Polyporales) group

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 79, 3-4 (2004), s. 425-431 ISSN 0029-5035 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : trametes versicolor * mating tests Subject RIV: EE - Microbiology, Virology Impact factor: 0.594, year: 2004

  5. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660 ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  6. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    with Anaeroclip® clips and Anaerotest® indicatorwere incubated at 25ºC, according to the 4 manufacturer’s instructions, either directly orafter oxicpre-incubation for 24 or 48 h. Growth was inspected at regular intervals up to one year. 2.3 Electron... °C. The PCR amplicons were purified using GenEluteTMGel Extraction kit (Sigma Aldrich, USA) and cloned individually for each gene using the TA cloning kit (Invitrogen, USA) according to the manufacturer’s instructions. A representative clone...

  7. Medicinal Mushroom Cracked-Cap Polypore, Phellinus rimosus (Higher Basidiomycetes) Attenuates Acute Ethanol-Induced Lipid Peroxidation in Mice.

    Science.gov (United States)

    Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Alcohol abuse and alcoholism remain one of the major health issues worldwide, especially in developing countries. The protective effect of Phellinus rimosus against acute alcohol-induced lipid peroxidation in the liver, kidney, and brain as well as its effect against antioxidant enzyme activity such as superoxide (SOD) and catalase (CAT) in the liver was evaluated in mice. Ethyl acetate extract of Ph. Rimosus (50 mg/kg body wt, p.o.) 1 h before each administration of alcohol (3 mL/kg, p.o.; total 2 doses at 24-h intervals) protected against lipid peroxidation in all organs and attenuated the decline of SOD and CAT activity in the liver. The fold increase in lipid peroxidation, including conjugated diene and thiobarbituric acid reactive substance (TBARS) levels, was highest in the liver. There were 2.6- and 1.5- fold increases in TBARS levels in the liver of the alcohol alone- and alcohol+Ph. Rimosus-treated groups, compared with that of the normal group. Activity of SOD and CAT in the liver of alcohol- and alcohol+Ph. Rimosus- treated animals was 9.05±1.38, 18.76±1.71, and 11.26±1.02, 31.58±3.35 IU/mg protein, respectively. Extract at 1 mg/mL inhibited 50.6% activity of aniline hydroxylase (CYP2E1) in liver homogenate. From these results, we concluded that the extract significantly protected against the lipid peroxidation. Protection in the liver may be due to the inhibitory effect on CYP2E1 as well as the direct radical scavenging effect of Ph. Rimosus, which warrants further research.

  8. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat; Bakkeren, Guus

    2014-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer

  9. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  10. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  11. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  12. Simulated nitrogen deposition affects wood decomposition by cord-forming fungi.

    Science.gov (United States)

    Bebber, Daniel P; Watkinson, Sarah C; Boddy, Lynne; Darrah, Peter R

    2011-12-01

    Anthropogenic nitrogen (N) deposition affects many natural processes, including forest litter decomposition. Saprotrophic fungi are the only organisms capable of completely decomposing lignocellulosic (woody) litter in temperate ecosystems, and therefore the responses of fungi to N deposition are critical in understanding the effects of global change on the forest carbon cycle. Plant litter decomposition under elevated N has been intensively studied, with varying results. The complexity of forest floor biota and variability in litter quality have obscured N-elevation effects on decomposers. Field experiments often utilize standardized substrates and N-levels, but few studies have controlled the decay organisms. Decomposition of beech (Fagus sylvatica) blocks inoculated with two cord-forming basidiomycete fungi, Hypholoma fasciculare and Phanerochaete velutina, was compared experimentally under realistic levels of simulated N deposition at Wytham Wood, Oxfordshire, UK. Mass loss was greater with P. velutina than with H. fasciculare, and with N treatment than in the control. Decomposition was accompanied by growth of the fungal mycelium and increasing N concentration in the remaining wood. We attribute the N effect on wood decay to the response of cord-forming wood decay fungi to N availability. Previous studies demonstrated the capacity of these fungi to scavenge and import N to decaying wood via a translocating network of mycelium. This study shows that small increases in N availability can increase wood decomposition by these organisms. Dead wood is an important carbon store and habitat. The responses of wood decomposers to anthropogenic N deposition should be considered in models of forest carbon dynamics.

  13. Inducción fúngica de la biorremediación de suelos contaminados con combustibles

    Directory of Open Access Journals (Sweden)

    Mary Lopretti

    2011-04-01

    Full Text Available La biorremediación de suelos ha sido en los últimos años una de las aplicaciones de los procesos de la biotecnología industrial que se ha desarrollado en busca de soluciones  naturales y eficientes al problema de la contaminación.Varios son los microorganismos que viven en condiciones extremas, desarrollando estrategias metabólicas que les permiten tener sus vías metabólicas aptas para vivir y reproducirse. Dentro de estas estrategias  se encuentra la acción de enzimas hidrolíticas, oxidativas y depolimerizantes que permiten modificar sustratos complejos como lo son los derivados del petróleo  y entre ellos los combustibles.En el presente trabajo se estudió la acción de dos hongos Gloeophylum trabeum y Phanerochaetes chrysosporium actuando en forma consorcial sobre sustratos  contaminados con gasoil y nafta.Se prepararon 4 reactores de fermentación sólida: dos de ellos blanco, contaminados sin inducción, y de los otros dos uno con nafta y el otro con gasoil inoculados ambos con 100cc de medio de propagación con micelios de P.chrysosporium y 50cc de medio de crecimiento con pellets de G. trabeum. Se extrajeron muestras cada 15 días y se evaluó  en el material de cada reactor características fisicoquímicas como %C, humedad y pH.También se realizó la evaluación microbiológica por siembra en placa y dilución en placa con agar malta al 1,25%. En todos los casos se obtuvieron micelios.Por último se determinó la actividad de enzimas lacasa  y peroxidasa. La actividad lacasa se determinó por espectrometría usando 0.5mM de ABTS como sustrato en 0,1M de buffer acetato de sodio pH5 y 1 ml de extracto obtenido por extracción salina. La determinación de actividad Mn peroxidasa se realizó con 0.01% de rojo fenol como sustrato en buffer succinato de sodio 0.1M en presencia de 1 ml de extracto enzimático, MnSO4 0.1M y H2O2 0.1M.Las actividad  de éstas enzimas permitió obtener moléculas mas pequeñas producto de la

  14. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    International Nuclear Information System (INIS)

    Haritash, A.K.; Kaushik, C.P.

