WorldWideScience

Sample records for basidiomycete phanerochaete chrysosporium

  1. Mating System and Basidiospore Formation in the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Alic, Margaret; Letzring, Celia; Gold, Michael H.

    1987-01-01

    Prototrophic strains recovered from crosses between auxotrophic strains of the lignin-degrading basidiomycete Phanerochaete chrysosporium were induced to fruit. The progeny of most of these self-crosses were prototrophic, indicating that the nuclei of the original prototroph were wild-type recombinants rather than complementary heterokaryons and that the binucleate basidiospores of this organism are homokaryotic. Various wild-type strains were shown to have multinucleate cells lacking clamp c...

  2. Decolorization of Several Polymeric Dyes by the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Glenn, Jeffrey K.; Michael H Gold

    1983-01-01

    The polymeric dyes Poly B-411, Poly R-481, and Poly Y-606 were examined as possible alternatives to the radiolabeled lignin previously used as a substrate in lignin biodegradation assays. Like lignin degradation, the decolorization of these dyes by the white rot basidiomycete Phanerochaete chrysosporium occurred during secondary metabolism, was suppressed in cultures grown in the presence of high levels of nitrogen, and was strongly dependent on the oxygen concentration in the cultures. A var...

  3. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site. PMID:17922847

  4. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium.

    OpenAIRE

    Boominathan, K; Dass, S B; Randall, T A; Kelley, R.L.; Reddy, C A

    1990-01-01

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study we isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin----14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical...

  5. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study the authors isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin →14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical conditions, produced 96 U of lignin peroxidase per liter. Both the wild type and the mutant produced comparable levels of manganese peroxidase and glucose oxidases, a key H2O2-generating secondary metabolic enzyme in P. chrysosporium. Fast protein liquid chromatographic analysis of the concentrated extracellular fluid of the lip mutant confirmed that it produced only heme proteins with manganese peroxidase activities were produced by the wild type. The lip mutant appears to be a regulatory mutant that is defective in the production of all the lignin peroxidases

  6. Crystallization of selenomethionyl exo-β-1,3-galactanase from the basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Selenomethionyl exo-β-1,3-galactanase from P. chrysosporium K-3 produced in Pichia pastoris was crystallized. The crystals diffracted to a resolution of 1.8 Å and belonged to space group P21. Exo-β-1,3-galactanase from Phanerochaete chrysosporium (Pc1,3Gal43A) consists of a glycoside hydrolase family 43 catalytic domain and a substrate-binding domain that belongs to carbohydrate-binding module family 35. It catalyzes the hydrolysis of β-1,3-galactan, which is the backbone of the arabinogalactan proteins; the C-terminal carbohydrate-binding module family 35 domain increases the local concentration of the enzyme around β-1,3-galactan by its high affinity for the substrate. To enable phase determination using the multiwavelength anomalous dispersion method, selenomethionyl Pc1,3Gal43A was crystallized at 298 K using the hanging-drop vapour-diffusion method. The presence of selenium in the crystals was confirmed from the X-ray absorption spectrum. The crystals belonged to space group P21 and diffracted to 1.8 Å resolution

  7. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD+-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  8. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  9. A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity

    OpenAIRE

    Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

    2003-01-01

    Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. O...

  10. Degradation of azo dyes by the lignin-degrading fungus Phanerochaete chrysosporium.

    OpenAIRE

    Spadaro, J T; Gold, M H; Renganathan, V

    1992-01-01

    Under nitrogen-limiting, secondary metabolic conditions, the white rot basidiomycete Phanerochaete chrysosporium extensively mineralized the specifically 14C-ring-labeled azo dyes 4-phenylazophenol, 4-phenylazo-2-methoxyphenol, Disperse Yellow 3 [2-(4'-acetamidophenylazo)-4-methylphenol], 4-phenylazoaniline, N,N-dimethyl-4-phenylazoaniline, Disperse Orange 3 [4-(4'-nitrophenylazo)-aniline], and Solvent Yellow 14 (1-phenylazo-2-naphthol). Twelve days after addition to cultures, the dyes had be...

  11. Heterologous expression of fungal cytochromes P450 (CYP5136A1 and CYP5136A3) from the white-rot basidiomycete Phanerochaete chrysosporium: Functionalization with cytochrome b5 in Escherichia coli.

    Science.gov (United States)

    Hatakeyama, Mayumi; Kitaoka, Takuya; Ichinose, Hirofumi

    2016-07-01

    Cytochromes P450 from the white-rot basidiomycete Phanerochaete chrysosporium, CYP5136A1 and CYP5136A3, are capable of catalyzing oxygenation reactions of a wide variety of exogenous compounds, implying their significant roles in the metabolism of xenobiotics by the fungus. It is therefore interesting to explore their biochemistry to better understand fungal biology and to enable the use of fungal enzymes in the biotechnology sector. In the present study, we developed heterologous expression systems for CYP5136A1 and CYP5136A3 using the T7 RNA polymerase/promoter system in Escherichia coli. Expression levels of recombinant P450s were dramatically improved by modifications and optimization of their N-terminal amino acid sequences. A CYP5136A1 reaction system was reconstructed in E. coli whole cells by coexpression of CYP5136A1 and a redox partner, NADPH-dependent P450 reductase (CPR). The catalytic activity of CYP5136A1 was significantly increased when cytochrome b5 (Cyt-b5) was further coexpressed with CPR, indicating that Cyt-b5 supports electron transfer reactions from NAD(P)H to CYP5136A1. Notably, P450 reaction occurred in E. coli cells that harbored CYP5136A1 and Cyt-b5 but not CPR, implying that the reducing equivalents required for the P450 catalytic cycle were transferred via a CPR-independent pathway. Such an "alternative" electron transfer system in CYP5136A1 reaction was also demonstrated using purified enzymes in vitro. The fungal P450 reaction system may be associated with sophisticated electron transfer pathways. PMID:27233123

  12. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica; Floudas, Dimitrios; HIbbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Ruben; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavin, Jose L.; Oguiza, Jose A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kues, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan

    2011-12-06

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.

  13. Biodegradation of azo and heterocyclic dyes by Phanerochaete chrysosporium.

    OpenAIRE

    Cripps, C.; Bumpus, J A; Aust, S D

    1990-01-01

    Biodegradation of Orange II, Tropaeolin O, Congo Red, and Azure B in cultures of the white rot fungus, Phanerochaete chrysosporium, was demonstrated by decolarization of the culture medium, the extent of which was determined by monitoring the decrease in absorbance at or near the wavelength maximum for each dye. Metabolite formation was also monitored. Decolorization of these dyes was most extensive in ligninolytic cultures, but substantial decolorization also occurred in nonligninolytic cult...

  14. Toxicity of graphene oxide to white rot fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Xie, Jingru; Ming, Zhu; Li, Hongliang; Yang, Hua; Yu, Baowei; Wu, Ruihan; Liu, Xiaoyang; Bai, Yitong; Yang, Sheng-Tao

    2016-05-01

    With the wide production and applications of graphene and its derivatives, their toxicity to the environment has received much attention nowadays. In this study, we investigated the toxicity of graphene oxide (GO) to white rot fungus (Phanerochaete chrysosporium). GO was prepared by modified Hummers method and well characterized before use. P. chrysosporium was exposed to GO at the concentrations of 0-4 mg/mL for 7 d. The fresh and dry weights, pH values of culture media, structures, ultrastructures, IR spectra and activities of the decomposition of pollutants were measured to reveal the hazards of GO to P. chrysosporium. Our results indicated that low concentrations of GO stimulated the growth of P. chrysosporium. The exposure to GO induced more acidic pH values of the culture media after 7 d. GO induced the disruption of the fiber structure of P. chrysosporium, while at 4 mg/mL some very long and thick fibers were formed. Such changes were reflected in the scanning electron microscopy investigations, where the disruption of fibers was observed. In the ultrastructural investigations, the shape of P. chrysosporium cells changed and more vesicles were found upon the exposure to GO. The infrared spectroscopy analyses suggested that the chemical compositions of mycelia were not changed qualitatively. Beyond the toxicity, GO did not alter the activities of P. chrysosporium at low concentrations, but led to the complete loss of activity at high concentrations. The implication to the ecological safety of graphene is discussed. PMID:26950023

  15. BIOPULPING OF WHEAT STRAW WITH PHANEROCHAETE CHRYSOSPORIUM

    Institute of Scientific and Technical Information of China (English)

    Hong Yu; Menghua Qin; Xuemei Lu; Yinbo Qu; Peiji Gao

    2004-01-01

    Wheat straw was cut into a certain size range and treated with a strain of the white rot fungus Phanerochatete Chrysosporium for 5 days before subjected to a chemi-mechanical treatment. Chemical analyses revealed the effects of the white rot fungus on the wheat straw components. SEM was applied to observe the changes in fiber micromorphological structures. CODcr of the effluent from the sulfonation treatment of wheat straw was also discussed. Handsheets made from the treated and untreated wheat straw exhibited different optical and physical properties after chemi-mechanical pulping.

  16. BIOPULPING OF WHEAT STRAW WITH PHANEROCHAETE CHRYSOSPORIUM

    Institute of Scientific and Technical Information of China (English)

    HongYu; MenghuaQin; XuemeiLu; YinboQu; PeijiGao

    2004-01-01

    Wheat straw was cut into a certain size range and treated with a strain of the white rot fungus Phaneroehatete Chrysosporium for 5 days before subjected to a chemi-mechanical treatment. Chemical analyses revealed the effects of the white rot fungus on the wheat straw components. SEM was applied to observe the changes in fiber micromorphological structures. CODcr of the effluent from the sulfonation treatment of wheat straw was also discussed. Handsheets made from the treated anduntreated wheat straw exhibited different optical and physical properties after chemi-mechanical pulping.

  17. Investigation of wheat straw biodegradation by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Production of renewable fuels and chemicals from biomass requires an efficient pretreatment technology, which further depends on better understanding of biodegradation process of such lignocellulosic biomass. The biodegradation of wheat straw by Phanerochaete chrysosporium was investigated in this study. The fungal secretomes and compositional, functional groups and structural changes of the fungal spent wheat straw lignin were determined. The result showed ∼ 30% loss of total lignin within three weeks of biopretreatment by P. chrysosporium. Detailed structural analysis through two dimentional heteronuclear multiple quantum coherence nuclear magnatic resonance (2D HMQC NMR) of the pretreated lignin (acetylated) revealed low abundance of substructures D (dibenzodioxacin) and E (cinnamyl alcohol). Further, analysis of lignin by Fourier Transmission Infrared (FTIR) and Pyrolysis Gas Chromatography/Mass Spectrometry (Py-GC/MS) demonstrated the significant decrease of guaiacyl (G) units. The results support the previous findings in the biodegradation of wheat straw analyzed by 13C cross polarization magic angle spinning (CPMAS). Revealing the characteristic behavior of P. chrysosporium mediated biomass degradation, the information presented in this paper offers new insights for understanding the biological lignin degradation of wheat straw by P. chrysosporium.

  18. Effect of nitrogen concentration in culture mediums on growth and enzyme production of Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    GAO Da-wen; WEN Xiang-hua; QIAN Yi

    2005-01-01

    Effect of different nitrogen concentration in the mediums on growth and enzyme production of Phanerochaete chrysosporium was studied when glucose concentration was 10 g/L. The results showed that the medium contained 0.8 g/L ammonium tartrate is the best. It not only supply abundant nutrients for the growth of Phanerochaete chrysosporium, which make mycelia the best grow compared with the other medium, but also produce higher manganese-dependent peroxidase(Mnp) and laccase(Lac) activity. In addition, it is observed that the variation of mycelia surface is related to ligninolytic enzyme secreted by Phanerochaete chrysosporium. When the surface of mycelium pellets appeared burs, it predicts secondary metabolism begin. This experimentation demonstrated that when the ratio of carbon and nitrogen in nitrogen limited medium is equal to 100:8, growth and enzyme production of Phanerochaete chrysosporium is the best, it could achieve the maximum Mnp and Lac activity.

  19. Polychlorinated biphenyls fractioning assessment in aqueous bioremediation assy with phanerochaete chrysosporium

    OpenAIRE

    Sangely, Matthieu; Sablayrolles, Caroline; Vialle, Claire; Strehaiano, Pierre; Thannberger, Laurent; Vignoles, Mireille

    2009-01-01

    Thanks to growing environmental concerns in public opinion, bioremediation processes are more and more used to decontaminate soils from organic compounds. Polychlorinated biphenyls (PCBs) are known to be world wide spread persistent organic pollutants (POPs). The white rot fungus Phanerochaete chrysosporium is able to degrade PCBs in water, and soil As POPs, PCBs can also be adsorbed onto organic matter, such as Phanerochaete chrysosporium mycelium. This study aims at estimating the fractioni...

  20. Pyranose 2-oxidase from Phanerochaete chrysosporium--expression in E. coli and biochemical characterization.

    Science.gov (United States)

    Pisanelli, Ines; Kujawa, Magdalena; Spadiut, Oliver; Kittl, Roman; Halada, Petr; Volc, Jindrich; Mozuch, Michael D; Kersten, Philip; Haltrich, Dietmar; Peterbauer, Clemens

    2009-06-15

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in yields of approximately 270 mg/l medium. The recombinant enzyme was provided with an N-terminal T7-tag and a C-terminal His(6)-tag to facilitate simple one-step purification. We obtained an apparently homogenous enzyme preparation with a specific activity of 16.5 U/mg. Recombinant P2Ox from P. chrysosporium was characterized in some detail with respect to its physical and catalytic properties, both for electron donor (sugar substrates) and - for the first time - alternative electron acceptors (1,4-benzoquinone, substituted quinones, 2,6-dichloroindophenol and ferricenium ion). As judged from the catalytic efficiencies k(cat)/K(m), some of these alternative electron acceptors are better substrates than oxygen, which might have implications for the proposed in vivo function of pyranose 2-oxidase. PMID:19501263

  1. A Simple Structure Model for Enzyme Production by Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    岑沛霖; 郑重鸣; FOOYinDin; JefferyPhilipObbard; 林建平

    2003-01-01

    In order to understand the behavior of ligninolytic enzyme production by white rot fungi Phanerochaete chrysosporium, study on time courses and a mathematical model for the production of lignin peroxidase (LiP) and manganese peroxidase (MnP) of the fungi was undertaken. Based on the Monod-Jacob operon model, the ligninolytic enzyme would be synthesized in the absence of a related repressor. The repressor is assumed to be active in the presence of ammonia nitrogen, and as combined as co-repressor, it causes the inhibition of enzyme synthesis. The model can explain the mechanism of extracellular ligninolytic enzyme production by white rot fungi. The results,as predicted by the model, correspond closely to those observed in experimental studies. In addition, some light is also shed on unmeasured variables, such as the concentrations of repressor and mRNA that are related to the enzyme synthesis.

  2. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    Science.gov (United States)

    Coconi-Linares, Nancy; Ortiz-Vázquez, Elizabeth; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  3. Solid state fermentation of Achras zapota lignocellulose by Phanerochaete chrysosporium.

    Science.gov (United States)

    Ganesh Kumar, A; Sekaran, G; Krishnamoorthy, Sarayu

    2006-09-01

    The biological transformation of lignocellulose of Achras zapota by white rot fungi, Phanerochaete chrysosporium, in solid state fermentation (SSF) was studied for 28 days. The kinetic transformation of lignocellulose was monitored through the determination of acid soluble and acid insoluble lignin content, total organic carbon (TOC) and chemical oxygen demand (COD). The lignolytic enzymes, lignin peroxidase (LiP) and manganese peroxidase (MnP) were quantified on weekly intervals. The degradation of lignin and other structural moieties of A. zapota lignocellulose were confirmed by high performance liquid chromatography (HPLC), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). The degradation of lignin was increased after 7 days of fermentation with the release of water soluble and fermentable products. The LiP and MnP activities were increased in the first week of SSF and lignin degradation was also set to increase. This was accompanied with increase in COD by 94.6% and TOC by 80% and lignin content was decreased by 76%. The maximum activities of the enzymes LiP and MnP in extracellular fluid of SSF under nitrogen limitation, at pH 5.0, at temperature 37 degrees C and at 60% humidity were 2100 U/L and 1200 U/L. PMID:16122921

  4. Lignin and veratryl alcohol are not inducers of the ligninolytic system of Phanerochaete chrysosporium.

    OpenAIRE

    Cancel, A M; Orth, A B; Tien, M

    1993-01-01

    Phanerochaete chrysosporium is a white rot fungus which secretes a family of lignin-degrading enzymes under nutrient limitation. In this work, we investigated the roles of veratryl alcohol and lignin in the ligninolytic system of P. chrysosporium BKM-F-1767 cultures grown under nitrogen-limited conditions. Cultures supplemented with 0.4 to 2 mM veratryl alcohol showed increased lignin peroxidase activity. Addition of veratryl alcohol had no effect on Mn-dependent peroxidase activity and inhib...

  5. Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium (1988)

    Science.gov (United States)

    Extensive biodegradation of pentachlorophenol (PCP) by the white rot fungus Phanerochaete chrysosporium was demonstrated by the disappearance and mineralization of [14C]PCP in nutrient nitrogen-limited culture. Mass balance analyses demonstrated the formation of water-soluble met...

  6. Regulation of Gene Expression during the Onset of Ligninolytic Oxidation by Phanerochaete chrysosporium on Spruce Wood

    OpenAIRE

    Korripally, Premsagar; Hunt, Christopher G.; Houtman, Carl J.; Jones, Don. C.; Kitin, Peter J.; Cullen, Dan; Hammel, Kenneth E.

    2015-01-01

    Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in the cultures. Confocal fluorescence microscopy of the beads showed that extracellular oxidation commenced 2 to 3 days after inoculation, coincident w...

  7. Glyoxal oxidase of Phanerochaete chrysosporium: its characterization and activation by lignin peroxidase.

    OpenAIRE

    Kersten, P J

    1990-01-01

    Glyoxal oxidase (GLOX) is an extracellular H2O2-generating enzyme produced by ligninolytic cultures of Phanerochaete chrysosporium. The production, purification, and partial characterization of GLOX from agitated cultures are described here. High-oxygen levels are critical for GLOX production as for lignin peroxidase. GLOX purified by anion-exchange chromatography appears homogeneous by NaDod-SO4/PAGE (molecular mass = 68 kDa). However, analysis by isoelectric focusing indicates two major ban...

  8. Biodegradation of textile Azo Dyes by Phanerochaete chrysosporium

    OpenAIRE

    Ferreira, Isabel C. F. R.; Santos, Isabel M.; Queiroz, Maria João R. P.; Lima, Nelson

    1998-01-01

    Azo dyes are used extensively in the textile and dyestuff industries and effluents from these industrial processes are usually resistant to biological treatment. Textile azo dyes with bioaccessible groups such as guaiacol and 2,6-dimethoxyphenol, for lignin-degrading fungus as P. chrysosporium were synthesised.

  9. VANILLIN PRODUCTION BY PHANEROCHAETE CHRYSOSPORIUM GROWN ON GREEN COCONUT AGRO-INDUSTRIAL HUSK IN SOLID STATE FERMENTATION

    Directory of Open Access Journals (Sweden)

    Elisabete dos Santos Barbosa

    2008-11-01

    Full Text Available Agro-industrial residues have become an important source for the production of chemical compounds using biological pathways, contributing to preservation of the environment and making the overall process economically supportable. Vanillin is a very important aromatic compound for the food, beverage, and pharmaceutical industries. The aim of the present study was to evaluate the vanillin production by solid-state fermentation on green coconut residue using the basidiomycete Phanerochaete chrysosporium. Solid-state fermentation was carried on a support of green coconut husk treated in two different ways: sun-dried and mechanical-pressed. A Plackett-Burman experimental design was used to screen the compounds of liquid medium culture of the vanillin production. Nineteen variables were studied to optimize the culture conditions, and eleven of them were significant. The screening improved the production of vanillin from 44.4 g/g of support to 52.5 g/g of support in 24 hours of fermentation. Sun-dried coconut husk was found to be superior to mechanical-pressed coconut husk for production of vanillin. HPLC was used for the quantification of vanillin aroma.

  10. THE IMPACT OF CoFeO 4 NANOPARTICLES ON SOLUBLE PROTEIN CONTENT AT WHITE ROT FUNGUS Phanerochaete chrysosporium

    OpenAIRE

    Lacramioara Oprica; Eugen Ungureanu

    2016-01-01

    Experimental investigation focused on influence of different CoFeO4 nanoparticles concentrations on soluble protein and electrophoretic pattern of Phanerochaete chrysosporium fungus. Number of electrophoretic fraction is higher in older mycelium P. chrysosporium 14-day-old compared to that 7-day-old. Moreover, there is an increase in staining intensity of polypeptides of mycelium 14-day-old fact confirmed also by the higher amount of soluble protein. On the other hand, there are n...

  11. High-yield production of manganese peroxidase, lignin peroxidase, and versatile peroxidase in Phanerochaete chrysosporium.

    Science.gov (United States)

    Coconi-Linares, Nancy; Magaña-Ortíz, Denis; Guzmán-Ortiz, Doralinda A; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2014-11-01

    The white-rot fungus Phanerochaete chrysosporium secretes extracellular oxidative enzymes during secondary metabolism, but lacks versatile peroxidase, an enzyme important in ligninolysis and diverse biotechnology processes. In this study, we report the genetic modification of a P. chrysosporium strain capable of co-expressing two endogenous genes constitutively, manganese peroxidase (mnp1) and lignin peroxidase (lipH8), and the codon-optimized vpl2 gene from Pleurotus eryngii. For this purpose, we employed a highly efficient transformation method based on the use of shock waves developed by our group. The expression of recombinant genes was verified by PCR, Southern blot, quantitative real-time PCR (qRT-PCR), and assays of enzymatic activity. The production yield of ligninolytic enzymes was up to four times higher in comparison to previously published reports. These results may represent significant progress toward the stable production of ligninolytic enzymes and the development of an effective fungal strain with promising biotechnological applications. PMID:25269601

  12. Effects of Nitrogen Supplements on Degradation of Aspen Wood Lignin and Carbohydrate Components by Phanerochaete chrysosporium.

    Science.gov (United States)

    Reid, I D

    1983-03-01

    A supplement of KH(2)PO(4), MgSO(4), CaCl(2), trace elements, and thiamine accelerated the initial rate of aspen wood decay by Phanerochaete chrysosporium but did not increase the extent of lignin degradation. Asparagine, casein hydrolysate, and urea supplements (1% added N) strongly inhibited lignin degradation and weight loss. The complex nitrogen sources peptone and yeast extract stimulated lignin degradation and weight loss. Albumen and NH(4)Cl had intermediate effects. Conversion of [C]lignin to CO(2) and water-soluble materials underestimated lignin degradation in the presence of the complex N sources. The highest ratio of lignin degradation to total weight loss and the largest increase in cellulase digestibility occurred during the decay of unsupplemented wood. Rotting of aspen wood by P. chrysosporium gives smaller digestibility increases than have been found with some other white-rot fungi. PMID:16346246

  13. Effect of Mn2+ on growth and lignin degradation by phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Influence of Mn2+ (0.03 to 90 μM) in defined basal medium on mycelial dry weight, 14C (lignin) solubilization and mineralization (14CO2 evolution) during 3 weeks by Phanerochaete chrysosporium was investigated. Optimal mycelial growth was obtained at 30 μM Mn2+ level. 14C (lignin) solubilization, and mineralization also increased up to 30 μM Mn2+ and declined at 90 μM level. These result suggest involvement of Mn2+ in both solubilization and mineralization steps of microbial lignin biodegradation. (author)

  14. In vitro depolymerization of lignin by manganese peroxidase of Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Homogeneous manganese peroxidase catalyzed the in vitro partial depolymerization of four different 14C-labeled synthetic lignin preparations. Gel permeation profiles demonstrated significant depolymerization of 14C-sidechain-labeled syringyl lignin, a 14C-sidechain-labeled syringyl-guaiacyl copolymer (angiosperm lignin), and depolymerization of 14C-sidechain- and 14C-ring-labeled guaiacyl lignins (gymnosperm lignin). 3,5-Dimethoxy-1,4-benzo-quinone, 3,5-dimethoxy-1,4-hydroquinone, and syringylaldehyde were identified as degradation products of the syringyl and syringyl-guaiacyl lignins. These results suggest that manganese peroxidase plays a significant role in the depolymerization of lignin by Phanerochaete chrysosporium

  15. Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium

    KAUST Repository

    Espinosa-Ortiz, Erika J.

    2014-10-24

    The ability of Phanerochaete chrysosporium to reduce the oxidized forms of selenium, selenate and selenite, and their effects on the growth, substrate consumption rate, and pellet morphology of the fungus were assessed. The effect of different operational parameters (pH, glucose, and selenium concentration) on the response of P. chrysosporium to selenium oxyanions was explored as well. This fungal species showed a high sensitivity to selenium, particularly selenite, which inhibited the fungal growth and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency, whereas less than 10 % selenium removal was achieved for incubations with selenate. P. chrysosporium was found to be a selenium-reducing organism, capable of synthesizing elemental selenium from selenite but not from selenate. Analysis with transmission electron microscopy, electron energy loss spectroscopy, and a 3D reconstruction showed that elemental selenium was produced intracellularly as nanoparticles in the range of 30–400 nm. Furthermore, selenite influenced the pellet morphology of P. chrysosporium by reducing the size of the fungal pellets and inducing their compaction and smoothness.

  16. Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

    Directory of Open Access Journals (Sweden)

    Suzuki Hitoshi

    2012-09-01

    Full Text Available Abstract Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.

  17. Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Hitoshi; MacDonald, Jacqueline; Syed, Khajamohiddin; Salamov, Asaf; Hori, Chiaki; Aerts, Andrea; Henrissat, Bernard; Wiebenga, Ad; vanKuyk, Patricia A.; Barry, Kerrie; Lindquist, Erika; LaButti, Kurt; Lapidus, Alla; Lucas, Susan; Coutinho, Pedro; Gong, Yunchen; Samejima, Masahiro; Mahadevan, Radhakrishnan; Abou-Zaid, Mamdouh; de Vries, Ronald P.; Igarashi, Kiyohiko; Yadav, Jagit S.; Grigoriev, Igor V.; Master, Emma R.

    2012-02-17

    Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s) among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.

  18. Bioreduction of hexavalent chromium by live and active phanerochaete chrysosporium: kinetics and modeling

    International Nuclear Information System (INIS)

    In this work the potential of live and active Phanerochaete chrysosporium, a white rot fungi, to remove lower Cr(VI) concentration from aqueous solutions was reported for the first time. A medium pH had significant effect on the growth of the fungus and bioremoval of Cr(VI). Substrate inhibition on the growth of Phanerochaete chrysosporium was evident beyond 20 g L-1 of dextrose concentration. A maximum biomass concentration of 15.64 g L-1 was obtained for an initial dextrose concentration of 20 g L-1 in metal free medium at pH 6.0. An increase in Cr(VI) concentration beyond 10 mg L-1 inhibited the growth of the fungi, thereby, reducing the chromium bioremoval efficiency. A maximum reduction efficiency of 98.92% was reported for an initial metal concentration of 10 mg L-1. A mathematical expression for the bioreduction of Cr(VI) considering the organic compounds in the cells was proposed. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. Bioreduction of hexavalent chromium by live and active phanerochaete chrysosporium: kinetics and modeling

    Energy Technology Data Exchange (ETDEWEB)

    Murugavelh, Somasundaram; Mohanty, Kaustubha [Department of Chemical Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam (India)

    2012-07-15

    In this work the potential of live and active Phanerochaete chrysosporium, a white rot fungi, to remove lower Cr(VI) concentration from aqueous solutions was reported for the first time. A medium pH had significant effect on the growth of the fungus and bioremoval of Cr(VI). Substrate inhibition on the growth of Phanerochaete chrysosporium was evident beyond 20 g L{sup -1} of dextrose concentration. A maximum biomass concentration of 15.64 g L{sup -1} was obtained for an initial dextrose concentration of 20 g L{sup -1} in metal free medium at pH 6.0. An increase in Cr(VI) concentration beyond 10 mg L{sup -1} inhibited the growth of the fungi, thereby, reducing the chromium bioremoval efficiency. A maximum reduction efficiency of 98.92% was reported for an initial metal concentration of 10 mg L{sup -1}. A mathematical expression for the bioreduction of Cr(VI) considering the organic compounds in the cells was proposed. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  20. Simultaneous cadmium removal and 2,4-dichlorophenol degradation from aqueous solutions by Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Anwei; Zeng, Guangming; Chen, Guiqiu; Fan, Jiaqi; Zou, Zhengjun; Li, Hui; Hu, Xinjiang; Long, Fei [Hunan Univ., Changsha (China). College of Environmental Science and Engineering; Ministry of Education, Changsha (CN). Key Lab. of Environmental Biology and Pollution Control (Hunan Univ.)

    2011-08-15

    Phanerochaete chrysosporium has been recognised as an effective bioremediation agent due to its unique degradation to xenobiotic and biosorption ability to heavy metals. However, few studies have focused on the simultaneous removal of heavy metals and organic pollutants. The aim of this work was to study the feasibility of simultaneous cadmium removal and 2,4-dichlorophenol (2,4-DCP) degradation in P. chrysosporium liquid cultures. The removal efficiencies were pH dependent and the maximum removal efficiencies were observed at pH 6.5 under an initial cadmium concentration of 5 mg/L and an initial 2,4-DCP concentration of 20 mg/L. The removal efficiencies for cadmium and 2,4-DCP reached 63.62% and 83.90%, respectively, under the optimum conditions. The high production levels of lignin peroxidase (7.35 U/mL) and manganese peroxidase (8.30 U/mL) resulted in an increase in 2,4-DCP degradation. The protein content decreased with increasing cadmium concentration. The surface characteristics and functional groups of the biomass were studied by scanning electron microscopy and a Fourier-transformed infrared spectrometer. The results showed that the use of P. chrysosporium is promising for the simultaneous removal of cadmium and 2,4-DCP from liquid media. (orig.)

  1. Expression of lignin peroxidase H2 from Phanerochaete chrysosporium by multi-copy recombinant Pichia strain

    Institute of Scientific and Technical Information of China (English)

    WANG Wei; WEN Xianghua

    2009-01-01

    The lipH2 gene, encoding the expression of lignin peroxidase, was cloned from Phanerochaete chrysosporium BKM-F-1767 and expressed in Pichia pastoris X-33, a yeast.The cDNA of LiPH2 was generated from total RNA extracted from P.chrysosporium by PCR with primers that do not contain a P.chrysosporium lignin peroxidase secretion signal.The gene was then successfully inserted into the expression vector pPICZα, resulting in the recombinant vector pPICZα-lipH2.The transformation was conducted in two ways.One was using the wild Pichia pastoris as the recipients, which results in the recombinant P.pastoris with single or low lipH2 gene copy.The second was using P.pastoris and single or low lipH2 gene copy as the recipients, which results in the recombinant P.pastoris with multi-copies of lipH2 genes.This study first expressed the gene lipH2 in P.pastoris and achieved the successful expression of the LiPH2 depending upon the generation of a recombinant strain that contains multiple copies.The lignin peroxidase activity reached a maximum of 15 U/L after 12 h induction.

  2. Activity Variation of Phanerochaete chrysosporium under Nanosilver Exposure by Controlling of Different Sulfide Sources

    Science.gov (United States)

    Guo, Zhi; Chen, Guiqiu; Liu, Lingzhi; Zeng, Guangming; Huang, Zhenzhen; Chen, Anwei; Hu, Liang

    2016-02-01

    Due to the particular activation and inhibition behavior of silver nanoparticles (AgNPs) on microbes at various concentrations, it’s crucial to exploit the special concentration effect in environment. Here, we studied the viability variation of Phanerochaete chrysosporium (P. chrysosporium) under exposure to citrate-coated AgNPs (Citrate-AgNPs) in the presence of different sulfide sources (an inorganic sulfide, NaHS and an organic sulfide, thioacetamide (TAA)). The results indicated that both NaHS and TAA can promote activation of P. chrysosporium by Citrate-AgNPs at a higher concentration, which was initial at toxic level. Treatment with various concentrations of Citrate-AgNPs (0-9 mg/L) demonstrated a maximum activation concentration (MAC) at 3 mg/L. With the increase in sulfide concentration, MAC transferred to higher concentration significantly, indicating the obvious “toxicity to activation” transformation at a higher concentration. Ag+ testing exhibited that variations in sulfide-induced Ag+ concentration (3-7 μg/L Ag+) accounted for the “toxicity to activation” transformation. In addition, the similar results were observed on antibacterial application using Escherichia coli as the model species. Based on the research results, the application of this transformation in improving antibacterial activity was proposed. Therefore, the antibacterial activity of AgNPs can be controlled, even at concentration, via adjusting for the sulfide concentration.

  3. Biosorption of lead by phanerochaete chrysosporium in the form of pellets

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The growth of Phanerochaete chrysosporium (ATCC 24725) in pellets was influenced by culture time, medium pH, C/N, surfactant concentration, spore number in inoculum, and shaking rate. The removal of Pb2+ from aqueous solution by this kind of mycelial pellets was studied. The results indicated that many factors affected biosorption. These factors included pH, Pb2+ concentration, co-ion, adsorption time, and chemical pretreatments of biomass. Under optimum biosorption conditions (pH 4.5, 27℃, 16h), the highest lead uptake of 108 mg/g, was observed with mycelial pellets of 1.5-1.7 mm in diameter which were treated with 0.1 mol/L NaOH solution before adsorption. Pretreatment of biomass with NaOH further increased its biosorption capacity.

  4. Construction of hybrid cell with Phanerochaete chrysosporium todegrade terephthalic acid wastewater (I) phenotype evidence

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The fungi Phanerochaete chrysosporium (PC) and Saccharomyces cerevisiae Y99 and the native bacterium YZ1 were the three parental strains for construction of hybrid cells through protoplast fusion to degrade terephthalic acid (TPA) wastewater. The results showed that the native bacterium YZ1 protoplasm could integrate with that of PC to form the hybrid cell Fhh and the fungus Y99 protoplasm also could integrate with that of Fhh to form the hybrid cell Fhhh. The protoplasts of YZ1 and Y99 could change the morphology of PC spore and mycelinm for two times. The hybrid cell Fhhh got the best growth and degradation abilities in the wastewater. It suggested that the hybrid strains obtained from the inter-kingdom protoplast fusion of the three parental strains could create potential for the purification of TPA wastewater.

  5. New pathway for degradation of sulfonated azo dyes by microbial peroxidases of Phanerochaete chrysosporium and Streptomyces chromofuscus.

    OpenAIRE

    Goszczynski, S; Paszczynski, A; Pasti-Grigsby, M B; Crawford, R L; Crawford, D. L.

    1994-01-01

    Pathways for the degradation of 3,5-dimethyl-4-hydroxy-azobenzene-4'-sulfonic acid (I) and 3-methoxy-4-hydroxyazobenzene-4'-sulfonamide (II) by the manganese peroxidase and ligninase of Phanerochaete chrysosporium and by the peroxidase of Streptomyces chromofuscus have been proposed. Twelve metabolic products were found, and their mechanisms of formation were explained. Preliminary oxidative activation of the dyes resulted in the formation of cationic species, making the molecules vulnerable ...

  6. Direct Probing of the Surface Ultrastructure and Molecular Interactions of Dormant and Germinating Spores of Phanerochaete chrysosporium

    OpenAIRE

    Dufrêne, Yves; Boonaert, C J; Gerin, Patrick A.; Asther, M.; Rouxhet, Paul

    1999-01-01

    Atomic force microscopy (AFM) has been used to probe, under physiological conditions, the surface ultrastructure and molecular interactions of spores of the filamentous fungus Phanerochaete chrysosporium. High-resolution images revealed that the surface of dormant spores was uniformly covered with rodlets having a periodicity of 10 +/- 1 nm, which is in agreement with earlier freeze-etching measurements. In contrast, germinating spores had a very smooth surface partially covered with rough gr...

  7. Purification and Characterization of a Cellulose-Binding (beta)-Glucosidase from Cellulose-Degrading Cultures of Phanerochaete chrysosporium

    OpenAIRE

    Lymar, E. S.; Li, B.; Renganathan, V.

    1995-01-01

    Extracellular (beta)-glucosidase from cellulose-degrading cultures of Phanerochaete chrysosporium was purified by DEAE-Sephadex chromatography, by Sephacryl S-200 chromatography, and by fast protein liquid chromatography (FPLC) using a Mono Q anion-exchange column. Sodium dodecyl sulfate-polyacrylamide gel electrophoretic (SDS-PAGE) analysis of FPLC-purified (beta)-glucosidase indicated the presence of three enzyme forms with molecular weights of 96,000, 98,000, and 114,000. On further fracti...

  8. Roles of manganese and organic acid chelators in regulating lignin degradation and biosynthesis of peroxidases by Phanerochaete chrysosporium.

    OpenAIRE

    Perez, J.; Jeffries, T W

    1992-01-01

    We studied the effect of manganese and various organic chelators on the distribution, depolymerization, and mineralization of synthetic 14C-labeled lignins (DHP) in cultures of Phanerochaete chrysosporium. In the presence of high levels of manganese [Mn(II) or Mn(III)], along with a suitable chelator, lignin peroxidase (LiP) production was repressed and manganese peroxidase (MnP) production was stimulated. Even though partial lignin depolymerization was observed under these conditions, furthe...

  9. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    International Nuclear Information System (INIS)

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles

  10. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhenzhen [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Zuo, Yanan; Guo, Zhi; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Song, Zhongxian [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming 650500 (China); Niu, Qiuya [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-05-30

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles.

  11. Expression of a Phanerochaete chrysosporium manganese peroxidase gene in the yeast Pichia pastoris.

    Science.gov (United States)

    Gu, Lina; Lajoie, Curtis; Kelly, Christine

    2003-01-01

    A gene encoding manganese peroxidase (mnp1) from Phanerochaete chrysosporium was cloned downstream of a constitutive glyceraldehyde-3-phosphate dehydrogenase promoter in the methylotrophic yeast Pichia pastoris. Three different expression vectors were constructed: pZBMNP contains the native P. chrysosporium fungal secretion signal, palphaAMNP contains an alpha-factor secretion signal derived from Saccharomyces cerevisiae, and pZBIMNP has no secretion signal and was used for intracellular expression. Both the native fungal secretion signal sequence and alpha-factor secretion signal sequence directed the secretion of active recombinant manganese peroxidase (rMnP) from P. pastoris transformants. The majority of the rMnP produced by P. pastoris exhibited a molecular mass (55-100 kDa) considerably larger than that of the wild-type manganese peroxidase (wtMnP, 46 kDa). Deletion of the native fungal secretion signal yielded a molecular mass of 39 kDa for intracellular rMnP in P. pastoris. Treatment of the secreted rMnP with endoglycosidase H (Endo H) resulted in a considerable decrease in the mass of rMnP, indicating N-linked hyperglycosylation. Partially purified rMnP showed kinetic characteristics similar to those of wtMnP. Both enzymes also had similar pH stability profiles. Addition of exogenous Mn(II), Ca(II), and Fe(III) conferred additional thermal stability to both enzymes. However, rMnP was slightly less thermostable than wtMnP, which demonstrated an extended half-life at 55 degrees C. PMID:14524699

  12. Regulation of Gene Expression during the Onset of Ligninolytic Oxidation by Phanerochaete chrysosporium on Spruce Wood.

    Science.gov (United States)

    Korripally, Premsagar; Hunt, Christopher G; Houtman, Carl J; Jones, Don C; Kitin, Peter J; Cullen, Dan; Hammel, Kenneth E

    2015-11-01

    Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in the cultures. Confocal fluorescence microscopy of the beads showed that extracellular oxidation commenced 2 to 3 days after inoculation, coincident with cessation of fungal growth. Whole transcriptome shotgun sequencing (RNA-seq) analyses based on the v.2.2 P. chrysosporium genome identified 356 genes whose transcripts accumulated to relatively high levels at 96 h and were at least four times the levels found at 40 h. Transcripts encoding some lignin peroxidases, manganese peroxidases, and auxiliary enzymes thought to support their activity showed marked apparent upregulation. The data were also consistent with the production of ligninolytic extracellular reactive oxygen species by the action of manganese peroxidase-catalyzed lipid peroxidation, cellobiose dehydrogenase-catalyzed Fe(3+) reduction, and oxidase-catalyzed H2O2 production, but the data do not support a role for iron-chelating glycopeptides. In addition, transcripts encoding a variety of proteins with possible roles in lignin fragment uptake and processing, including 27 likely transporters and 18 cytochrome P450s, became more abundant after the onset of extracellular oxidation. Genes encoding cellulases showed little apparent upregulation and thus may be expressed constitutively. Transcripts corresponding to 165 genes of unknown function accumulated more than 4-fold after oxidation commenced, and some of them may merit investigation as possible contributors to ligninolysis. PMID:26341198

  13. VANILLIN PRODUCTION BY PHANEROCHAETE CHRYSOSPORIUM GROWN ON GREEN COCONUT AGRO-INDUSTRIAL HUSK IN SOLID STATE FERMENTATION

    OpenAIRE

    Elisabete dos Santos Barbosa; Daniel Perrone; Ana Lúcia do Amaral Vendramini; Selma Gomes Ferreira Leite

    2008-01-01

    Agro-industrial residues have become an important source for the production of chemical compounds using biological pathways, contributing to preservation of the environment and making the overall process economically supportable. Vanillin is a very important aromatic compound for the food, beverage, and pharmaceutical industries. The aim of the present study was to evaluate the vanillin production by solid-state fermentation on green coconut residue using the basidiomycete Phanerochaete chrys...

  14. Degradation of wheat straw cell wall by white rot fungi Phanerochaete chrysosporium

    Science.gov (United States)

    Zeng, Jijiao

    The main aim of this dissertation research was to understand the natural microbial degradation process of lignocellulosic materials in order to develop a new, green and more effective pretreatment technology for bio-fuel production. The biodegradation of wheat straw by white rot fungi Phanerochaete chrysosporium was investigated. The addition of nutrients significantly improved the performance of P.chrysosporium on wheat straw degradation. The proteomic analysis indicated that this fungus produced various pepetides related to cellulose and lignin degradation while grown on the biomass. The structural analysis of lignin further showed that P.chrysosporium preferentially degraded hydroxycinnamtes in order to access cellulose. In details, the effects of carbon resource and metabolic pathway regulating compounds on manganeses peroxidase (MnP) were studied. The results indicated that MnP activity of 4.7 +/- 0.31 U mL-1 was obtained using mannose as a carbon source. The enzyme productivity further reached 7.36 +/- 0.05 U mL-1 and 8.77 +/- 0.23 U mL -1 when the mannose medium was supplemented with cyclic adenosine monophosphate (cAMP) and S-adenosylmethionine (SAM) respectively, revealing highest MnP productivity obtained by optimizing the carbon sources and supplementation with small molecules. In addition, the effects of nutrient additives for improving biological pretreatment of lignocellulosic biomass were studied. The pretreatment of wheat straw supplemented with inorganic salts (salts group) and tween 80 was examined. The extra nutrient significantly improved the ligninase expression leading to improve digestibility of lignocellulosic biomass. Among the solid state fermentation groups, salts group resulted in a substantial degradation of wheat straw within one week, along with the highest lignin loss (25 %) and ˜ 250% higher efficiency for the total sugar release through enzymatic hydrolysis. The results were correlated with pyrolysis GC-MS (Py

  15. Polycyclic aromatic hydrocarbon biodegradation and extracellular enzyme secretion in agitated and stationary cultures of Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The extracellular enzyme secretion and biodegradation of polycyclic aromatic hydrocarbons (PAHs) were studied in agitated and shallow stationary liquid cultures of Phanerochaete chrysosporium. Veratryl alcohol and Tween80 were added to cultures as lignin peroxidase (LiP) and manganese peroxidase (MnP) inducer, respectively. Shallow stationary cultures were suitable for the production of enzyme, whereas agitated cultures enhanced overall biodegradation by facilitating interphase mass transfer of PAH into aqueous phases. The use of a LiP stimulator, veratryl alcohol, did not increase PAH degradation but significantly enhanced LiP activity. In contrast, Tween80 increased both MnP secretion and PAH degradation in shallow stationary cultures. On the other hand, high PAH degradation was observed in agitated cultures in the absence of detectable LiP and MnP activities. The results suggested that extracellular peroxidase activities are not directly related to the PAH degradation, and the increased solubility rather than enzyme activity may be more important in the promotion of PAH degradation.

  16. Phenotypic classes of phenoloxidase-negative mutants of the lignin-degrading fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    This paper reports the isolation of phenoloxidase-negative mutants of the white-rot fungus Phanerochaete chrysosporium and the results of a survey of idiophasic functions among these mutants. The mutant strains were isolated from a medium containing o-anisidine after gamma irradiation of wild-type spores and fell into four classes, divided by the manner in which they mineralized 14C-lignin wheat lignocellulose. Examples are strain LMT7, which degraded lignin at a rate similar to that of the wild type; strain LMT26, in which degradation was enhanced; strain LMT16, whose degradation rate was apparently unaffected, although the onset of lignin attack was delayed compared with that in the wild type; and strain LMT24, which was unable to evolve significant amounts of 14CO2 from the radiolabeled substrate. The mutants were not necessarily defective in other functions associated with idiophasic activities (intracellular cyclic AMP levels, sporulation, extracellular glucan production, veratryl alcohol synthesis). The authors conclude that phenoloxidase activity as detected by the o-anisidine plate test is not necessary for lignin degradation. In addition, mutations resulting in the loss of lignin-degrading ability were not necessarily pleiotropic with other idiophasic functions

  17. Identification of metabolites produced by Phanerochaete chrysosporium in the presence of amlodipine orotate using metabolomics.

    Science.gov (United States)

    De Sotto, R B; Kim, K I; Kim, S; Song, K G; Park, Y

    2015-01-01

    Pharmaceuticals are very useful in treating human diseases but they are excreted to the environment sometimes in their original form or as byproducts of human metabolism. Pharmaceuticals and their metabolites have been proven by studies to be harmful to non-target ecological species and may be persistent in different water matrices. In this regard, there is an emergent need to eliminate these compounds to prevent their adverse effects on aquatic species. Biodegradation using white-rot fungi is a promising technology for the removal of recalcitrant compounds; however, products of fungal biodegradation can also be detrimental. In this novel study, we evaluated the ability of Phanerochaete chrysosporium to degrade amlodipine, an anti-hypertensive drug which was recently found in water systems. Analysis of amlodipine metabolites was done using quadrupole time-of-flight liquid chromatography mass spectrometry after the degradation set-up of 120 hours. Pharmaceutical degradation was seen using triple quadrupole liquid chromatography tandem mass spectrometry. Ninety-two significant metabolites (P-value ≤ 0.05) were significantly expressed after false discovery rate adjustment at a significance threshold of q = 0.05. Pyridine derivatives which were identified from samples became the basis of the proposed degradation pathway of amlodipine in this study. PMID:26398029

  18. Effect of selenite on the morphology and respiratory activity of Phanerochaete chrysosporium biofilms.

    Science.gov (United States)

    Espinosa-Ortiz, Erika J; Pechaud, Yoan; Lauchnor, Ellen; Rene, Eldon R; Gerlach, Robin; Peyton, Brent M; van Hullebusch, Eric D; Lens, Piet N L

    2016-06-01

    The temporal and spatial effects of selenite (SeO3(2-)) on the physical properties and respiratory activity of Phanerochaete chrysosporium biofilms, grown in flow-cell reactors, were investigated using oxygen microsensors and confocal laser scanning microscopy (CLSM) imaging. Exposure of the biofilm to a SeO3(2-) load of 1.67mgSeL(-1)h(-1) (10mgSeL(-1) influent concentration), for 24h, resulted in a 20% reduction of the O2 flux, followed by a ∼10% decrease in the glucose consumption rate. Long-term exposure (4days) to SeO3(2-) influenced the architecture of the biofilm by creating a more compact and dense hyphal arrangement resulting in a decrease of biofilm thickness compared to fungal biofilms grown without SeO3(2-). To the best of our knowledge, this is the first time that the effect of SeO3(2-) on the aerobic respiratory activity on fungal biofilms is described. PMID:26935326

  19. Production and characterization of recombinant lignin peroxidase isozyme H2 from Phanerochaete chrysosporium using recombinant baculovirus.

    Science.gov (United States)

    Johnson, T M; Pease, E A; Li, J K; Tien, M

    1992-08-01

    Recombinant Phanerochaete chrysosporium lignin peroxidase isozyme H2 (pI 4.4) was produced in insect cells infected with a genetically engineered baculovirus containing a copy of the cDNA clone lambda ML-6. The recombinant enzyme was purified to near homogeneity and is capable of oxidizing veratryl alcohol, iodide, and, to a lesser extent, guaiacol. The Km of the recombinant enzyme for veratryl alcohol and H2O2 is similar to that of the fungal enzyme. The guaiacol oxidation activity or any other activity is not dependent upon Mn2+. The purified recombinant peroxidase is glycosylated with N-linked carbohydrate(s). The recombinant lignin peroxidase eluted from an anion exchange resin similar to that of native isozyme H1 rather than H2. However, the pI of the recombinant enzymes is different from both H1 and H2 isozymes. Further characterization of native isozymes H1 and H2 from the fungal cultures revealed identical N-terminus residues. This indicates that isozymes H1 and H2 differ in post-translational modification. PMID:1632652

  20. The RT-PCR Analysis of Lignocellulytic Biodegradation-related Gene Expression of Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    Jiang Mingfeng(江明锋); Zhang Yizheng

    2004-01-01

    Expression of lignocellulytic biodegradation-related genes of Phanerochaete chrysosporium grown in 10 kinds of defined media for 5 days and on fir wood chip for 2 to 8 weeks is analyzed by using the RT-PCR method. The result shows that an individual gene of lip gene family responds differently to different nutrient factors. The expression of lipD gene can be promoted by molecular O2 but suppressed by Mn2+. The influence of nitorgen is not the controlling factor for lipD gene expression. No clear relationship is found between nutrient factors and the expression of lipA gene which may be regulated by several nutrient factors through a complex system. Mnp3 gene is not strongly regulated by Mn2+ and other nutrient factors. It can be expressed in different media. CBHI gene family can not be expressed in the presence of glucose as the sole carbon source. Glx expression is regulated by Mn2+ and molecular O2, and depressed when Mn2+ concerntration goes up to 300 mg/L. The transcription patterns of lip gene family grown on fir wood chip are shown to be markedly different from those patterns in defined media. The expression of single lip gene changes with colonized time. No difference is observed between the expression pattern of mnp, cbh, glx gene in defined media and fir wood chips.

  1. Biodegradation of TNT (2,4,6-Trinitrotoluene) by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Extensive biodegradation of TNT (2,4,6-trinitrotoluene) by the white rot fungus Phanerochaete chrysosporium was observed. At an initial concentration of 1.3 mg/liter, 35.4 ± 3.6% of the [14C]TNT was degraded to 14CO2 in 18 days. The addition of glucose 12 days after the addition of TNT did not stimulate mineralization, and, after 18 days of incubation with TNT only, about 3.3% of the initial TNT could be recovered. Mineralization of [14C]TNT absorbed on soil was also examined. Ground corncobs served as the nutrient for slow but sustained degradation of [14C]TNT to 14CO2 such that 6.3 ± 0.6% of the [14C]TNT initially present was converted to 14CO2 during the 30-day incubation period. Mass balance analysis of liquid cultures and of soil-corncob cultures revealed that polar [14C]TNT metabolites are formed in both systems, and high-performance liquid chromatography analyses revealed that less then 5% of the radioactivity remained as undegraded [14C]TNT following incubation with the fungus in soil and liquid cultures. When the concentration of TNT in cultures (both liquid and soil) was adjusted to contamination levels that might be found in the environment, i.e., 10,000 mg/kg in soil and 100 mg/liter in water, mineralization studies showed that 18.4 ± 2.9% and 19.6 ± 3.5% of the initial TNT was converted to 14CO2 in 90 days in soil and liquid cultures, respectively. In both cases (90 days in water at 100 mg/liter and in soil at 10,000 mg/kg) approximately 85% of the TNT was degraded. These results suggest that this fungus may be useful for the decontamination of sites in the environment contaminated with TNT

  2. BIODEGRADATION OF DDT [1,1,1-TRICHLORO-2,2-BIS(4- CHLOROPHENYL) ETHANE] BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the form...

  3. BIODEGRATION OF 2,4,5-TRICHLOROPHENOXYACETIC ACID IN LIQUID CULTURE AND IN SOIL BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOSPORIUM

    Science.gov (United States)

    Extensive biodegradation of [14C]-2,4,5-trichlorophenoxyacetic acid ([[14C]-2,4,5-T) by the white rot fungus Phanerochaete chrysosporium was demonstrated in nutrient nitrogen-limited aqueous cultures and in [14C]-2,4,5-T-contaminated soil inoculat...

  4. Biodegradation, Biosorption of Phenanthrene and Its Trans-Membrane Transport by Massilia sp. WF1 and Phanerochaete chrysosporium

    Science.gov (United States)

    Gu, Haiping; Lou, Jun; Wang, Haizhen; Yang, Yu; Wu, Laosheng; Wu, Jianjun; Xu, Jianming

    2016-01-01

    Reducing phenanthrene (PHE) in the environment is critical to ecosystem and human health. Biodegradation, biosorption, and the trans-membrane transport mechanism of PHE by a novel strain, Massilia sp. WF1, and an extensively researched model fungus, Phanerochaete chrysosporium were investigated in aqueous solutions. Results showed that the PHE residual concentration decreased with incubation time and the data fitted well to a first-order kinetic equation, and the t1/2 of PHE degradation by WF1, spores, and mycelial pellets of P. chrysosporium were about 2 h, 87 days, and 87 days, respectively. The biosorbed PHE was higher in P. Chrysosporium than that in WF1, and it increased after microorganisms were inactivated and inhibited, especially in mycelial pellets. The detected intracellular auto-fluorescence of PHE by two-photon excitation microscopy also proved that PHE indeed entered into the cells. Based on regression, the intracellular (Kdin) and extracellular (Kdout) dissipation rate constants of PHE by WF1 were higher than those by spores and mycelial pellets. In addition, the transport rate constant of PHE from outside solution into cells (KinS/Vout) for WF1 were higher than the efflux rate constant of PHE from cells to outside solution (KoutS/Vin), while the opposite phenomena were observed for spores and mycelial pellets. The amount of PHE that transported from outside solution into cells was attributed to the rapid degradation and active PHE efflux in the cells of WF1 and P. Chrysosporium, respectively. Besides, the results under the inhibition treatments of 4°C, and the presence of sodium azide, colchicine, and cytochalasin B demonstrated that a passive trans-membrane transport mechanism was involved in PHE entering into the cells of WF1 and P. Chrysosporium. PMID:26858710

  5. Removal of phenol in phenolic resin wastewater by a novel biomaterial: the Phanerochaete chrysosporium pellet containing chlamydospore-like cells.

    Science.gov (United States)

    Hailei, Wang; Ping, Li; Yu, Qin; Hui, Yang

    2016-06-01

    A novel biomaterial, the Phanerochaete chrysosporium pellet (CP) composed of chlamydospore-like cells (CLCs), was prepared and its potential in treating phenolic resin wastewater was evaluated. CP possesses higher phenol removal ability in contrast with mycelial pellets of P. chrysosporium, and CLC can be seen as the naturally immobilized enzymes. At shake-flask level, the ideal pH value, temperature, and inoculation quantity of CP for treatment of 1430 mg/l phenol wastewater were pH 4-6, 30 °C, and 5.0 g/l, respectively, and the maximum specific removal rate, 41.1 mg phenol/g CP/h, was obtained in fixed bed reactor (FBR) when the flow rate of wastewater was 3.4 l/h. During the treatment, FBR harbored amounts of bacteria (135 genera) and eukaryotes, as analyzed by metagenomic sequencing. Bacterial pollution not only decreased reactor performance but also had a negative impact on reusability of CP. Hot water treatment (80-85 °C) is effective to inhibit bacterial pollution, and heat resistance of CLC makes the repeated regrowing of CP be feasible. This work presents an innovative and low-cost biomaterial for phenol removal and will be helpful for the practical application of P. chrysosporium in wastewater treatment. PMID:26860939

  6. Microbial pretreatment of cotton stalks by Phanerochaete chrysosporium for bioethanol production

    Science.gov (United States)

    Shi, Jian

    Lignocellulosic biomass has been recognized as a widespread, potentially low cost renewable source of mixed sugars for fermentation to fuel ethanol. Pretreatment, as the first step towards conversion of lignocellulose to ethanol, remains one of the main barriers to technical and commercial success of the processing technology. Existing pretreatment methods have largely been developed on the basis of physiochemical technologies which are considered relatively expensive and usually involve adverse environmental impacts. In this study, an environmentally benign alternative, microbial pretreatment using Phanerochaete chrysosporium, was explored to degrade lignin in cotton stalks and facilitate their conversion into ethanol. Two submerged liquid pretreatment techniques (SmC), shallow stationary and agitated cultivation, at three inorganic salt concentrations (no salts, modified salts without Mn2+, modified salts with Mn2+) were compared by evaluating their pretreatment efficiencies. Shallow stationary cultivation with no salt was superior to other pretreatment conditions and gave 20.7% lignin degradation along with 76.3% solids recovery and 29.0% carbohydrate availability over a 14 day period. The influence of substrate moisture content (65%, 75% and 80% M.C. wet-basis), inorganic salt concentration (no salts, modified salts without Mn2+ , modified salts with Mn2+) and culture time (0-14 days) on pretreatment effectiveness in solid state (SSC) systems was also examined. It was shown that solid state cultivation at 75% M.C. without salts was the most preferable pretreatment resulting in 27.6% lignin degradation, 71.1% solids recovery and 41.6% carbohydrate availability over a period of 14 days. A study on hydrolysis and fermentation of cotton stalks treated microbially using the most promising SmC (shallow stationary, no salts) and SSC (75% moisture content, no salts) methods resulted in no increase in cellulose conversion with direct enzyme application (10.98% and 3

  7. Biosorption of 2,4-dichlorophenol from aqueous solution by Phanerochaete chrysosporium biomass: Isotherms, kinetics and thermodynamics

    International Nuclear Information System (INIS)

    The biosorption of 2,4-dichlorophenol (2,4-DCP) from aqueous solution on non-living mycelial pellets of Phanerochaete chrysosporium was studied with respect to pH, initial concentration of 2,4-DCP, temperature and pellet size. The fungal biomass exhibited the highest sorption capacity of 4.09 mg/g at an initial pH of 5.0, initial 2,4-DCP concentration of 50.48 mg/l, 25 deg. C and a pellet size of 1.0-1.5 mm in the investigated pH 2.0-11.0, initial concentrations of 5-50 mg/l, temperature 25-50 deg. C, and pellet size of 1.0-2.5 mm. The Freundlich model exhibited a slightly better fit to the biosorption data of 2,4-DCP than the Langmuir model. The biosorption of 2,4-DCP to biomass followed pseudo second-order adsorption kinetics. The second-order kinetic constants decreased with increasing temperature, and the apparent activation energy of biosorption was estimated to be -16.95 kJ/mol. The thermodynamic analysis indicates that the biosorption process was exothermic and that the adsorption of 2,4-DCP on P. chrysosporium might be physical in nature. Both intraparticle diffusion and kinetic resistances might affect the adsorption rate and that their relative effects varied with operation temperature in the biosorption of 2,4-DCP by mycelial pellets

  8. Treatment of landfill leachate using immobilized Phanerochaete chrysosporium loaded with nitrogen-doped TiO₂ nanoparticles.

    Science.gov (United States)

    Hu, Liang; Zeng, Guangming; Chen, Guiqiu; Dong, Haoran; Liu, Yutang; Wan, Jia; Chen, Anwei; Guo, Zhi; Yan, Ming; Wu, Haipeng; Yu, Zhigang

    2016-01-15

    This study investigated the performance of immobilized Phanerochaete chrysosporium loaded with nitrogen-doped TiO2 nanoparticles in the treatment of raw landfill leachate with a very low biodegradability ratio (BOD5/COD) of 0.09. The effects of various operating parameters, such as initial chemical oxygen demand (COD) concentration, pH, temperature, and biosorbent dosage, were evaluated with respect to the removal efficiency of total organic carbon (TOC) and ammonia nitrogen (NH3-N). For the immobilized biosorbents, an optimum pH of 6.0 for TOC and 7.0 for NH3-N were found suitable for TOC and NH3-N removal at temperature of 37°C, respectively. The most superior removal efficiencies of TOC and NH3-N of landfill leachate were over 75% and 74% in 72 h at an initial COD concentration of 200 mg L(-1), respectively. In addition, heavy metals were partly removed by the immobilized biosorbents during the process of landfill leachate treatment. The species and mass percentage of organic compounds in landfill leachate after the treatment were found to have considerably declined according to the gas chromatography coupled with mass spectrometry (GC-MS) system. These results indicate that the immobilized P. chrysosporium loaded with nitrogen-doped TiO2 nanoparticles could be a convenient and efficient method for the treatment of landfill leachate. PMID:26355412

  9. Impact of Trametes versicolor and Phanerochaete chrysosporium on differential breakdown of pesticide mixtures in soil microcosms at two water potentials and associated respiration and enzyme activity.

    OpenAIRE

    Fragoeiro, Silvia; Magan, Naresh

    2008-01-01

    This study has examined the effect of inoculation of soil microcosms with Trametes versicolor and Phanerochaete chrysosporium on wood chips on differential degradation of pesticides (simazine, trifluralin and dieldrin, 10 mg kg−1 soil) at two water potentials (−0.7 and −2.8 MPa) at 15 °C. The soil microcosms were destructively sampled after 6/12 weeks and four extracellular enzymes quantified, respiration and pesticides measured with GC and HPLC. The fungal treatments produced extracellular e...

  10. Relationship of chemical structures of textile dyes on the pre-adaptation medium and the potentialities of their biodegradation by Phanerochaete chrysosporium

    OpenAIRE

    Martins, M. Adosinda M.; Queiroz, Maria João R. P.; Silvestre, Armando J. D.; Lima, Nelson

    2002-01-01

    Azo dye derivatives of azobenzene constitute the largest group of dyes used in the textile industry and possess recalcitrant chemical groups, such as those of azo and sulphonic acid. Some microorganisms are able to degrade these aromatic compounds. In the present work, decolourisation of culture media containing azo dyes by the ligninolytic fungus Phanerochaete chrysosporium was achieved under nitrogenlimited conditions. The dyes used in the study are derivatives of meta- or para-ami...

  11. Purification and characterization of a cellulose-binding {beta}-glucosidase from cellulose-degrading cultures of phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Lymar, E.S.; Li, B.; Renganathan, V. [Oregon Graduate Institute of Science & Technology, Portland, OR (United States)

    1995-08-01

    Extracellular {beta}-glucosidase from cellulose-degrading cultures of Phanerochaete chrysosporium was purified by DEAE-Sephadex chromatography, by Sephacryl S-200 chromatography, and by fast protein liquid chromatography (FPLC) using a Mono Q anion-exchange column. Sodium dodecyl sulfate-polyacrylamide gel electrophoretic (SDS-PAGE) analysis of FPLC-purified {beta}-glucosidase indicated the presence of three enzyme forms with molecular weights of 96,000, 98,000, and 114,000. On further fractionation with a microcrystalline cellulose column, the 114,000-molecular-weight {beta}-glucosidase, which had 82% of the {beta}-glucosidase activity, was bound to cellulose. The {beta}-glucosidases with molecular weights of 96,000 and 98,000 did not bind to cellulose. The cellulose-bound {beta}-glucosidase was eluted completely from the cellulose matrix with water. Cellulose-bound {beta}-glucosidase catalyzed p-nitrophenylglucoside hydrolysis, suggesting that the catalytic site is not involved in cellulose binding. When the cellulose-binding form was incubated with papain for 20 h, no decrease in the enzyme activity was observed; however, approximately 74% of the papain-treated glucosidase did not bind to microcrystalline cellulose. SDS-PAGE analysis of the nonbinding glucosidase produced by papain indicated the presence of three bands with molecular weights in the range of 95,000 to 97,000. On the basis of these results, we propose that the low-molecular-weight (96,000 and 98,000) non-cellulose-binding {beta}-glucosidase forms are most probably formed from the higher-molecular-weight (114,000) cellulose-binding {beta}-glucosidase via extracellular proteolytic hydrolysis. Also, it appears that the extracellular {beta}-glucosidase from P. chrysosporium might be organized into two domains, a cellulose-binding domain and a catalytic domain. Kinetic characterization of the cellulose-binding form is also presented. 31 refs., 6 figs., 1 tab.

  12. Manganese peroxidase production from cassava residue by Phanerochaete chrysosporium in solid state fermentation and its decolorization of indigo carmine

    Institute of Scientific and Technical Information of China (English)

    Huixing Li; Ruijing Zhang; Lei Tang; Jianhua Zhang; Zhonggui Mao

    2015-01-01

    Bioconversion of lignocellulosic wastes to higher value products through fungal fermentation has economic and ecological benefits. In this study, to develop an effective strategy for production of manganese peroxidase (MnP) from cassava residue by Phanerochaete chrysosporium in solid state fermentation, the stimulators of MnP produc-tion were screened and their concentrations were optimized by one-at-a-time experiment and Box–Behnken design. The maximum MnP activity of 186.38 nkat·g−1 dry mass of the sample was achieved after 6 days of fer-mentation with the supplement of 79.5 mmol·L−1·kg−1 acetic acid, 3.21 ml·kg−1 soybean oil, and 28.5 g·kg−1 alkaline lignin, indicating that cassava residue is a promising substrate for MnP production in solid state fermen-tation. Meanwhile, in vitro decolorization of indigo carmine by the crude MnP was also carried out, attaining the ratio of 90.18%after 6 h of incubation. An oxidative mechanism of indigo carmine decolorization by MnP was pro-posed based on the analysis of intermediate metabolites with ultra-high performance liquid chromatography and gas chromatography tandem mass spectrometry. Using the crude MnP produced from cassava residue for indigo carmine decolorization gives an effective approach to treat dyeing effluents.

  13. Influence of glucose feeding on the ligninolytic enzyme production of the white-rot fungus Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    ZHOU Xiaoyan; WEN Xianghua; FENG Yan

    2007-01-01

    The present work studied the influence of glucose feeding on the ligninolytic enzyme production of Phanerochaete chrysosporium in a nitrogen-limited(C/N ratio is 56/8.8 mmol/L)medium.Several sets of shaking flask experiments were conducted.The results showed that 2g/L glucose feeding on the first day of the culture(24 h after the inoculation)stimulated both fungal biomass growth and enzyme production.The manganese peroxidase(MnP)activity was 2.5 times greater than that produced in cultures without glucose feeding.Furthermore,the glucose feeding mode in fed-batch culture was also investigated.Compared to cultures with glucose feeding every 48 h,cultures with glucose feeding of 1.5 g/L(final concentration)every 24 h produced more enzymes.The peak and total yield of MnP activity were 2.7 and 3 times greater compared to the contrast culture,respectively,and the enzyme was kept stable for 4 days with an activity of over 200 U/L.

  14. Continuous production of manganese peroxidase by Phanerochaete chrysosporium immobilized on polyurethane foam in a pulsed packed-bed bioreactor.

    Science.gov (United States)

    Moreira, M T; Feijoo, G; Palma, C; Lema, J M

    1997-10-20

    The bottleneck of the application of manganese peroxidase (MnP) on an industrial scale in pulp biobleaching or in degradation of hazardous compounds is the lack of an efficient production system. Three main problems arise for the continuous production of MnP during secondary metabolism of Phanerochaete chrysosporium: enzyme production occurs only under specific physiological conditions corresponding to C or N limitation, high O(2) tension, and adequate Mn(+2) concentration; the enzyme that is produced is destabilized by extracellular proteases; and excessive growth of the mycelium blocks effective oxygen transfer. To overcome these drawbacks, continuous production of MnP was optimized by selecting a suitable bioreactor configuration and the environmental and operating conditions affecting both enzyme production and stability. The combination between a proper feed rate and the application of a pulsation in a packed-bed bioreactor permitted the maintenance of continuous secretion of MnP while limiting mycelial growth and avoiding bed clogging. Environmental factors as an Mn(+2) concentration of 5000 microM and high oxygen tension enhanced MnP production. The hydraulics of the bioreactor corresponding to a plug flow model with partial mixing and an operating hydraulic rentention time of 24 h were optimal to achieve stable operating conditions. This policy allowed long operation periods, obtaining higher productivities than the best reported in the literature. (c) 1997 John Wiley & Sons, Inc. Biotechnol Bioeng 56: 130-137, 1997. PMID:18636618

  15. Decolourization potential of white-rot fungus Phanerochaete chrysosporium on synthetic dye bath effluent containing Amido black 10B

    Directory of Open Access Journals (Sweden)

    S. Senthilkumar

    2014-12-01

    Full Text Available Synthetic azo dyes are extensively used in textile industry and are not easily degraded into the environment due to their complex structure. Due to the low degree of fixation of these dyes to fabrics, more than 10–15% of the dye does not bind to fabrics during colour processing and release into water bodies as effluent cause serious environmental pollution. White-rot fungus is found to be capable of degrading lignin which has a complex structure similar to azo dyes. In this study, the decolourization potential of white-rot fungus Phanerochaete chrysosporium, which is capable of decolourizing synthetic dye bath effluent, was investigated. Maximum decolourization of 98% was achieved on the third day under normal conditions. The rate of decolourization carried out at different concentrations revealed that the increase in dye effluent concentration suppresses the percentage decolourization. The optimized amounts of nutrients were found to be 0.5%, 0.1% and 0.5% of glucose, manganese sulphate and ammonium salts, respectively. The addition of inducers such as starch and lignin increased enzyme production and the rate of decolourization.

  16. Cloning, expression and characterization of an aryl-alcohol dehydrogenase from the white-rot fungus Phanerochaete chrysosporium strain BKM-F-1767

    Directory of Open Access Journals (Sweden)

    Yang Dong-Dong

    2012-06-01

    Full Text Available Abstract Background The white-rot fungus Phanerochaete chrysosporium is among the small group of fungi that can degrade lignin to carbon dioxide while leaving the crystalline cellulose untouched. The efficient lignin oxidation system of this fungus requires cyclic redox reactions involving the reduction of aryl-aldehydes to the corresponding alcohols by aryl-alcohol dehydrogenase. However, the biochemical properties of this enzyme have not been extensively studied. These are of most interest for the design of metabolic engineering/synthetic biology strategies in the field of biotechnological applications of this enzyme. Results We report here the cloning of an aryl-alcohol dehydrogenase cDNA from the white-rot fungus Phanerochaete chrysosporium, its expression in Escherichia coli and the biochemical characterization of the encoded GST and His6 tagged protein. The purified recombinant enzyme showed optimal activity at 37°C and at pH 6.4 for the reduction of aryl- and linear aldehydes with NADPH as coenzyme. NADH could also be the electron donor, while having a higher Km (220 μM compared to that of NADPH (39 μM. The purified recombinant enzyme was found to be active in the reduction of more than 20 different aryl- and linear aldehydes showing highest specificity for mono- and dimethoxylated Benzaldehyde at positions 3, 4, 3,4 and 3,5. The enzyme was also capable of oxidizing aryl-alcohols with NADP + at 30°C and an optimum pH of 10.3 but with 15 to 100-fold lower catalytic efficiency than for the reduction reaction. Conclusions In this work, we have characterized the biochemical properties of an aryl-alcohol dehydrogenase from the white-rot fungus Phanerochaete chrysosporium. We show that this enzyme functions in the reductive sense under physiological conditions and that it displays relatively large substrate specificity with highest activity towards the natural compound Veratraldehyde.