    2009-01-01

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H 2 O, CO 2 (aerobic) or CH 4 (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions and the rate can

  15. Biotransformation of Domestic Wastewater Treatment Plant Sludge by Two-Stage Integrated Processes -Lsb & Ssb

    Directory of Open Access Journals (Sweden)

    Md. Zahangir Alam, A. H. Molla and A. Fakhru’l-Razi

    2012-10-01

    Full Text Available The study of biotransformation of domestic wastewater treatment plant (DWTP sludge was conducted in laboratory-scale by two-stage integrated process i.e. liquid state bioconversion (LSB and solid state bioconversion (SSB processes. The liquid wastewater sludge [4% w/w of total suspended solids (TSS] was treated by mixed filamentous fungi Penicillium corylophilum and Aspergillus niger, isolated, screened and mixed cultured in terms of their higher biodegradation potential to wastewater sludge. The biosolids was increased to about 10% w/w. Conversely, the soluble [i.e. Total dissolve solid (TDS] and insoluble substances (TSS in treated supernatant were decreased effectively in the LSB process. In the developed LSB process, 93.8 g kg-1of biosolids were enriched with fungal biomass protein and nutrients (NPK, and 98.8% of TSS, 98.2% of TDS, 97.3% of turbidity, 80.2% of soluble protein, 98.8% of reducing sugar and 92.7% of chemical oxygen demand (COD in treated sludge supernatant were removed after 8 days of treatment. Specific resistance to filtration (1.39x1012 m/kg was decreased tremendously by the microbial treatment of DWTP sludge after 6 days of fermentation. The treated biosolids in DWTP sludge was considered as pretreated resource materials for composting and converted into compost by SSB process. The SSB process was evaluated for composting by monitoring the microbial growth and its subsequent roles in biodegradation in composting bin (CB. The process was conducted using two mixed fungal cultures, Trichoderma harzianum with Phanerochaete chrysosporium 2094 and (T/P and T. harzianum and Mucor hiemalis (T/M; and two bulking materials, sawdust (SD and rice straw (RS. The most encouraging results of microbial growth and subsequent solid state bioconversion were exhibited in the RS than the SD. Significant decrease of the C/N ratio and germination index (GI were attained as well as the higher value of glucosamine was exhibited in compost; which

  16. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    Energy Technology Data Exchange (ETDEWEB)

    Haritash, A.K., E-mail: akharitash@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India); Kaushik, C.P. [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India)

    2009-09-30

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H{sub 2}O, CO{sub 2} (aerobic) or CH{sub 4} (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions

  17. Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter

    Energy Technology Data Exchange (ETDEWEB)

    Hashida, Shin-nosuke; Yoshihara, Toshihiro [Environmental Science Research Laboratory, Central Research Institute of Electric Power Industry, Abiko 1646, Abiko-shi, Chiba (Japan)

    2014-07-01

    .e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)

  18. A fungal P450 (CYP5136A3 capable of oxidizing polycyclic aromatic hydrocarbons and endocrine disrupting alkylphenols: role of Trp(129 and Leu(324.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available The model white rot fungus Phanerochaete chrysosporium, which is known for its versatile pollutant-biodegradation ability, possesses an extraordinarily large repertoire of P450 monooxygenases in its genome. However, the majority of these P450s have hitherto unknown function. Our initial studies using a genome-wide gene induction strategy revealed multiple P450s responsive to individual classes of xenobiotics. Here we report functional characterization of a cytochrome P450 monooxygenase, CYP5136A3 that showed common responsiveness and catalytic versatility towards endocrine-disrupting alkylphenols (APs and mutagenic/carcinogenic polycyclic aromatic hydrocarbons (PAHs. Using recombinant CYP5136A3, we demonstrated its oxidation activity towards APs with varying alkyl side-chain length (C3-C9, in addition to PAHs (3-4 ring size. AP oxidation involves hydroxylation at the terminal carbon of the alkyl side-chain (ω-oxidation. Structure-activity analysis based on a 3D model indicated a potential role of Trp(129 and Leu(324 in the oxidation mechanism of CYP5136A3. Replacing Trp(129 with Leu (W129L and Phe (W129F significantly diminished oxidation of both PAHs and APs. The W129L mutation caused greater reduction in phenanthrene oxidation (80% as compared to W129F which caused greater reduction in pyrene oxidation (88%. Almost complete loss of oxidation of C3-C8 APs (83-90% was observed for the W129L mutation as compared to W129F (28-41%. However, the two mutations showed a comparable loss (60-67% in C9-AP oxidation. Replacement of Leu(324 with Gly (L324G caused 42% and 54% decrease in oxidation activity towards phenanthrene and pyrene, respectively. This mutation also caused loss of activity towards C3-C8 APs (20-58%, and complete loss of activity toward nonylphenol (C9-AP. Collectively, the results suggest that Trp(129 and Leu(324 are critical in substrate recognition and/or regio-selective oxidation of PAHs and APs. To our knowledge, this is the first

  19. Gold nanoparticles/water-soluble carbon nanotubes/aromatic diamine polymer composite films for highly sensitive detection of cellobiose dehydrogenase gene

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Guangming, E-mail: zgming@hnu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li Zhen, E-mail: happylizhen@yeah.ne [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Tang Lin; Wu Mengshi; Lei Xiaoxia; Liu Yuanyuan; Liu Can; Pang Ya; Zhang Yi [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2011-05-01

    Highlights: > Gold nanoparticles/multiwalled carbon nanotubes/poly (1,5-naphthalenediamine) modified electrode was fabricated. > The sensor was applied for the detection of cellobiose dehydrogenase genes. > An effective method to distribute MWCNTs and attach to the electrode was proposed. > The composite films greatly improved the sensitivity and enhanced the DNA immobilization. > The DNA biosensor exhibited fairly high sensitivity and quite low detection limit. - Abstract: An electrochemical sensor based on gold nanoparticles (GNPs)/multiwalled carbon nanotubes (MWCNTs)/poly (1,5-naphthalenediamine) films modified glassy carbon electrode (GCE) was fabricated. The effectiveness of the sensor was confirmed by sensitive detection of cellobiose dehydrogenase (CDH) gene which was extracted from Phanerochaete chrysosporium using polymerase chain reaction (PCR). The monomer of 1,5-naphthalenediamine was electropolymerized on the GCE surface with abundant free amino groups which enhanced the stability of MWCNTs modified electrode. Congo red (CR)-functionalized MWCNTs possess excellent conductivity as well as high solubility in water which enabled to form the uniform and stable network nanostructures easily and created a large number of binding sites for electrodeposition of GNPs. The continuous GNPs together with MWCNTs greatly increased the surface area, conductivity and electrocatalytic activity. This electrode structure significantly improved the sensitivity of sensor and enhanced the DNA immobilization and hybridization. The thiol modified capture probes were immobilized onto the composite films-modified GCE by a direct formation of thiol-Au bond and horseradish peroxidase-streptavidin (HRP-SA) conjugates were labeled to the biotinylated detection probes through biotin-streptavidin bond. Scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were used to investigate the film assembly and DNA hybridization processes

  20. Genomics reveals traces of fungal phenylpropanoid-flavonoid metabolic pathway in the f ilamentous fungus Aspergillus oryzae.