  17. A novel knotted cotton-thread carrier:Its potential use in achieving the biomass renewal of Phanerochaete chrysosporium in an immobilized growth system

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    In order to achieve an innovative strategy to renew the biomass of Phanerochaete chrysosporium in an immobilized growth system which can maintain white-rot fungi biomass, a novel knotted cotton-thread carrier was designed and made. By using a high-speed stirring apparatus under the conditions of 1400 r/min stirring speed for 6 min, mycelia immobilized on the knotted cotton-thread carriers were exfoliated completely and homogenized to a proper size. Furthermore, the homogenized mycelia from the immobilized mycelia can resume their growth on the knotted cotton-thread carriers in agitated flask cultures. The average regrowth biomass on the new carriers and the reused carriers was 0.0171 g/carrier and 0.0314 g/carrier, respectively. It proves that the knotted cotton-thread carrier performs perfectly in homogening the immobilized mycelia to achieve the biomass renewal of P. chrysosporium in an immobilized growth system.

  18. A novel knotted cotton-thread carrier: Its potential use in achieving the biomass renewal of Phanerochaete chrysosporium in an immobilized growth system

    Institute of Scientific and Technical Information of China (English)

    ZHOU Cheng; WEN XiangHua

    2009-01-01

    In order to achieve an innovative strategy to renew the biomass of Phanerochaete chrysosporium in an immobilized growth system which can maintain white-rot fungi biomass, a novel knotted cotton-thread carrier was designed and made. By using a high-speed stirring apparatus under the conditions of 1400 r/min stirring speed for 6 min, mycelia immobilized on the knotted cotton-thread carriers were exfoli-ated completely and homogenized to a proper size. Furthermore, the homogenized mycelia from the Immobilized mycalia can resume their growth on the knotted cotton-thread carriers in agitated flask cultures. The average regrowth biomass on the new carriers and the reused carriers was 0.0171 g/carrier and 0.0314 g/carrier, respectively. It proves that the knotted cotton-threed carrier performs perfectly in homogening the immobilized mycelia to achieve the biomass renewal of P. chrysosporium in an immobilized growth system.

  19. Biodegradation of the Hexahydro-1,3,5-Trinitro-1,3,5-Triazine Ring Cleavage Product 4-Nitro-2,4-Diazabutanal by Phanerochaete chrysosporium

    OpenAIRE

    Fournier, Diane; Halasz, Annamaria; Spain, Jim; Spanggord, Ronald J.; Bottaro, Jeffrey C.; Hawari, Jalal

    2004-01-01

    Initial denitration of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) by Rhodococcus sp. strain DN22 produces CO2 and the dead-end product 4-nitro-2,4-diazabutanal (NDAB), OHCNHCH2NHNO2, in high yield. Here we describe experiments to determine the biodegradability of NDAB in liquid culture and soils containing Phanerochaete chrysosporium. A soil sample taken from an ammunition plant contained RDX (342 μmol kg−1), HMX (octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine; 3,057 μmol kg−1), MNX (hex...

  20. 载体吸附培养黄孢原毛平革菌(Phanerochaete chrysosporium)和云芝(Trametes versicolor) 对染料的脱色%Decolorization of dyes by Phanerochaete chrysosporium and Trametes versicolor growing on adsorptive carriers

    Institute of Scientific and Technical Information of China (English)

    张昊; 李学梅; 张文黎; 花清信; 苌道松; 徐颖; 李雪玲; 任四伟; 陈宣宇; 杨清香

    2012-01-01

    Phanerochaete chrysosporium and Trametes versicolor were cultured on different carriers for continuous decolorization, the performance of different Phanerochaete chrysosporium and Trametes versicolor were researched and compared. In this paper, Phanerochaete chrysosporium and Trametes versicolor were cultured in liquid containing spherical sawdust, corncob and peanut shells under oscillation conditions. During few days of cultivation, large amount of bacteria was grew and attached on the carrier surface in membranous and lump state. After consecutive 4 rounds of decolorization, Phanerochaete chrysosporium and Trametes versicolor growing on sawdust carrier had significant advantage both in continuous decolorization and producing enzymes, so the optimal adsorptive carrier was sawdust. After consecutive 2 rounds and 12 d of reactive black RB5 decolorization, the Phanerochaete chrysosporium culture with sawdust as adsorptive carrier could achieve the decolorization of 97 %; after three rounds of dye supplemented, the cultures also could remove nearly 96% of M-3BE and the maximum production of manganese dependant pcroxidase enzyme (MnP) and lignin peroxidase enzyme (LiP) was 611, 1 477 U/L. In the actual application, Phanerochaete chrysosporium and Trametes versicolor culture with sawdust as carriers should be added to dye wastewater treatment system to strengthen the biological treatment effect.%比较研究了不同载体吸附培养的黄孢原毛平革菌(Phanerochaete chrysosporium)和云芝(Trametes versicolor)对染料连续脱色的效果.结果表明:(1)白腐真菌黄孢原毛平革菌和云芝分别在含有球形的木屑、玉米芯和花生壳载体的液体环境中振荡培养,菌体以膜状或团状形式大量附着生长在载体表面.(2)连续4轮脱色过程中,不论黄孢原毛平革菌还是云芝,都是木屑为载体的培养液的持续脱色和产酶能力最好,宜选择木屑为载体.其中,木屑为载体的黄孢

  1. Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

    Science.gov (United States)

    Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

    2009-04-01

    The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month. PMID:18758969

  2. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes

    DEFF Research Database (Denmark)

    Manavalan, Arulmani

    2006-01-01

    Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production at...... 3.5-fold increase compared to control. Solid-state fermentation using wheat bran as substrate exhibit, maximum laccase activity of 48.89 ± 1.82 U/L on day 5, whereas it was only 30.21 ± 1.66 and 22.56 ± 1.22 U/L, respectively, in batch fermentation in a laboratory scale bioreactor and in static...... liquid culture on the same day. The molecular weight of partially purified laccase was found to be 62 kDa. The presence of isoforms as evidenced through Native PAGE reveals that, supplementation of inducers only accelerates the laccase production and are not at all involved in the isoform expressions....

  3. Diversité fonctionnelle des glutation transférases fongiques : caractérisation des classes Ure2p et GTT2 de Phanerochaete chrysosporium

    OpenAIRE

    Thuillier, Anne

    2013-01-01

    Phanerochaete chrysosporium est un champignon forestier faisant partie des organismes saprophytes capables de recycler la matière organique morte. Grâce à l’excrétion de nombreuses enzymes de dégradation, en particulier des lignine peroxydases, il est capable de décomposer la matière végétale dont la lignine, un polymère complexe de composés phénoliques très résistant. L’élimination de la lignine permet la libération des autres composants du bois tels que la cellulose et l’hémicellulose qui p...

  4. Catabolic fate of Streptomyces viridosporus T7A-Produced, acid precipitable polymeric lignin upon incubation with ligninolytic Streptomyces species and Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Degradation of ground and hot-water-extracted corn stover (Zea mays) lignocellulose by Streptomyces viridosporus T7A generates a water-soluble lignin degradation intermediate termed acid-precipitable polymeric lignin (APPL). The further catabolism of T7A-APPL by S. viridosporus T7A, S. badius 252, and S. setonii75Vi2 was followed for 3 weeks. APPL catabolism by Phanerochaete chrysosporium was followed in stationary cultures in a low-nitrogen medium containing 1% (wt/vol) glucose and 0.05% (wt/vol) T7A-APPL. Metabolism of the APPL was followed by turbidometric assay (600 nm) and by direct measurement of APPL recoverable from the medium. Accumulation and disappearance of soluble low-molecular-weight products of APPL catabolism were followed by gas-liquid chromatography and by high-pressure liquid chromatography, utilizing a diode array detector. Mineralization of a [14C-lignin]APPL was also followed. The percent 14C recovered as 14CO2, 14C-APPL, 14C-labeled water-soluble products, and cell mass-associated radioactivity, were determined for each microorganism after 1 and 3 weeks of incubation in bubbler tube cultures at 370C. P. chrysosporium evolved the most 14CO2, and S. viridosporus gave the greatest decrease in recoverable 14C-APPL. The results show that S. badius was not able to significantly degrade the APPL, while the other microorganisms demonstrated various APPL-degrading abilities

  5. Enhanced oxidation of benzo[a]pyrene by crude enzyme extracts produced during interspecific fungal interaction of Trametes versicolor and Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    Linbo Qian; Baoliang Chen

    2012-01-01

    The effects of interspecific fungal interactions between Trametes versicolor and Phanerochaete chrysosporium on laccase activity and enzymatic oxidation of polycyclic aromatic hydrocarbons (PAHs) were investigated.A deadlock between the two mycelia rather than replacement of one fungus by another was observed on an agar medium.The laccase activity in crude enzyme extracts from interaction zones reached a maximum after a 5-day incubation,which was significantly higher than that from regions of T.versicolor or P.chrysosporium alone.The enhanced induction of laccase activity lasted longer in half nutrition than in normal nutrition.A higher potential to oxidize benzo[a]pyrene by a crude enzyme preparation extracted from the interaction zones was demonstrated.After a 48 hr incubation period,the oxidation of benzo[a]pyrene by crude enzyme extracts from interaction zones reached 26.2%,while only 9.5% of benzo[a]pyrene was oxidized by crude extracts from T.versicolor.The oxidation was promoted by the co-oxidant 2,2'-azinobis-3-ethylbenzthiazoline-6-sulphonate diammonium salt (ABTS).These findings indicate that the application of co-culturing of white-rot fungi in bioremediation is a potential ameliorating technique for the restoration of PAH-contaminated soil.

  6. A Ca-alginate particle co-immobilized with Phanerochaete chrysosporium cells and the combined cross-linked enzyme aggregates from Trametes versicolor.

    Science.gov (United States)

    Li, Yanchun; Wang, Zhi; Xu, Xudong; Jin, Liqiang

    2015-12-01

    For improving stability of immobilized white-rot fungus to treat various effluents, Phanerochaete chrysosporium cells and the combined cross-link enzyme aggregates (combi-CLEAs) prepared from Trametes versicolor were co-immobilized into the Ca-alginate gel particles in this paper. The activity yields of obtained combi-CLEAs were 42.7% for lignin peroxidases (LiPs), 31.4% for manganese peroxidases (MnPs) and 40.4% for laccase (Lac), respectively. And their specific activities were 30.2U/g as combi-CLEAs-LiPs, 9.5 U/g as combi-CLEAs-MnPs and 28.4 U/g as combi-CLEAs-Lac. Further, the present of the combi-CLEAs in the particles extremely improved their ability to degrade the dyes. Compared to the immobilized Ph. chrysosporium without the combi-CLEAs, the co-immobilized particles enhanced the decolorized rate of Acid Violet 7 (from 45.2% to 93.4%) and Basic Fuchsin (from 12.1% to 67.9%). In addition, the addition of the combi-CLEAs improved the adaptability of the white-rot fungal particles to adverse environmental conditions. PMID:26413897

  7. OPTIMASI BIOKRAFT JAMUR Phanerochaete chrysosporium TERHADAP KOMPONEN KIMIA CAMPURAN BATANG DAN LIMBAH CABANG MANGIUM SEBAGAI BAHAN BAKU PULP

    Directory of Open Access Journals (Sweden)

    Devi Silsia

    2010-11-01

    Full Text Available Optimation biokraft of fungi P. Chrysosporium through elongated incubation time on mixed stem and branch waste mangium is a solution to solve the environmental pollution problem, low quality of pulp and limited raw material. Effect of P. Chrysosporium 10 % concentration and 45 days incubation time on pre research could not decrease lignin optimally and exstractive degradation had not occured yet. The aims of the study were to observe the effect of incubation time extension, and to determine the best incubation time of P. Chrysosporium applied at 10 % concentration based on the chemical component percentage, 45, 60 and 75 days on mixed stem and branch as raw material for pulp. Results showed that increasing incubation time decreased extractive and lignin content and increased holocelulosa and alpha celulosa content. Mixed stem and branch with 10% amount and 75 day incubation time of P. Chrysosporium gave the best results for raw material of pulp.

  8. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    International Nuclear Information System (INIS)

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag+ and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag+ to AgNPs

  9. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Zuo, Yanan [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li, Zhongwu; Yan, Ming [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Guo, Zhi; Huang, Zhenzhen; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-03-21

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag{sup +} and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag{sup +} to AgNPs.

  10. Azo dye degradation by Phanerochaete chrysosporium in the medium enriched with nitrogen in the presence of primary co-substrate

    OpenAIRE

    Marcus Vinicius Freire Andrade; Karla Mayara Lima da Silva; João Paulo da Silva Siqueira; Carlos Ronald Pessoa Wanderley; Rinaldo dos Santos Araújo; Gloria Marinho; Kelly Rodrigues

    2013-01-01

    This work sought to evaluate the ability of fungi Phanerochaete chryosporium to degrade congo red azo dye in batch reactor, evaluate the influence of glucose and wheat bran as co-substrates on the removal of the dye in the medium and investigate the influence of ammonium chloride, ammonium nitrate and ammonium sulfate as the inorganic nitrogen source for the process. Wheat bran was not effective satisfactorily for the removal of dye and organic matter had no desired effect for the removal of ...

  11. The putative endoglucanase PcGH61D from Phanerochaete chrysosporium is a metal-dependent oxidative enzyme that cleaves cellulose.

    Directory of Open Access Journals (Sweden)

    Bjørge Westereng

    Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.

  12. Heterologous Expression of Endo-1,4-beta-xylanaseA from Phanerochaete chrysosporium in Pichia pastoris

    OpenAIRE

    Huy, Nguyen Duc; Thiyagarajan, Saravanakumar; Son, Yu-Lim; Park, Seung-Moon

    2011-01-01

    The cDNA of endo-1,4-β-xylanaseA, isolated from Phaenerocheate chrysosporium was expressed in Pichia pastoris. Using either the intrinsic leader peptide of XynA or the α-factor signal peptide of Saccharomyces cerevisiae, xylanaseA is efficiently secreted into the medium at maximum concentrations of 1,946 U/L and 2,496 U/L, respectively.

  13. Azo dye degradation by Phanerochaete chrysosporium in the medium enriched with nitrogen in the presence of primary co-substrate

    Directory of Open Access Journals (Sweden)

    Marcus Vinicius Freire Andrade

    2013-10-01

    Full Text Available This work sought to evaluate the ability of fungi Phanerochaete chryosporium to degrade congo red azo dye in batch reactor, evaluate the influence of glucose and wheat bran as co-substrates on the removal of the dye in the medium and investigate the influence of ammonium chloride, ammonium nitrate and ammonium sulfate as the inorganic nitrogen source for the process. Wheat bran was not effective satisfactorily for the removal of dye and organic matter had no desired effect for the removal of color and organic matter and showed the lowest values of k2, 0.008 M-1.d-1and 0.0004 M-1.d-1, respectively. Glucose presented the best response with the highest final percentage of dye removal (97% and rate of dye removal (0.017 M-1.d-1, without adding an external source of nitrogen.

  14. Physiological fluxes and antioxidative enzymes activities of immobilized Phanerochaete chrysosporium loaded with TiO2 nanoparticles after exposure to toxic pollutants in solution.

    Science.gov (United States)

    Tan, Qiong; Chen, Guiqiu; Zeng, Guangming; Chen, Anwei; Guan, Song; Li, Zhongwu; Zuo, Yanan; Huang, Zhenzhen; Guo, Zhi

    2015-06-01

    Immobilized Phanerochaete chrysosporium loaded with TiO2 nanoparticles (PTNs) are novel high-value bioremediation materials for adsorbing cadmium and for degrading 2,4-dichlorophenol (2,4-DCP). The real-time changes in H(+) and O2 fluxes were measured using the noninvasive microtest technique (NMT). The H(+) influx increased after the addition of 2,4-DCP, and shifted to efflux following the addition of Cd(2+). The O2 flux decreased after the addition of both 2,4-DCP and Cd(2+). A larger Cd(2+) flux was immediately observed after exposure to 0.5mM Cd(2+) (-351.25 pmol cm(-2) s(-1)) than to 0.1 mM Cd(2+) (-107.47 pmol cm(-2) s(-1)). The removal of Cd(2+) by the PTNs increased more after treatment with the 0.5 mM exposure solution (27.6 mg g(-1)) than with the 0.1 mM exposure solution (3.49 mg g(-1)). The enzyme activities were analyzed to review the antioxidative defense system of PTNs in a solution containing various concentrations of Cd(2+). The activities of the coenzyme nicotinamide adenine dinucleotide (NADH) oxidase as well as the enzyme catalase (CAT) plateaued at 6.5 U g(-1) FW and 9.7 U g(-1) FW, respectively, after exposure to 0.25 mM Cd(2+). The activity of superoxide dismutase (SOD) increased gradually in solutions containing 0.1-0.6 mM Cd(2+), and eventually reached a maximum (68.86 U g(-1) FW). These results illustrate how the antioxidative defense system and the physiological fluxes of PTNs respond to the stress caused by toxic pollutants. PMID:25638529

  15. Chemical, biophysical and morphological changes of native and treated Phanerochaete chrysosporium pellets for dye bio sorption application

    International Nuclear Information System (INIS)

    The pretreatment of fungal biomass in general offers an increase in the bio sorptive capacity according to the type of treatment used. Phosphoric acid and heat were the pretreatments chosen for their eminent removal of Brilliant Green (BG) from aqueous solution using waste Phanerocheate chrysosporium pellets. The results indicate that pretreatment with phosphoric acid resulted in increase in removal capacity by 92% in 30 minutes compared to 72.16 and 46.3% for heat treated and native pellets, respectively. The bio sorptive capacities of phosphoric acid and heat treatment were 7.46 and 4.1, respectively compared to 2.63 mg dye/g biomass for native pellets. The dielectric properties of the fungal wall show that both the capacitance and conductance of phosphoric acid pretreated pellets are higher than those for heat treated or native pellets. Morphological changes and FT-IR reflect noticeable cell wall changes. Desorption experiments suggest that chemisorption could be considered as the primary mechanism for dye binding to phosphoric acid and heat pretreated pellets, while physisorption could be the main mechanism for dye binding to native pellets. The study represents an in depth investigation of waste native and treated fungal pellets as possible low-cost bio sorbents

  16. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  17. (Physiology and molecular biology of extracellular peroxidases, H sub 2 O sub 2 -generating system and deregulated mutants of Phanerochaete chrysosporium)

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element and was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.

  18. [Physiology and molecular biology of extracellular peroxidases, H{sub 2}O{sub 2}-generating system and deregulated mutants of Phanerochaete chrysosporium]. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    1992-07-01

    We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element and was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.

  19. BIODEGRADATION OF ENVIRONMENTAL POLLUTANTS BY THE WHITE ROT FUNGUS PHANEROCHATETE CHRYSOSPORIUM: INVOLVEMENT OF THE LIGNIN DEGRADING SYSTEM

    Science.gov (United States)

    The white-rot fungus Phanerochaete chrysosporium has the ability to degrade's wide variety of structurally diverse organic compounds, including a number of environmentall3 persistent organopollutants. he unique biodegradative abilities of this fungus appears to be dependent upon ...

  20. 黄孢原毛平革菌合成的木质素过氧化物酶、锰过氧化物酶及其菌球在染料脱色过程中的作用%Roles of Lignin Peroxidase, Manganese Peroxidase and Pellet of Phanerochaete chrysosporium in Decoloration of Dyes

    Institute of Scientific and Technical Information of China (English)

    章燕芳; 李华钟; 华兆哲; 陈坚

    2002-01-01

    在黄孢原毛平革菌(Phanerochaete chrysosporium)限氮浸没式培养中,获得了含木质素过氧化物酶(LiP)和锰过氧化物酶(MnP)、只含LiP或MnP以及无LiP和MnP的4种培养物,考察了LiP,MnP及菌球在染料脱色过程中的作用. 结果表明,4种培养物对6种染料都有明显的脱色效果,甲基橙、橙I、次甲基蓝脱色率在90(左右,刚果红、直接湖蓝脱色率在80%左右,结晶紫脱色率在60%左右. 无酶情况下染料的脱色主要是菌球的吸附,有酶情况下染料的脱色主要是酶的降解. 菌球在脱色过程中除了吸附染料外,还起到提供H2O2和藜芦醇的作用,促进了染料的降解.

  1. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi.

    Science.gov (United States)

    Riley, Robert; Salamov, Asaf A; Brown, Daren W; Nagy, Laszlo G; Floudas, Dimitrios; Held, Benjamin W; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika A; Sun, Hui; LaButti, Kurt M; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E; Pisabarro, Antonio G; Walton, Jonathan D; Blanchette, Robert A; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David S; Grigoriev, Igor V

    2014-07-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white-rot/brown-rot classification paradigm, we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically informed principal-components analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white-rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown-rot fungi. Our results suggest a continuum rather than a dichotomy between the white-rot and brown-rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay. PMID:24958869

  2. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  3. Improving xylitol production through recombinant expression of xylose reductase in the white-rot fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Hirabayashi, Sho; Wang, Jianqiao; Kawagishi, Hirokazu; Hirai, Hirofumi

    2015-07-01

    We generated an expression construct consisting of the xylose reductase (XR) gene (xr) from Phanerochaete chrysosporium. Transformant X7 exhibited increased xylitol production and markedly higher XR activities than the wild-type strain. RT-PCR analysis demonstrated that the increased XR activity was associated with constant expression of the recombinant xr gene. PMID:25547244

  4. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  5. Characterization of lignin and Mn peroxidases from Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    1991-01-01

    Long-term objectives are to elucidate the role and mechanism of the various isozymes in lignin biodegradation. Work is described on electrochemical studies on lignin and Mn peroxidases. This study was performed to investigate the structural aspects which confer the lignin and Mn peroxidases with their high reactivity. The experimentally determined redox potential of the Fe{sup 3+}/Fe{sup 2+} couple for the lignin peroxidase isozymes H1, H2, H8 and H10 are very similar, near-130 mV. The redox potential for the Mn peroxidase isozymes H3 and H4 are similar to each other ({minus}88 mV and {minus}95 mV, respectively) and are more positive than the lignin peroxidases. The higher redox potential for the Fe{sup 3+}/Fe{sup 2+} couple is consistent with the heme active site of these fungal peroxidases being more electron deficient. To investigate the accessibility of the heme active site to the substrate which is oxidized (veratryl alcohol and Mn (II)), we investigated whether these substrates had any affect on the redox potential of the heme. The E{sub m7} value for lignin and Mn peroxidases are not affected by their respective substrates, veratryl alcohol and Mn (II). These results suggest that substrates do not directly interact with the ferric heme-iron as axial ligands. This is consistent with the present model for peroxidase catalysis. Suicide inhibitor (1) and nmr studies (2) indicate that the heme-iron of horseradish peroxidase (HRP) is not fully accessible to bulky substrates occur at the periphery of the heme.

  6. Biodegradation of bioaccessible textile azo dyes by Phanerochaete chrysosporium

    OpenAIRE

    Martins, Maria Adosinda; Ferreira, Isabel C.F.R.; Santos, Isabel; Queiroz, Maria João R. P.; Lima, Nelson

    2000-01-01

    Azo dyes are important chemical pollutants of industrial origin. Textile azo dyes with bioaccessible groups for lignin degrading fungi, such as 2-methoxyphenol (guaiacol) and 2,6-dimethoxyphenol (syringol), were synthesised using different aminobenzoic and aminosulphonic acids as diazo components. The inocula of the best biodegradation assays were obtained from a pre-growth medium (PAM), containing one of the synthesised dyes. The results of the dye biodegradation assays were eval...

  7. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  8. Enzymes of Saprotrophic Basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    Amsterdam: Academic Press, 2007, s. 19-41. ISBN 978-0-12-374185-1 R&D Projects: GA AV ČR KJB600200516; GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : saprotrophic basidiomycetes * extracellular enzymes * polymers Subject RIV: EE - Microbiology, Virology

  9. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    Directory of Open Access Journals (Sweden)

    García Torres Angélica María

    2003-06-01

    Full Text Available La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de éstas es de gran importancia para la degradación de diversas sus­tancias recalcitrantes que muestran similitudes estructurales con la lignina como son los PAH's, PCB's, DDT, colo­rantes azoicos, etc. El trabajo de investigación se realizó utilizando reactores a nivel de matraces y teniendo como sustrato siete diferentes desechos agroindustriales de la región de Santander ( de los cuales se desconoce su pro­ducción de enzimas lignolíticas: tuza de mazorca, bagazo de caña, hoja de pina, cacota de cacao, cereza de café, tamo de arroz, salvado de trigo y paja de trigo. El objetivo general fue evaluar la capacidad de los Basidiomycetes: Trametes versicolor, Pleurotus floridae y Phanerochaete chrysosporium de crecer sobre los desechos agroindustriales y producir las enzimas lignolíticas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; mediante la técnica de fermentación sólida. Se encontró que la producción de enzimas lignolíticas en los sustratos mencionados fue sensible a la concentración de azúcares reductores, condiciones de pH, contenidos de humedad y, dependiente del tipo de inductor presente en el medio de cultivo. El sustrato que presentó una mejor producción de Lacasa y Manganeso-peroxidasa fue la paja de trigo. Se observó la producción de Lignina-peroxidasa en cultivos de tuza de mazorca y salvado de trigo. Palabras clave: enzimas inducibles; Lacasa; Mn-peroxidasa; Li-peroxidasa; desechos agroindustriales; represi

  10. [Antiviral properties of basidiomycetes metabolites].

    Science.gov (United States)

    Avtonomova, A V; Krasnopolskaya, L M

    2014-01-01

    The data on the antiviral action of the Ganoderma lucidum, Lentinus edodes, Grifola frondosa, Agaricus brasiliensis and other basidiomycetes metabolites are summurized. The metabolites of these species of basidiomycetes exhibit a direct antiviral effect on herpes simplex virus types I and II, human immunodeficiency virus (HIV), hepatitis B virus, vesicular stomatitis virus, influenza virus, Epstein-Barr virus, and others. Moreover, metabolites of basidiomycetes increased antiviral immunity. PMID:25975107

  11. Activity Regulation of Lignin Peroxidase from Phanerochaete chrysosporium in Nonionic Reversed Micellar Medium

    Institute of Scientific and Technical Information of China (English)

    Dan WANG; Xi Rong HUANG; Cai Xia LIU; Yue Zhong LI; Yin Bo QU; Pei Ji GAO

    2005-01-01

    The activity of lignin peroxidase (LiP) in reversed micelles of polyoxyethylene lauryl ether (Brij30) changed with the molar ratio of water to the surfactant and the denaturant concentration of guanidinium chloride. At low water contents the activity of LiP could be enhanced by the denaturant at moderate concentration. This phenomenon, together with the spectral characteristics of the intrinsic fluorescence of LiP, suggested that the conformation of the active center of LiP was flexible.

  12. Oxidative cleavage of a phenolic diarylpropane lignin model dimer by manganese peroxidase from Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    In the presence of MnII and H2O2, homogeneous manganese peroxidase oxidized 1-(3,5-dimethoxy-4-hydroxyphenyl)-2-(4-methoxyphenyl)-1,3-dihydroxypropane (I) to yield 1-(3,5-dimethoxy-4-hydroxyphenyl)-2-(4-methoxyphenyl)-1-oxo-3-hydroxypropane (II), 2,6-dimethoxy-1,4-benzoquinone (III), 2,6-dimethoxy-1,4-dihydroxybenzene (IV), 1-(4-methoxyphenyl)-1-oxo-2-hydroxyethane (V), 1-(4-methoxyphenyl)-1,2-dihydroxyethane (VI), syringaldehyde (VIII), and 2-(4-methoxyphenyl)-3-hydroxypropanal (IX). Chemically prepared manganese(III) malonate catalyzed the same reactions. Oxidation of I in H218O under argon resulted in >80% incorporation of 18O into the phenylglycol VI, the hydroquinone IV, and the quinone III. Oxidation of I in H218O under aerobic conditions resulted in 40% incorporation of 18O into VI but no 18O incorporation into V. Finally, oxidation of I under 18O2 resulted in 89% and 28% incorporation of 18O into V and VI, respectively. These results are explained by mechanisms involving the one-electron oxidation of the substrate I by enzyme-generated MnIII to produce a phenoxy radical intermediate I'. Subsequent Cα-Cβ bond cleavage of the radical intermediate yields syringaldehyde (VIII) and a C6-C2 benzylic radical. Syringaldehyde is oxidized by MnIII in several steps to a cyclohexadiene cation intermediate I double-prime, which is attacked by water to yield the benzoquinone III. The C6-C2 radical is scavenged by O2 to form a peroxy radical that decomposes to V and VI. In these reactions, MnIII generated by manganese peroxidase catalyzes both formation of the substrate phenoxy radical and oxidation of carbon-centered radical intermediates, to yield reactive cations

  13. Characterization of lignin and Mn peroxidases from Phanerochaete chrysosporium. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-31

    Long-term objectives are to elucidate the role and mechanism of the various isozymes in lignin biodegradation. Work is described on electrochemical studies on lignin and Mn peroxidases. This study was performed to investigate the structural aspects which confer the lignin and Mn peroxidases with their high reactivity. The experimentally determined redox potential of the Fe{sup 3+}/Fe{sup 2+} couple for the lignin peroxidase isozymes H1, H2, H8 and H10 are very similar, near-130 mV. The redox potential for the Mn peroxidase isozymes H3 and H4 are similar to each other ({minus}88 mV and {minus}95 mV, respectively) and are more positive than the lignin peroxidases. The higher redox potential for the Fe{sup 3+}/Fe{sup 2+} couple is consistent with the heme active site of these fungal peroxidases being more electron deficient. To investigate the accessibility of the heme active site to the substrate which is oxidized [veratryl alcohol and Mn (II)], we investigated whether these substrates had any affect on the redox potential of the heme. The E{sub m7} value for lignin and Mn peroxidases are not affected by their respective substrates, veratryl alcohol and Mn (II). These results suggest that substrates do not directly interact with the ferric heme-iron as axial ligands. This is consistent with the present model for peroxidase catalysis. Suicide inhibitor (1) and nmr studies (2) indicate that the heme-iron of horseradish peroxidase (HRP) is not fully accessible to bulky substrates occur at the periphery of the heme.

  14. Degradation of polychlorinated biphenyls by extracellular enzymes of Phanerochaete chrysosporium produced in a perforated plate bioreactor

    Czech Academy of Sciences Publication Activity Database

    Krčmář, P.; Kubátová, Alena; Votruba, Jaroslav; Erbanová, Pavla; Novotný, Čeněk; Šašek, Václav

    1999-01-01

    Roč. 15, - (1999), s. 237-242. ISSN 0959-3993 R&D Projects: GA AV ČR IAA6301501; GA AV ČR KSK2020602 Grant ostatní: Agency for International Development(US) TA-MOU-95-C15-190 Institutional research plan: CEZ:A53/98:Z5-020-9ii Subject RIV: EE - Microbiology, Virology Impact factor: 0.570, year: 1999

  15. Mineralization of sulfonated azo dyes and sulfanilic acid by Phanerochaete chrysosporium and Streptomyces chromofuscus.

    OpenAIRE

    Paszczynski, A; Pasti-Grigsby, M B; Goszczynski, S; Crawford, R L; Crawford, D. L.

    1992-01-01

    Five 14C-radiolabeled azo dyes and sulfanilic acid were synthesized and used to examine the relationship between dye substitution patterns and biodegradability (mineralization to CO2) by a white-rot fungus and an actinomycete. 4-Amino-[U-14C]benzenesulfonic acid and 4-(3-sulfo-4-aminophenylazo)-[U-14C]benzenesulfonic acid were used as representative compounds having sulfo groups or both sulfo and azo groups. Such compounds are not known to be present in the biosphere as natural products. The ...

  16. A series of Xerophilic Chrysosporium species

    DEFF Research Database (Denmark)

    Skou, Jens-Peder

    1992-01-01

    Xerophilic Chrysosporium species related to C. farinicola were often isolated from uneaten provisions (pollen-and-nectar mixture) of mason bees (Osmia spp.). The fungi have an optimal growth rate on media which are 2 to 3 molar in regard to glucose, exhibit some growth up to 3.6 molar glucose, and...

  17. Isolation of Saprophytic Basidiomycetes from Soil

    OpenAIRE

    Thorn, R.G.; Reddy, C. A.; Harris, D.; Paul, E. A.

    1996-01-01

    A method with the combined advantages of soil particle washing, selective inhibitors, and an indicator substrate was developed to isolate saprophytic basidiomycetes from soil. Organic particles were washed from soil and plated on a medium containing lignin, guaiacol, and benomyl, which reduced mold growth and allowed detection of basidiomycetes producing laccase or peroxidase. The 64 soil samples yielded 67 basidiomycete isolates, representing 51 groups on the basis of morphology and physiolo...

  18. Primary Cutaneous Chrysosporium Infection following Ear Piercing: A Case Report

    Directory of Open Access Journals (Sweden)

    Poonkiat Suchonwanit

    2015-07-01

    Full Text Available Chrysosporium is a large genus of saprophytic fungi that is commonly found in the soil. Infection caused by this organism is rare in humans and typically occurs in immunocompromised patients. Primary cutaneous Chrysosporium infection is relatively rare and has been reported in a heart transplant patient. The prognosis is usually favorable, but very poor in the setting of persistent profound immunosuppression. We herein report a case of primary cutaneous Chrysosporium infection following ear piercing in an immunocompetent patient. It is important for clinicians to consider this condition in patients with slow-onset skin and soft tissue infection following cutaneous injury, even in an immunocompetent setting.

  19. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  20. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  1. Oxidation-reduction potentials and ionization states of extracellular peroxidases from the lignin-degrading fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    The oxidation-reduction potentials of lignin peroxidase isozymes H1, H2, H8, and H10 as well as the Mn-dependent peroxidase isozymes H3 and H4 are reported. The potentiometric titrations involving the ferrous and ferric states of the enzyme had Nernst plots indicating single-electron transfer. The Em7 values of lignin peroxidase isozymes H1, H2, H8, and H10 are -142, -135, -137, and -127 mV versus standard hydrogen electrode, respectively. The Em7 values for the Mn-dependent peroxidase isozymes H3 and H4 are -88 and -93 mV versus standard hydrogen electrode, respectively. The midpoint potential of H1, H8, and H4 remained unchanged in the presence of their respective substrates, veratryl alcohol and Mn(II). The midpoint potential between the ferric and ferrous forms of isozymes H1 and H4 exhibited a pH-dependent change between pH 3.5 and pH 6.5. These results indicate that the reductive half-reaction of the enzymes is the following: ferric peroxidase + le- + H+----ferrous peroxidase. Above pH 6.5, the effect of pH on the midpoint potential is diminished and indicates that an ionization with an apparent pKa equal to approximately 6.6-6.7 occurs in the reduced form of the enzymes. A heme-linked ionization group in the ferrous form of the enzymes was confirmed by studying the effect of pH on the absorption spectra of isozymes H1 and H4. These spectrophotometric pH titration experiments confirmed the electrochemical results indicating pKa values of 6.59 and 6.69 for reduced isozymes H1 and H4, respectively. These results indicate the presence of a heme-linked ionization of an amino acid in the reduced form of the lignin peroxidase isozymes similar to that of other plant peroxidases

  2. Decolourization potential of white-rot fungus Phanerochaete chrysosporium on synthetic dye bath effluent containing Amido black 10B

    OpenAIRE

    Senthilkumar, S.; M. Perumalsamy; H. Janardhana Prabhu

    2014-01-01

    Synthetic azo dyes are extensively used in textile industry and are not easily degraded into the environment due to their complex structure. Due to the low degree of fixation of these dyes to fabrics, more than 10–15% of the dye does not bind to fabrics during colour processing and release into water bodies as effluent cause serious environmental pollution. White-rot fungus is found to be capable of degrading lignin which has a complex structure similar to azo dyes. In this study, the decolou...

  3. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  4. Biological activities of selected basidiomycetes from Yemen.

    Science.gov (United States)

    Al-Fatimi, M; Schröder, G; Kreisel, H; Lindequist, U

    2013-03-01

    In a previous paper we demonstrated the results of biological screening of Yemeni basidiomycetes. The present study was aimed to investigate the antimicrobial and the antioxidant activity of further basidiomycetes collected in Yemen. Dichloromethane, methanol and aqueous extracts of the fruiting bodies of 25 species were screened in vitro for their antibacterial activities against three Gram-positive bacteria (Staphyloccocus aureus, Bacillus subtilis, Micrococcus flavus) and two Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa), against six human fungal pathogens (Candida albicans, Candida krusei, Aspergillus fumigatus, Mucor sp., Microsporum gypseum, Trichophyton mentagrophytes) and against one non human pathogenic fungus (Candida maltosa). The results indicated that 75 extracts exhibited activity against one or more of the bacteria. The methanol extracts of Agaricus cf. bernardii, Agrocybe pediades, Chlorophyllum molybdites, Coriolopsis polyzona, Ganoderma xylonoides, Pycnoporus sanguineus, Trametes lactinea and Trametes cingulata showed activity against all tested bacteria. The highest antibacterial activity was exhibited by methanol extracts from Chlorophyllum molybdites, Ganoderma xylonoides and Trametes cingulata and Agaricus cf. bernardii, Agrocybe pediades, Coriolopsis polyzona, Pycnoporus sanguineus and Trametes lactinea. The methanol extracts of Chlorophyllum molybdites, Ganoderma xylonoides and Pycnoporus sanguineus showed considerable antifungal activities against the tested fungal strains. Strong antioxidative effects employing the DPPH assay were exhibited by methanol extracts from Chlorophyllum molybdites, Ganoderma xylonoides, Hexagonia velutina, Pycnoporus sanguineus, Trametes lactinea and Trametes cingulata. Our previous and presented studies about 48 basidiomycetes collected in Yemen provide evidence that basidiomycetes from the Arabic region so far should attract more attention as potential source for new biologically active

  5. Effects of Homologous Expression of 1,4-Benzoquinone Reductase and Homogentisate 1,2-Dioxygenase Genes on Wood Decay in Hyper-Lignin-Degrading Fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Mori, Toshio; Koyama, Genki; Kawagishi, Hirokazu; Hirai, Hirofumi

    2016-10-01

    We investigated the function of 1,4-benzoquinone reductase (BQR)- and homogentisate 1,2-dioxygenase (HGD)-like genes in wood degradation by Phanerochaete sordida YK-624, which exhibits high ligninolytic activity and selectivity. We determined homologous expression in the genomic and cDNA sequences of BQR- and HGD-like genes in P. sordida YK-624 (PsBQR and PsHGD). Both genes shared high homology (≥90 % amino acid sequence similarity) with the corresponding genes in Phanerochaete chrysosporium. These genes were co-transformed with a reporter gene into an uracil auxotrophic mutant of P. sordida YK-624. The PsBQR and PsHGD co-transformants exhibited lower holocellulolytic activity and higher ligninolytic selectivity than the control transformants. In liquid culture with vanillin, both co-transformants significantly accelerated vanillin degradation. Thus, we suggest that the rapid metabolism of low-molecular weight lignin fragments, due to the homologous expression of BQR- and HGD-like genes, affects quinone redox cycling to produce hydroxyl radicals, thereby decreasing holocellulose degradation and increasing ligninolytic selectivity. PMID:27363425

  6. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2

  7. Lignicolous Basidiomycetes as Valuable Biotechnological Agents

    Directory of Open Access Journals (Sweden)

    Cristiana-Virginia Petre

    2014-10-01

    Full Text Available Lignicolous basidiomycetes are highly specialized organisms that are capable of degrading lignin, one of the most abundant and resistant organic compounds. Through their enzymes and secondary metabolites, these fungi have a great potential that can be successfully used in various biotechnological processes, ranging from mycoremediation of different pollutants and isolation of bioactive molecules with applications in the pharmacological industry and agriculture, as biocontrol agents of phytopathogens.

  8. Fatal cutaneous mycosis in tentacled snakes caused by the chrysosporium anamorph of nannizziposis vriesii

    DEFF Research Database (Denmark)

    Bertelsen, Mads Frost; Crawshaw, Graham J.; Sigler, Lynne; Smith, Dale A.

    2005-01-01

    The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes......The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes...

  9. [Morphology and structural peculiarities of Basidiomycetes pathogens].

    Science.gov (United States)

    Boĭko, O A; Shevchenko, T P; Boĭko, A A

    2013-01-01

    The materials of studies of morphology and structural peculiarities of viruses, fungi and bacteria, which affect Basidiomycetes under biotechnology process and nature biocenosis conditions are given. The analysis of infection development in button mushroom (Agaricus bisporus) (J.Lge) Imbach and in oyster mushroom (Pleurotus ostreatus Kumm.), which served as model objects in the experiments of various levels of complexity has been carried out. Other kinds of edible and medicinal mushrooms, which were a source of biochemical fractions to form biologicals were investigated. PMID:23866587

  10. Degradation of cellulose by basidiomycetous fungi.

    Science.gov (United States)

    Baldrian, Petr; Valásková, Vendula

    2008-05-01

    Cellulose is the main polymeric component of the plant cell wall, the most abundant polysaccharide on Earth, and an important renewable resource. Basidiomycetous fungi belong to its most potent degraders because many species grow on dead wood or litter, in environment rich in cellulose. Fungal cellulolytic systems differ from the complex cellulolytic systems of bacteria. For the degradation of cellulose, basidiomycetes utilize a set of hydrolytic enzymes typically composed of endoglucanase, cellobiohydrolase and beta-glucosidase. In some species, the absence of cellobiohydrolase is substituted by the production of processive endoglucanases combining the properties of both of these enzymes. In addition, systems producing hydroxyl radicals based on cellobiose dehydrogenase, quinone redox cycling or glycopeptide-based Fenton reaction are involved in the degradation of several plant cell wall components, including cellulose. The complete cellulolytic complex used by a single fungal species is typically composed of more than one of the above mechanisms that contribute to the utilization of cellulose as a source of carbon or energy or degrade it to ensure fast substrate colonization. The efficiency and regulation of cellulose degradation differs among wood-rotting, litter-decomposing, mycorrhizal or plant pathogenic fungi and yeasts due to the different roles of cellulose degradation in the physiology and ecology of the individual groups. PMID:18371173

  11. Basidiomycete cryopreservation on perlite: Evaluation of a new method

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    2006-01-01

    Roč. 52, - (2006), s. 446-453. ISSN 0011-2240 Institutional research plan: CEZ:AV0Z50200510 Keywords : cryopreservation * perlite * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.162, year: 2006

  12. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  13. Survey of Basidiomycets and Insect Infested Roadside Trees

    OpenAIRE

    Oga, Shoji; Nomura, Shuhei; Inoue, Susumu

    1995-01-01

    Some biotic and abiotic factors causal to the deterioration of roadside trees were surveyed in Fukuoka City on 23 species planted along 22 main streets. Various fruit bodies of basidiomycete, imperfect fungi and bacterial canker disease as well as insect pests were detected. Forty-six fungi strains were obtained in this survey. Aphyllophorales basidiomycete was the most abundant fungi found in surveyed raodside trees. Fruit bodies of 7 edible mushroom species were identified on the scaffold l...

  14. PRODUCTION OF EXTRACELLULAR KERATINASE BY CHRYSOSPORIUM TROPICUM AND TRICHOPHYTON AJELLOI

    Directory of Open Access Journals (Sweden)

    Jaroslava Kačinová

    2014-02-01

    Full Text Available Keratinous wastes constitute a troublesome environmental contaminant that is produced in large quantities in companies processing of poultry and their further use has ecological significance. We can use for degradation of keratinous wastes enzymes or strains, which produce these enzymes. The aim of this study was isolation of keratinophilic fungi from the soil samples and optimalization of culture conditions of keratinase producing strains in vitro. For the isolation of our strains, we used hair - baiting method. From the all isolated strains, we used for other screening Chrysosporium tropicum (JK39 and Trichophyton ajelloi (JK82. Production of keratinase we monitored with different time of cultivation (7th, 14th, 21th days, sources of carbon (glucose, fructose, mannitol, sucrose, concentration of carbon sources (1%, 2% and cultivation temperature (20, 25, 30, 37ºC. Keratinase production was studied in a liquid medium containing chicken feathers as a source of keratin. We recorded the maximum production of keratinase (10.51 KU/ml by Chrysosporium tropicum on 21th day of incubation with 1% glucose at 25ºC.

  15. Screening of Brazilian basidiomycetes for antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Rosa Luiz Henrique

    2003-01-01

    Full Text Available A total of 103 isolates of basidiomycetes, representing 84 species from different Brazilian ecosystems, were evaluated for their antifungal and antibacterial activity in a panel of pathogenic and non-pathogenic microorganisms. Tissue plugs of the fruiting bodies were cultivated in liquid media and the whole culture extracted with ethyl acetate. Crude extracts from Agaricus cf. nigrecentulus, Agrocybe perfecta, Climacodon pulcherrimus, Gloeoporus thelephoroides, Hexagonia hydnoides, Irpex lacteus, Leucoagaricus cf. cinereus, Marasmius cf. bellus, Marasmius sp., Nothopanus hygrophanus, Oudemansiella canarii, Pycnoporus sanguineus, Phellinus sp., and Tyromyces duracinus presented significant activity against one or more of the target microorganisms. Eight isolates were active only against bacteria while three inhibited exclusively the growth of fungi. Two extracts presented wide antimicrobial spectrum and were active against both fungi and bacteria. Differences in the bioactivity of extracts obtained from isolates from the same species were observed.

  16. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  17. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described. PMID:19341364

  18. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  19. Penggunaan Bungkil Inti Sawit Fermentasi (Phanerochaete chrysosporium) dan Suplementasi Mineral Zn dalam Ransum terhadap Performans Broiler Umur 0-6 Minggu

    OpenAIRE

    Afrianti, Eva Rustina

    2011-01-01

    This research conducted in Biological Veterinary Laboratory of Animal Husbandry Departement, Faculty of Agriculture North Sumatra University, Prof A. Sofyan no 3 Medan, at December 2009 until January 2010. The experiment objective to know the usage palm kernel cake fermentation and supplementation of mineral Zincum in some levels in feed to feed consumption, increase average weight gain, and feed conversion ratio broiler 0-6 weeks of age. This research was using factorial complete...

  20. Degradation of humic acids by letter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Trögl, Josef; Steffen, K.; Heeg, K.; Hofrichter, M.; Baldrian, Petr

    Praha: ČSSM, 2007, s. 105-108. [Kongres Československé společnosti mikrobiologické /24./. Liberec (CZ), 02.10.2007-05.10.2007] R&D Projects: GA ČR GA526/05/0168 Institutional research plan: CEZ:AV0Z50200510 Keywords : saprotrophic basidiomycetes Subject RIV: EE - Microbiology, Virology

  1. Oxidases and peroxidases of saprotrophic basidiomycetes decomposing leaf litter

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Bittner, B.; Šnajdr, Jaroslav; Hofrichter, M.; Baldrian, Petr

    Barcelona : Verlag, 2007, s. 15-15. [COST Action 868 – Biotechnical functionalisation of renewable polymeric materials. Sitges (ES), 14.04.2007-17.04.2007] R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes Subject RIV: EE - Microbiology, Virology

  2. Enzyme Profiles of Basidiomycete Strains Growing on Different Wood Substrates

    Czech Academy of Sciences Publication Activity Database

    Nerud, František; Homolka, Ladislav; Lisá, Ludmila

    Riga : Riga centre, 2007, s. 44-44. [International conference Biodeterioration of Wood and Wood Products. Riga (LT), 26.09.2007-29.09.2007] R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete Subject RIV: EE - Microbiology, Virology

  3. FIELD EVALUATION OF THE LIGNIN-DEGRADING FUNGUS PHANEROCHAETE SORDIDA TO TREAT CREOSOTE-CONTAMINATED SOIL

    Science.gov (United States)

    A field study to determine the ability of selected lignin-degrading fungi to remediate soil contaminated with creosote was performed at a wood-treating facility in south central Mississippi in the autumn of 1991. The effects of solid-phase bioremediation with Phanerochaete sordid...

  4. BIODEGRADATION OF ENVIRONMENTAL POLLUTANTS BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM: INVOLVEMENT OF THE LIGNIN DEGRADING SYSTEM

    Science.gov (United States)

    The white-rot fungus Phanrochaete chrysosporium has the ability to degrade a wide variety of structurally diverse organic compounds, including a number of environmentally persistent organopollutants. The unique biodegradative abilities of this fungus appears to be depend...

  5. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    International Nuclear Information System (INIS)

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  6. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    Energy Technology Data Exchange (ETDEWEB)

    Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.

    2009-07-01

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  7. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    proteins. Several TCS proteins are highly conserved among all the basidiomycetes, and other TCS proteins appear to be specific to particular species of basidiomycetes. Moreover, some species appear to have developed a unique histidine kinase group with unusual domain architecture, the Dual-histidine...

  8. Development of novel fermentation systems for the production of nonalcoholic beverages with basidiomycetes

    OpenAIRE

    Zhang, Yanyan

    2015-01-01

    Basidiomycetes represent the highest developed class of fungi. They are able to synthesize pharmacological relevant secondary metabolites, natural flavor compounds, and highly sought after enzymes. Because of their biochemical potential, basidiomycetes are ideal tools for the food industry. With the recent worldwide declining consumption of beer, breweries are eagerly searching for innovative nonalcoholic fermented beverages to compensate for this negative trend. Different from microorgan...

  9. BIOSORPTION OF TEXTILE DYE USING IMMOBILIZED BACTERIAL (PSEUDOMONAS AERUGINOSA AND FUNGAL (PHANEROCHATE CHRYSOSPORIUM CELLS

    Directory of Open Access Journals (Sweden)

    Natarajan Saravanan

    2013-01-01

    Full Text Available Wastewater containing dyes presents a serious problem due to its high toxicity which leads to creating enormous environmental pollution and ecological hazards. Therefore the removal of the high stable dyes from the textile effluents is of major importance. The purpose of this study is to remove the reactive dye Procion Blue 2G from textile dye solution by biosorption process using immobilized cells of Pseudomonas aeruginosa and Phanerochate chrysosporium. It was found that maximum dye uptake is 1.648 mg g-1 of bead for P. aeruginosa and it is 1.242 mg g-1 of bead for P. chrysosporium. Both the results are derived from higher initial dye concentration (100 mg L-1 and high cell concentration (in terms of volume of inoculum 20 mL and at low mass of biosorbent (5 g of bead. Comparatively better results are produced by the beads having the cells of P. aeruginosa than P. chrysosporium. Further, due to the cell immobilization, both the cell beads can be utilized repeatedly in continuous reactors by selecting suitable eluent in industrial scale with the advantage of avoiding wash out of cells.

  10. Dermatomycosis in a pet inland bearded dragon (Pogona vitticeps) caused by a Chrysosporium species related to Nannizziopsis vriesii.

    Science.gov (United States)

    Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J

    2009-08-01

    A Chrysosporium sp. related to Nannizziopsis vriesii was isolated in pure culture from squames and biopsies of facial lesions in a pet inland bearded dragon (Pogona vitticeps) in Spain. The presence in histological sections of morphologically consistent fungal elements strongly incriminates this fungus as the aetiological agent of infection. Lesions regressed following treatment with oral ketoconazole and topical chlorhexidine and terbinafine until the lizard was lost to follow up 1 month later. The ITS-5.8S rRNA gene of the isolate was sequenced and a search on the GenBank database revealed a high match with the sequences of two Chrysosporium sp. strains recently isolated from green iguanas (Iguana iguana) with dermatomycosis, also in Spain. Phylogenetic analysis of the sequences revealed that all these strains are related to N. vriesii. This is the first report of dermatomycoses caused by a Chrysosporium species related to N. vriesii in a bearded dragon outside North America. PMID:19659541

  11. Viability of Basidiomycete Strains after Cryopreservation: Compatison of Ewo Different Freezing Protocols

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    2003-01-01

    Roč. 48, č. 2 (2003), s. 219-226. ISSN 0015-5632 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycete strains * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.857, year: 2003

  12. Сultivation Features of Higher Basidiomycetes Trametes zonatus for Liquid Medium

    OpenAIRE

    Тітова, Лариса Олександрівна; Клечак, Інна Рішардівна

    2016-01-01

    Background. The basidiomycetes T. zonatus are producers and cellulose oxidative enzymes and polysaccharides with antitumor activity. The feasibility of this study is that the creation of functional food biotechnology from strains of biomass from domestic collections is not enough initial data: fragmentary data on cultivation conditions and culture medium composition, biochemical biomass of T. zonatus.Оbjective. The aim of the study is to conduct screening of basidiomycetes strains T. zonatus ...

  13. Gene knockdown by ihpRNA-triggering in the ectomycorrhizal basidiomycete fungus Laccaria bicolor

    OpenAIRE

    Kemppainen, Minna J.; Pardo, Alejandro G.

    2010-01-01

    Ectomycorrhiza (ECM) is a mutualistic association between fungi and the roots of the vast majority of trees. These include numerous ecologically and economically relevant species and the participating fungal symbionts are predominantly filamentous basidiomycetes. In natural ecosystems the plant nutrient uptake from soil takes place via the extraradical mycelia of these ECM mycosimbionts as a trade for plant photosyntates. The symbiotic phase in the life cycle of ECM basidiomycetes is the dika...

  14. SOLID-PHASE TREATMENT OF A PENTACHLOROPHENOL- CONTAMINATED SOIL USING LIGNIN-DEGRADING FUNGI

    Science.gov (United States)

    The abilities of three lignin-degrading fungi, Phanerochaete chrysosporium, Phanerochaete sordida, and Trametes hirsuta, to deplete pentachlorophenol (PCP) from soil contaminated with PCP and creosote were evaluated. A total of seven fungal and three control treatments ...

  15. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Science.gov (United States)

    David-Palma, Márcia; Sampaio, José Paulo; Gonçalves, Paula

    2016-06-01

    In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R) and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD) transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism will benefit from

  16. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Directory of Open Access Journals (Sweden)

    Márcia David-Palma

    2016-06-01

    Full Text Available In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism

  17. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    OpenAIRE

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant ...

  18. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  19. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  20. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  1. Subcutaneous abscess due to the basidiomycete Phellinus mori in a patient with chronic granulomatous disease.

    Science.gov (United States)

    Shigemura, T; Nakazawa, Y; Amano, Y; Sudo, A; Watanabe, M; Kobayashi, M; Kobayashi, N; Koike, K; Agematsu, K; Nishimura, K

    2015-06-01

    Chronic granulomatous disease (CGD), a primary immunodeficiency caused by impaired phagocyte killing of intracellular pathogens, is characterized by recurrent, life-threatening, bacterial and fungal infections. As a result of improvements in microbiologic culture and identification techniques, a number of unique filamentous fungi have been reported as significant pathogens in patients with CGD. We report a case of subcutaneous basidiomycete Phellinus mori infection in a patient with CGD. To the best of our knowledge, this is the first reported case of human infection by this fungus. The causative fungus was identified on the basis of its morphological characteristics and nucleotide sequence on the internal transcribed spacer region of the ribosomal RNA gene. This is the fifth case report of filamentous basidiomycetes infecting a patient with CGD; all of these cases have been caused by Phellinus species. We highlight the importance of recognizing filamentous basidiomycetes Phellinus species as possible agents of non-Aspergillus fungal infections in patients with CGD. PMID:25600930

  2. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  3. Saprotrophic basidiomycetes from temperate oak (Quercus petraea) forest soil: degradation of soil organic matter

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Cajthaml, Tomáš; Merhautová, Věra; Baldrian, Petr

    Vienna: Verlag, 2006, A141-A141. [International Symposium on Microbial Ecology – ISME-11 /11./. Vienna (AT), 20.08.2006-25.08.2006] R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * forest soil * saprotrophic fungi Subject RIV: EE - Microbiology, Virology

  4. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  5. Distribution of Brown Blotch Bacteria in Wild and Cultivated Species of Basidiomycetes

    OpenAIRE

    Bessette, Alan E.

    1984-01-01

    Wild and cultivated Basidiomycetes species were cultured to determine the distribution of bacteria causing brown blotch disease of Agaricus bisporus. Colonies from each basidiocarp were screened for brown blotch organisms by the white line and host pathogenicity tests. Isolates causing brown blotch were identified as Pseudomonas tolaasi and an Arthrobacter species.

  6. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  7. 黄孢原毛平革菌产酶的简化结构动力学模型%A Simple Structure Model for Enzyme Production by Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    ZHENG Zhongming(郑重鸣); FOO YinDin; Jeffery Philip Obbard; LIN Jianping(林建平); CEN Peilin(岑沛霖)

    2003-01-01

    In order to understand the behavior of ligninolytic enzyme production by white rot fungi Phanerochaetechrysosporium, study on time courses and a mathematical model for the production of lignin peroxidase (LiP) andmanganese peroxidase (MnP) of the fungi was undertaken. Based on the Monod-Jacob operon model, the ligninolyticenzyme would be synthesized in the absence of a related repressor. The repressor is assumed to be active in thepresence of ammonia nitrogen, and as combined as co-repressor, it causes the inhibition of enzyme synthesis. Themodel can explain the mechanism of extracellular ligninolytic enzyme production by white rot fungi. The results,as predicted by the model, correspond closely to those observed in experimental studies. In addition, some lightis also shed on unmeasured variables, such as the concentrations of repressor and mRNA that are related to theenzyme synthesis.

  8. Metabolic pathways of biotransformation and biosynthesis of aromatic compounds for the flavour industry by the basidiomycete Pycnoporus cinnabarinus

    OpenAIRE

    Asther, Marcel; Lomascolo, A.; Asther, M.; Moukha, S.; Lesage-Meessen, L.

    1998-01-01

    Among filamentous fungi, white-rot Basidiomycetes have become a strategic group to generate industrial aromatic flavours. In the course of a basidiomycete screening, the biotechnological potential of #Pycnoporus cinnabarinus$ strains was studied in order to produce, by transformation or de novo, natural aromatic flavours in liquid cultures. Ferulic acid and L-phenylalanine were found to be suitable substrates for vanillin and benzaldehyde (bitter almond aroma) production, respectively. These ...

  9. Carbon translocation in mycelial cord systems of Phanerochaete velutina (DC.: Pers.) Parmasto

    International Nuclear Information System (INIS)

    Movement of radiotracer was monitored in mycelial cord systems developed from wood block inocula, pre-colonized by Phanerochaete velutina (DC: Pers.) Parmasto grown on unsterile soil. In short-term studies, reproducible but low-level loading of radiotracer was observed which was independent of the extent of cord systems. Carbon translocation velocities ranged from 132 to 336 cm h-1, whilst fluxes were estimated to range from 35 to 66 nmol cm-2 h-1 (as glucose). When cord systems were supplied with a range of potential carbon resources as baits considerable movement of carbon was detected over 9 wk. More than 80 % of exogenously supplied carbon was retained in resource units rather than being allocated to extra-resource mycelium. The direction and extent of carbon movement, and partitioning of decay between inocula and baits within cord systems, was dependent upon the type and size of bait and whether or not combinations of baits included wood pre-colonized by other sapro trophic fungi. There was evidence for coordinated use of resources within cord systems and that carbon movement was not a function of mycelial growth. Respiratory carbon losses were greatest when baits included sterile leaf litter packs and least when sterile wood baits were supplied. The results are discussed in terms of nutrient conservation and cycling in cord systems. (author)

  10. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  11. Mn(II) regulation of lignin peroxidases and manganese-dependent peroxidases from lignin-degrading white rot fungi

    International Nuclear Information System (INIS)

    Two families of peroxidases-lignin peroxidase (LiP) and manganese-dependent lignin peroxidase (MnP)-are formed by the lignin-degrading white rot basidiomycete Phanerochaete chrysosporium and other white rot fungi. Isoenzymes of these enzyme families carry out reactions important to the biodegradation of lignin. This research investigated the regulation of LiP and MnP production by Mn(II). In liquid culture, LiP titers varied as an inverse function of and MnP titers varied as a direct function of the Mn(II) concentration. The extracellular isoenzyme profiles differed radically at low and high Mn(II) levels, whereas other fermentation parameters, including extracellular protein concentrations, the glucose consumption rate, and the accumulation of cell dry weight, did not change significantly with the Mn(II) concentration. In the absence of Mn(II), extracellular LiP isoenzymes predominated, whereas in the presence of Mn(II), MnP isoenzymes were dominant. The release of 14CO2 from 14C-labeled dehydrogenative polymerizate lignin was likewise affected by Mn(II). The rate of 14CO2 release increased at low Mn(II) and decreased at high Mn(II) concentrations. This regulatory effect of Mn(II) occurred with five strains of P. chrysosporium, two other species of Phanerochaete, three species of Phlebia, Lentinula edodes, and Phellinus pini

  12. Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi.

    OpenAIRE

    Bakkeren, G; Kronstad, J. W.

    1994-01-01

    Sexual compatibility requires self vs. non-self recognition. Genetically, two compatibility or mating-type systems govern recognition in heterothallic basidiomycete fungi such as the edible and woodrotting mushrooms and the economically important rust and smut phytopathogens. A bipolar system is defined by a single genetic locus (MAT) that can have two or multiple alleles. A tetrapolar system has two loci, each with two or more specificities. We have employed two species from the genus Ustila...

  13. Patterns of Repeat-Induced Point Mutation in Transposable Elements of Basidiomycete Fungi

    OpenAIRE

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E.

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-...

  14. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    OpenAIRE

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree...

  15. Iron-Binding Compounds Produced by Wood-Decaying Basidiomycetes

    OpenAIRE

    Fekete, Frank A.; Chandhoke, Vikas; Jellison, Jody

    1989-01-01

    The chrome azurol-S universal siderophore assay and the rapid paper electrophoresis siderophore assay were used to screen 10 wood-decaying basidiomycete isolates for the formation of iron-chelating compounds. All 10 isolates were positive for chrome azurol-S reactivity on solid plating medium and in liquid cultures, and 9 of the 10 isolates produced fluorescent iron-binding compounds in the paper electrophoresis assay.

  16. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing basidiomycetes strains

    OpenAIRE

    Moreira Neto, S. L.; Solange I. Mussatto; Machado, K. M. G.; Milagres, Adriane M. F.

    2013-01-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Ciba...

  17. Basidiomycete DyPs: Genomic diversity, structural–functional aspects, reaction mechanism and environmental significance

    OpenAIRE

    Linde, Dolores; Ruiz-Dueñas, Francisco J.; Fernandez-Fueyo, Elena; Guallar, Víctor; Hammel, Kenneth E.; Pogni, Rebecca; Martínez, Angel T.

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes...

  18. Molecular characterization of reptile pathogens currently known as members of the chrysosporium anamorph of Nannizziopsis vriesii complex and relationship with some human-associated isolates.

    Science.gov (United States)

    Sigler, Lynne; Hambleton, Sarah; Paré, Jean A

    2013-10-01

    In recent years, the Chrysosporium anamorph of Nannizziopsis vriesii (CANV), Chrysosporium guarroi, Chrysosporium ophiodiicola, and Chrysosporium species have been reported as the causes of dermal or deep lesions in reptiles. These infections are contagious and often fatal and affect both captive and wild animals. Forty-nine CANV isolates from reptiles and six isolates from human sources were compared with N. vriesii based on their cultural characteristics and DNA sequence data. Analyses of the sequences of the internal transcribed spacer and small subunit of the nuclear ribosomal gene revealed that the reptile pathogens and human isolates belong in well-supported clades corresponding to three lineages that are distinct from all other taxa within the family Onygenaceae of the order Onygenales. One lineage represents the genus Nannizziopsis and comprises N. vriesii, N. guarroi, and six additional species encompassing isolates from chameleons and geckos, crocodiles, agamid and iguanid lizards, and humans. Two other lineages comprise the genus Ophidiomyces, with the species Ophidiomyces ophiodiicola occurring only in snakes, and Paranannizziopsis gen. nov., with three new species infecting squamates and tuataras. The newly described species are Nannizziopsis dermatitidis, Nannizziopsis crocodili, Nannizziopsis barbata, Nannizziopsis infrequens, Nannizziopsis hominis, Nannizziopsis obscura, Paranannizziopsis australasiensis, Paranannizziopsis californiensis, and Paranannizziopsis crustacea. Chrysosporium longisporum has been reclassified as Paranannizziopsis longispora. N. guarroi causes yellow fungus disease, a common infection in bearded dragons and green iguanas, and O. ophiodiicola is an emerging pathogen of captive and wild snakes. Human-associated species were not recovered from reptiles, and reptile-associated species were recovered only from reptiles, thereby mitigating concerns related to zoonosis. PMID:23926168

  19. Molecular Characterization of Reptile Pathogens Currently Known as Members of the Chrysosporium Anamorph of Nannizziopsis vriesii Complex and Relationship with Some Human-Associated Isolates

    Science.gov (United States)

    Hambleton, Sarah; Paré, Jean A.

    2013-01-01

    In recent years, the Chrysosporium anamorph of Nannizziopsis vriesii (CANV), Chrysosporium guarroi, Chrysosporium ophiodiicola, and Chrysosporium species have been reported as the causes of dermal or deep lesions in reptiles. These infections are contagious and often fatal and affect both captive and wild animals. Forty-nine CANV isolates from reptiles and six isolates from human sources were compared with N. vriesii based on their cultural characteristics and DNA sequence data. Analyses of the sequences of the internal transcribed spacer and small subunit of the nuclear ribosomal gene revealed that the reptile pathogens and human isolates belong in well-supported clades corresponding to three lineages that are distinct from all other taxa within the family Onygenaceae of the order Onygenales. One lineage represents the genus Nannizziopsis and comprises N. vriesii, N. guarroi, and six additional species encompassing isolates from chameleons and geckos, crocodiles, agamid and iguanid lizards, and humans. Two other lineages comprise the genus Ophidiomyces, with the species Ophidiomyces ophiodiicola occurring only in snakes, and Paranannizziopsis gen. nov., with three new species infecting squamates and tuataras. The newly described species are Nannizziopsis dermatitidis, Nannizziopsis crocodili, Nannizziopsis barbata, Nannizziopsis infrequens, Nannizziopsis hominis, Nannizziopsis obscura, Paranannizziopsis australasiensis, Paranannizziopsis californiensis, and Paranannizziopsis crustacea. Chrysosporium longisporum has been reclassified as Paranannizziopsis longispora. N. guarroi causes yellow fungus disease, a common infection in bearded dragons and green iguanas, and O. ophiodiicola is an emerging pathogen of captive and wild snakes. Human-associated species were not recovered from reptiles, and reptile-associated species were recovered only from reptiles, thereby mitigating concerns related to zoonosis. PMID:23926168

  20. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. PMID:25637654

  1. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  2. Purification and Characterization of a Trehalose Synthase from the Basidiomycete Grifola frondosa

    OpenAIRE

    Saito, Koki; Kase, Toshiya; Takahashi, Eiichi; Takahashi, Eisaku; Horinouchi, Sueharu

    1998-01-01

    A trehalose synthase (TSase) that catalyzes the synthesis of trehalose from d-glucose and α-d-glucose 1-phosphate (α-d-glucose 1-P) was detected in a basidiomycete, Grifola frondosa. TSase was purified 106-fold to homogeneity with 36% recovery by ammonium sulfate precipitation and several steps of column chromatography. The native enzyme appears to be a dimer since it has apparent molecular masses of 120 kDa, as determined by gel filtration column chromatography, and 60 kDa, as determined by ...

  3. Lignin-Modifying Enzymes of Flavodon flavus, a Basidiomycete Isolated from a Coastal Marine Environment†

    OpenAIRE

    Raghukumar, C.; D’Souza, T. M.; Thorn, R. G.; Reddy, C A

    1999-01-01

    A basidiomycetous fungus Flavodon flavus (Klotzsch) Ryvarden (strain 312), isolated from decaying sea grass from a coral lagoon off the west coast of India, mineralized nearly 24% of 14C-labeled synthetic lignin to 14CO2 in 24 days. When grown in low-nitrogen medium (2.4 mM N) this fungus produced three major classes of extracellular lignin-modifying enzymes (LMEs): manganese-dependent peroxidase (MNP), lignin peroxidase (LIP), and laccase. Low MNP and laccase activities were seen in high-nit...

  4. Improvement of ethanol production by recombinant expression of pyruvate decarboxylase in the white-rot fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Wang, Jianqiao; Hirabayashi, Sho; Mori, Toshio; Kawagishi, Hirokazu; Hirai, Hirofumi

    2016-07-01

    To improve ethanol production by Phanerochaete sordida YK-624, the pyruvate decarboxylase (PDC) gene was cloned from and reintroduced into this hyper lignin-degrading fungus; the gene encodes a key enzyme in alcoholic fermentation. We screened 16 transformant P. sordida YK-624 strains that each expressed a second, recombinant PDC gene (pdc) and then identified the transformant strain (designated GP7) with the highest ethanol production. Direct ethanol production from hardwood was 1.41 higher with GP7 than with wild-type P. sordida YK-624. RT-PCR analysis indicated that the increased PDC activity was caused by elevated recombinant pdc expression. Taken together, these results suggested that ethanol production by P. sordida YK-624 can be improved by the stable expression of an additional, recombinant pdc. PMID:26766784

  5. Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii in captive coastal bearded dragons (Pogona barbata).

    Science.gov (United States)

    Johnson, R S P; Sangster, C R; Sigler, L; Hambleton, S; Paré, J A

    2011-12-01

    Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was diagnosed in a group of coastal bearded dragons (Pogona barbata). The outbreak extended over a 6-month period, with four of six lizards from the same zoological outdoor enclosure succumbing to infection. A fifth case of dermatomycosis was identified in a pet lizard originally sourced from the wild. Diagnosis of infection with the CANV was based on similar clinical signs and histopathology in all animals and confirmed by culture and sequencing of the fungus from one animal. This is the first report of the CANV causing disease in a terrestrial reptile species in Australia and the first in the coastal bearded dragon. PMID:22103953

  6. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants. PMID:24502208

  7. Determination of trace elements in three mushroom samples of basidiomycetes from Shandong, China.

    Science.gov (United States)

    Wang, Chao; Hou, Yunhua

    2011-09-01

    We have determined the trace element composition of three mushrooms of Basidiomycetes, used in traditional Chinese medicine using atomic absorption spectrophotometer (AAS). Metal concentrations in mushrooms were 203-401 mg/kg for iron, 22-51 mg/kg for manganese, 84-116 mg/kg for zinc, 24.1-41.3 mg/kg for copper, 1.6-5.6 mg/kg for lead, 3.3-4.4 mg/kg for chromium, 9.3-11.5 mg/kg for nickel, 0 mg/kg for vanadium, and 55.3-71 mg/kg for magnesium. The trace metal concentrations in mushrooms are hardly affected by the ecosystem and soil where they grew, as well as by the mushroom species and trace metal species. The results can be used to set new standards to control the quality of the three mushrooms of Basidiomycetes-Ganoderma lucidum, Coprinus comatus, and Grifola frondosa. PMID:20665124

  8. Extracellular laccase produced by an edible basidiomycetous mushroom, Grifola frondosa: purification and characterization.

    Science.gov (United States)

    Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko

    2011-01-01

    A major laccase isozyme (Lac 1) was isolated from the culture fluid of an edible basidiomycetous mushroom, Grifola frondosa. Lac 1 was revealed to be a monomeric protein with a molecular mass of 71 kDa. The N-terminal amino acid sequence of Lac 1 was highly similar to those of laccases of some other white-rot basidiomycetes. Lac 1 showed the typical absorption spectrum of a copper-containing enzyme. The enzyme was stable in a wide pH range (4.0 to 10.0), and lost no activity up to 60 °C for 60 min. The optimal pH of the enzyme activity varied among substrates. The K(m) values of Lac 1 toward 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 2,6-dimethoxyphenol, guaiacol, catechol, and 3,4-dihydroxy-L-phenylalanine were 0.0137 mM, 0.608 mM, 0.531 mM, 2.51 mM, and 0.149 mM respectively. Lac 1 activity was remarkably inhibited by the chloride ion, in a reversible manner. Lac 1 activity was also inhibited by thiol compounds. PMID:21389619

  9. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  10. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  11. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions. PMID:27481160

  12. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  13. In vitro decomposition of Sphagnum-derived acrotelm and mesotelm peat by indigenous and alien basidiomycetous fungi

    Directory of Open Access Journals (Sweden)

    M.N. Thormann

    2011-05-01

    Full Text Available Northern peatlands have accumulated significant quantities of peat, and it has been predicted that rates of peat decomposition may increase due to climate warming. In peatlands, organic matter decomposition in the acrotelm is accomplished primarily by fungi that act differentially through time on various peat constituents. After four months of decomposition in vitro, I show a distinct microbiological limitation to the decomposition of Sphagnum-derived peat (mean mass losses of 1.1–7.1 % by indigenous and alien basidiomycetous fungi of both acrotelm and mesotelm peat (the mesotelm is the lower part of the acrotelm sensu lato, in which conditions fluctuate between oxic and anoxic. Neither acrotelm nor mesotelm Sphagnum peat can be degraded effectively by many fungi (mean mass losses of 2.7 % and 4.3 % for acrotelm and mesotelm peat, respectively, including the ubiquitous wood decomposing basidiomycetes known to decompose some of nature’s most complex polymers. Peatland basidiomycetes caused significantly greater mass losses of acrotelm and mesotelm peat than wood decay basidiomycetes (mean mass losses of 5.7 % and 1.4 %, respectively. Brown rot fungi caused significantly greater mass losses to acrotelm and mesotelm peat than white rot fungi and non-wood-decay fungi (mean mass losses of 10.1 %, 1.7 %, and 2.3 %, respectively. Rates of peat decomposition may not increase to the extent previously predicted, and peatlands may not necessarily be long-term sources of CO2 in response to a warming climate.