    Science.gov (United States)

    Juvvadi, Praveen Rao; Seshime, Yasuyo; Kitamoto, Katsuhiko

    2005-12-01

    Fungal secondary metabolites constitute a wide variety of compounds which either play a vital role in agricultural, pharmaceutical and industrial contexts, or have devastating effects on agriculture, animal and human affairs by virtue of their toxigenicity. Owing to their beneficial and deleterious characteristics, these complex compounds and the genes responsible for their synthesis have been the subjects of extensive investigation by microbiologists and pharmacologists. A majority of the fungal secondary metabolic genes are classified as type I polyketide synthases (PKS) which are often clustered with other secondary metabolism related genes. In this review we discuss on the significance of our recent discovery of chalcone synthase (CHS) genes belonging to the type III PKS superfamily in an industrially important fungus, Aspergillus oryzae. CHS genes are known to play a vital role in the biosynthesis of flavonoids in plants. A comparative genome analyses revealed the unique character of A. oryzae with four CHS-like genes (csyA, csyB, csyC and csyD) amongst other Aspergilli (Aspergillus nidulans and Aspergillus fumigatus) which contained none of the CHS-like genes. Some other fungi such as Neurospora crassa, Fusarium graminearum, Magnaporthe grisea, Podospora anserina and Phanerochaete chrysosporium also contained putative type III PKSs, with a phylogenic distinction from bacteria and plants. The enzymatically active nature of these newly discovered homologues is expected owing to the conservation in the catalytic residues across the different species of plants and fungi, and also by the fact that a majority of these genes (csyA, csyB and csyD) were expressed in A. oryzae. While this finding brings filamentous fungi closer to plants and bacteria which until recently were the only ones considered to possess the type III PKSs, the presence of putative genes encoding other principal enzymes involved in the phenylpropanoid and flavonoid biosynthesis (viz

  1. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes).

    Science.gov (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin

    2017-01-01

    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  2. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  3. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation.

    Science.gov (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2013-01-01

    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  4. The Effects of Light Intensity, Casing Layers, and Layering Styles on Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) Cultivation in Turkey.

    Science.gov (United States)

    Adanacioglu, Neşe; Boztok, Kaya; Akdeniz, Ramazan Cengiz

    2015-01-01

    The aim of this research is to evaluate the effects of light intensity, casing layers, and layering styles on the production of the culinary-medicinal mushroom Agaricus brasiliensis in Turkey. The experiments were designed in split-split plots and replicated twice. Three different light intensities-I1, 350 lux; I2, 450 lux; and I3, 750 lux-were used in main plots as environmental factors. A mixture of 4 different casing layers- peat (100%), peat-perlite (75%:25%), peat-clinoptilolite (75%:25%), and peat-perlite-clinoptilolite (60%:20%:20%)-were used at split plots and at split plots. S1, a flat, 3-cm casing layer; S2, a flat, 5-cm casing layer; and S3, casing soil ridges 10 cm wide × 4 cm high, 10 cm apart, were deposited on top of 1-cm overall soil casing layers. At the end of the harvest phase, the total yield was estimated per 100 kg of substrate. Biological efficiency (percentage) was determined from the fresh weight of the mushrooms and the dry weight of the compost at the end of the harvesting period. The highest total yield (7.2 kg/100 kg compost) and biological efficiency (27.63%) were achieved from I2 × peat-perlite-clinoptilolite × S2 treatment. Influence of light intensity, casing layer, layering style, and their interaction in treatments with color values (L*, a*, b*, chroma*, and hue*) also were examined. It has been shown that within color values, chroma* (saturation) values of mushroom caps were affected by light intensity, casing layer, and layering style treatments and light intensity × casing layer treatments and the brightness of mushroom caps tended to increase as light intensity increased.

  5. Optimization of cultivation conditions of fermented shaggy ink cap culinary-medicinal mushroom, Coprinus comatus (O.Mull.:Fr.) Pers. (higher Basidiomycetes) rich in Vanadium.

    Science.gov (United States)

    Zhang, Chunjing; Qi, Xiaodan; Shi, Yan; Sun, Yan; Li, Shuyan; Gao, Xiulan; Yu, Haitao

    2012-01-01

    The present paper is mainly aimed at optimization of cultivation conditions of fermented mushrooms of Coprinus comatus rich in vanadium (CCRV). Initial screening of effects of carbon source, temperature, pH, and inoculum size were done by using a one-factor-at-a-time method. The results obtained in that study showed that the optimal medium composition was 30 g glucose/Lin YEPG medium, initial pH 6.0, inoculum volume 10%, and incubation time 120 h. Then the medium was subjected to screening of the most significant parameters using the L9 orthogonal array to solve multivariable equations simultaneously. The results obtained in this study showed that the optimal medium composition was 0.4% V and 30 g glucose/Lin YEPG medium, initial pH 5.0, inoculum volume 15%, and incubation time 120 h. At this medium composition, the mycelial biomass and V content were 7.18 ± 0.24 g/L and 3786.0 ± 17 μg/g, respectively. The anti-diabetic potential of CCRV produced with the optimal level was tested in alloxan-induced diabetes. After the mice were administered (i.g.) with CCRV, the level of blood sugar in the CCRV group was very close to that of the control group. These findings suggested that CCRV produced with the optimal level is useful in the control of diabetes mellitus.

  6. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  7. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells.

    Science.gov (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan

    2015-01-01

    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells.

  8. COMPARATIVE GENOME ANALYSES OF MONILIOPHTHORA PERNICIOSA AND MONILIOPHTHORA RORERI: TWO CLOSELY RELATED PHYTOPATHOGENIC BASIDIOMYCETES THAT CAUSE DISTINCTLY DIFFERENT DISEASES OF THEOBROMA CACAO

    Science.gov (United States)

    Theobroma cacao (cacao), the source of chocolate, is a tropical understory tree. Fungal diseases such as Witches’ Broom Disease (WBD) and Frosty Pod Rot Disease (FPRD) of cacao have devastated cacao production in much of the Western Hemisphere and are threats to the main cacao producing regions in A...

  9. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.

    2016-02-01

    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  10. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  11. Antitumor and Immunomodulating Activities of Exopolysaccharide Produced by Big Cup Culinary- Medicinal Mushroom Clitocybe maxima (Higher Basidiomycetes) in Liquid Submerged Culture.