  14. Gene expression profiling of the plant pathogenic basidiomycetous fungus Rhizoctonia solani AG 4 reveals putative virulence factors

    Science.gov (United States)

    Rhizoctonia solani is a ubiquitous basidiomycetous soilborne fungal pathogen causing damping off of seedlings, aerial blights and postharvest diseases. To gain insight into the molecular mechanisms of pathogenesis a global approach based on analysis of expressed sequence tags (ESTs) was undertaken. ...

  15. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  16. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524. E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  17. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol. PMID:17697987

  18. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  19. BIOSORPTION OF TEXTILE DYE USING IMMOBILIZED BACTERIAL (PSEUDOMONAS AERUGINOSA) AND FUNGAL (PHANEROCHATE CHRYSOSPORIUM) CELLS

    OpenAIRE

    Natarajan Saravanan; Tiruvenkadam Kannadasan; Chiya Ahmed Basha; Veerasamy Manivasagan

    2013-01-01

    Wastewater containing dyes presents a serious problem due to its high toxicity which leads to creating enormous environmental pollution and ecological hazards. Therefore the removal of the high stable dyes from the textile effluents is of major importance. The purpose of this study is to remove the reactive dye Procion Blue 2G from textile dye solution by biosorption process using immobilized cells of Pseudomonas aeruginosa and Phanerochate chrysosporium. It was found that maximum dye uptake ...

  20. Gene knockdown by ihpRNA-triggering in the ectomycorrhizal basidiomycete fungus Laccaria bicolor.

    Science.gov (United States)

    Kemppainen, Minna J; Pardo, Alejandro G

    2010-01-01

    Ectomycorrhiza (ECM) is a mutualistic association between fungi and the roots of the vast majority of trees. These include numerous ecologically and economically relevant species and the participating fungal symbionts are predominantly filamentous basidiomycetes. In natural ecosystems the plant nutrient uptake from soil takes place via the extraradical mycelia of these ECM mycosimbionts as a trade for plant photosyntates. The symbiotic phase in the life cycle of ECM basidiomycetes is the dikaryotic hyphae. Therefore, studies on symbiotic relevant gene functions require the inactivation of both gene copies in these dikaryotic fungi. RNA silencing is a eukaryotic sequence homology-dependent degradation of target RNAs which is believed to have evolved as a protection mechanism against invading nucleic acids. In different eukaryotic organisms, including fungi, the RNA silencing pathway can be artificially triggered to target and degrade gene transcripts of interest, resulting in gene knock-down. Most importantly, RNA silencing can act at the cytosolic level affecting mRNAs originating from several gene copies and different nuclei thus offering an efficient means of altering gene expression in dikaryotic organisms. Therefore, the pHg/pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII-promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy two-step PCR-cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300-based binary vector carrying a hygromycin resistance cassette, makes the pHg/pSILBAγ plasmid compatible with Agrobacterium-mediated transformation. The pHg/pSILBAγ-system results in predominantly single integrations of RNA silencing triggering T-DNAs in the fungal genome

  1. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  2. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. PMID:24800960

  3. [Biological synthesis of gold nanoparticles by the xylotrophic basidiomycete Lentinula edodes].

    Science.gov (United States)

    Vetchinkina, E P; Burov, A M; Ageeva, M V; Dykman, L A; Nikitina, V E

    2013-01-01

    This is the first study to demonstrate that the medicinal basidiomycete Lentinula edodes can reduce gold (III) ions from hydrogen tetrachloaurate (chloroauric acid) H[AuCl4] to the elementary state with the formation of spherical nanoparticles (nanospheres). When a culture was grown under submerged conditions in the presence of chloroauric acid, the appearance of an intense purple-red color of L. edodes filamentous hyphae was recorded, which indicates that gold ions were reduced to gold nanoparticles. Using transmission electron microscopy and X-ray fluorescence, we observed accumulation of colloidal gold by the fungal mycelium in the form of electron-dense nanospheres of 5 to 50 nm in diameter on the surface and inside fungal cells. PMID:24455867

  4. Cardiovascular effects of the fungal extract of basidiomycetes sp. YL8006.

    Science.gov (United States)

    Andreacchi, A S; Wang, T; Wu, J H

    1997-01-01

    Many fungal products are known to possess biological activity towards the mammalian tissues. We studied vasodilating activity in the crude ethanol extract of the dried mycelia of Basidiomycetes sp. YL8006, cultured by submerged fermentation with a complex medium. The activity was assayed using the isolated perfused rat heart in the working mode. Immediately following injection of the extract into the perfusion system, a 20-25% increase in coronary flow was observed (pvehicle control). There was a concurrent decrease in diastolic pressure and coronary vascular resistance. Aortic flow, systolic pressure, and cardiac output declined slightly over time after treatment. No significant changes in heart rate, efficiency, and oxygen consumption were observed. Solvent vehicle did not cause any changes in hemodynamic performance. PMID:9180352

  5. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  6. Coprinopsis cinerea as a Model Fungus to Evaluate Genes Underlying Sexual Development in Basidiomycetes

    Directory of Open Access Journals (Sweden)

    P. Srivilai

    2009-01-01

    Full Text Available Coprinopsis cinerea is an excellent model for study of sexual reproduction and development in basidiomycetes because of its short-life cycle, capability to grow and fruit on artificial media under laboratory conditions. Deepening the understanding of genes underlying sexual reproduction and development in this mushroom model is expected to help in the future the world mushroom cultivation of any other basidiomycetes concerning the potential agronomic, economic and environmental benefits. This study presents findings with clear statements from the literature as well as own results focusing on the genetic analysis of genes acting in sexual reproduction and development in C. cinerea. Sexual reproduction and development in C. cinerea are regulated by the A and B mating type genes that encode two types of homeodomain transcription factors, pheromones and pheromone receptors, respectively. Coprinopsis cinerea has two different mycelial stages defined as the monokaryotic-(primary and dikaryotic-(secondary mycelium. When two compatible haploid monokaryons with different mating type alleles at A and B loci are fused, the fertile dikaryons are formed and developed into fruiting bodies, indicating that mating type genes regulate sexual development in C. cinerea. Self-fertile homokaryon AmutBmut strain with mutations in the A and B mating loci is ideal for production of mutants in fruiting body formation. Co-isogenic strains were generated by the repeated back-crossing against AmutBmut to analyze the genetic background of such mutants and the functions of genes in the fruiting pathway. Genetic analysis of AmutBmut fruiting mutants that are blocked at different stages in fruiting pathway will be described.

  7. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Science.gov (United States)

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  8. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  9. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    Science.gov (United States)

    Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  10. A Checklist of the Basidiomycetous Macrofungi and a Record of Five New Species from Mt. Oseo in Korea

    Science.gov (United States)

    Lee, Won Dong; Lee, Hyun; Fong, Jonathan J.; Oh, Seung-Yoon; Park, Myung Soo; Quan, Ying; Jung, Paul E.

    2014-01-01

    Basidiomycetous macrofungi play important roles in maintaining forest ecosystems via carbon cycling and the mobilization of nitrogen and phosphorus. To understand the impact of human activity on macrofungi, an ongoing project at the Korea National Arboretum is focused on surveying the macrofungi in unexploited areas. Mt. Oseo was targeted in this survey because the number of visitors to this destination has been steadily increasing, and management and conservation plans for this destination are urgently required. Through 5 field surveys of Mt. Oseo from April to October 2012, 116 specimens of basidiomycetous macrofungi were collected and classified. The specimens were identified to the species level by analyzing their morphological characteristics and their DNA sequence data. A total of 80 species belonging to 57 genera and 25 families were identified. To the best of our knowledge, this is the first study to identify five of these species-Artomyces microsporus, Hymenopellis raphanipes, Pholiota abietis, Phylloporus brunneiceps, and Sirobasidium magnum-in Korea. PMID:25071381

  11. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications. PMID:23558529

  12. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment. PMID:20585855

  13. Biomass estimation during macro-scale solid-state fermentation of basidiomycetes using established and novel approaches.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-07-01

    Solid-state fermentation (SSF) has been utilised in food production for millennia and is well suited for the cultivation of basidiomycetes, due to the robustness of the process and the possibility of using lignocellulose as the substrate. Basidiomycetes produce diverse enzymes and various primary and secondary metabolites, many of which have biotechnological potential. The quantification of the fungal biomass present is essential for the characterisation of growth kinetics in processes such as SSF. In SSF, fungi grow into the substrate and use it as a nutrient source. Therefore, direct biomass determination is not possible and indirect methods have to be employed. In the presented study, we compared 11 methods for quantifying fungal biomass during SSF of the basidiomycete Trametes hirsuta in a newly developed laboratory reactor (working volume 10 L). The methods were based on measuring the levels of six cell-specific components (ergosterol, glucosamine, nucleic acids, number of fungal nuclei, protein and genomic DNA) and estimations of biological activity (respiration, activities of lignolytic and cellulolytic enzymes, and the glucose and protein contents of the liquid). The methods were evaluated with regards to reproducibility and plausibility of the results, time and resource requirements, possible influential factors, and matrix effects. The most reliable biomass estimates were obtained from measurements of ergosterol content, number of nuclei, and respiration. Thus, these three methods were deemed most suitable for process control and modelling. PMID:25656698

  14. Patterns of repeat-induced point mutation in transposable elements of basidiomycete fungi.

    Science.gov (United States)

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-T transition mutations in particular di- and trinucleotide target sites for TE-like sequences from nine fungal genomes. We find evidence of RIP-like patterns of hypermutation at TpCpG trinucleotide sites in repetitive sequences from all species of the Pucciniomycotina subphylum of the Basidiomycota, Microbotryum lychnidis-dioicae, Puccinia graminis, Melampsora laricis-populina, and Rhodotorula graminis. In contrast, we do not find evidence for RIP-like hypermutation in four species of the Agaricomycotina and Ustilaginomycotina subphyla of the Basidiomycota. Our results suggest that a RIP-like process and the specific nucleotide context for mutations are conserved within the Pucciniomycotina subphylum. These findings imply that coevolutionary interactions between TEs and a hypermutating genome defense are stable over long evolutionary timescales. PMID:22250128

  15. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  16. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. PMID:22954341

  17. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively. PMID:23510286

  18. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment. PMID:23350659

  19. Sympodiomycopsis yantaiensis sp. nov., a basidiomycetous yeast isolated from insect frass.

    Science.gov (United States)

    Chen, Liang; Zhang, Lin; Li, Zhi-Hui; Hui, Feng-Li

    2013-09-01

    Two strains (NYNU 121010(T) and NYNU 121032) of a novel basidiomycetous yeast species belonging to the genus Sympodiomycopsis were isolated from insect frass collected from trunks of a pagoda tree (Sophora japonica L.) in Yantai, Shandong province, east China. The sequence analyses of the D1/D2 domain of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region indicated that the closest relatives were Sympodiomycopsis kandeliae FIRDI 007(T), Sympodiomycopsis paphiopedili CBS 7429(T) and Sympodiomycopsis sp. S6A. The D1/D2 sequences of the novel strains differed by 12 nt substitutions (2%) from the type strain of S. kandeliae, and by 13 nt substitutions (2.2%) from the type strain of S. paphiopedili and from Sympodiomycopsis sp. S6A. The novel strains differed from closely related species by more than 4.6% substitutions in the ITS region. The novel strains can also be distinguished from S. kandeliae and S. paphiopedili on the basis of a number of morphological and physiological characteristics and represent a novel species in the genus Sympodiomycopsis, for which the name Sympodiomycopsis yantaiensis sp. nov. is proposed. The type strain is NYNU 121010(T) ( =CICC 32998(T) = CBS 12813(T)). The Mycobank deposit number is MB 804119. PMID:23838443

  20. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs. PMID:18805521

  1. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis. PMID:16885300

  2. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-02-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  3. Penarines A-F, (nor-)sesquiterpene carboxylic acids from Hygrophorus penarius (Basidiomycetes).

    Science.gov (United States)

    Otto, Alexander; Porzel, Andrea; Schmidt, Jürgen; Wessjohann, Ludger; Arnold, Norbert

    2014-12-01

    Five sesquiterpene carboxylic acids (1-5) and one nor-sesquiterpene carboxylic acid (6) of the very rare ventricosane type, named penarines A-F, were isolated from fruiting bodies of the basidiomycete Hygrophorus penarius (Hygrophoraceae). This is the first report of (nor)-sesquiterpenes isolated from basidiocarps of the family Hygrophoraceae. Their structures were elucidated on the basis of extensive 1D ((1)H, (13)C) and 2D (HSQC, HMBC, COSY, ROESY) NMR spectroscopic analyses as well as high-resolution mass spectrometry studies. Additionally, the only known member of this rare type of sesquiterpenes, ventricos-7(13)-ene (7), could be identified via headspace GC-MS analysis in a fruiting body of H. penarius. Compounds 1-6 were devoid of remarkable antifungal activity against Cladosporium cucumerinum. Additionally, the cytotoxic activities of compounds 1 and 2 were evaluated against the human prostate cancer cell line PC-3 and the colon cancer cell line HT-29 showing no significant cytotoxic activity. PMID:25269661

  4. Active site and laminarin binding in glycoside hydrolase family 55.

    Science.gov (United States)

    Bianchetti, Christopher M; Takasuka, Taichi E; Deutsch, Sam; Udell, Hannah S; Yik, Eric J; Bergeman, Lai F; Fox, Brian G

    2015-05-01

    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100-10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  5. A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea.

    Science.gov (United States)

    Ford, Kathryn L; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M; Foster, Gary D

    2016-01-01

    Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974

  6. Lignolytic Enzymes of a Mushroom Stereum ostrea Isolated from Wood Logs

    OpenAIRE

    Praveen, K.; B. Viswanath; Usha, K. Y.; Pallavi, H.; Venkata Subba Reddy, G.; M. Naveen; B. Rajasekhar Reddy

    2011-01-01

    Production of lignolytic enzymes by the mushroom fungus Stereum ostrea in liquid medium under conditions of vegetative growth was examined for 10 days in comparison to the reference culture Phanerochaete chrysosporium. Though growth and secretion of extracellular protein by S. ostrea were comparable to those of P. chrysosporium, yields of laccase enzyme by S. ostrea were higher than laccase titres of P. chrysosporium by more than 2 folds on the peak production time interval (IVth day of incu...

  7. The BETA-1, 3-Glucanase of Basidiomycete QM 806: Studies on it's production and application in yeast cell wall hydrolysis

    OpenAIRE

    Ryan, Eleanor

    1986-01-01

    In this project the growth and production of JB-1,3-glucanase by Basidiomycete sp QM 806 was investigated, with a view to studying its application in B-1,3-glucan degradation and in yeast extract production. The effect of various parameters on 3-1 »3-glucanase production was examined. The optimal conditions for enzyme production in submerged shake-flask culture were chosen. Two B-1,3-glucans (laminarin and yeast cell walls) were degraded using the B-1,3-glucanase produced. The degra...

  8. Lignocellulose-Degrading Enzymes of Hardwood Forest Soil: Their Activity, Spatial Distribution and Their Producers - Saprotrophic Basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Šnajdr, Jaroslav; Valášková, Vendula; Cajthaml, Tomáš; Trögl, Josef; Bittner, B.; Hofrichter, M.

    Wisconsin: Verlag, 2007, s. 58-58. [International Congress on Biotechnology in the Pulp and Paper Industry /10./. Madison (US), 10.06.2007-15.06.2007] R&D Projects: GA ČR GA526/05/0168; GA AV ČR KJB600200516 Grant ostatní: CZ(CZ) PPP D17-CZ27/06-07 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje Keywords : basidiomycetes Subject RIV: EE - Microbiology, Virology

  9. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia)

    OpenAIRE

    Siabatto F. Helbert David

    2005-01-01

    Se realizó la colección de especímenes jóvenes de Basidiomycetes en el páramo de Ocetá, ubicado en el municipio de Monguí, Boyacá, Colombia. Con el fin de crear un inventario de cada morfoespecie colectada, se realizó una descripción macroscópica, microscópica y pruebas químicas con
    el fin de obtener los principales taxones. Se encontraron 11 géneros: Gomphydus, Chroogomphus, Paneolus, Macrolepiota, Tricholoma, Lentinellus, Crepidotus, Amanita, Polyborus, Lycoperdon y Tubaria, pert...

  10. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  11. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935. ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  12. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence. PMID:23814110

  13. Primary structure of dihydrofolate reductase and mitochondrial ribosomal protein L36 genes from the basidiomycete Coprinus cinereus.

    Science.gov (United States)

    Aimi, Tadanori; Fukuhara, Shoji; Ishiguro, Maki; Kitamoto, Yutaka; Morinaga, Tsutomu

    2004-08-01

    We amplified and sequenced the dihydrofolate reductase (DHFR) gene of the basidiomycete Coprinus cinereus. Downstream of the DHFR coding region, a mitochondrial (mt) ribosomal protein L36 (RPL36) gene was discovered in the opposite orientation to DHFR gene. Putative polyadenylation signals of the two genes overlapped, both containing the 8-bp palindrome 5'-aatatatt-3'. The finding that C. cinereus DHFR gene is closely clustered with a mt protein gene strongly suggests that C. cinereus DHFR is closely related to mt function and evolution. The amino acid sequence of C. cinereus DHFR is most homologous to eukaryotic proteins such as Cryptococcus neoformans and Pneumocystis carinii DHFRs. However, the sequence of C. cinereus mt RPL36 closely resembles RPL36 of bacteria and cyanobacteria such as Synechocystis sp. and Escherichia coli. This result strongly supports the serial endosymbiotic theory of the development of ancestral eukaryotes, and suggests that C. cinereus mt RPL36 gene originated from the ancestral eubacterial genome. PMID:15620217

  14. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  15. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi. PMID:25239747

  16. Kenaf biomass biodecomposition by basidiomycetes and actinobacteria in submerged fermentation for production of carbohydrates and phenolic compounds.

    Science.gov (United States)

    Brzonova, Ivana; Kozliak, Evguenii; Kubátová, Alena; Chebeir, Michelle; Qin, Wensheng; Christopher, Lew; Ji, Yun

    2014-12-01

    The efficiency and dynamics of simultaneous kenaf biomass decomposition by basidiomycetous fungi and actinobacteria were investigated. After 8weeks of incubation, up to 34wt.% of the kenaf biomass was degraded, with the combination of fungi and bacteria being the most efficient. Lignin decomposition accounted for ∼20% of the observed biomass reduction, regardless of the culture used. The remaining 80% of biomass degradation was due to carbohydrate based polymers. Major monosaccharides were produced in tangible yields (26-38%) at different times. Glucose, fructose and xylose were then fully consumed by day 25 while some galactose persisted until day 45. Once monosaccharides were depleted, the production of laccase, manganese-dependent peroxidase and lignin peroxidase enzymes, essential for lignin decomposition, was induced. The products of lignin biodecomposition were shown to be water-soluble and characterized by thermal desorption-pyrolysis-gas chromatography. PMID:25314665

  17. Evidence from Serpula lacrymans that 2,5-dimethoxyhydroquinone Is a lignocellulolytic agent of divergent brown rot basidiomycetes.

    Science.gov (United States)

    Korripally, Premsagar; Timokhin, Vitaliy I; Houtman, Carl J; Mozuch, Michael D; Hammel, Kenneth E

    2013-04-01

    Basidiomycetes that cause brown rot of wood are essential biomass recyclers in coniferous forest ecosystems and a major cause of failure in wooden structures. Recent work indicates that distinct lineages of brown rot fungi have arisen independently from ligninolytic white rot ancestors via loss of lignocellulolytic enzymes. Brown rot thus proceeds without significant lignin removal, apparently beginning instead with oxidative attack on wood polymers by Fenton reagent produced when fungal hydroquinones or catechols reduce Fe(3+) in colonized wood. Since there is little evidence that white rot fungi produce these metabolites, one question is the extent to which independent lineages of brown rot fungi may have evolved different Fe(3+) reductants. Recently, the catechol variegatic acid was proposed to drive Fenton chemistry in Serpula lacrymans, a brown rot member of the Boletales (D. C. Eastwood et al., Science 333:762-765, 2011). We found no variegatic acid in wood undergoing decay by S. lacrymans. We found also that variegatic acid failed to reduce in vitro the Fe(3+) oxalate chelates that predominate in brown-rotting wood and that it did not drive Fenton chemistry in vitro under physiological conditions. Instead, the decaying wood contained physiologically significant levels of 2,5-dimethoxyhydroquinone, a reductant with a demonstrated biodegradative role when wood is attacked by certain brown rot fungi in two other divergent lineages, the Gloeophyllales and Polyporales. Our results suggest that the pathway for 2,5-dimethoxyhydroquinone biosynthesis may have been present in ancestral white rot basidiomycetes but do not rule out the possibility that it appeared multiple times via convergent evolution. PMID:23377930

  18. Polycyclic aromatic hydrocarbons (PAHs) biodegradation by basidiomycetes fungi, Pseudomonas isolate, and their cocultures: comparative in vivo and in silico approach.

    Science.gov (United States)

    Arun, A; Raja, P Praveen; Arthi, R; Ananthi, M; Kumar, K Sathish; Eyini, M

    2008-12-01

    The polycyclic aromatic hydrocarbons (PAHs) biodegradation potential of the five basidiomycetes' fungal monocultures and their cocultures was compared with that of a Pseudomonas isolate recovered from oil-spilled soil. As utilization of hydrocarbons by the microorganisms is associated with biosurfactant production, the level of biosurfactant production and its composition by the selected microorganisms was also investigated. The Pseudomonas isolate showed higher ability to degrade three of the five PAHs but the isolate did not produce biosurfactant higher than C. versicolor and P. ostreatus. Among the PAHs, the most effective biodegradation of PAH--pyrene (42%)--was obtained with the fungus C. versicolor. Cocultures involving the fungi and Pseudomonas could not significantly degrade the selected PAHs compounds above that degraded by the most efficient monoculture. A slight increase in pyrene degradation was observed in cocultures of C. versicolor and F. palustris (93.7% pyrene). The crude biosurfactant was biochemically characterized as a multicomponent surfactant consisting of protein and polysaccharides. The PAH biodegradation potential of the basidiomycetes fungi positively correlated with their potential to express ligninolytic enzymes such as lignin peroxidase (Lip), manganese peroxidase (Mnp), and laccase. The present study utilized in silico method such as protein-ligand docking using the FRED in Open Eye software as a tool to assess the level of ligninolytic enzymes and PAHs interactions. The in silico analysis using FRED revealed that of the five PAHs, maximum interaction occurred between pyrene and all the three ligninolytic enzymes. The results of the in silico analysis corroborated with our experimental results showing that pyrene was degraded to the maximum extent by species such as C. versicolor and P. ostreatus. PMID:18975143

  19. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  20. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  1. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  2. Biological characteristics of teleomorph and optimized in vitro fruiting conditions of the Hoelen medicinal mushroom, Wolfiporia extensa (Higher Basidiomycetes).

    Science.gov (United States)

    Xu, Zhangyi; Meng, Hu; Xiong, Huan; Bian, Yinbing

    2014-01-01

    Wolfiporia extensa is a basidiomycetous brown rot fungus and is of well-known medicinal import in China, Japan, and other Asiatic countries. Fruiting body induction is of major relevance for basic biological research and for their use in industrial applications. Based on the evaluation of the effects of temperature, time in the dark before induction and culture, and wounding treatment on fruiting, this report describes the most efficient protocol for inducing fruiting of W. extensa growing on agar plates. Furthermore, several biological characteristics of teleomorph, such as the locations of hymenium, the configuration of basidiospores and primary mycelia, and events involved in basidiosporogenesis in W. extensa, were analyzed for the first time using fluorescence microscopy. The results showed that the hymenium born on both sides of the wall of the honeycomb-like structure on the surface of fruiting bodies and the hymenophoral trama situated in the middle. Each basidia has 4 binuclear basidiospores, and the primary mycelia are multinucleate without clamp connections. These results broaden our knowledge about this brown rot fungus and promote further studies of the sexual reproduction, fruiting body development, and advancement of breeding program, new topics related to the contents of pharmacologically active substances in W. extensa fruiting bodies. PMID:25271978

  3. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities. PMID:26616098

  4. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5. PMID:20652239

  5. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  6. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process. PMID:26797957

  7. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Siabatto F. Helbert David

    2005-12-01

    Full Text Available Se realizó la colección de especímenes jóvenes de Basidiomycetes en el páramo de Ocetá, ubicado en el municipio de Monguí, Boyacá, Colombia. Con el fin de crear un inventario de cada morfoespecie colectada, se realizó una descripción macroscópica, microscópica y pruebas químicas con
    el fin de obtener los principales taxones. Se encontraron 11 géneros: Gomphydus, Chroogomphus, Paneolus, Macrolepiota, Tricholoma, Lentinellus, Crepidotus, Amanita, Polyborus, Lycoperdon y Tubaria, pertenecientes a diez familias: Gomphidiaceae, Coprinaceae, Agaricaceae, Tricholomataceae, Pleurotaceae, Crepidotaceae, Amanitaceae, Poliporaceae, Lycoperdaceae y Entolomalaceae; distribuidas éstas en cuatro
    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  8. Inonotus rickii (Pat.) Reid: an important legnicolous basidiomycete in urban trees Inonotus rickii (Pat.) Reid: um importante basidomiceta lenhícola em árvores urbanas

    OpenAIRE

    Ana Paula Ramos; Maria Filomena Caetano; Ireneia Melo

    2008-01-01

    Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of heartwood. In some cases, chlamy...

  9. Purification and characterization of a novel detergent- and organic solvent-resistant endo-beta-1,4-glucanase from a newly isolated basidiomycete Peniophora sp. NDVN01

    OpenAIRE

    TRINH, Dinh Kha; Quyen, Dinh Thi; Do, Thi Tuyen; Nghiem, Ngoc Minh

    2013-01-01

    A novel extracellular endoglucanase from a basidiomycete strain Peniophora sp. NDVN01 was purified 2.8-fold to homogeneity through ammonium sulfate precipitation and gel filtration with Bio-Gel P-100 and Sephadex G-75. The endoglucanase had a specific activity of 163.8 U/mg protein and a molecular mass of 32 kDa. Optimum temperature and pH were at 60 °C and 4.5, respectively. The enzyme was stable at up to 42 °C and in the pH range of 3.5-5.5 with a residual activity of over 80% for 24 h of t...

  10. Utilizing the CreA Gene to Better Understand Carbon Flux in Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Annecharico, Matthew D.; Baker, Scott E.

    2005-01-01

    Carbon catabolite repression (CCR) is a system which represses the synthesis of enzymes required for certain carbon sources when more favored carbon sources are present. Fungal enzymes are useful in various industrial applications such as the degradation of bi-product biomass produced in many areas of manufacturing and production. For example, the basidiomycete, Phanerochaete chrysosporium, a filamentous fungus, produces a number of lignin peroxidases (LiPs) such as an extra-cellular lignin-modifying protein and manganese-dependent peroxidase (MnPs). The LiPs secreted by P. chrysosporium are able to break down lignin, one of the main substances of wood, while leaving the cellulose behind. These enzymes are capable of degrading toxic waste as well as biomass waste. Through polysaccharide hydrolysis and lignin utilization, biobased products and biofuels can be processed from biomass instead of petroleum, which is more environmentally sound than current fuel options. Previous research in the fungal phylum, Ascomyces has shown that the creA gene is an important gene that controls various enzymes which have key roles in controlling carbon utilization by fungi. We hypothesize that there are similarities across all fungi in the mechanism by which carbon flux is controlled and that orthologs of the creA gene exist in all fungal phyla. A COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOP) polymerase chain reaction (PCR) strategy was used to isolate genomic fragments of the creA gene from a variety of fungi with the objective to design and utilize a method for isolation of the creA gene from a wide range of fungi.

  11. Computational studies on LiP H isolated from Ganoderma lucidum GD88

    Directory of Open Access Journals (Sweden)

    Parambayil Nayana

    2015-01-01

    Full Text Available Ganoderma lucidum is a basidiomycete fungus that produces ligninase for the modification of lignin. Lignin peroxidase (LiP is a glycoprotein that acts on the recalcitrant cell wall component lignin. In the present study, the phylogenetic analysis of Ganoderma lucidum GD88 with the partial coding sequence (cds of other LiP isoforms was performed using MEGA6. After determination of the open reading frame, the +3 frame nucleotide sequence was converted to protein using the EMBOSS Transseq and the secondary structure was predicted using the Chou and Fasman Secondary Structure Prediction server (CFSSP. Protein modeling was also performed by SWISS-MODEL. The obtained result shows that the lipH partial cds of Ganoderma lucidum GD88 is homologous to the lipD gene of Phanerochaete chrysosporium. The secondary structure prediction result revealed that the percent content of the helix (67 is higher than the percent contents of sheet (53.4 and turns (13.6. According to the generated model, LiP H protein is a homodimer with chains A and B. The heme acts as a ligand and plays a major role in structure stabilization.

  12. Fungal Bioconversion of Lignocellulosic Residues; Opportunities & Perspectives

    Directory of Open Access Journals (Sweden)

    Mehdi Dashtban, Heidi Schraft, Wensheng Qin

    2009-01-01

    Full Text Available The development of alternative energy technology is critically important because of the rising prices of crude oil, security issues regarding the oil supply, and environmental issues such as global warming and air pollution. Bioconversion of biomass has significant advantages over other alternative energy strategies because biomass is the most abundant and also the most renewable biomaterial on our planet. Bioconversion of lignocellulosic residues is initiated primarily by microorganisms such as fungi and bacteria which are capable of degrading lignocellulolytic materials. Fungi such as Trichoderma reesei and Aspergillus niger produce large amounts of extracellular cellulolytic enzymes, whereas bacterial and a few anaerobic fungal strains mostly produce cellulolytic enzymes in a complex called cellulosome, which is associated with the cell wall. In filamentous fungi, cellulolytic enzymes including endoglucanases, cellobiohydrolases (exoglucanases and β-glucosidases work efficiently on cellulolytic residues in a synergistic manner. In addition to cellulolytic/hemicellulolytic activities, higher fungi such as basidiomycetes (e.g. Phanerochaete chrysosporium have unique oxidative systems which together with ligninolytic enzymes are responsible for lignocellulose degradation. This review gives an overview of different fungal lignocellulolytic enzymatic systems including extracellular and cellulosome-associated in aerobic and anaerobic fungi, respectively. In addition, oxidative lignocellulose-degradation mechanisms of higher fungi are discussed. Moreover, this paper reviews the current status of the technology for bioconversion of biomass by fungi, with focus on mutagenesis, co-culturing and heterologous gene expression attempts to improve fungal lignocellulolytic activities to create robust fungal strains.

  13. Fungal bioconversion of lignocellulosic residues; opportunities & perspectives.

    Science.gov (United States)

    Dashtban, Mehdi; Schraft, Heidi; Qin, Wensheng

    2009-01-01

    The development of alternative energy technology is critically important because of the rising prices of crude oil, security issues regarding the oil supply, and environmental issues such as global warming and air pollution. Bioconversion of biomass has significant advantages over other alternative energy strategies because biomass is the most abundant and also the most renewable biomaterial on our planet. Bioconversion of lignocellulosic residues is initiated primarily by microorganisms such as fungi and bacteria which are capable of degrading lignocellulolytic materials. Fungi such as Trichoderma reesei and Aspergillus niger produce large amounts of extracellular cellulolytic enzymes, whereas bacterial and a few anaerobic fungal strains mostly produce cellulolytic enzymes in a complex called cellulosome, which is associated with the cell wall. In filamentous fungi, cellulolytic enzymes including endoglucanases, cellobiohydrolases (exoglucanases) and beta-glucosidases work efficiently on cellulolytic residues in a synergistic manner. In addition to cellulolytic/hemicellulolytic activities, higher fungi such as basidiomycetes (e.g. Phanerochaete chrysosporium) have unique oxidative systems which together with ligninolytic enzymes are responsible for lignocellulose degradation. This review gives an overview of different fungal lignocellulolytic enzymatic systems including extracellular and cellulosome-associated in aerobic and anaerobic fungi, respectively. In addition, oxidative lignocellulose-degradation mechanisms of higher fungi are discussed. Moreover, this paper reviews the current status of the technology for bioconversion of biomass by fungi, with focus on mutagenesis, co-culturing and heterologous gene expression attempts to improve fungal lignocellulolytic activities to create robust fungal strains. PMID:19774110

  14. High Level Secretion of Laccase (LccH) from a Newly Isolated White-Rot Basidiomycete, Hexagonia hirta MSF2

    Science.gov (United States)

    Kandasamy, Sujatha; Muniraj, Iniya K.; Purushothaman, Namitha; Sekar, Ashika; Sharmila, D. J. S.; Kumarasamy, Ramasamy; Uthandi, Sivakumar

    2016-01-01

    Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH) in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY) medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modeling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7) with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5%, respectively. Such high level secretion, thermal and solvent stability of LccH make H. hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications. PMID:27242729

  15. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  16. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  17. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Science.gov (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) region and fungal internal transcribed spacer 2 (ITS2) region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity. PMID:25884708

  18. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied. PMID:26330322

  19. Evaluation of different lignocellulosic substrates for the production of cellulases and xylanases by the basidiomycete fungi Bjerkandera adusta and Pycnoporus sanguineus.

    Science.gov (United States)

    Quiroz-Castañeda, Rosa Estela; Pérez-Mejía, Nancy; Martínez-Anaya, Claudia; Acosta-Urdapilleta, Lourdes; Folch-Mallol, Jorge

    2011-06-01

    Agricultural waste products are potential resources for the production of a number of industrial compounds, including biofuels. Basidiomycete fungi display a battery of hydrolytic enzymes with prospective use in lignocellulosic biomass transformation, however little work has been done regarding the characterization of such activities. Growth in several lignocellulosic substrates (oak and cedar sawdust, rice husk, corn stubble, wheat straw and Jatropha seed husk) and the production of cellulases and xylanases by two basidiomycete fungi: Bjerkandera adusta and Pycnoporus sanguineus were analyzed. Growth for P. sanguineus was best in rice husk while corn stubble supported the highest growth rate for B. adusta. Among the substrates tested, cedar sawdust produced the highest cellulolytic activities in both fungal species, followed by oak sawdust and wheat straw. Xylanolytic activity was best in oak and cedar sawdust for both species. We found no correlation between growth and enzyme production. Zymogram analysis of xylanases and cellulases showed that growth in different substrates produced particular combinations of protein bands with hydrolytic activity. PMID:20963471

  20. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  1. High-level recombinant protein production by the basidiomycetous yeast Pseudozyma antarctica under a xylose-inducible xylanase promoter.