    Science.gov (United States)

    Hu, Shu-Hui; Cheung, Peter Chi Keung; Hung, Raw-Pou; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2015-01-01

    Water-soluble polysaccharides extracted from mushrooms have been found to have some physiological effects. In this study, exopolysaccharides (EPSs) were extracted by alcohol precipitation from cultivated broth of the mushroom Clitocybe maxima. EPSs with molecular weights of 10(4) and 10(5) Da were obtained by ultrafiltration; they are referred to as EPA and EPB, respectively. The major components of these EPSs were glucose, galactose, mannose, rhamnose, and arabinose. ICR mice with artificially induced metastatic pulmonary tumors were fed a daily diet containing EPA or EPB at doses of 8, 20, or 50 mg/kg. Results showed that the proliferation of pulmonary sarcoma lesions was lower in the groups fed EPS. In addition, the numbers of total T cells, CD4+ cells, CD8+ cells, and macrophages significantly increased in EPS-fed mice compared with the negative control group. The antitumor and immunomodulating effects observed in the EPB-fed groups were higher than those of EPA-fed groups. These results demonstrate the ability of EPSs of C. maxima to inhibit tumor cells while enhancing immune response.

  12. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav

    2012-01-01

    Roč. 355, č. 1-2 (2012), s. 341-352 ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  13. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages.

    Science.gov (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie

    2015-01-01

    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  14. A shift in nuclear state as the result of natural interspecific hybridization between two North American taxa of the basidiomycete complex Heterobasidion

    Science.gov (United States)

    Matteo Garbelotto; Paolo Gonthier; Rachel Linzer; Giovanni Nicolotti; William Otrosina

    2004-01-01

    A natural first generation hybrid fungus shows interspecific heterozygosity. The nuclear condition of a rare natural hybrid between two taxa of the Heterobasidion complex is investigated. Heterobasidion species are known to be either homokaryotic (haploid) or heterokaryotic (n + n), but heterokaryons are made up of both...

  15. Oxalic acid overproduction by copper-tolerant brown-rot basidiomycetes on southern yellow pine treated with copper-based preservatives

    Science.gov (United States)

    Carol A. Clausen; Frederick Green

    2003-01-01

    Accumulation of oxalic acid (OA) by brown-rot fungi and precipitation of copper oxalate crystals in wood decayed by copper-tolerant decay fungi has implicated OA in the mechanism of copper tolerance. Understanding the role of OA in copper tolerance is important due to an increasing reliance on copper-based wood preservatives. In this study, four copper-tolerant brown-...

  16. HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

    Science.gov (United States)

    Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

    2014-01-01

    The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

  17. Transformation of 14C-labelled lignin and humic substances in forest soil by the saprobic basidiomycetes Gymnopus erythropus and Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    2010-01-01

    Roč. 42, č. 9 (2010), s. 1541-1548 ISSN 0038-0717 R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : Forest soil * Humic acid * Gymnopus erythropus Subject RIV: EE - Microbiology, Virology Impact factor: 3.242, year: 2010

  18. Hypoglycemic and Hypolipidemic Effects of the Cracked-Cap Medicinal Mushroom Phellinus rimosus (Higher Basidiomycetes) in Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Rony, Kuttikkadan A; Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Phellinus rimosus is a parasitic host specific polypore mushroom with profound antioxidant, antihepatotoxic, anti-inflammatory, antitumor, and antimutagenic activities. This study investigated the hypoglycemic and hypolipidemic activities of the wood-inhabiting polypore mushroom Ph. Rimosus in streptozotocin (STZ)-induced diabetic rats. Diabetes was induced by single intraperitoneal injection of STZ (45 mg/kg) to Wistar rats. The effects of 30 days treatment with Ph. Rimosus (50 and 250 mg/ kg) and glibenclamide (0.65 mg/kg) on blood glucose level, serum insulin, serum lipid profile, liver glycogen, liver function enzymes, and non-enzymic and enzymic antioxidants activities in pancreas, liver, and kidney were evaluated in STZ-induced diabetic rats. Oral administration of Ph. Rimosus extract exhibited a significant reduction in blood glucose, triacylglycerol, total cholesterol, LDL-cholesterol, and liver function enzymes, and increased serum insulin, liver glycogen, and HDL-cholesterol levels in STZ-induced diabetic rats. Furthermore, Ph. Rimosus treatment increased antioxidant status in pancreas, liver, and kidney tissues with concomitant decreases in levels of thiobarbituric acid- reactive substances. Results of this study indicated that Ph. Rimosus possessed significant hypoglycemic and hypolipidemic activities and this effect may be related to its insulinogenic and antioxidant effect.

  19. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  20. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  1. Evaluation of the antigenotoxic effects of the royal sun mushroom, agaricus brasiliensis (Higher basidiomycetes) in human lymphocytes treated with thymol in the comet assay

    NARCIS (Netherlands)

    Radaković, Milena; Stevanović, Jevrosima; Soković, Marina; Radović, Dejan; Griensven, Van Leo J.L.D.; Stanimirović, Zoran

    2015-01-01

    The aim of this investigation was to evaluate the possible protective activity of Agaricus brasiliensis (=A. blazei sensu Murrill) ethanol extract against thymol-induced DNA damage in human lymphocytes. Before we studied the possible interaction of thymol and A. brasiliensis extract, each

  2. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  3. Higher marine fungi from mangroves (Manglicolous fungi)

    Digital Repository Service at National Institute of Oceanography (India)

    ChinnaRaj, S.

    of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

  4. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  5. Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes.

    Science.gov (United States)

    Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin

    2015-01-01

    Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

  6. The protective effects of aqueous extracts of wild-growing and fermented Royal Sun mushroom, Agaricus brasiliensis S. Wasser et al. (higher basidiomycetes), in CCl4-induced oxidative damage in rats.

    Science.gov (United States)

    Zhang, Chunjing; Han, Chunchao; Zhao, Baosheng; Yu, Haitao

    2012-01-01

    Culinary-medicinal Royal Sun mushroom, Agaricus brasiliensis (AbS), has traditionally been used for the prevention of a range of diseases, including cancer, hepatitis, atherosclerosis, hypercholesterolemia, diabetes, and dermatitis. The hepatoprotective effect of the fermented mushroom of A. brasiliensis (FMAE) and wild-growing A. brasiliensis (WMAE) were studied in this paper. An in vivo study of carbon tetrachloride (CCl4)-induced antioxidant activity in 2-month-old rats was conducted by examining the levels of activities of alanine aminotransaminase (ALT) and aspartate aminotransaminase (AST) and the antioxidant enzymes, including glutathione peroxidase (GSHPx) and catalase (CAT). Rats were divided into four groups, each containing six rats. The first group served as a control group. The second group was the CCl4 group. Group I and group II were treated orally with distilled water for 14 days respectively. Group III and Group IV were treated orally by WMAE and FMAE at oral doses of 50 mg/kg-day, respectively. Both WMAE and FMAE could reduce CCl4-induced toxicity, particularly hepatotoxicity, by suppressing ALT and AST activities, and increasing antioxidant enzyme activity. The studies demonstrate that both the fermented and wild-growing A. brasiliensis could protect the liver against CCl4-induced oxidative damage in rats.

  7. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  8. The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster.

    Science.gov (United States)

    Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis

    2014-01-01

    Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

  9. The Anti-Inflammatory Effects of Lion's Mane Culinary-Medicinal Mushroom, Hericium erinaceus (Higher Basidiomycetes) in a Coculture System of 3T3-L1 Adipocytes and RAW264 Macrophages.

    Science.gov (United States)

    Mori, Koichiro; Ouchi, Kenji; Hirasawa, Noriyasu

    2015-01-01

    Chronic low-grade inflammation in the adipose tissue accompanying obesity is thought to be an underlying driver of metabolic diseases. In this study, we aimed to investigate the efficacy of Hericium erinaceus on adipose tissue inflammation. The anti-inflammatory effects of the ethyl acetate soluble fraction of H. erinaceus (EAHE) were examined using cocultures of 3T3-L1 adipocytes and RAW264 macrophages. EAHE significantly suppressed tumor necrosis factor (TNF)-α and interleukin (IL)-6 production in cultured RAW264 macrophages stimulated by lipopolysaccharide (LPS). EAHE also caused notable inhibition of c-Jun N-terminal kinase (JNK) activation, which is thought to be involved in the suppression of proinflammatory cytokines by EAHE. In a coculture system with 3T3-L1 and RAW264 cells stimulated with LPS, EAHE reduced TNF-α and IL-6 concentrations in the conditioned medium and lowered the gene expression levels of these cytokines in 3T3-L1 adipocytes. Furthermore, EAHE suppressed the LPS-induced reduction of adiponectin mRNA levels in 3T3-L1 adipocytes cocultured with RAW264 macrophages. However, in 3T3-L1 adipocytes cultured alone, the concentration of LPS used in this study did not affect the gene expression levels of these adipokines. We attributed the anti-inflammatory effects of EAHE on 3T3-L1 adipocytes cocultured with RAW264 macrophages to the suppression of Toll-like receptor 4 (TLR4) signaling and subsequent proinflammatory cytokine secretion in RAW264 cells. Our findings indicate the possibility that H. erinaceus exerts anti-inflammatory effects on macrophages through the inhibition of TLR4-JNK signaling and prevents or ameliorates adipose tissue inflammation associated with obesity.

  10. Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study.

    Science.gov (United States)

    Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary

    2015-01-01

    Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

  11. Survey on the role of brown hares (Lepus europaeus, Pallas 1778 as carriers of zoonotic dermatophytes

    Directory of Open Access Journals (Sweden)

    Francesca Mancianti

    2010-02-01

    Full Text Available The occurrence of dermatophytes and keratinophilic fungi was investigated by hair-brush technique on the coat of 986 apparently healthy brown hares (Lepus europaeus, Pallas 1778 caught in 9 restocking and capture zones in Central Italy. Overall, 7.5% hair samples gave positive results. Trichophyton terrestre (2.1%, Chrysosporium sp, Chrysosporium keratinophilum, Microsporum gypseum, Trichophyton gloriae and Trichophyton mentagrophytes (0.6% each, Trichophyton erinacei and Scopulariopsis brevicaulis (0.4% each, Chrysosporium asperatum (0.3%, Arthroderma sp and Microsporum canis (0.1% each were identified in cultures with single isolates, whereas Chrysosporium sp/T. mentagrophytes (0.3%, Chrysosporium sp/T. terrestre and M. gypseum/T. terrestre (0.2% each, Chrysosporium tropicum/T. terrestre, M. canis/T. terrestre and T. ajelloi/T. terrestre (0.1% each were identified in cultures with mixed isolates. T. erinacei and M. canis have not previously been isolated from hares. M. canis, T. erinacei and T. mentagrophytes were the most clinically important dermatophytes found. Altogether, they were isolated only from 1.5% hair samples. Thus, it is concluded that brown hares may play a limited epidemiological role as carriers of zoonotic dermatophytes. Nevertheless, this should be taken into consideration as many people may be exposed to zoonotic agents from brown hares during hunting and trapping activities.

  12. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1982-01-01

    A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

  13. 26 - 30 Kutama

    African Journals Online (AJOL)

    DR. AMINU

    wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

  14. Occurrence of keratinophilic fungi on Indian birds.

    Science.gov (United States)

    Dixit, A K; Kushwaha, R K

    1991-01-01

    Keratinophilic fungi were isolated from feathers of most common Indian birds, viz. domestic chicken (Gallus domesticus), domestic pigeon (Columba livia), house sparrow (Passer domesticus), house crow (Corvus splendens), duck (Anas sp.), rose-ringed parakeet (Psittacula krameri). Out of 87 birds, 58 yielded 4 keratinophilic fungal genera representing 13 fungal species and one sterile mycelium. The isolated fungi were cultured on Sabouraud's dextrose agar at 28 +/- 2 degrees C. Chrysosporium species were isolated on most of the birds. Chrysosporium lucknowense and Chrysosporium tropicum were the most common fungal species associated with these Indian birds. Maximum occurrence of fungi (47%) was recorded on domestic chickens and the least number of keratinophilic fungi was isolated from the domestic pigeon and duck. The average number of fungi per bird was found to be the 0.44.

  15. Isolation of keratinophilic fungi from selected soils of Sanjay Gandhi National Park, Mumbai (India).

    Science.gov (United States)

    Deshmukh, S K; Verekar, S A

    2014-12-01

    One hundred and twenty-five samples were collected from eight different sites in the vicinity of Sanjay Gandhi National Park (SGNP) and screened for the presence of keratinophilic fungi using hair baiting technique for isolation. Seventy-three isolates were recovered and identified. The cultures were identified using macro- and micro-morphological features. Their identification was also confirmed by the BLAST search of sequences of the ITS1-5.8S-ITS2 rDNA region against the NCBI/Genbank data and compared with deposited sequences for identification purpose. Thirteen species of nine genera were isolated viz. Aphanoascus durus (2.4%), Arthroderma corniculatum (1.6%), Auxarthron umbrinum (0.8%), Chrysosporium evolceanui (1.6%), Chrysosporium indicum (16.0%), Chrysosporium tropicum (2.4%), Chrysosporium zonatum (4.0%), Chrysosporium states of Arthroderma tuberculatum (0.8%), Chrysosporium state of Ctenomyces serratus (11.2%), Gymnascella dankaliensis (3.2%), Microsporum gypseum (12.0%), Myriodontium keratinophilum (0.8%) and Trichophyton mentagrophytes (1.6%). Representative of all thirteen species can release the protein in the range of 152.2-322.4 μg/mL in liquid media when grown on human hair in shake flask culture and also decompose 18.4-40.2% of human hair after four weeks of incubation. This study indicates that the soils of SGNP, Mumbai may be significant reservoirs of certain keratinophilic fungi. The keratinolytic activity of these fungi may be playing significant role in superficial infections to man and animals and recycling of keratinic material of this environment. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.