    Science.gov (United States)

    Watanabe, Takashi; Morita, Tomotake; Koike, Hideaki; Yarimizu, Tohru; Shinozaki, Yukiko; Sameshima-Yamashita, Yuka; Yoshida, Shigenobu; Koitabashi, Motoo; Kitamoto, Hiroko

    2016-04-01

    Yeast host-vector systems are useful tools for the production of recombinant proteins. Here, we report the construction of a new high-level expression plasmid pPAX1-neo for the basidiomycetous yeast, Pseudozyma antarctica. pPAX1-neo harbours a xylose-inducible expression cassette under control of the xylanase promoter and terminator of P. antarctica T-34, a selection cassette of neomycin/G418 with an Escherichia coli neomycin resistance gene under control of the homocitrate synthase promoter of strain T-34, and an autonomously replicating sequence fragment of Ustilago maydis (UARS). Biodegradable plastic (BP)-degrading enzymes of P. antarctica JCM10317 (PaE) and Paraphoma-related fungal strain B47-9 (PCLE) were used as reporter proteins and inserted into pPAX1-neo, resulting in pPAX1-neo::PaCLE1 and pPAX1-neo::PCLE, respectively. Homologous and heterologous BP-degrading enzyme production of transformants of P. antarctica T-34 were detected on agar plates containing xylose and emulsified BP. Recombinant PaE were also produced by transformants of other Pseudozyma strains including Pseudozyma aphidis, Pseudozyma rugulosa, and Pseudozyma tsukubaensis. To improve the stability of transformed genes in cells, the UARS fragment was removed from linearized pPAX1-neo::PaCLE1 and integrated into the chromosome of the P. antarctica strain, GB-4(0), which was selected as a PaE producer in xylose media. Two transformants, GB-4(0)-X14 and X49, had an 11-fold higher activity compared with the wild type strain in xylose-containing liquid media. By xylose fed-batch cultivation using a 3-L jar fermentor, GB-4(0)-X14 produced 73.5 U mL(-1) of PaE, which is 13.4-fold higher than that of the wild type strain GB-4(0), which produced 5.5 U mL(-1) of PaE. PMID:26695155

  2. Ectomycorrhizas in vitro between Tricholoma matsutake, a basidiomycete that associates with Pinaceae, and Betula platyphylla var. japonica, an early-successional birch species, in cool-temperate forests.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Maruyama, Tsuyoshi; Neda, Hitoshi

    2015-04-01

    Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates with Pinaceae in the Northern Hemisphere and produces prized "matsutake" mushrooms. We questioned whether the symbiont could associate with a birch that is an early-successional species in boreal, cool-temperate, or subalpine forests. In the present study, we demonstrated that T. matsutake can form typical ectomycorrhizas with Betula platyphylla var. japonica; the associations included a Hartig net and a thin but distinct fungal sheath, as well as the rhizospheric mycelial aggregate "shiro" that is required for fruiting in nature. The in vitro shiro also emitted a characteristic aroma. This is the first report of an ectomycorrhizal formation between T. matsutake and a deciduous broad-leaved tree in the boreal or cool-temperate zones that T. matsutake naturally inhabits. PMID:25236465

  3. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes

    Science.gov (United States)

    Álvarez-Cervantes, Jorge; Díaz-Godínez, Gerardo; Mercado-Flores, Yuridia; Gupta, Vijai Kumar; Anducho-Reyes, Miguel Angel

    2016-01-01

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to determine that the proteins under study were classified into the GH10 and GH11 families, based on the regions of highly conserved amino acids, 233–318 and 180–193 respectively, where glutamate residues are responsible for the catalysis. PMID:27040368

  4. CYP63A2, a catalytically versatile fungal P450 monooxygenase capable of oxidizing higher-molecular-weight polycyclic aromatic hydrocarbons, alkylphenols, and alkanes

    Science.gov (United States)

    Cytochrome P450 monooxygenases (P450s) are known to oxidize hydrocarbons albeit with limited substrate specificity across classes of these compounds. Here we report a P450 monooxygenase (CYP63A2) from the model ligninolytic white rot fungus Phanerochaete chrysosporium that was fo...

  5. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    Energy Technology Data Exchange (ETDEWEB)

    Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.

    2009-07-01

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  6. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    International Nuclear Information System (INIS)

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  7. GenBank blastx search result: AK061841 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK061841 001-040-E04 S69963.1 mnp2=manganese peroxidase isozyme 2 {heat-shock elements, metal response eleme...nts} [Phanerochaete chrysosporium, Genomic, 3297 nt].|PLN PLN 2e-12 +3 ...

  8. Comparative studies of fungal degradation of single or mixed bioaccessible reactive azo dyes

    OpenAIRE

    Martins, M. Adosinda M.; Lima, Nelson; Silvestre, Armando J. D.; Queiroz, Maria João R. P.

    2003-01-01

    A screening using several fungi (Phanerochaete chrysosporium, Pleurotus ostreatus, Trametes versicolor and Aureobasidium pullulans) was performed on the degradation of syringol derivatives of azo dyes possessing either carboxylic or sulphonic groups, under optimized conditions previously established by us. T. versicolor showed the best biodegradation performance and its potential was confirmed by the degradation of differently substituted fungal bioaccessible dyes. Enzymatic assay...

  9. OXIDATION OF PERSISTANT ENVIRONMENTAL POLLUTANTS BY A WHITE ROT FUNGUS

    Science.gov (United States)

    The white rot fungus Phanerochaete chrysosporium degraded DDT [1,1,-bis(4-chlorophenyl)-2,2,2-trichloroethane], 3,4,3',4'-tetrachlorobiphenyl, 2,4,5,2',-4',5'-hexachlorobiphenyl, 2,3,7,8-tetrachlorodibenzo-p-dioxin, lindane (1,2,3,4,5,6-hexachlorocylohexane), and benzo[a]pyrene t...

  10. Molecular analysis of ectomycorrhizal basidiomycete communities in a Pinus sylvestris L. stand reveals long-term increased diversity after removal of litter and humus layers.

    Science.gov (United States)

    Smit, Eric; Veenman, Christiaan; Baar, Jacqueline

    2003-07-01

    Abstract The number of fruiting bodies of ectomycorrhizal species in pine forests in The Netherlands has decreased dramatically in recent decades. This decrease has been attributed to an increase in nitrogen deposition and the accumulation of litter and humus. The effects of sod cutting and the removal of litter and humus, to restore ectomycorrhizal diversity in a Scots pine forest in Dwingeloo, The Netherlands, were investigated previously from 1990 to 1993. Removal of the litter and humus resulted in a significant increase in the numbers of species and fruiting bodies of ectomycorrhizal fungi. However, until now all data were obtained by counting fruiting bodies and the effects on mycelial development below ground were not assessed. To investigate hyphal development, DNA was extracted from bulk soil and polymerase chain reaction products were obtained by amplification using basidiomycete-specific internal transcribed spacer (ITS) primers. The differences in diversity between the control plots and the treated plots were analyzed using denaturing gradient gel electrophoresis. To assess the species composition and differences, ITS regions of the amplified fragments were cloned and sequenced. Sequences were compared with sequences from GenBank and from fruiting bodies collected from the same plots. Data indicated increased below-ground ectomycorrhizal diversity in the plots that had been subjected to removal of the litter and humus layers. PMID:19719606

  11. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi. PMID:16447071

  12. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies. PMID:25954907

  13. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with the degree of soil organic matter humification and available electrolytes.

    Science.gov (United States)

    Gryndler, M; Soukupová, L; Gryndlerová, H; Baldrian, P; Hršelová, H

    2010-09-01

    Spatial distribution of ectomycorrhizae-associated basidiomycetes was determined in oakbirch forest using terminal restriction fragment length polymorphism (T-RFLP) analysis. The data were correlated with actual soil humidity, pH, electric conductivity of the soil extract, absorbance A(465) and A(665) of water and alkali soil extracts and with the ratio A(465)/A(665) (parameter A4/A6). Natural non-homogeneity of the soil parameters was used as experimental gradient. Distance-based redundancy analysis of the T-RFLP data (with soil parameters being taken as environmental parameters) provided significant results when ITS1F-terminanted restriction fragments were analyzed. Among other fungi, a Mycena galericulata related fungus was observed to correlate negatively with A4/A6, indicating its association with highly humified soil organic matter. Positive association of other, unidentified fungi with A4/A6 was also observed. Several other unidentified fungi negatively correlated with electric conductivity of the soil extract. The results may explain nonhomogeneity of the spatial distribution of the fungi associated with ectomycorrhizae as a result of their interaction with non-homogeneous soil environment. PMID:20941580

  14. Screening of basidiomycetes for the production of exopolysaccharide and biomass in submerged culture Triagem de basidiomicetos para a produção de exopolissacarídeos e biomassa em cultura líquida

    OpenAIRE

    Rosana Maziero; Valeria Cavazzoni; Vera Lúcia Ramos Bononi

    1999-01-01

    Fifty-six strains of Basidiomycetes, including native Brazilian fungi isolated from different ecosystems and edible mushrooms, were screened for production of exopolysaccharides and biomass in submerged culture. Agaricus sp. (CCB 280) and Oudemansiella canarii (Jungh.) Hohn (CCB 179) were the highest exopolysaccharide producers (6.01 and 3.54 g dry w./l respectively) after 7 days of incubation. The best producer of biomass was Schizophyllum commune Fr.:Fr. (CCB 473) with 16.68 g dry w./l in 1...

  15. Molecular systematics of the cotton root rot pathogen, Phymatotrichopsis omnivora

    OpenAIRE

    Marek, S.M.; Hansen, K; Romanish, M.; Thorn, R. G.

    2009-01-01

    Cotton root rot is an important soilborne disease of cotton and numerous dicot plants in the south-western United States and Mexico. The causal organism, Phymatotrichopsis omnivora (= Phymatotrichum omnivorum), is known only as an asexual, holoanamorphic (mitosporic) fungus, and produces conidia resembling those of Botrytis. Although the corticoid basidiomycetes Phanerochaete omnivora (Polyporales) and Sistotrema brinkmannii (Cantharellales; both Agaricomycetes) have been suggested as teleomo...

  16. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants. PMID:26756185

  17. Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher Basidiomycetes mushrooms.

    Science.gov (United States)

    Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P

    2014-01-01

    This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources

  18. Inonotus rickii (Pat. Reid: an important legnicolous basidiomycete in urban trees Inonotus rickii (Pat. Reid: um importante basidomiceta lenhícola em árvores urbanas

    Directory of Open Access Journals (Sweden)

    Ana Paula Ramos

    2008-12-01

    Full Text Available Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of heartwood. In some cases, chlamydospores masses and basidiocarps occurred on trunks and branches, especially on trees with more than 40 cm of DBH. Considering the increasingly importance of I. rickii and being C. australis one of the most important ornamental species used in the green areas of Lisbon, morphological and cultural characteristics of the pathogen are presented and its impact as agent of decline of urban trees is discussed.Inonotus rickii é um basidiomiceta que causa cancros, exsudações e podridão branca do cerne em diversas espécies arbóreas, tendo sido identificado em Portugal em 2002. No presente trabalho pretendeu-se avaliar a incidência da doença causada por I. rickii em Celtis australis, numa zona de Lisboa onde esta espécie é a principal árvore de alinhamento. A incidência da doença ronda os 19%, sendo os sintomas mais frequentes a redução do tamanho das folhas, morte de ramos e podridão branca do lenho. Por vezes, observaram-se a presença de massas de clamidósporos e a formação de basidiomas nos troncos e nas pernadas, essencialmente nas árvores com DAP superior a 40 cm. Considerando a importância crescente de I. rickii e sendo o lodão a espécie de eleição da cidade de Lisboa, descrevem-se as características morfológicas e culturais do fungo e discutese o papel que este patogénio pode assumir no declínio do arvoredo urbano.

  19. Biotreatment of red water with fungal systems

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, TenLin S.; Turner, R.J.; Sanville, C.J.

    1990-01-01

    Red water generated during the manufacture of trinitrotoluene (TNT) is an environmental concern because it contaminates ground surfaces and groundwaters. Past methods for the management of this hazardous waste stream did not meet pollution compliance or were not cost effective. Biodegradation of TNT by bacteria has been reported, but no conclusive evidence supports its biotransformation to harmless products or its complete mineralization. The lignin peroxidase (ligninase) secreted by the white rot fungus (Phanerochaete chrysosporium) has been shown to degrade a broad spectrum of organic pollutants. In this study, the efficacy of treating red water with the P. chrysosporium system was investigated.

  20. Evaluation of the types of starch for preparation of LDPE/starch blends

    OpenAIRE

    Glória Maria Vinhas; Suzana Moreira de Lima; Lívia Almeida Santos; Maria Alice Gomes de Andrade Lima; Yêda Medeiros Bastos de Almeida

    2007-01-01

    This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w) before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In ...

  1. Visualization of the mycelia of wood-rotting fungi by fluorescence in situ hybridization using a peptide nucleic acid probe.

    Science.gov (United States)

    Nakada, Yuji; Nakaba, Satoshi; Matsunaga, Hiroshi; Funada, Ryo; Yoshida, Makoto

    2013-01-01

    White rot fungus, Phanerochaete chrysosporium, and brown rot fungus, Postia placenta, grown on agar plates, were visualized by fluorescence in situ hybridization (FISH) using a peptide nucleic acid (PNA) probe. Mycelia grown on wood chips were also clearly detected by PNA-FISH following blocking treatment. To the best of our knowledge, this is the first report on the visualization of fungi in wood by FISH. PMID:23391931

  2. Evaluation of Potential Fungal Species for the in situ Simultaneous Saccharification and Fermentation (SSF) of Cellulosic Material

    OpenAIRE

    van Leeuwen, J.; Vincent, M; Pometto III, A. L.

    2011-01-01

    Three fungal species were evaluated for their abilities to saccharify pure cellulose. The three species chosen represented three major wood-rot molds; brown rot (Gloeophyllum trabeum), white rot (Phanerochaete chrysosporium) and soft rot (Trichoderma reesei). After solid state fermentation of the fungi on the filter paper for four days, the saccharified cellulose was then fermented to ethanol by using Saccharomyces cerevisiae. The efficiency of the fungal species in saccharifying the filter p...

  3. An insight into the lignin peroxidase of Macrophomina phaseolina

    OpenAIRE

    Akbar, Mohammed Touaha; Habib, Abdul Musaweer; Chowdhury, Dil Umme Salma; Bhuiyan, Md Iqbal Kaiser; Mostafa, Kazi Md Golam; Mondol, Sobuj; Mosleh, Ivan MHAI

    2013-01-01

    Macrophomina phaseolina is one of the deadliest necrotrophic fungal pathogens that infect more than 500 plant species including major food, fiber, and oil crops all throughout the globe. It secretes a cocktail of ligninolytic enzymes along with other hydrolytic enzymes for degrading the woody lignocellulosic plant cell wall and penetrating into the host tissue. Among them, lignin peroxidase has been reported only in Phanerochaete chrysosporium so far. But interestingly, a recent study has rev...

  4. Lignin Peroxidase Oxidation of Aromatic Compounds in Systems Containing Organic Solvents

    OpenAIRE

    Vazquez-Duhalt, Rafael; Westlake, Donald W. S.; Fedorak, Phillip M.

    1994-01-01

    Lignin peroxidase from Phanerochaete chrysosporium was used to study the oxidation of aromatic compounds, including polycyclic aromatic hydrocarbons and heterocyclic compounds, that are models of moieties of asphaltene molecules. The oxidations were done in systems containing water-miscible organic solvents, including methanol, isopropanol, N, N-dimethylformamide, acetonitrile, and tetrahydrofuran. Of the 20 aromatic compounds tested, 9 were oxidized by lignin peroxidase in the presence of hy...

  5. Transformation of Industrial Dyes by Manganese Peroxidases from Bjerkandera adusta and Pleurotus eryngii in a Manganese-Independent Reaction

    OpenAIRE

    Heinfling, A.; Martínez, M. J.; Martínez, A. T.; Bergbauer, M.; Szewzyk, U

    1998-01-01

    We investigated the transformation of six industrial azo and phthalocyanine dyes by ligninolytic peroxidases from Bjerkandera adusta and other white rot fungi. The dyes were not oxidized or were oxidized very little by Phanerochaete chrysosporium manganese peroxidase (MnP) or by a chemically generated Mn3+-lactate complex. Lignin peroxidase (LiP) from B. adusta also showed low activity with most of the dyes, but the specific activities increased 8- to 100-fold when veratryl alcohol was includ...

  6. Effect of different carbon sources on decolourisation of an industrial textile dye under alkaline-saline conditions

    OpenAIRE

    Ottoni, C. A.; Lima, Luís; Santos, Cledir; Lima, Nelson

    2014-01-01

    White-rot fungal strains of Trametes versicolor and Phanerochaete chrysosporium were selected to study the decolourisation of the textile dye, Reactive Black 5, under alkaline–saline conditions. Free and immobilised T. versicolor cells showed 100 % decolourisation in the growth medium supplemented with 15 g l-1 NaCl, pH 9.5 at 30 C in liquid batch culture. Continuous culture experiments were performed in a fixed-bed reactor using free and immobilised T. versicolor cel...

  7. Hydrolytic and Oxidative Mechanisms Involved in Cellulose Degradation

    OpenAIRE

    Nutt, Anu

    2006-01-01

    The enzymatic degradation of cellulose is an important process in nature. This thesis has focused on the degradation of cellulose by enzymes from two cellulose-degrading fungi, Hypocrea jecorina and Phanerochaete chrysosporium, including both the action of the individual enzymes and their synergistic interplay. The end-preference of cellobiohydrolases on crystalline cellulose was studied. Cellobiohydrolases belonging to glycosyl hydrolase (GH) family 7 were found to hydrolyse cellulose proce...

  8. BLEACHING OF SULFONATED CMP FROM BIO-TREATED WHEAT STRAW

    Institute of Scientific and Technical Information of China (English)

    HongYu; MenghuaQin; XuemeiLu; YinboQu; PeijiGao

    2004-01-01

    Wheat straw chemi-mechanical pulp was pretreated with a crude xylanase which was secreted by white rot fungus Phanerochaete Chrysosporium prior to hydrogen peroxide bleaching. The process of xylanase pretreatment and hydrogen peroxide bleaching was optimized. The xylanase treated pulp achieved a brightness gain of 5.8% ISO over the untreated pulp. The xylanase treatment was found to liberate reducing sugars and facilitating lignin removal. Fiber morphology of pulp treated with xylanase was also studied by SEM.

  9. Pengaruh Penambahan Jamur Pelapuk Putih (White Rot Fungi) pada Proses Pengomposan Tandan Kosong Kelapa Sawit

    OpenAIRE

    Nasrul Nasrul; Teuku Maimun

    2010-01-01

    Composting is nowadays a general treatment method for agriculture waste such as empty fruit bunch. This research article reported the composting process of the empty fruit bunches. The effect of addition of white rot fungi (Phanerochaete Chrysosporium) as an activator on composting product was studied. Experiment results indicated that white rot fungi is a good activator to improve degradation process of the empty fruit bunch become an organic fertilizer. White rot fungi has capable to increa...

  10. SACCHARIFICATION BY FUNGI AND ETHANOL PRODUCTION BY BACTERIA USING LIGNOCELLULOSIC MATERIALS

    OpenAIRE

    Srivastava Ajeet Kumar; Agrawal Pushpa

    2012-01-01

    Lignocellulosic material is one of the most abundant, renewable and inexpensive energy resources for bioethanol production. These materials are mainly composed of three groups of polymers namely cellulose, hemicellulose and lignin. Cellulose and hemicellulose are sugar rich fractions of interest for use in fermentation processes such as ethanol production. Cellulase production by the different fungi like Trichoderma reesei (MTCC-4876), Phanerochaete chrysosporium (MTCC-787) and Aspergillus aw...

  11. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  12. New polymeric model substrates for the study of microbial ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Kawai, S.; Jensen, K.A.; Bao, W.; Hammel, K.E. [Department of Agriculture Forest Products Lab., Madison, WI (United States)

    1995-09-01

    Lignin model dimers are valuable tools for the elucidation of microbial ligninolytic mechanisms, but their low molecular weight (MW) makes them susceptible to nonligninolytic intracellular metabolism. To address this problem, we prepared lignin models in which unlabeled and {alpha}-{sup 14}C-labeled {beta}-O-4-linked dimers were covalently attached to 8,000-MW polyethylene glycol (PEG) or to 45,000-MW polystyrene (PS). The water-soluble PEG-linked model was mineralized extensively in liquid medium and in solid wood cultures by the white rot fungus Phanerochaete chrysosporium, whereas the water-insoluble PS-linked model was not. Gel permeation chromatography showed that P. chrysosporium degraded the PEG-linked model by cleaving its lignin dimer substructure rather than its PEG moiety. C{sub {alpha}}-C{sub {beta}} cleavage was the major fate of the the PEG-linked model after incubation with P. chrysosporium in vivo and also after oxidation with P. chrysosporium lignin peroxidase in vitro. The brown rot fungus Gloeophyllum trabeum, which unlike P. chrysosporium lacks a vigorous extracellular liginolytic system, was unable to degrade the PEG-linked model efficiently. These results show that PEG-linked lignin models are a marked improvement over the low-MW models that have been used in the past. 32 refs., 8 figs., 3 tabs.

  13. Análisis de las reacciones de hipersensibilidad tipo I a los basidiomicetes en una población alérgica costarricense, durante 2009 Analysis of the reactions of type I hypersensitivity to the Basidiomycetes in a Costa Rican allergic population during 2009

    Directory of Open Access Journals (Sweden)

    Daniela Jaikel-Víquez

    2012-12-01

    Full Text Available Justificación y objetivos: Costa Rica es un país tropical en donde se ha encontrado una alta concentración de basidiosporas aéreas, las cuales miden alrededor de 4-13µm de diámetro, y son por definición aerobiológicas, capaces de penetrar a tracto respiratorio inferior, irrespetando la barrera nasal. El presente estudio tiene como objetivos encontrar posibles fuentes de contaminación ambiental por basidiomicetes y determinar si en Costa Rica sería necesario analizar, de forma rutinaria, la reactividad por alergenos a basidiomicetes en la población portadora de enfermedad rinobronquial alérgica. Métodos: se determinó el porcentaje de pacientes alérgicos a los extractos de basidiomicetes, tipo carbón Sporisorium cruentum y Ustilago cynodontis y tipo roya Puccinia graminis subsp. graminis. A la vez, se recolectaron panículas de Panicum maximum para evaluar su contaminación por basidiomicetes. Resultados: se encontró que el 59,23% de los pacientes eran alérgicos a hongos y que el tipo de hongo al que más pacientes presentaron alergia fueron los basidiomicetes. El 100% de las panículas recolectadas estaban contaminadas con un hongo del género Ustilago. Conclusión: se recomienda el testeo continuo por basidiomicetes, ya que estos son los hongos a los que la mayoría de los pacientes estudiados presentó alergia.Background and aim: Costa Rica is a tropical country in which a high concentration of aerial basidiospores has been found, which measure between 4-13 µm and are capable of arriving to the lower respiratory system, surpassing the nasal barrier. This study aims to find possible sources of environmental contamination by basidiomycetes and to determine if it is necessary to routinely analyze this allergen in the Costa Rican population that suffer from rhino bronchial allergy. Methods: The percentage of patients allergic to the extracts of basidiomycetes, specifically smuts like Sporisorium cruentum and Ustilago cynodontis

  14. DELIGNIFICACIÓN SELECTIVA DEL PASTO Pennisetum purpureum x Pennisetum typhoides USANDO BASIDIOMICETOS LIGNINOLÍTICOS SELECTIVE DELIGNIFICATION OF THE Pennisetum purpureum x Pennisetum typhoides GRASS USING LIGNINOLYTIC BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Freimar SEGURA S

    2008-01-01

    Full Text Available Muestras de pasto Pennisetum purpureum x Pennisetum typhoides de 120 días de corte se someten durante siete semanas a fermentación selectiva en estado sólido (FES con cepas de Ganoderma ssp y Lentinus ssp. Se realiza la caracterización de la delignificación por Infrarrojo con Transformada de Fourier (IR-TF midiendo las áreas de las principales bandas características. Mediante esta técnica se establece que en las muestras tratadas con Ganoderma spp se obtiene una pérdida del 70% de los compuestos aromáticos con relación a los alifáticos. En las semanas cero y séptima se establecieron valores de lignina en detergente ácido (LDA de 55,9% y 10,7%, respectivamente. En este mismo período los contenidos de materia seca y celulosa variaron del 73,3% al 92,9% y del 3,1% al 51,7% respectivamente. Estos resultados confirman una degradación selectiva de la lignina en las muestras tratadas con Ganoderma spp y medios suplementados con manganeso. Las pruebas de degradabilidad in situ, utilizando la técnica de la bolsa de nailon y de digestibilidad in vitro de la materia seca basada en técnicas enzimáticas y gravimétricas, no mostraron mejoramiento de la digestibilidad de la materia seca del pasto como consecuencia de la fermentación con las dos cepas de hongos basidiomicetos, corroborando lo indicado por otros autores que afirman que los hongos pueden ser tóxicos para la microflora del rumen y, por lo tanto, pueden afectar la digestibilidad de la materia seca.Samples of Pennisetum purpureum x Pennisetum typhoides grass of 120 days are put under selective fermentation in solid state with two strains of basidiomycetes fungi Ganoderma ssp and Lentinus ssp, during seven weeks. The delignification characterization is made by Fourier Transform Infrared Spectroscopy (FTIR measuring the areas of the main characteristic bands. In the samples treated with the Ganoderma ssp strain, a loss of 70% of aromatic compounds in relation to the aliphatics is

  15. Photochemical and microbial degradation technologies to remove toxic chemicals

    International Nuclear Information System (INIS)

    An effort was made to apply photochemical degradation technology on biodegradation processes to increase the bioremediation potential of microbial actions. For this purpose, we have chosen Phanerochaete chrysosporium, a wood decaying white-rot fungus and a variety of chlorinated pesticides and aromatics as study materials. By using UV-irradiation and benomyl (a commonly used fungicide) as selection methods, a strain of UV-resistant P. chrysosporium was developed. This strain was found to be capable of rapidly degrading these chlorinated chemicals when they were incubated in N-deficient medium which received 1 hr/day of UV-irradiation. UV-irradiation either at 300 or 254 nm showed the beneficial effect of speeding up the rate of degradation on most of test chemicals with the exception of toxaphene and HCH (hexachlorocyclohexane). By adding fresh glucose to the medium it was possible to maintain high degradation capacity for several weeks

  16. Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

    International Nuclear Information System (INIS)

    The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT ampersand E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable for the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs

  17. Biodecolourisation of reactive red an industrial dye by Phlebia spp. .

    Science.gov (United States)

    Chander, Mukesh; Singh, Daljit; Kaur, Ramandeep

    2014-11-01

    Four white rot fungi namely Phanerochaete chrysosporium, Phlebia floridensis, P. radiata and P. brevispora were selected for their ligninolytic enzymes viz., lignin peroxidase, manganese peroxidase and laccase. Cell free enzyme extracts (as such and concentrated) obtained from these fungi were tested for their ability to decolourise reactive red 28 (Congo red), an industrial dye. The use of cell free enzyme extracts helped to overcome the problem of adsorption of dye to mycelia. Laccase production was best expressed in P. brevispora. Increase in decolourisation percentage by concentrated culture extract was comparable to increase in enzyme activity. P. floridensis proved to be a better dye decolouriser in comparison to Pha. chrysosporium, thus showing its potential for biocleaning of industrial wastes and wastewaters. PMID:25522502

  18. Degradation of 3,3',4,4'-tetrachlorobiphenyl by selected white rot fungi

    International Nuclear Information System (INIS)

    N-limited stationary cultures of the white rot fungi Phanerochaete chrysosporium, Trametes versicolor, and Coriolopsis polysona mineralized 1.393 ± 0.353 (0.301 ± 0.023) and 0.398 ± 0.061 (0.112 ± 0.010), and 0.015 ± 0.004 (0.002 ± 0.0008) % of the originally supplied 30.14 nmol (513.7 nmol) of 3,3′,4,4′-tetrachloro[U-14C]biphenyl (PCB 77) during 4 weeks. The extent of PCB 77 degradation was followed by 14C-radioactivity partitioning into aqueous, organic soluble, biomass associated, aqueous (intracellular) and organic soluble (intracellular) fractions. After four weeks incubation the pattern of distribution of radioactivity was similar in P. chrysosporium and C. polysona at higher dose but not at the lower dose of PCB 77. T. versicolor differed in the distribution pattern of radiolabel

  19. Endogenous cytokinins in medicinal basidiomycetes mycelial biomass

    OpenAIRE

    VEDENICHEVA N.P.; AL-MAALI G.A.; MYTROPOLSKA N. YU.; MYKHAYLOVA O.B.; N. A. Bisko; I.V. Kosakivska

    2016-01-01

    The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species ( Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa ) using HPLC. Trans and cis -zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species ( G. lucidum, strain 1900) contain...

  20. Cryopreservation of basidiomycete strains using perlite

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Nerud, František

    2001-01-01

    Roč. 2001, - (2001), s. 1281-1287. ISSN 0167-7012 Institutional research plan: CEZ:AV0Z5020903 Keywords : macrolactone * glycoside * esters Subject RIV: EE - Microbiology, Virology Impact factor: 1.810, year: 2001

  1. Biotransformations of organic energetic materials

    International Nuclear Information System (INIS)

    This paper reviews data on the acute eco-toxicity and delayed effects (mutagenicity) of the model substance (TNT) and of a wide spectrum of its biodegradation products in the wastewaters. It also suggests main metabolic pathways of biotransformation, involving biological reduction. Some possibilities of remediation of contaminated soils utilising microbial catabolic pathways leading to the hydroxy derivatives and up to the cleavage of the aromatic ring system in the presence of the soil bacteria Pseudomonas fluorescens are shown, as well as the practical utilisation of fungi Phanerochaete chrysosporium under aerobic conditions

  2. Inmovilización de hongos ligninolíticos para la remoción del colorante negro reactivo 5

    Directory of Open Access Journals (Sweden)

    Jorge Andrés Fernández

    2009-06-01

    Full Text Available Immobilising lignilolytic fungus for removing reactive black 5 dye Resumen: La presencia de colorantes azoicos en aguas residuales de la industria textil es un problema ambiental y sanitario, porque muchos de estos compuestos son cancerígenos. Los tratamientos biológicos son una alternativa para la remoción de ese tipo de colorantes. En el presente trabajo se evaluó el efecto de tres hongos de podredumbre blanca, Trametes versicolor, Pleurotus ostreatus y Phanerochaete chrysosporium sobre la decoloración de un agua que contiene colorante negro reactivo 5 (NR5, ampliamente usado en la industria textil. Se estudió la inmovilización de estos hongos en dos soportes, espuma de poliuretano y estropajo (L. cylíndrica para seleccionar el mejor soporte y el hongo con mayor capacidad para la decoloración. Ambos soportes fueron igualmente efectivos, pero se seleccionó estropajo por ser un producto natural. El hongo que generó los mayores porcentajes de decoloración en 4 días fue Trametes versicolor, con 96%, 98% y 98% para agua con concentración de NR5 300 ppm, 150 ppm y 75 ppm, respectivamente. La actividad lacasa para cada concentración de NR5 fue 8 U L-1, 7 U L-1 y 5 U L-1.Palabras clave: , Trametes versicolor; Pleurotus ostreatus y Phanerochaete chrysosporium Luffa cylindrinca; espuma de poliuretano y negro reactivo 5. Abstract: Waste water from the textile industry represents a major environmental and health problem because it contains azo dyes whose carcirogenic effect has been tested in research. Biological treatment represents a valuable alternative for removing these dyes. The effect of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium rot fungi on decoloration of water containing reactive black five (NR5 textile dye was evaluated in this work. Immobilising the fungi on polyurethane foam and luffa sponge (Luffa cylindrica supports was studied in order to select the best support and the fungi having the best

  3. SOIL FUNGI: POTENTIAL MYCOREMEDIATORS OF LIGNOCELLULOSIC WASTE

    Directory of Open Access Journals (Sweden)

    Y. Avasn Maruthi

    2010-05-01

    Full Text Available The continual expansion of urbanization and industrial activity has led to the accumulation of a large quantity of lignocellulosic residues throughout the world. In particular, large quantities of paper and bagasse are largely produced in Visakhapatnam. In this work we present the study of the degradability of these substrates with fungi. Three cultures of soil fungi were screened for their ability to degrade cellulose. Aspergillus flavus degraded the most, as shown by the highest CO2 release. Further, Aspergillus flavus was tested with the standard fungus Phanerochaete chrysosporium for cellulose degradation, which showed nearly equivalent potential.

  4. Integration of Chemical and Biological Catalysis

    DEFF Research Database (Denmark)

    Schwartz, Thomas J.; Goodman, Samuel M.; Osmundsen, Christian Mårup;

    2013-01-01

    Furylglycolic acid (FA), a pseudoaromatic hydroxy-acid suitable for copolymerization with lactic acid, can be produced from glucose via enzymatically derived cortalcerone using a combination of Bronsted and Lewis acid catalysts. Cortalcerone is first converted to furylglyoxal hydrate (FH) over a......-ulose dehydratase from the wood-decay fungus Phanerochaete chrysosporium BKM-F-1767. This enzymatically derived cortalcerone is converted in one pot to FA in a methanol/water solvent over an Al-containing Sn-beta zeolite possessing both Bronsted and Lewis acid sites, achieving 42% selectivity to FA at...

  5. Animal bioavailability of defined xenobiotic lignin metabolites

    International Nuclear Information System (INIS)

    Lignin has been recognized as a major component of bound pesticide residues in plants and is thought to be undigestible in animals. Two defined ring-U-14C-labeled chloroaniline/lignin metabolites have now been fed to rats, where a release of ∼66% of the bound xenobiotic occurred in the form of simple chloroaniline derivatives. The observed high degree of bioavailability indicates that bound pesticidal residues may possess ecotoxicological significance. In parallel studies, the white-rot fungus Phanerochaete chrysosporium was more efficient, and a soil system was much less efficient, in the degradation of the [ring-U-14C]chloroaniline/lignin metabolites

  6. PRODUCTION OF EXTRACELLULAR KERATINASE BY CHRYSOSPORIUM TROPICUM AND TRICHOPHYTON AJELLOI

    OpenAIRE

    Jaroslava Kačinová; Dana Tančinová; Juraj Medo

    2014-01-01

    Keratinous wastes constitute a troublesome environmental contaminant that is produced in large quantities in companies processing of poultry and their further use has ecological significance. We can use for degradation of keratinous wastes enzymes or strains, which produce these enzymes. The aim of this study was isolation of keratinophilic fungi from the soil samples and optimalization of culture conditions of keratinase producing strains in vitro. For the isolation of our strains, we used h...

  7. Transformation behavior of lead fractions during composting of lead-contaminated waste

    Institute of Scientific and Technical Information of China (English)

    LIU Jian-xiao; XU Xiang-min; HUANG Dan-lian; ZENG Guang-ming

    2009-01-01

    The transformation behaviors of Pb fractions during composting of Pb-polluted waste without inoculants and with the inoculants of Phanerochaete chrysosporium were studied. Results show that the active Pb ions with high toxicity and transferability are transformed into the inactive Pb with low toxicity and transferability, confirming that Pb ions can be efficiently immobilized during composting without or with the inoculants. The soluble-exchangeable Pb in composting without inoculants reaches 49.0 mg/kg at day 60, while that with the inoculants is reduced to 0 mg/kg dry mass compost. The higher contents of organic-bound Pb (59.0 mg/kg) and residual Pb (69.2 mg/kg) with low toxicity are found after 60-day composting with inoculants, compared with those without inoculants. The above data indicate the better immobilization effect of Pb and the greater alleviation of Pb hazards in composting with the inoculants of Phanerochaete chrysosporium than without inoculants, which may be due to the more microbial biomass and the higher pH value in composting of Pb-polluted waste with inoculants.