    Science.gov (United States)

    Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S

    2006-06-01

    The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

  17. Browse Title Index

    African Journals Online (AJOL)

    Vol 12, No 47 (2013), Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725, Abstract ... of rice straw by thermotolerant cellulolytic Streptomyces viridiochromogenes under solid-state fermentation conditions for bioethanol production, Abstract PDF.

  18. Author Details

    African Journals Online (AJOL)

    Motedayen, Nazila. Vol 12, No 47 (2013) - Articles Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725. Abstract PDF. ISSN: 1684-5315. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

  19. African Journal of Biotechnology - Vol 12, No 47 (2013)

    African Journals Online (AJOL)

    Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725 · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Nazila Motedayen, Maznah B. T. Ismail, Forough Nazarpour, 6618-6624 ...

  20. Decolorization of laundry effluent by filamentous fungi | Miranda ...

    African Journals Online (AJOL)

    After selecting, the best fungi were subjected to an experimental design and evaluation of the production of the ligninolytics enzymes. Fungi Phanerochaete chrysosporum CCT 1999, Lentinula edodes CCT 4519 and Curvularia lunata UFPEDA 885 reduced 100% the color of the effluent during growth under agitation while ...

  1. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  2. Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.

    Science.gov (United States)

    Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

    2008-07-01

    Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

  3. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  4. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  5. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)

    DR GATSING

    Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.

  6. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1993-01-01

    Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

  7. Bioleaching of copper, aluminum, magnesium and manganese from ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.

  8. 12038_2016_9614_Article_print 265..275

    Indian Academy of Sciences (India)

    2016-05-13

    May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.

  9. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  10. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

    Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...

  11. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  12. octadecenoic acid in tomato

    African Journals Online (AJOL)

    User

    bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.

  13. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  14. Formation and cell wall regeneration of protoplasts from Schizophyllum commune

    NARCIS (Netherlands)

    de Vries, Onno Minne Hotze

    1974-01-01

    Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.

  15. Characterization and cultivation of a wild mushroom species isolated in Brazil
    Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil

    OpenAIRE

    Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki

    2002-01-01

    Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

  16. Decolorization of six synthetic dyes by fungi

    OpenAIRE

    Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.

    2016-01-01

    To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...

  17. Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.

  18. Physical Damages of Wood Fiber in Acacia Mangium due to Biopulping Treatment

    Directory of Open Access Journals (Sweden)

    Ridwan Yahya

    2016-05-01

    chrysosporium to Acacia mangium Willd can reduce lignin and improve holocellulose and cellulose content of the material. Fiber dimension recognized as other important factor for paper properties. The question is how the integrity and dimensions of the wood fiber that has been pretreated with the fungus. The objectives of present study were to know effect of pretreatment of P. chrysosporium to the integrity and dimensions of the fiber. The P. chrysosporium was cultured for 14 days in growth medium, and inoculated to wood chips 5% (w/v and incubated for 0, 15 and 30 days. The inoculated wood chips were chipped into 1 mm x 1 mm x 20 mm and macerated using franklin solution at 60 oC for 48 hours. Forty fibers from each incubated time were analized their physical damages using a light microscope at a 400 magnification. The inoculated fibers were measured theirs dimensions. The physical damage percentage of fibers pretreated using P. chrysosporium was 0%. Length and wall thickness of the pretreated fibers were can be categorized as middle class and thin fibers, respectively.

  19. The Role of Drosophila Merlin in the Control of Mitosis Exit and Development

    Science.gov (United States)

    2008-07-01

    chrysosporium --- http://genome.jgi-p Aspergillus flavus --- http://www.tigr.or Arabidopsis thaliana --- http://www.tigr.or Oryza sativa --- http...distinguish colon and ovarian adenocarcinomas: identi- fication, genomic, proteomic , and tissue array profiling. Cancer Res 2003;63:5243–50. 108

  20. Biodegradation of endocrine-disrupting compounds by ligninolytic fungi: mechanisms involved in the degradation

    Czech Academy of Sciences Publication Activity Database

    Cajthaml, Tomáš

    2015-01-01

    Roč. 17, č. 12 (2015), s. 4822-4834 ISSN 1462-2912 R&D Projects: GA TA ČR TE01020218; GA ČR GA13-28283S Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGUS * PHANEROCHAETE-SORDIDA YK-624 * POLYCYCLIC AROMATIC-HYDROCARBONS Subject RIV: EE - Microbiology, Virology Impact factor: 5.932, year: 2015

  1. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  3. Comparative efficacy and pathogenicity of keratinophilic soil fungi against Culex quinquefasciatus larvae.

    Science.gov (United States)

    Mohanty, Suman Sundar; Prakash, Soam

    2010-09-01

    Out of seven fungal species belonging to four genera isolated from pond and wallow soils using feathers of Pavo cristatus as bait, four species viz., Aspergillus flavus, Aspergillus niger, Chrysosporium pseudomerdarium and Trichophyton ajelloi were most frequent. Chrysosporium and Trichophyton spp. were more pathogenic on Culex quinquefasciatus larvae than Aspergillus and Penicillium. The bioefficacy tests conducted as per the protocol of World Health Organization and the LC(50) values calculated by the Probit analysis showed that 3(rd)-instar C. quinquefasciatus were more susceptible to the conidia of above fungi. Highest mortality was observed in the larvae of C. quinquefasciatus when exposed to T. ajelloi. The density of fungal conidia was greatest on the ventral brush, palmate hair and anal region of the mosquito larvae after exposing for 72 hours. The potentiality of these fungi for use in the control of C. quinquefasciatus is discussed which can be exploited as a suitable biocontrol agent in the tropics.

  4. Effects of Rhamnolipid and Microbial Inoculants on the Vermicomposting of Green Waste with Eisenia fetida.

    Science.gov (United States)

    Gong, Xiaoqiang; Wei, Le; Yu, Xin; Li, Suyan; Sun, Xiangyang; Wang, Xinyu

    2017-01-01

    The effects of adding the biosurfactant rhamnolipid, the lignolytic and cellulolytic fungus Phanerochete chrysosporium, and the free-living nitrogen-fixing bacterium Azotobacter chrococcum on vermicomposting of green waste with Eisenia fetida was investigated. The addition of rhamnolipid and/or either microorganism alone or in all combinations significantly increased E. fetida growth rate, the number of E. fetida juveniles and cocoons, the population densities of cellulolytic fungi and Azotobacter bacteria, and cellulase and urease activities in the vermicomposts. The quality of the final vermicompost (in terms of electrical conductivity, nutrient content, C/N ratio, humic acid content, lignin and cellulose contents, and phytotoxicity to germinating seeds) was enhanced by addition of rhamnolipid and/or microorganisms. The physical characteristics of vermicomposts produced with rhamnolipid and/or microorganisms were acceptable for agricultural application. The best quality vermicompost was obtained with the combined addition of P. chrysosporium, A. chrococcum, and rhamnolipid.

  5. Microbial Degradation of RDX and HMX

    Science.gov (United States)

    2004-02-01

    cultivated in the M-succinate medium as previously described (Coleman et al., 1998). P. chrysosporium ATCC 24725 was provided by Ian Reid (Paprican...Sunahara. 1999. Ecotoxicological Evaluation of a Bench–Scale Bioslurry Treating Explosives – Spiked Soil. Bioremediation J. 3(3), 233-245. 217...1999. Ecotoxicological characterization of energetic substances using a soil extraction procedure. Ecotoxicol. Environ. Safety 43, 138-148

  6. Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.

    Science.gov (United States)

    Kozar, F; MacDonald, B R; Weijer, J

    1977-01-01

    The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

  7. Antibiotics in the chemical communication of fungi.

    Science.gov (United States)

    Kettering, Melanie; Sterner, Olov; Anke, Timm

    2004-01-01

    In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.

  8. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  9. [Characterization of an extracellular glycolipid from Lentinus edodes (Berk.) Sing [Lentinula edodes (Berk.) Pegler

    Science.gov (United States)

    Tsivileva, O M; Nikitina, V E; Makarov, O E

    2008-01-01

    Submerged mycelium of a xylotrophic basidiomycete Lentinus edodes produces an extracellular glycolipid, S3, associated with a lectin. Galactose glycan residue, as well as the lipid pool composition, which includes nonhydroxylated short-chain fatty acids, is uncommon for basidiomycetes. The glycolipid consists of D-galactopyranose (15% of S3 contains galactose sulfate) acylated by octadecanoic and nonadecanoic fatty acid residues (28 and 72%, respectively). The glycolipid structure and composition are confirmed by physicochemical analysis. The glycolipid is assumed to be a regulator of lectin activity.

  10. Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications

    Science.gov (United States)

    Cathy L. Cripps

    2001-01-01

    Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...

  11. Global warming and mycoflora in the Baltic Region

    Directory of Open Access Journals (Sweden)

    Hanns Kreisel

    2013-12-01

    Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

  12. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  13. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter

    2010-01-01

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  14. Novel mandibular gland volatiles from Apterostigma ants

    DEFF Research Database (Denmark)

    Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya

    2017-01-01

    The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...

  15. On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.

    2013-01-01

    Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

  16. Molecular identification, genetic diversity, population genetics and genomics of Rhizoctonia solani. In:perspective of plant pathology in genomic era

    Science.gov (United States)

    The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...

  17. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

    2000-01-01

    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  18. Clonality and α-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia

    NARCIS (Netherlands)

    Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland

    2011-01-01

    Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the

  19. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  20. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  1. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

    2015-01-01

    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  2. [First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].

    Science.gov (United States)

    Madrid Lorca, Hugo; Muñoz, Mélica

    2006-06-01

    Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

  3. Moniliophthora roreri Genome and Transcriptome

    Science.gov (United States)

    Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

  4. Elevated tropospheric CO2 and O3 may not alter initial wood decomposition rate or wood-decaying fungal community composition of Northern hardwoods

    Science.gov (United States)

    Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser

    2016-01-01

    We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...

  5. Fungal Systematics and Evolution: FUSE 3

    NARCIS (Netherlands)

    Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying

    2017-01-01

    The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra

  6. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

    2014-01-01

    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  7. A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao

    Science.gov (United States)

    The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

  8. Identification and first report of Inonotus (Phellinus) tropicalis as an etiologic agent in a patient with chronic granulomatous disease

    Science.gov (United States)

    D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul

    2005-01-01

    Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.

  9. Fungal Systematics and Evolution: FUSE 2

    NARCIS (Netherlands)

    Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.

    2016-01-01

    The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature

  10. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  11. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    DEFF Research Database (Denmark)

    Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H

    2007-01-01

    BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...

  12. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.

    2007-01-01

    Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species

  13. The genus Actiniceps Berk. & Br

    NARCIS (Netherlands)

    Boedijn, K.B.

    1959-01-01

    The genus Actiniceps Berk. & Br. is shown to be a Basidiomycete. Wiesnerina Höhn. and Dimorphocystis Corner are regarded synonymous. The type species A. thwaitesii Berk. & Br. is redescribed with D. capitatus Corner as synonym. The following new combinations are proposed: A. horrida (Höhn.) Boedijn,

  14. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

    2015-01-01

    Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

  15. Temporal Alterations in the Secretome of the Selective Ligninolytic Fungus Ceriporipsis subvermispora during growth on Aspen Wood Reveal this Organism's Strategy for Degrading Lighnocellulose

    Science.gov (United States)

    Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen

    2014-01-01

    The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...

  16. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  17. First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia

    Science.gov (United States)

    Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...

  18. SECONDARY METABOLITES FROM MARINE PENICILLIUM BREVICOMPACTUM

    OpenAIRE

    ROVIROSA, JUANA; DIAZ-MARRERO, ANA; DARIAS, JOSE; PAINEMAL, KARIN; SAN MARTIN, AURELIO

    2006-01-01

    In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.