  8. ACCELERATED LABORATORY TEST OF RUBBERWOOD ORIENTED STRANDBOARD EXPOSED TO WOOD DECAY FUNGI

    Directory of Open Access Journals (Sweden)

    Esmeralda Yoshico Arakaki Okino

    2009-10-01

    Full Text Available This work aimed to evaluate the natural durability of oriented strandboards (OSB manufactured with strands of Hevea brasiliensis Müll.Arg. bonded with 5% and 8% of urea-formaldehyde (UF and phenol-formadehyde (FF resins, exposed to xilophagous fungi under laboratory conditions. In accelerated laboratory test decay, samples of OSB were exposed to the following fungi: the brown-rot fungi Gloeophyllum trabeum (Pers. ex Fries Murr., Coniophora puteana (Schumach. : Fr.P. Karst., Meruliporia incrassata (Berk. & M.A. Curtis Murrill as well as the white-rot fungi Fomes annosus (Fr. : Fr. Cooke, Trametes versicolor (L. : Fr. Pilát, Ganoderma applanatum (Pers. Pat., Bjerkandera fumosa (Pers. : Fr. P. Karst. and Phanerochaete chrysosporium Burds. Among the brown-rot fungi, the Gloeophyllum trabeum was the most aggressive, showing the highest loss of mass. Trametes versicolor and Ganoderma applanatum confirmed the preference for broadleave species. All oriented strandboards at lower UF resin contents were more degraded by Phanerochaete chrysosporium, Trametes versicolor, Ganoderma applanatum, Merulia incrassata, Coniophora puteana and Gloeophyllum trabeum, with high rate of loss of mass. Coniophora puteana showed small loss of mass when FF resin was applied. Bjerkandera fumosa showed low loss of mass only at higher resin content. Oriented strandboards exposed to Coniophora puteana showed insignificant OSB degradation.

  9. Utility of four strains of white-rot fungi for the detoxification of 2,4,6-trinitrotoluene in liquid culture

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, K.C.; Chen, J.C.; Huebner, H.J.; Brown, K.W.; Autenrieth, R.L.; Bonner, J.S. [Texas A and M Univ., College Station, TX (United States)

    1997-06-01

    The purpose of this study was to investigate the potential of four different strains of white-rot fungi (Phanerochaete chrysosporium, Phanerochaete sordida, Phlebia brevispora, and Cyathus stercoreus) to degrade 2,4,6-trinitrotoluene (TNT) in liquid medium. Loss of TNT from the culture medium was determined using high-performance liquid chromatography (HPLC), while the mutagenicity of the medium residues were evaluated using the Salmonella/microsome bioassay. The data indicate that within 21 d of incubation, all fungi were able to reduce the TNT concentration in the liquid medium to below detection limits. In this study, P. sordida showed a relatively high growth rate and the fastest rate of TNT degradation. The fungal treatment also produced a significant reduction of TNT mutagenicity. Treatment with C. stercoreus, P. brevispora, P. sordida, and P. chrysosporium resulted in the elimination of 94%, 90%, 87%, and 67% of the initial TNT-amended medium mutagenicity, respectively. The data also demonstrate that during incubation, TNT was eliminated from the culture medium two to eight times faster than the reduction in mutagenic potential. These results suggest that TNT disappearance alone cannot be used as the sole criterion in TNT remediation. Chemical analysis revealed that the major metabolites in the initial transformation of TNT were the monoamino-dinitrotoluenes, which were also degraded by the selected white-rot fungi. The study demonstrated that the white-rot fungi are capable of metabolizing and detoxifying TNT under aerobic conditions in nonligninolytic liquid medium.

  10. Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

    Directory of Open Access Journals (Sweden)

    Georgios Koutrotsios

    2014-01-01

    Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.

  11. Lignolytic Enzymes of a Mushroom Stereum ostrea Isolated from Wood Logs

    Directory of Open Access Journals (Sweden)

    K. Praveen

    2011-01-01

    Full Text Available Production of lignolytic enzymes by the mushroom fungus Stereum ostrea in liquid medium under conditions of vegetative growth was examined for 10 days in comparison to the reference culture Phanerochaete chrysosporium. Though growth and secretion of extracellular protein by S. ostrea were comparable to those of P. chrysosporium, yields of laccase enzyme by S. ostrea were higher than laccase titres of P. chrysosporium by more than 2 folds on the peak production time interval (IVth day of incubation. S. ostrea yielded titres of 25 units of laccase/ml as against 8.9 units of laccase/ml on the IVth day of incubation. Stereum ostrea also exhibited activities of other lignolytic enzymes, lignin peroxidase (LiP and manganese peroxidase (MnP, higher than the reference culture. Growth of S. ostrea on the medium in the presence of Remazol orange 16 resulted in the decolourisation of dye, confirming the presence of lignolytic enzymes. S. ostrea appears to be a promising culture with complete lignolytic system.

  12. Extracellular oxidases and the transformation of solubilised low-rank coal by wood-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ralph, J.P. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Graham, L.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Catcheside, D.E.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences

    1996-12-31

    The involvement of extracellular oxidases in biotransformation of low-rank coal was assessed by correlating the ability of nine white-rot and brown-rot fungi to alter macromolecular material in alkali-solubilised brown coal with the spectrum of oxidases they produce when grown on low-nitrogen medium. The coal fraction used was that soluble at 3.0{<=}pH{<=}6.0 (SWC6 coal). In 15-ml cultures, Gloeophyllum trabeum, Lentinus lepideus and Trametes versicolor produced little or no lignin peroxidase, manganese (Mn) peroxidase or laccase activity and caused no change to SWC6 coal. Ganoderma applanatum and Pycnoporus cinnabarinus also produced no detectable lignin or Mn peroxidases or laccase yet increased the absorbance at 400 nm of SWC6 coal. G. applanatum, which produced veratryl alcohol oxidase, also increased the modal apparent molecular mass. SWC6 coal exposed to Merulius tremellosus and Perenniporia tephropora, which secreted Mn peroxidases and laccase and Phanerochaete chrysosporium, which produced Mn and lignin peroxidases was polymerised but had unchanged or decreased absorbance. In the case of both P. chrysosporium and M. tremellosus, polymerisation of SWC6 coal was most extensive, leading to the formation of a complex insoluble in 100 mM NaOH. Rigidoporus ulmarius, which produced only laccase, both polymerised and reduced the A{sub 400} of SWC6 coal. P. chrysosporium, M. tremellosus and P. tephropora grown in 10-ml cultures produced a spectrum of oxidases similar to that in 15-ml cultures but, in each case, caused more extensive loss of A{sub 400}, and P. chrysosporium depolymerised SWC6 coal. It is concluded that the extracellular oxidases of white-rot fungi can transform low-rank coal macromolecules and that increased oxygen availability in the shallower 10-ml cultures favours catabolism over polymerisation. (orig.)

  13. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  14. Low carbon/nitrogen ratio increases laccase production from basidiomycetes in solid substrate cultivation Reduzida relação carbono/nitrogênio aumenta a produção de lacase por basidiomicetos em cultivo de semissólido

    Directory of Open Access Journals (Sweden)

    Érica Clarissa D'Agostini

    2011-06-01

    Full Text Available Basidiomycetes are laccase producers used for hydrolysis of lignocellulosic byproducts in fermentative processes and could be used on biofuel production or ruminant feeding. The objective of this study was to evaluate the effect of concentrations of non-protein nitrogen sources on laccase production and mycelial growth of Pleurotus ostreatus, Lentinula edodes and Agaricus blazei. The fungi were grown on soybean hulls to which urea (U, ammonium sulfate (AS or mixture of AS:U (1:1 were added to achieve carbon/nitrogen (C/N ratios of 5, 15, 20 or 30. The average longitudinal mycelial growth was measured and laccase activity was determined by the oxidation of 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid. Higher C/N ratios increased mycelial growth and decreased laccase production. The highest activities were obtained with a C/N ratio of 5. P. ostreatus, L. edodes and A. blazei produced more laccase when AS, AS:U and U, respectively, were added. In addition, C/N ratios lower than 30 induced laccase syntheses, inhibited mycelial growth and were a better condition for pre-hydrolysis of plant residues.Basidiomicetos são produtores de lacases utilizadas na hidrólise de subprodutos lignocelulósicos em processos fermentativos e pode ser utilizado na produção de biocombustíveis ou na alimentação de ruminantes. Avaliou-se o efeito da adição de fontes e concentrações de nitrogênio não-protéico na produção de lacase e no crescimento micelial de Pleurotus ostreatus, Lentinula edodes e Agaricus blazei. Os fungos foram cultivados em cascas de soja com adição de uréia (U, sulfato de amônio (AS ou AS:U (1:1 de forma a manter a relação carbono/ nitrogênio (C/N de 5, 15, 20 ou 30. O crescimento micelial longitudinal médio foi medido, e a atividade da lacase foi determinada pela oxidação do ácido 2,2'-azino-bis-3-etilbenzotiazolina-6-sulfônico. O crescimento micelial foi diretamente proporcional à relação C/N, enquanto a

  15. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015). E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.234, year: 2014

  16. A New p-Terphenyl Derivative from Basidiomycetes Boletopsis grisea

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new p-terphenyl derivative 1 was isolated from the fruiting bodies of Boletopsis grisea. Its structure was established as 2, 3-diacetoxy-4', 4", 5, 6-tetrahydroxy-p-terphenyl by spectroscopic and chemical means.

  17. Prevalence of transcription factors in ascomycete and basidiomycete fungi

    OpenAIRE

    Todd, Richard B.; Zhou, Miaomiao; Ohm, Robin A.; Leeggangers, Hendrika ACF; Visser, Loek; de Vries, Ronald P

    2014-01-01

    Background Gene regulation underlies fungal physiology and therefore is a major factor in fungal biodiversity. Analysis of genome sequences has revealed a large number of putative transcription factors in most fungal genomes. The presence of fungal orthologs for individual regulators has been analysed and appears to be highly variable with some regulators widely conserved and others showing narrow distribution. Although genome-scale transcription factor surveys have been performed before, no ...

  18. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448. ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  19. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125. ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  20. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S; Kharb, D.; Raghukumar, C.; Kuhad, R

    isolate RCK-3 was found to decolorizemore of Congo Red (69%), Xylidine Ponceau 2R (100%), Poly R-478 (96%), Indigo Carmine (99%), Lissamine Green B (90%), Toluidine Blue (57%) and textile effluent B (54%), than the rest of fungi. Percentage decolorization...

  1. Transgene expression in the basidiomycete root pathogen Armillaria mellea.

    Science.gov (United States)

    Toward development of a genetic transformation system for Armillaria mellea, we used particle bombardment to identify promoters for driving transgene expression. The plasmid tested was pYES-hph-004iGFP, on which the green fluorescence protein gene, gfp, is linked to the Agaricus bisporus gpdII promo...

  2. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  3. DNA-mediated transformation of the basidiomycete Coprinus cinereus.

    OpenAIRE

    Binninger, D M; Skrzynia, C.; Pukkila, P. J.; Casselton, L A

    1987-01-01

    We have developed a simple and efficient transformation system for the agaric fungus, Coprinus cinereus. Protoplasts were prepared from asexual spores that harbor one or two mutations in the structural gene for tryptophan synthetase. The protoplasts can be stably transformed using the cloned Coprinus gene at a frequency of 1 in 10(4) viable protoplasts. A variety of molecular events accompanies the formation of stable transformants, including insertion of the transforming DNA at the homologou...

  4. Dicty_cDB: VFC786 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CATTGFVATKGWDAV Translated Amino Acid sequence (All Frames) Frame A: ---hacatstqesylfisxrfdhxwwwflqllpttsmai...XGC_Tad1 Xenopus laevis cDNA clone IMAGE:6880798 3', mRNA sequence. 42 6.3 1 AW644748 |AW644748.1 cm45h05.w1 Black... dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16486-1 Original site URL http://dictycdb.biol.tsukuba.ac...103; Alt... 186 3e-46 DQ242648_1( DQ242648 |pid:none) Phanerochaete chrysosporium family... 123 3e-27 AC1169...00 mit: 0.29 mip: 0.11 nuc: 0.00 erl: 0.00 erm: 0.00 pox: 0.00 px2: 0.00 vac: 0.00 rnp: 0.00 act: 0.00 caa:

  5. Manganese regulation of manganese peroxidase expression and lignin degradation by the white rot fungus Dichomitus squalens

    International Nuclear Information System (INIS)

    Extracellular manganese peroxidase and laccase activities were detected in cultures of Dichomitus squalens (Polyporus anceps) under conditions favoring lignin degradation. In contrast, neither extracellular lignin peroxidase nor aryl alcohol oxidase activity was detected in cultures grown under a wide variety of conditions. The mineralization of 14C-ring-, -side chain-, and -methoxy-labeled synthetic guaiacyl lignins by D. squalens and the expression of extracellular manganese peroxidase were dependent on the presence of Mn(II), suggesting that manganese peroxidase is an important component of this organism's lignin degradation system. The expression of laccase activity was independent of manganese. In contrast to previous findings with Phanero-chaete chrysosporium, lignin degradation by D. squalens proceeded in the cultures containing excess carbon and nitrogen

  6. Dicty_cDB: Contig-U02126-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 79 ) RecName: Full=Citrate synthase, peroxisomal; E... 40 0.034 DQ674540_1( DQ674540 |pid:none) Coccidioides posadasii ci...m chrysogenum Wisconsi... 41 0.015 CP000585_177( CP000585 |pid:none) Ostreococcus lucimarinus CCE9901... 40 ....076 AB272085_1( AB272085 |pid:none) Phanerochaete chrysosporium Cit1 m... 39 0.076 AY144810_1( AY144810 |pid:none) Sacc...DNA c... 36 0.49 CU633872_205( CU633872 |pid:none) Podospora anserina genomic DNA c... 35 0.64 DQ849026_1( DQ849026 |pid:none) Hypoc...tial mR... 45 0.001 (A4HXU4) RecName: Full=Probable citrate synthase, mitochondrial;... 44 0.002 (Q4QDX3) RecName: Full=Probable ci

  7. Lignin peroxidase oxidation of aromatic compounds in systems containing organic solvents.

    Science.gov (United States)

    Vazquez-Duhalt, R; Westlake, D W; Fedorak, P M

    1994-02-01

    Lignin peroxidase from Phanerochaete chrysosporium was used to study the oxidation of aromatic compounds, including polycyclic aromatic hydrocarbons and heterocyclic compounds, that are models of moieties of asphaltene molecules. The oxidations were done in systems containing water-miscible organic solvents, including methanol, isopropanol, N, N-dimethylformamide, acetonitrile, and tetrahydrofuran. Of the 20 aromatic compounds tested, 9 were oxidized by lignin peroxidase in the presence of hydrogen peroxide. These included anthracene, 1-, 2-, and 9-methylanthracenes, acenaphthene, fluoranthene, pyrene, carbazole, and dibenzothiophene. Of the compounds studied, lignin peroxidase was able to oxidize those with ionization potentials of stability characteristics of lignin peroxidase were determined by using pyrene as the substrate in systems containing different amounts of organic solvent. Benzyl alkylation of lignin peroxidase improved its activity in a system containing water-miscible organic solvent but did not increase its resistance to inactivation at high solvent concentrations. PMID:16349176

  8. [Effect of pretreatment by solid-state fermentation of sawdust on the pelletization and pellet's properties].

    Science.gov (United States)

    Guo, Jingjing; Yuan, Xingzhong; Li, Hui; Li, Changzhu; Xiao, Zhihong; Xiao, Zhihua; Jiang, Longbo; Zeng, Guangming

    2015-10-01

    We pretreated sawdust (Castanopsis fissa Rehd.et Wils) by solid state fermentation (SSF) with Phanerochaete chrysosporium, and then compressed it into pellets with the moisture content of 15% and the pressure of 98 MPa, to solve the problem of low density, low Meyer hardness, high water uptake, and short storage period of pellet in the woody pellet industry. We studied the effects of fermentation time on pelletization and pellets's characteristics (including energy consumption, density, Meyer hardness, and hydrophobicity). SSF affected the heating values of pellet. Compared with fresh sawdust, SSF consumed more energy at the maximal value by 6.98% but saved extrusion energy by 32.19% at the maximum. Meanwhile, SSF could improve the density, Meyer hardness and hydrophobicity of pellet. Pellet made of sawdust pretreated by SSF for 48 d had best quality, beneficial for long-term transportation and storage of pellets. PMID:26964334

  9. Effect of different carbon sources on decolourisation of an industrial textile dye under alkaline-saline conditions.

    Science.gov (United States)

    Ottoni, Cristiane; Lima, Luis; Santos, Cledir; Lima, Nelson

    2014-01-01

    White-rot fungal strains of Trametes versicolor and Phanerochaete chrysosporium were selected to study the decolourisation of the textile dye, Reactive Black 5, under alkaline-saline conditions. Free and immobilised T. versicolor cells showed 100 % decolourisation in the growth medium supplemented with 15 g l(-1) NaCl, pH 9.5 at 30 °C in liquid batch culture. Continuous culture experiments were performed in a fixed-bed reactor using free and immobilised T. versicolor cells and allowed 85-100 % dye decolourisation. The immobilisation conditions for the biomass and the additional supply of carbon sources improved the decolourisation performance during a long-term trial of 40 days. Lignin peroxidase, laccase and glyoxal oxidase activities were detected during the experiments. The laccase activity varied depending on carbon source utilized and glycerol-enhanced laccase activity compared to sucrose during extended growth. PMID:23982200

  10. Solid state bioconversion of oil palm biomass for ligninase enzyme production.

    Science.gov (United States)

    Alam, Md Zahangir; Mahmat, Mohd Erman; Muhammad, Nurdina

    2005-01-01

    A laboratory-scale study of bioconversion of local lignocellulosic material, oil palm biomass (OPB) was conducted by evaluating the enzyme production through microbial treatment in solid state bioconversion (SSB). OPB in the form of empty fruit bunches (EFB) was used as a solid substrate and treated with the white-rot fungus, Phanerochaete chrysosporium, to produce ligninase. The results showed that the highest ligninase activity of 400.27 U/liter was obtained at day 12 of fermentation. While the optimum study indicated the enzyme production of 1472.8 U/liter with moisture content of 50%, 578.7 U/liter with 10% v/w of inoculum size, and 721.8 U/liter with co-substrate concentration of 1% (w/w) at days 9, 9 and 12 of fungal treatment, respectively. The parameters glucosamine and reducing sugar were observed to evaluate the growth and substrate utilization in the experiment. PMID:16317964

  11. Pengaruh Penambahan Jamur Pelapuk Putih (White Rot Fungi pada Proses Pengomposan Tandan Kosong Kelapa Sawit

    Directory of Open Access Journals (Sweden)

    Nasrul Nasrul

    2010-12-01

    Full Text Available Composting is nowadays a general treatment method for agriculture waste such as empty fruit bunch. This research article reported the composting process of the empty fruit bunches. The effect of addition of white rot fungi (Phanerochaete Chrysosporium as an activator on composting product was studied. Experiment results indicated that white rot fungi is a good activator to improve degradation process of the empty fruit bunch become an organic fertilizer. White rot fungi has capable to increase composting period become shorter in compare with original composting without addition of white rot fungi. The organic fertilizer product as regulation issued by the Standar Nasional Indonesia (NSI can be achieved in duration of 3 months, while for original process without addition of white rot fungi longer degradation time is necessary. Keyword: Composting, empty fruit bunch, white rot fungi

  12. Oxidative 4-dechlorination of polychlorinated phenols is catalyzed by extracellular fungal lignin peroxidases

    International Nuclear Information System (INIS)

    The extracellular lignin peroxidases (ligninases) of Phanerochaete chrysosporium catalyzed H2O2-dependent spectral changes in several environmentally significant polychlorinated phenols: 2,4-dichloro-, 2,4,5-trichloro-, 2,4,6-trichloro-, and pentachlorophenol. Gas chromatography/mass spectrometry of reduced and acetylated reaction products showed that, in each case, lignin peroxidase catalyzed a 4-dechlorination of the starting phenol to yield a p-benzoquinone. The oxidation of 2,4-dichlorophenol also yielded a dechlorinated coupling dimer, tentatively identified as 2-chloro-6-(2,4-dichlorophenoxy)-p-benzoquinone. Experiments on the stoichiometry of 2,4,6-trichlorophenol oxidation showed that this substrate was quantitatively dechlorinated to give the quinone and inorganic chloride. H218O-labeling experiments on 2,4,6-trichlorophenol oxidation demonstrated that water was the source of the new 4-oxo substituent in 2,6-di-chloro-p-benzoquinone. The results indicate a mechanism whereby lignin peroxidase oxidizes a 4-chlorinated phenol to an electrophilic intermediate, perhaps the 4-chlorocyclohexadienone cation. Nucleophilic attack by water and elimination of HCl then ensue at the 4-position, which produces the quinone. Lignin peroxidases have previously been implicated in the degradation by Phanerochaete of several nonphenolic aromatic pollutants. It appears likely from their results that these peroxidases could also catalyze the initial dechlorination of certain polychlorinated phenols in vivo

  13. Mineralization of 14C-ring-labeled synthetic lignin correlates with the production of lignin peroxidase, not of manganese peroxidase or laccase

    International Nuclear Information System (INIS)

    Recently, Mn(II) has been shown to induce manganese peroxidases (MnPs) and repress lignin peroxidases (LiPs) in defined liquid cultures of several white rot organisms. The present work shows that laccase is also regulated by Mn(II). We therefore used Mn(II) to regulate production of LiP, MnP, and laccase activities while determining the effects of Mn(II) on mineralization of ring-labeled synthetic lignin. At a low Mn(II) level, Phanerochaete chrysosporium and Phlebia brevispora produced relatively high titers of LiPs but only low titers of MnPs. At a high Mn(II) level, MnP titers increased 12- to 20-fold, but LiPs were not detected in crude broths. P. brevispora formed much less LiP then P. chrysosporium, but it also produced laccase activity that increased more than sevenfold at the high Mn(II) level. The rates of synthetic lignin mineralization by these organisms were similar and were almost seven times higher at low than at high Mn(II). Increased synthetic lignin mineralization therefore correlated with increased LiP, not with increased MnP or laccase activities

  14. Fermented Apple Pomace as a Feed Additive to Enhance Growth Performance of Growing Pigs and Its Effects on Emissions

    Directory of Open Access Journals (Sweden)

    Chandran M. Ajila

    2015-06-01

    Full Text Available Apple pomace is a by-product from the apple processing industry and can be used for the production of many value-added compounds such as enzymes, proteins, and nutraceuticals, among others. An investigation was carried out to study the improvement in the protein content in apple pomace by solid-state fermentation using the fungus Phanerochaete chrysosporium by tray fermentation method. The effect of this protein in terms of how it enriched apple pomace as animal feed for pigs has also been studied. There was a 36% increase in protein content in the experimental diet with 5% w/w fermented apple pomace. The efficiency of conversion of ingested food was increased from 43.5 ± 2.5 to 83.1 ± 4.4 in the control group and the efficiency of conversion of feed increased from 55.4 ± 4.5 to 92.1 ± 3.6 in the experimental group during the animal feed experiment. Similarly, the effect of a protein enriched diet on odor emission and greenhouse gas emission has also been studied. The results demonstrated that the protein enrichment of apple pomace by solid state cultivation of the fungus P. chrysosporium makes it possible to use it as a dietary supplement for pigs.

  15. Bioremediation of a Chilean Andisol contaminated with pentachlorophenol (PCP) by solid substrate cultures of white-rot fungi.

    Science.gov (United States)

    Rubilar, O; Tortella, G; Cea, M; Acevedo, F; Bustamante, M; Gianfreda, L; Diez, M C

    2011-02-01

    This study provides a first attempt investigation of a serie of studies on the ability of Anthracophyllum discolor, a recently isolated white-rot fungus from forest of southern Chile, for the treatment of soil contaminated with pentachlorophenol (PCP) to future research on potential applications in bioremediation process. Bioremediation of soil contaminated with PCP (250 and 350 mg kg⁻¹ soil) was investigated with A. discolor and compared with the reference strain Phanerochaete chrysosporium. Both strains were incorporated as free and immobilized in wheat grains, a lignocellulosic material previously selected among wheat straw, wheat grains and wood chips through the growth and colonization of A. discolor. Wheat grains showed a higher growth and colonization of A. discolor, increasing the production of manganese peroxidase (MnP) activity. Moreover, the application of white-rot fungi immobilized in wheat grains to the contaminated soil favored the fungus spread. In turn, with both fungal strains and at the two PCP concentrations a high PCP removal (70-85%) occurred as respect to that measured with the fungus as free mycelium (30-45%). Additionally, the use of wheat grains in soil allowed the proliferation of microorganisms PCP decomposers, showing a synergistic effect with A. discolor and P. chrysosporium and increasing the PCP removal in the soil. PMID:20512655

  16. Evaluation of Potential Fungal Species for the in situ Simultaneous Saccharification and Fermentation (SSF of Cellulosic Material

    Directory of Open Access Journals (Sweden)

    Leeuwen, J.

    2011-01-01

    Full Text Available Three fungal species were evaluated for their abilities to saccharify pure cellulose. The three species chosen represented three major wood-rot molds; brown rot (Gloeophyllum trabeum, white rot (Phanerochaete chrysosporium and soft rot (Trichoderma reesei. After solid state fermentation of the fungi on the filter paper for four days, the saccharified cellulose was then fermented to ethanol by using Saccharomyces cerevisiae. The efficiency of the fungal species in saccharifying the filter paper was compared against a low dose (25 FPU/g cellulose of a commercial cellulase. Total sugar, cellobiose and glucose were monitored during the fermentation period, along with ethanol, acetic acid and lactic acid. Results indicated that the most efficient fungal species in saccharifying the filter paper was T. reesei with 5.13 g/100 g filter paper of ethanol being produced at days 5, followed by P. chrysosporium at 1.79 g/100 g filter paper. No ethanol was detected for the filter paper treated with G. trabeum throughout the five day fermentation stage. Acetic acid was only produced in the sample treated with T. reesei and the commercial enzyme, with concentration 0.95 and 2.57 g/100 g filter paper, respectively at day 5. Lactic acid production was not detected for all the fungal treated filter paper after day 5. Our study indicated that there is potential in utilizing in situ enzymatic saccharification of biomass by using T. reesei and P. chrysosporium that may lead to an economical simultaneous saccharification and fermentation process for the production of fuel ethanol.

  17. Enhanced bioprocessing of lignocellulose: Wood-rot fungal saccharification and fermentation of corn fiber to ethanol

    Science.gov (United States)

    Shrestha, Prachand

    This research aims at developing a biorefinery platform to convert corn-ethanol coproduct, corn fiber, into fermentable sugars at a lower temperature with minimal use of chemicals. White-rot (Phanerochaete chrysosporium), brown-rot (Gloeophyllum trabeum) and soft-rot (Trichoderma reesei) fungi were used in this research to biologically break down cellulosic and hemicellulosic components of corn fiber into fermentable sugars. Laboratory-scale simultaneous saccharification and fermentation (SSF) process proceeded by in-situ cellulolytic enzyme induction enhanced overall enzymatic hydrolysis of hemi/cellulose from corn fiber into simple sugars (mono-, di-, tri-saccharides). The yeast fermentation of hydrolyzate yielded 7.1, 8.6 and 4.1 g ethanol per 100 g corn fiber when saccharified with the white-, brown-, and soft-rot fungi, respectively. The highest corn-to-ethanol yield (8.6 g ethanol/100 g corn fiber) was equivalent to 42 % of the theoretical ethanol yield from starch and cellulose in corn fiber. Cellulase, xylanase and amylase activities of these fungi were also investigated over a week long solid-substrate fermentation of corn fiber. G. trabeum had the highest activities for starch (160 mg glucose/mg protein.min) and on day three of solid-substrate fermentation. P. chrysosporium had the highest activity for xylan (119 mg xylose/mg protein.min) on day five and carboxymethyl cellulose (35 mg glucose/mg protein.min) on day three of solid-substrate fermentation. T. reesei showed the highest activity for Sigma cell 20 (54.8 mg glucose/mg protein.min) on day 5 of solid-substrate fermentation. The effect of different pretreatments on SSF of corn fiber by fungal processes was examined. Corn fiber was treated at 30 °C for 2 h with alkali [2% NaOH (w/w)], alkaline peroxide [2% NaOH (w/w) and 1% H2O 2 (w/w)], and by steaming at 100 °C for 2 h. Mild pretreatment resulted in improved ethanol yields for brown- and soft-rot SSF, while white-rot and Spezyme CP SSFs showed

  18. Espécies raras de Phallales (Agaricomycetidae, Basidiomycetes no Nordeste do Brasil Rare species of Phallales (Agaricomycetidae, Basidiomycetes in Northeast Brazil

    Directory of Open Access Journals (Sweden)

    Anileide Gomes Leite

    2007-03-01

    Full Text Available Seis espécies interessantes de Phallales são registradas para a Mata Atlântica: Aseroë floriformis Baseia & Calonge, Geastrum setiferum Baseia, Ileodictyon cibarium Tulasne ex Raoul, Laternea triscapa Turpin, Phallus pygmaeus Baseia e Staheliomyces cinctus E. Fischer. Adicionalmente, são fornecidas chave de identificação e comentários sobre a taxonomia e ecologia dessas espécies.Six interesting species of Phallales are recorded from the Atlantic rainforest: Aseroë floriformis Baseia & Calonge, Geastrum setiferum Baseia, Ileodictyon cibarium Tulasne ex Raoul, Laternea triscapa Turpin, Phallus pygmaeus Baseia and Staheliomyces cinctus E. Fischer. A key and comments on taxonomy and ecology of these species are also provided.

  19. A biodegradabilidade da blenda de poli(β-Hidroxibutirato-co-Valerato/amido anfótero na presença de microrganismos The Biodegradation of polyhydroxybutyrate-co-valerate/amphiprotic starch in the presence of microorganisms

    Directory of Open Access Journals (Sweden)

    Nadjane S. Coelho

    2008-09-01

    Full Text Available O crescimento do consumo de plásticos vem gerando grandes problemas ambientais, pois um polímero, uma vez descartado no ambiente, necessita de mais de cem anos para se degradar. O plástico ideal deve apresentar propriedades industriais desejáveis e, ao mesmo tempo ser degradável num período considerado satisfatório. Busca-se desenvolver plásticos com boas propriedades para embalagens e que possam ser biodegradados quando descartados ao ambiente. Neste trabalho avaliamos a biodegradação da blenda do copolímero poli(β-hidroxibutirato-co-valerato, PHB-HV, que é um termoplástico natural, biodegradável e biocompatível, e do amido anfótero, na proporção de 75 e 25% m/m, respectivamente. Os resultados foram obtidos através do teste de Sturm, uma metodologia para a avaliação da biodegradação na presença de uma cultura mista dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Os resultados evidenciam a biodegradação da blenda em função do tempo, de acordo com os resultados do teste de Sturm, com o aparecimento de grupos carboxílicos terminais. Foi detectado também o aparecimento de nova simetria cristalina na estrutura polimérica.The increasing consumption of plastics has generated environmental problems because it takes more than a hundred years for a discarded polymer to degrade. The ideal plastic should present desirable industrial properties and be degradable within a satisfactory time period. Researches is conducted to plastics with good properties for packaging, but that are biodegradable when discarded to the environment. In this work we evaluated the biodegradation of the blend of the copolymer poly(hydroxybutyrate-hydroxyvalerate, PHB-HV, which is a natural, biodegradable and biocompatible thermoplastic, and of the starch amphiprotic, in the proportion of 75 and 25% m/m, respectively. The results were obtained through the Sturm test, a methodology for the evaluation of biodegradation in the presence

  20. Enzymantic Conversion of Coal to Liquid Fuels

    Energy Technology Data Exchange (ETDEWEB)

    Richard Troiano

    2011-01-31

    The work in this project focused on the conversion of bituminous coal to liquid hydrocarbons. The major steps in this process include mechanical pretreatment, chemical pretreatment, and finally solubilization and conversion of coal to liquid hydrocarbons. Two different types of mechanical pretreatment were considered for the process: hammer mill grinding and jet mill grinding. After research and experimentation, it was decided to use jet mill grinding, which allows for coal to be ground down to particle sizes of 5 {mu}m or less. A Fluid Energy Model 0101 JET-O-MIZER-630 size reduction mill was purchased for this purpose. This machine was completed and final testing was performed on the machine at the Fluid Energy facilities in Telford, PA. The test results from the machine show that it can indeed perform to the required specifications and is able to grind coal down to a mean particle size that is ideal for experimentation. Solubilization and conversion experiments were performed on various pretreated coal samples using 3 different approaches: (1) enzymatic - using extracellular Laccase and Manganese Peroxidase (MnP), (2) chemical - using Ammonium Tartrate and Manganese Peroxidase, and (3) enzymatic - using the live organisms Phanerochaete chrysosporium. Spectral analysis was used to determine how effective each of these methods were in decomposing bituminous coal. After analysis of the results and other considerations, such as cost and environmental impacts, it was determined that the enzymatic approaches, as opposed to the chemical approaches using chelators, were more effective in decomposing coal. The results from the laccase/MnP experiments and Phanerochaete chrysosporium experiments are presented and compared in this final report. Spectra from both enzymatic methods show absorption peaks in the 240nm to 300nm region. These peaks correspond to aromatic intermediates formed when breaking down the coal structure. The peaks then decrease in absorbance over time

  1. Evaluation of the types of starch for preparation of LDPE/starch blends

    Directory of Open Access Journals (Sweden)

    Glória Maria Vinhas

    2007-05-01

    Full Text Available This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In spite of the short time that the blends were exposed to the fungi, the microorganisms promoted physical and chemical changes in the structure of the blend, modifying its thermal and mechanical properties. The alteration of the degree of crystallinity and mechanical properties of the blends could be indications of the modification caused by the biodegradation process.Nesse trabalho foi realizado um estudo sobre diferentes tipos de amido quanto ao crescimento, e a atividade amilolítica de culturas mistas e isoladas dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Avaliaram-se também as propriedades térmicas e mecânicas das blendas de polietileno/amido anfótero (na proporção 80/20 (m/m antes e apos a inoculação das culturas mistas desses fungos.O amido regular Amidex 3 e o amido modificado Fox5901 foram os que se destacaram quanto ao crescimento celular e produção da enzima amilase. Apesar do pouco tempo de exposição dos filmes com os fungos, pode-se concluir que os microrganismos promovem mudanças físicas e químicas na estrutura da blenda, modificando suas propriedades térmicas e mecânicas. A alteração do grau de cristalinidade e das propriedades mecânicas das blendas podem ser indícios da modificação provocada pelo processo de biodegradação.

  2. Vegetal waste degradation by microbial strains inoculation Degradación de residuos vegetales mediante inoculación con cepas microbianas

    Directory of Open Access Journals (Sweden)

    Nubia Grijalva Vallejos

    2013-06-01

    Full Text Available (Received: 2013/03/31 - Accepted: 2013/06/02Vegetal waste treatment product of urban, agricultural and industrial processes has severaltechnical problems and constitutes a significant environmental concern. Among them are thepersistence of crop protection products in high concentrations in plant material and the lack ofmicroorganisms that can tolerate such compounds and efficiently decompose the substrate.Bacteria and mainly white rot fungi are the main decomposers of lignin because of their ability tosynthesize extracellular hydrolytic and oxidative enzymes in large quantities. Trichodermareesei, Aspergillus niger, Penicillium sp. and Phanerochaete chrysosporium strains are modelstrains whose hight degradation efficiency with lignocellulose materials even in the presence ofpollutants has been proven. Several studies such as directed mutagenesis, co-culturing andheterologous expression have been done in order to improve the content of some enzymes(cellulase, xylanase, and β-glucosidase in model strains, additionally it has been done newgenetic searches to find other microorganisms with this potential. Its main applications are theindustrial production of ethanol and some seconday metabolites under controlled conditions infermentation processes. This review provides an overview about strategies and methodologiescurrently used for vegetal waste utilization by inoculation of microbial strains.(Recibido: 2013/03/31 - Aceptado: 2013/06/02El tratamiento de los residuos vegetales producto de desechos urbanos, procesos agrícolas eindustriales enfrenta varios problemas técnicos y constituye una preocupación ambientalimportante. Entre ellos se destacan la permanencia de productos fitosanitarios en altasconcentraciones en el material vegetal unido a la carencia de microorganismos que puedantolerar dichos compuestos y logren descomponer eficientemente el sustrato. Las bacterias yprincipalmente los hongos de la podredumbre blanca son los mejores

  3. ИСПОЛЬЗОВАНИЕ ДЕРЕВОРАЗРУШАЮЩИХ ГРИБОВ КЛАССА BASIDIOMYCETES В НЕТРАДИЦИОННОЙ МЕДИЦИНЕ (АМУРСКАЯ ОБЛАСТЬ)

    OpenAIRE

    Кочунова, Наталья

    2014-01-01

    В последние годы, как за рубежом, так и в России усиленно ведутся поиск и испытание новых лекарственных препаратов, полученных из грибов. Перспективным источником целебных веществ являются базидиальные грибы (класс Basidiomycetes ), В статье приводятся литературные сведения и собственные данные относительно лекарственных свойств 52 видов дереворазрушающих базидиальных грибов, распространенных в Амурской области и перспективных для использования местным населением в нетрадиционной медицине. Ра...