  19. ASSIGNMENT OF GENES TO PULSE-FIELD SEPARATED CHROMOSOMES OF SCHIZOPHYLLUM-COMMUNE

    NARCIS (Netherlands)

    ASGEIRSDOTTIR, SA; SCHUREN, FHJ; WESSELS, JGH

    Chromosomal DNAs of the basidiomycete Schizophyllum commune were separated by Contour-Clamped Homogeneous Electric Field Electrophoresis (CHEF). The estimated sizes of the chromosomal DNAs ranged from 4.7 Megabase pairs (Mbp) to 1.6 Mbp, totalling 35.6 Mbp. Using sequences from 20 cloned genes we

  20. Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada

    NARCIS (Netherlands)

    Hagen, F; Boekhout, T

    2006-01-01

    Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a

  1. Two yeast species Cystobasidium psychroaquaticum f.a. sp. nov. and Cystobasidium rietchieii f.a. sp. nov. isolated from natural environments, and the transfer of Rhodotorula minuta clade members to the genus Cystobasidium

    NARCIS (Netherlands)

    Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D

    Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic

  2. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  3. Enzyme activities of fungi associated with Picea abies needles

    Czech Academy of Sciences Publication Activity Database

    Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 427-436 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  4. Proteomic and functional analysis of the cellulase system expressed by Postia placenta during brown rot of solid wood

    Science.gov (United States)

    Jae San Ryu; Semarjit Shary; Carl J. Houtman; Ellen A. Panisko; Premsagar Korripally; Franz J. St. John; Casey Crooks; Matti Siika-aho; Jon K. Magnuson; Kenneth E. Hammel

    2011-01-01

    Brown rot basidiomycetes have an important ecological role in lignocellulose recycling and are notable for their rapid degradation of wood polymers via oxidative and hydrolytic mechanisms. However, most of these fungi apparently lack processive (exo-acting) cellulases, such as cellobiohydrolases, which are generally required for efficient cellulolysis. The recent...

  5. INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI

    NARCIS (Netherlands)

    DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH

    Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted

  6. The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.

    2013-01-01

    Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median

  7. HYDROPHOBIN GENES INVOLVED IN FORMATION OF AERIAL HYPHAE AND FRUIT BODIES IN SCHIZOPHYLLUM

    NARCIS (Netherlands)

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SCHUREN, FHJ

    Fungi typically grow by apical extension of hyphae that penetrate moist substrates. After establishing a branched feeding mycelium, the hyphae differentiate and grow away from the substrate into the air where they form various structures such as aerial hyphae and mushrooms. In the basidiomycete

  8. THE THN MUTATION OF SCHIZOPHYLLUM-COMMUNE, WHICH SUPPRESSES FORMATION OF AERIAL HYPHAE, AFFECTS EXPRESSION OF THE SC3 HYDROPHOBIN GENE

    NARCIS (Netherlands)

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SPRINGER, J

    1991-01-01

    The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents

  9. The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin

    NARCIS (Netherlands)

    Lugones, L G; de Jong, J F; de Vries, O M H; Jalving, R; Dijksterhuis, J; Wösten, H A B

    Disruption of the SC3 gene in the basidiomycete Schizophyllum commune affected not only formation of aerial hyphae but also attachment to hydrophobic surfaces. However, these processes were not completely abolished, indicating involvement of other molecules. We here show that the SC15 protein

  10. Bioconcentration of manganese and iron in Panaeoloideae Sing

    NARCIS (Netherlands)

    Stijve, T.; Blake, C.

    1994-01-01

    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae,

  11. Uncovering the abilities of Agaricus bisporus to degrade plant biomass throughout its life cycle

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, M.; Jurak, E.; Heck, A.J.R.; Hilden, K.S.; Kabel, M.A.; Makela, M.R.; Altenaar, M.A.F.; Vries, de R.P.

    2015-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and con-tributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  12. A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

    Science.gov (United States)

    2009-03-01

    tolerate 3,000–5000 Gy, but are rendered sterile. As a haploid, the basidiomycete fungus Ustilago maydis carries a single set of chromosomes per...salinarum NRC-1. Environ. Microbiol. 5 Jan 2009 (doi:10.1111/j.1462-2920.2008.01828.x). 21. Chan, H. L. et al. Proteomic analysis of UVC irradiation

  13. Enzymology and molecular biology of lignin degradation

    Science.gov (United States)

    D. Cullen; P.J. Kersten

    2004-01-01

    This review provides an overview of the physiology and genetics of lignin degradation by white rot basidiomycetes. Emphasis is on recent advances and the reader is referred to earlier comprehensive reviews for historical perspective and background (Kirk and Farrell 1987; Gold and Alic 1993; Higuchi 1993; Cullen and Kersten 1996; Cullen 1997). Recent completion of a...

  14. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...

  15. Author Details

    African Journals Online (AJOL)

    Goud, MJP. Vol 2, No 3 (2007) - Articles Antibacterial activity and biomolecular composition of certain fresh water micro-algae from River Godavari (India) Abstract PDF · Vol 3, No 1 (2008) - Articles Replica plate screening method for detecting phosphatase activity in basidiomycetes using 1-Napthyl Phosphate as a ...

  16. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

    Science.gov (United States)

    Chiaki Hori; Takuya Ishida; Kiyohiko Igarashi; Masahiro Samejima; Hitoshi Suzuki; Emma Master; Patricia Ferreira; Francisco J. Ruiz-Duenas; Benjamin Held; Paulo Canessa; Luis F. Larrondo; Monika Schmoll; Irina S. Druzhinina; Christian P. Kubicek; Jill A. Gaskell; Phil Kersten; Franz St. John; Jeremy Glasner; Grzegorz Sabat; Sandra Splinter Bondurant; Khajamohiddin Syed; Jagjit Yadav; Anthony C. Mgbeahuruike; Andriy Kovalchuk; Fred O. Asiegbu; Gerald Lackner; Dirk Hoffmeister; Jorge Recoret; Ana Gutierrez; Hui Sun; Erika Lindquist; Kerrie Barry; Robert Riley; Igor V. Grigoriev; Bernard Henrissat; Ursula Kues; Randy M. Berka; Angel T. Martinez; Sarah F. Covert; Robert A. Blanchette; Daniel Cullen

    2014-01-01

    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other...

  17. Transcriptome and secretome analyses of the wood decay fungus Wolfiporia cocos support alternative mechanisms of lignocellulose conversion

    Science.gov (United States)

    Jill Gaskell; Robert A. Blanchette; Philip E. Stewart; Sandra Splinter BonDurant; Marie Adams; Grzegorz Sabat; Philip Kersten; Daniel Cullen

    2016-01-01

    Certain wood decay basidiomycetes, collectively referred to as brown rot fungi, rapidly depolymerize cellulose while leaving behind the bulk of cell wall lignin as a modified residue. The mechanism(s) employed is unclear, but considerable evidence implicates the involvement of diffusible oxidants generated via Fenton-like chemistry. Toward a better understanding of...

  18. A rare case of urinary tract infection due to Trichosporonasahii in a ...

    African Journals Online (AJOL)

    Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...

  19. Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 25, č. 1 (2004), s. 49-55 ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004

  20. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

    Science.gov (United States)

    Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia

    2015-01-01

    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839