  4. Degradation of lignin and humic substances in forest soil by saprotrophic basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    České Budějovice: Ústav půdní biologie BC AV ČR, 2009, s. 170-179. ISBN 978-80-86525-16-7. [Život v půdě /10./. České Budějovice (CZ), 27.01.2009-28.01.2009] R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : soil * enzyme * interaction Subject RIV: EE - Microbiology, Virology

  5. Evaluation of Pb (II) biosorption utilizing sugarcane bagasse colonized by Basidiomycetes.

    Science.gov (United States)

    Palin, D; Rufato, K B; Linde, G A; Colauto, N B; Caetano, J; Alberton, O; Jesus, D A; Dragunski, D C

    2016-05-01

    The contamination of water resources by metallic ions is a serious risk to public health and the environment. Therefore, a great emphasis has been given to alternative biosorption methods that are based on the retention of aqueous-solution pollutants; in the last decades, several agricultural residues have been explored as low-cost adsorbent. In this study, the ability of Pb (II) biosorption using sugarcane bagasse modified by different fungal species was evaluated. The presence of carbonyl, hydroxyl, and carboxyl groups in the biosorbent was observed by spectroscopy in the infrared region. By scanning electron microscopy, changes in the morphology of modified material surfaces were observed. The highest adsorption capacity occurred at pH 5.0, while the shorter adsorbate-adsorbent equilibrium was at 20 min, and the system followed the pseudo-second-order model. The maximum biosorption in isotherms was found at 58.34 mg g(-1) for modified residue by Pleurotus ostreatus U2-11, and the system followed the Langmuir isotherm. The biosorption process was energetically spontaneous with low desorption values. This modification showed great potential for filters to remove Pb (II) and provide the preservation of water resources and animal health. PMID:27063515

  6. Transformation of lignin and humic acids by extracellular enzymes of saprotrophic basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    Gent : Universiteit Gent, 2009, s. 271-272. ISBN 978-90-813924-1-9. [International Conference on Textile and Polymer Biotechnology /6./. Gent (BE), 23.09.2009-25.09.2009] R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : soil * fungi * enzyme Subject RIV: EE - Microbiology, Virology

  7. Antioxidant Effects of Medicinal Mushrooms Agaricus brasiliensis and Ganoderma lucidum (Higher Basidiomycetes): Evidence from Animal Studies.

    Science.gov (United States)

    Yurkiv, Borys; Wasser, Solomon P; Nevo, Eviatar; Sybirna, Nataliya O

    2015-01-01

    With diabetes mellitus and increased glucose concentrations, the mitochondria electron transport chain is disrupted, superoxide anions are overproduced, and oxidative stress develops in cells. Thus, preventing oxidative stress can produce a decrease in the antioxidant system activity and an increase in apoptosis in immune cells. The application of medicinal mushrooms is a new possible approach to diabetes mellitus treatment. Therefore, the aim of this work was to investigate the influence of administration of the medicinal mushrooms Agaricus brasiliensis and Ganoderma lucidum on antioxidant enzyme activity in rat leukocytes. Wistar outbred white rats were used in the study. Streptozotocin was intraperitoneally injected once at a dose of 50 mg/kg body weight. Mushroom preparations were orally administered at a dose of 1 g/kg/day for 2 weeks. This revealed that in diabetes mellitus, the level of antioxidant enzyme activity is significantly decreased compared with control values, whereas the levels of lipid peroxidation is increased; this manifested in an increase in the amount of thiobarbituric acid reactive substances (TBARS). The medicinal mushrooms' administration is accompanied by an increase in antioxidant enzyme activity to control values and is even higher in the case of A. brasiliensis administration when compared with the diabetic group. As for the indicators of lipid peroxidation under mushroom administration of A. brasiliensis and G. lucidum, we observed a significant decrease of TBARS levels compared with the diabetic group. Increased activity of antioxidant enzymes and reduction of TBARS level indicate pronounced antioxidant properties of studied mushrooms. PMID:26756186

  8. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12. ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  9. Phylogenetic, genomic organization and expression analysis of hydrophobin genes in the ectomycorrhizal basidiomycete Laccaria bicolor

    OpenAIRE

    Plett, Jonathan M.

    2014-01-01

    Hydrophobins are morphogenetic, small secreted hydrophobic fungal proteins produced in response to changing development and environmental conditions. These proteins are important in the interaction between certain fungi and their hosts. In mutualistic ectomycorrhizal fungi several hydrophobins form a subclass of mycorrhizal-induced small secreted proteins that are likely to be critical in the formation of the symbiotic interface with host root cells. In this study, two genomes of the ectomyco...

  10. Studies on ectomycorrhizal basidiomycete in pine forest on the Lithuania-Poland transboundary region

    OpenAIRE

    Danutė Stankovičienė; Jonas Kaspravičius

    2013-01-01

    The diversity of ectomycorrhizal fungi and sporocarps abundance were investigated in 2003-2005 at nine permanent study plots in a 50-year-old pine forest. Diversity of ectomycorrhizal fungi consisted of 53 taxa and the majority of them belonged to the genera Cortinarius, Russula, Amanita and Tricholoma. The most frequent species, whose fruit bodies were found in each study plot, were C. cibarius, L. necator L. rufus, P. involutus, R. aeruginea, T. saponaceum and the most abundant species whic...

  11. A fungal conserved gene from the basidiomycete Hebeloma cylindrosporum is essential for efficient ectomycorrhiza formation.

    Science.gov (United States)

    Doré, Jeanne; Marmeisse, Roland; Combier, Jean-Philippe; Gay, Gilles

    2014-10-01

    We used Agrobacterium-mediated insertional mutagenesis to identify genes in the ectomycorrhizal fungus Hebeloma cylindrosporum that are essential for efficient mycorrhiza formation. One of the mutants presented a dramatically reduced ability to form ectomycorrhizas when grown in the presence of Pinus pinaster. It failed to form mycorrhizas in the presence of glucose at 0.5 g liter(-1), a condition favorable for mycorrhiza formation by the wild-type strain. However, it formed few mycorrhizas when glucose was replaced by fructose or when glucose concentration was increased to 1 g liter(-1). Scanning electron microscopy examination of these mycorrhizas revealed that this mutant was unable to differentiate true fungal sheath and Hartig net. Molecular analyses showed that the single-copy disrupting T-DNA was integrated 6,884 bp downstream from the start codon, of an open reading frame potentially encoding a 3,096-amino-acid-long protein. This gene, which we named HcMycE1, has orthologs in numerous fungi as well as different other eukaryotic microorganisms. RNAi inactivation of HcMycE1 in the wild-type strain also led to a mycorrhizal defect, demonstrating that the nonmycorrhizal phenotype of the mutant was due to mutagenic T-DNA integration in HcMycE1. In the wild-type strain colonizing P. pinaster roots, HcMycE1 was transiently upregulated before symbiotic structure differentiation. Together with the inability of the mutant to differentiate these structures, this suggests that HcMycE1 plays a crucial role upstream of the fungal sheath and Hartig net differentiation. This study provides the first characterization of a fungal mutant altered in mycorrhizal ability. PMID:24918768

  12. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    in high-nitrogen medium (24 mM N), but no LIP activity was seen. In media containing lignocellulosic substrates such as pine, poplar, or sugarcane bagasse as the sole source of carbon and nitrogen, relatively hgih MNP and moderate levels of laccases were...

  13. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens. PMID:27279445

  14. Genetic characterization of isolates of the basidiomycete Agaricus blazei by RAPD

    Directory of Open Access Journals (Sweden)

    Colauto Nelson Barros

    2002-01-01

    Full Text Available The genetic divergence of five isolates of Agaricus blazei was determined based on RAPD data. Results indicate that there is little genetic variability among the commercialized strains and that RAPD is a feasible and low cost technique that can be used to characterize this fungus.

  15. Genetic characterization of isolates of the basidiomycete Agaricus blazei by RAPD

    OpenAIRE

    Colauto Nelson Barros; Dias Eustáquio Souza; Gimenes Marcos Aparecido; Eira Augusto Ferreira da

    2002-01-01

    The genetic divergence of five isolates of Agaricus blazei was determined based on RAPD data. Results indicate that there is little genetic variability among the commercialized strains and that RAPD is a feasible and low cost technique that can be used to characterize this fungus.

  16. Phallus indusiatus Vent. & Pers. (Basidiomycetes - a new generic record for Eastern Ghats of India

    Directory of Open Access Journals (Sweden)

    P.K. Dash

    2010-07-01

    Full Text Available A mushroom fungus Phallus indusiatus Vent. & Pers. (commonly called Long Net Stinkhorn belonging to the order Phallales in the fungal phylum Basidiomycotina was collected from a bamboo thicket near the foothills of the Kutrumali Hill range in Koraput District of Orissa, representing a new distributional record for the Eastern Ghats of India.

  17. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands

    OpenAIRE

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-01-01

    Background Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and s...

  18. Response of the Higher Basidiomycetic Ganoderma resinaceum to Sodium Chloride Stress

    OpenAIRE

    Mahmoud, Yehia A. G.; Mohamed, Eman H. F. A.; Abd Elzaher, E. H. F.

    2007-01-01

    Ganoderma resinaceum tolerated sodium chloride salt stress within a range of 0 mM till 300 mM. It responded to salt stress with fluctuation in proline formation at different NaCl concentrations. However,the mycelial dry weight,total protein contents and exopolysaccharides did not changed considerably. Increasing sodium chloride concentration led to morphological alteration in fungal mycelia with disappearance of fungal cell wall,plasmolysis,and vacuolation as indicated with electron microscop...

  19. Antioxidant Properties and Antioxidant Compounds of Various Extracts from the Edible Basidiomycete Grifola Frondosa (Maitake)

    OpenAIRE

    Kaun-Tzer Wu; Cheng-Fang Tsai; Li-Hui Hsieh; Jan-Ying Yeh

    2011-01-01

    Grifola frondosa is an edible mushroom currently available in Taiwan. Ethanolic, cold-water and hot-water extracts were prepared and their antioxidant properties were investigated. At 1 mg/mL, G. frondosa T1 and T2 cold-water extracts showed high reducing powers of 1.02 and 0.50, respectively. Chelating abilities on ferrous ions of G. frondosa T1 and T2 were higher for cold-water extracts than for ethanolic and hot-water extracts. For the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl (D...

  20. Antioxidant properties and antioxidant compounds of various extracts from the edible basidiomycete Grifola frondosa (Maitake).

    Science.gov (United States)

    Yeh, Jan-Ying; Hsieh, Li-Hui; Wu, Kaun-Tzer; Tsai, Cheng-Fang

    2011-01-01

    Grifola frondosa is an edible mushroom currently available in Taiwan. Ethanolic, cold-water and hot-water extracts were prepared and their antioxidant properties were investigated. At 1 mg/mL, G. frondosa T1 and T2 cold-water extracts showed high reducing powers of 1.02 and 0.50, respectively. Chelating abilities on ferrous ions of G. frondosa T1 and T2 were higher for cold-water extracts than for ethanolic and hot-water extracts. For the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical, G. frondosa T1 and T2 extracts were effective in the following order: ethanolic > hot-water > cold-water. The G. frondosa hot-water extract showed high scavenging ability on superoxide anions. Total phenols, flavonoids, ascorbic acid and α-tocopherol are the major antioxidant components found in the various G. frondosa extracts. Based on EC(50) values (<20 mg/mL) obtained, the various extracts from G. frondosa investigated in this study display potent antioxidative properties. PMID:21499220

  1. Antioxidant Properties and Antioxidant Compounds of Various Extracts from the Edible Basidiomycete Grifola Frondosa (Maitake

    Directory of Open Access Journals (Sweden)

    Kaun-Tzer Wu

    2011-04-01

    Full Text Available Grifola frondosa is an edible mushroom currently available in Taiwan. Ethanolic, cold-water and hot-water extracts were prepared and their antioxidant properties were investigated. At 1 mg/mL, G. frondosa T1 and T2 cold-water extracts showed high reducing powers of 1.02 and 0.50, respectively. Chelating abilities on ferrous ions of G. frondosa T1 and T2 were higher for cold-water extracts than for ethanolic and hot-water extracts. For the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl (DPPH radical, G. frondosa T1 and T2 extracts were effective in the following order: ethanolic > hot-water > cold-water. The G. frondosa hot-water extract showed high scavenging ability on superoxide anions. Total phenols, flavonoids, ascorbic acid and α-tocopherol are the major antioxidant components found in the various G. frondosa extracts. Based on EC50 values (

  2. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  3. Influence of cryopreservation on activities of ligninolytic enzymes in some white-rot basidiomycete strains

    Czech Academy of Sciences Publication Activity Database

    Stoychev, I.; Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    Praha: Mikrobiologický ústav AV ČR, 1997 - (Gabriel, J.; Novotný, Č.). s. 76-77 [Mini-Symposium on Biosorption and Microbial Degradations /5./. 24.11.1997-28.11.1997, Praha] R&D Projects: GA ČR GA206/97/0853

  4. Coconut lumber for wood decks (Cocos nucifera L.):decay resistance against Basidiomycetes fungi

    OpenAIRE

    Jourez, Benoît; Verheyen, Cécile; Van Acker, Joris

    2011-01-01

    Since a couple of years, manufactured products of coconut wood for outdoor uses like wood decks have been proposed on the European market. These are presented as an alternative for traditional tropical timbers. In the past, coconut wood was neglected and burned for sanitary reasons and lack of interest at industrial scale. Plantation coconut trees at end of production of copra constitute a renewable resource with high added value. In order to convince the markets, natural durability for outdo...

  5. Chemical constituents of Stereum subtomentosum and two other birch-associated basidiomycetes: An interspecies comparative study

    Czech Academy of Sciences Publication Activity Database

    Hybelbauerová, S.; Sejbal, J.; Dračínský, Martin; Hahnová, H.; Koutek, Bohumír

    2008-01-01

    Roč. 5, č. 5 (2008), s. 743-750. ISSN 1612-1872 Institutional research plan: CEZ:AV0Z40550506 Keywords : Stereum subtomentosum * Trametes versicolor * Piptoporus betulinus * steroids * saccharides Subject RIV: CC - Organic Chemistry Impact factor: 1.659, year: 2008

  6. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415. ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  7. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80. ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  8. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455. ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  9. Studies on ectomycorrhizal basidiomycete in pine forest on the Lithuania-Poland transboundary region

    Directory of Open Access Journals (Sweden)

    Danutė Stankovičienė

    2013-12-01

    Full Text Available The diversity of ectomycorrhizal fungi and sporocarps abundance were investigated in 2003-2005 at nine permanent study plots in a 50-year-old pine forest. Diversity of ectomycorrhizal fungi consisted of 53 taxa and the majority of them belonged to the genera Cortinarius, Russula, Amanita and Tricholoma. The most frequent species, whose fruit bodies were found in each study plot, were C. cibarius, L. necator L. rufus, P. involutus, R. aeruginea, T. saponaceum and the most abundant species which made the main part of total sporocarp yield were C. cibarius and P. involutus. The lowest species richness of ectomycorrhizal fungi was in study plots with the densest cover of grasses. Maximum of species over the fruiting period was characteristic for October and for September. It was noticed that some species virtually never occurred together at the same plot (eg. C. cibarius and H. aurantiaca, meanwhile others occurred together quite frequently (eg. H.aurantiaca and X. badius.

  10. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426. ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  11. Activity and spatial distribution of lignocellulose-degrading enzymes during forest soil colonization by saprotrophic basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Valášková, Vendula; Merhautová, Věra; Cajthaml, Tomáš; Baldrian, Petr

    2008-01-01

    Roč. 43, č. 2 (2008), s. 186-192. ISSN 0141-0229 R&D Projects: GA ČR GA526/05/0168; GA AV ČR KJB600200516 Institutional research plan: CEZ:AV0Z50200510 Keywords : lignocellulose * soil * litter Subject RIV: EE - Microbiology, Virology Impact factor: 2.375, year: 2008

  12. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90. ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  13. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  14. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials. PMID:24586250

  15. Enhancement of microbial degradation of hydrocarbons in soil and water

    International Nuclear Information System (INIS)

    A major focus in the biotechnology program at the Institute of Gas Technology (IGT) is to develop bioremediation processes for soil and water contaminated with hazaardous organic chemicals. Aerobic microbial cultures that have been developed in the past and anaerobic microbial cultures recently enriched for, are being used in a variety of ways to develop viable treatment strategies for these wastes. The authors have found that the chief factor limiting the rate and extent of PAH biodegradation in contaminated soil is mass transfer and when PAH's are rendered bioavailable in extensively. The most effective biodegradation is observed for polycyclic compounds of three- and fewer rings. Although not to as remarkable an extent, cultures are also able to decompose four, five and six ring PAH's. Studies with 14C-labelled PAH's haave revealed thaat two-, three-, four-, five-, and six-ring compounds can be completely mineralized with bacterial cultures or the white-rot fungus, Phanerochaete chrysosporium, either as pure reagent chemicals or in complex organic mixtures derived from contaminated town gas site soils. Continued scientific investigations must endeavor to overcome hazaardous waste mass transfer difficulties as an integral part of the development of practical treatment processes

  16. [Induction and measurement of cytochrome P450 in white rot fungi].

    Science.gov (United States)

    Ning, Da-liang; Wang, Hui; Li, Dong

    2009-08-15

    The induction and measurement of cytochrome P450 in white rot fungus Phanerochaete chrysosporium were studied in this work. The spectrophotometric results demonstrated that n-hexane was able to induce the fungal P450 to high level, which facilitated isolation and measurement of microsomal P450. The highest concentration of microsomal P450 could reach 140-160 pmol/mg after 6-h-induction by addition of 2 microL/mL hexane each hour, and the concentration of hexane and incubation time had significant effect on the induction of P450s. After effective induction, the method for isolation and measurement of microsomal P450 with CO difference spectrum was studied and the optimized method was obtained as followed. High-speed disperser and glass homogenizer were used to disrupt cells, which obtained higher amount of microsomal P450 than those from cells disrupted by glass homogenizer, ultrasonicator and bead-beater respectively. To record CO difference spectrum,the sample was bubbled with CO for 40 s at a rate of 3 mL/min (300 microL sample), and the reference cuvette was bubbled with N2 to the same extent. Then, the reducer sodium dithionite was added to a concentration 0.4 mol/L. PMID:19799321

  17. Continous monitoring of cellulase action on microcrystalline cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Kremer, S.M.; Wood, P.M. (Bristol Univ. (United Kingdom). Dept. of Biochemistry)

    1992-09-01

    Cellobiose oxidase from Phanerochaete chrysosporium was used for continuous monitoring of cellulase action on microcrystalline cellulose (Avicel). Two protocols are described, the parameter monitored being either the decline in electrode potential as ferricyanide is reduced or consumption of dioxygen. Most experiments used a commercial cellulase preparation from Trichoderma reesei and ferricyanide as acceptor. Within 1 min of an addition of cellulase, ferricyanide reduction reached a steady rate. This was converted into a rate of production of substrate for cellobiose oxidase, in [mu]mol.min[sup -1]. Experiments were conducted either with a constant concentration of cellulase and increasing Avicel, or with constant Avicel and increasing cellulase. Kinetic analysis of the experiments with constant cellulase indicated a K[sub m] of 4.8 [+-] 1.0 (g cellulose).1[sup -1], which was close to the value predicted from binding studies. The specific activity of the cellulase was measured as 375 [+-] 25 [mu]mol.(g cellulase)[sup -1].min[sup -1] in experiments with a high cellulose concentration, but was less than half this value when the cellulose was saturated with cellulase. The maximal rate of cellulose degradation was 9.6 [+-] 1.3 [mu]mol.(g cellulose)[sup -1].min[sup -1]. (orig.).

  18. Solid-state fermentation of rice straw residues for its use as growing medium in ornamental nurseries

    Science.gov (United States)

    Belal, Elsayed B.; El-Mahrouk, M. E.

    2010-11-01

    This work was conducted at a private nursery in Kafr El-Sheikh governorate to investigate the bioconversion of rice straw into a soil-like substrate (SLS) by Phanerochaete chrysosporium and Trichoderma hazianum and the possibility of using rice straw compost in ornamental nurseries as a partial or total replacement of coconut peat (CP) and vermiculite (V) in the growing medium. The results showed that rice straw could be treated better by aerobic fermentation. The authors used five mixtures as follows: (1) Control (CP+V at 1:1 v/v), (2) SLS (100%), (3) SLS+CP (1:1 v/v), (4) SLS+V (1:1 v/v), and (5) SLS+CP+V (1:1:1 v/v/v). Data were recorded as seedling height, no. of leaves, shoot fresh and dry weights, root length and root fresh and dry weights in order to assess the quality of both transplants of Althea rosea (hollyhock) and Calendula officinalis (scotch marigold). Hollyhock seedlings grown in medium containing a mixture of SLS+CP+V displayed quality traits similar to those recorded from the control treatment, while scotch marigold seedlings in the same medium followed the control medium in quality.

  19. Biomethanation of white rotted and brown rotted rice straw

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, A.; Bhattacharyya, B.C. [Chemical Engineeringg Dept., Biotechnology Unit, IIT Kharagpur, (India)

    1999-04-01

    Biomethanation of white rotted and brown rotted rice straw was taken for the present investigation and their efficiency on biomethanation has been tested. Rice straw was treated with white rot fungus Phanerochaete chrysosporium (P{sub C}) and brown rot fungus Polyporus ostreiformis (P{sub O}). Biogas and methane production was increased by about 34.73% and 46.19% in P{sub C}-treated straw and 21.12% and 31.94% in P{sub O}-treated straw respectively. VFA production has also been increased in P{sub C} and P{sub O} treated straw compared to control straw which were 76.73% and 30.69% respectively. Reduction of COD has also been found during biomethanation. The rate of reduction of COD during the initial period of digestion was 59.01%, 55.55% and 26.00% in P{sub C}-treated, P{sub O}-treated and control straw respectively after 21 days of digestion. (orig.) With 12 figs., 3 tabs., 14 refs.

  20. Encapsulation of ligninolytic enzymes and its application in clarification of juice.

    Science.gov (United States)

    Gassara-Chatti, Fatma; Brar, Satinder K; Ajila, C M; Verma, M; Tyagi, R D; Valero, J R

    2013-04-15

    The thermal stability, physico-chemical properties and effect on juice clarification of hydrogel formulations of ligninolytic enzymes from Phanerochaete chrysosporium were evaluated. The results showed that enzyme entrapment increase significantly (Pthermal stability of enzymes at 4 and 75 °C. At 75 °C, maximum activity decreased to non detectable values of 7.9% for free laccase, manganese peroxidase (MnP), lignin peroxidase (LiP), respectively; to 94%, 97%, 93% for laccase, MnP and LiP entrapped into Polyacrylamide/pectin, 94%, 98%, 88% for laccase, MnP and LiP encapsulated respectively into polyacrylamide/ gelatine and to 87%, 91%, 87% for laccase, MnP and LiP entrapped, respectively into polyacrylamide/carboxymethylcellulose (CMC). When particle size and viscosity of the formulation increased, enzyme stability increased. The polyphenolic reduction and clarity amelioration in mixed juice of berry and pomegranate was more significant (p>0.05) using encapsulated enzymes treatment than free enzymes. This suggested that enzymatic treatment was efficient for the juice clarification. PMID:23199985

  1. Evolution of several soil properties following amendment with olive mill wastewater

    Institute of Scientific and Technical Information of China (English)

    Ali Mekki; Abdelhafidh Dhouib; Sami Sayadi

    2009-01-01

    Occurrences of olive mill wastewater (OMW) amendment on several chemical and biochemical properties of soil were investigated. Compared to the control, soils amended with untreated and treated OMW (by an integrated process based on aerobic fungal pre-treat-ment using Phanerochaete chrysosporium DSMZ 6909 followed by anaerobic treatment) showed high levels of organic and mineral mat-ters. Soil amended with untreated OMW presented low levels of total and inorganic nitrogen (0.38 and 0.08 mg g~(-1) dry soil). Treated OMW contained little content of pollutants (COD=4 gl~(-1); phenolic compounds=0.6 gl~(-1)); so, organic matter brought by these res-idues was rapidly mineralized in the soil. The number of heterotrophic bacteria was increased (from 54×10~5 CFU g~(-1) dry soil in control soil to 123×10~5 CFU g~(-1) dry soil) in response to the OMW amendment, mainly after C/N ratio correction. Untreated OMW applica-tion improved the soil carbon content (2.18 times higher), while the specific respiration remained very low. However, the treated OMW application positively affected the soil-specific respiration that increased from 6.1 in control soil to 9.75 in soil amended with treated OMW. This phenomenon was accompanied by an enhancement of nitrifiers number, urease and ammonium oxidases activities.

  2. Effect of bio-treatment on the lipophilic and hydrophilic extractives of wheat straw.

    Science.gov (United States)

    Qin, M H; Xu, Q H; Shao, Z Y; Gao, Y; Fu, Y J; Lu, X M; Gao, P J; Holmbom, B

    2009-06-01

    Wheat straw, an important papermaking raw material in China, was treated with a white-rot fungus of Phanerochaete chrysosporium ME446, and the lipophilic and hydrophilic extractives from the control and bio-treated samples were analyzed by GC and GC-MS. Bio-treatment of wheat straw could alter the chemical composition of both the lipophylic and hydrophilic extractives. Sugars and phenolic substances such as coniferyl alcohol, 4-hydroxycinnamic acid, 1-guaiacylglycerol and ferulic acid were substantially degraded or consumed by the fungus. More lipophilic substances such as wax, glycerides and steryl esters were degraded into the corresponding components, resulting in much higher concentrations of fatty acids and sterols in the bio-treated samples. Obviously, the bio-treatment of wheat straw was of benefit to pitch control in pulping and papermaking processes, in the view of degradation of the more lipophilic substances. In addition, the bio-treatment could increase the lignin concentration in hot-water extractives of wheat straw. PMID:19268580

  3. Enhanced reduction of phenol content and toxicity in olive mill wastewaters by a newly isolated strain of Coriolopsis gallica.

    Science.gov (United States)

    Daâssi, Dalel; Belbahri, Lassaad; Vallat, Armelle; Woodward, Steve; Nasri, Moncef; Mechichi, Tahar

    2014-02-01

    The search for novel microorganisms able to degrade olive mill wastewaters (OMW) and withstand the toxic effects of the initially high phenolic concentrations is of great scientific and industrial interest. In this work, the possibility of reducing the phenolic content of OMW using new isolates of fungal strains (Coriolopsis gallica, Bjerkandera adusta, Trametes versicolor, Trichoderma citrinoviride, Phanerochaete chrysosporium, Gloeophyllum trabeum, Trametes trogii, and Fusarium solani) was investigated. In vitro, all fungal isolates tested caused an outstanding decolorization of OMW. However, C. gallica gave the highest decolorization and dephenolization rates at 30 % v/v OMW dilution in water. Fungal growth in OMW medium was affected by several parameters including phenolic compound concentration, nitrogen source, and inoculum size. The optimal OMW medium for the removal of phenolics and color was with the OMW concentration (in percent)/[(NH4)2SO4]/inoculum ratio of 30:6:3. Under these conditions, 90 and 85 % of the initial phenolic compounds and color were removed, respectively. High-pressure liquid chromatography analysis of extracts from treated and untreated OMW showed a clear and substantial reduction in phenolic compound concentrations. Phytotoxicity, assessed using radish (Raphanus sativus) seeds, indicated an increase in germination index of 23-92 % when a 30 % OMW concentration was treated with C. gallica in different dilutions (1/2, 1/4, and 1/8). PMID:23979847

  4. Decolorization of reactive brilliant red K-2BP by white rot fungus under sterile and non-sterile conditions

    Institute of Scientific and Technical Information of China (English)

    GAO Da-wen; WEN Xiang-hua; QIAN Yi

    2006-01-01

    Almost all the studies both domestic and international using white rot fungus for dye wastewater treatment are performed under sterile conditions. However, it is obviously unpractical that wastewater with dyes is treated under sterile conditions. A feasible study was made for using white rot fungus Phanerochaete chrysosporium to degrade reactive brilliant red K-2BP dye under non-sterile conditions. The results showed that there was no decolorizing effect under non-sterile condition if white rot fungus was incubated under non-sterile condition, and the decolorization was always near to 0% during decolorizing test for 3 d; in the meantime, a lot of yeast funguses were found in liquid medium when white rot fungus was incubated under non-sterile conditions; however, if white rot fungus was incubated under sterile condition firstly, its decolorization was above 90% under non-sterile condition, which was similar to that of sterile condition. So we point out that the treating process for wastewater with dyes should be divided into two stages. The first stage is that white rot fungus should be incubated under sterile conditions, and the second stage is that reactive brilliant red K-2BP is decolorized under non-sterile conditions. The method not only save the operation cost which decolorizing reactive brilliant red K-2BP under sterile condition, but also provide the feasibility for using white rot fungus to degrade wastewater with dyes under non-sterile conditions.

  5. Bioremediation of heavy metals in liquid media through fungi isolated from contaminated sources.

    Science.gov (United States)

    Joshi, P K; Swarup, Anand; Maheshwari, Sonu; Kumar, Raman; Singh, Namita

    2011-10-01

    Wastewater particularly from electroplating, paint, leather, metal and tanning industries contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and biosorption at low cost and in eco-friendly way. An attempt was, therefore, made to isolate fungi from sites contaminated with heavy metals for higher tolerance and removal of heavy metals from wastewater. Seventy-six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspegillus awamori, Aspergillus flavus, Trichoderma viride) also were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi. With respect to Pb, Cd, Cr and Ni, maximum uptake of 59.67, 16.25, 0.55, and 0.55 mg/g was observed by fungi Pb3 (Aspergillus terreus), Trichoderma viride, Cr8 (Trichoderma longibrachiatum), and isolate Ni27 (A. niger) respectively. This indicated the potential of these fungi as biosorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. PMID:23024411

  6. Toxicity profile of choline chloride-based deep eutectic solvents for fungi and Cyprinus carpio fish.

    Science.gov (United States)

    Juneidi, Ibrahim; Hayyan, Maan; Mohd Ali, Ozair

    2016-04-01

    An investigation on the toxicological assessment of 10 choline chloride (ChCl)-based deep eutectic solvents (DESs) towards four fungi strains and Cyprinus carpio fish was conducted. ChCl was combined with materials from different chemical groups such as alcohols, sugars, acids and others to form DESs. The study was carried out on the individual DES components, their aqueous mixture before DES formation and their formed DESs. The agar disc diffusion method was followed to investigate their toxicity on four fungi strains selected as a model of eukaryotic microorganisms (Phanerochaete chrysosporium, Aspergillus niger, Lentinus tigrinus and Candida cylindracea). Among these DESs, ChCl:ZnCl2 exhibited the highest inhibition zone diameter towards the tested fungi growth in vitro, followed by the acidic group (malonic acid and p-toluenesulfonic acid). Another study was conducted to test the acute toxicity and determine the lethal concentration at 50 % (LC50) of the same DESs on C. carpio fish. The inhibition range and LC50 of DESs were found to be different from their individual components. DESs were found to be less toxic than their mixture or individual components. The LC50 of ChCl:MADES is much higher than that of ChCl:MAMix. Moreover, the DESs acidic group showed a lower inhibition zone on fungi growth. Thus, DESs should be considered as new components with different physicochemical properties and toxicological profiles, and not merely compositions of compounds. PMID:26743645

  7. Biodegradation study of crop residues as affected by exogenous inorganic nitrogen and fungal inoculants.

    Science.gov (United States)

    Gaind, Sunita; Pandey, Alok Kumar; Lata

    2005-01-01

    The comparative decomposition of chickpea residue, and chopped and unchopped wheat straw was investigated in pits for 120 days. Microbial biomass, humus, C/N ratio, pH, Electrical conductivity (EC), dehydrogenase, alkaline phosphatase, cellulase, xylanase, total phenol and soluble protein were determined to assess their response to the addition of inorganic nitrogen and mixed fungal inoculum of Aspergillus nidulans, Phanerochaete chrysosporium and Trichoderma viride. The evaluation of physico-chemical parameters (organic matter, organic carbon, N, C/N, pH, EC, microbial biomass) revealed that by supplementing unchopped wheat straw with 1% urea and mixed fungal inoculum, a lowest C/N ratio of 10.7, lowest biomass of 9.54 and highest humus content of 13% can be achieved within 3 months. Germination of Lepidium sativum (cress seeds) showed a germination index >60%, in this treatment. The enzyme assay for dehydrogenase indicated highest microbial activity in uninoculated treatments compared to fungal inoculated counterparts, in the second month sampling (active phase of composting). However, cellulase and xylanase activity showed an upward trend during curing phase of composting. Chickpea residue compost, though resulted in a C/N ratio of 17.3, but its germination index was less than 60%. The rapid quality tests conducted for H2S, NH3, NO3 and starch confirmed the stability and maturity of finished compost prepared from wheat straw through microbial inoculants. PMID:16028202

  8. SACCHARIFICATION BY FUNGI AND ETHANOL PRODUCTION BY BACTERIA USING LIGNOCELLULOSIC MATERIALS

    Directory of Open Access Journals (Sweden)

    Srivastava Ajeet Kumar

    2012-05-01

    Full Text Available Lignocellulosic material is one of the most abundant, renewable and inexpensive energy resources for bioethanol production. These materials are mainly composed of three groups of polymers namely cellulose, hemicellulose and lignin. Cellulose and hemicellulose are sugar rich fractions of interest for use in fermentation processes such as ethanol production. Cellulase production by the different fungi like Trichoderma reesei (MTCC-4876, Phanerochaete chrysosporium (MTCC-787 and Aspergillus awamori (MTCC-6652 were studied using different substrates (rice straw, wheat straw and rice husk by keeping the concentration constant at 5g/ 150 ml. The subculture medium was a salt solution consisting of KH2PO4, CaCl2, etc. Fungal cells were sub-cultured in an orbital shaker (180 rpm at 30°C for 1-2 generations (two days for each generation and were then used as inoculums. The maximum cellulase production and saccharification observed in the presence of combination of fungi with treated rice straw. Further Zymomonas mobilis bacteria was used for carrying out fermentation of sugars to ethanol production. Among the three raw materials studied the ethanol yield was observed to be the highest in rice straw ( 9.5 g/l .

  9. Effects of pH and Temperature on Recombinant Manganese Peroxidase Production and Stability

    Science.gov (United States)

    Jiang, Fei; Kongsaeree, Puapong; Schilke, Karl; Lajoie, Curtis; Kelly, Christine

    The enzyme manganese peroxidase (MnP) is produced by numerous white-rot fungi to overcome biomass recalcitrance caused by lignin. MnP acts directly on lignin and increases access of the woody structure to synergistic wood-degrading enzymes such as cellulases and xylanases. Recombinant MnP (rMnP) can be produced in the yeast Pichia pastoris αMnP1-1 in fed-batch fermentations. The effects of pH and temperature on recombinant manganese peroxidase (rMnP) production by P. pastoris αMnP1-1 were investigated in shake flask and fed-batch fermentations. The optimum pH and temperature for a standardized fed-batch fermentation process for rMnP production in P. pastoris ctMnP1-1 were determined to be pH 6 and 30 °C, respectively. P. pastoris αMnP1-1 constitutively expresses the manganese peroxidase (mnp1) complementary DNA from Phanerochaete chrysosporium, and the rMnP has similar kinetic characteristics and pH activity and stability ranges as the wild-type MnP (wtMnP). Cultivation of P. chrysosporium mycelia in stationary flasks for production of heme peroxidases is commonly conducted at low pH (pH 4.2). However, shake flask and fed-batch fermentation experiments with P. pastoris αMnP1-1 demonstrated that rMnP production is highest at pH 6, with rMnP concentrations in the medium declining rapidly at pH less than 5.5, although cell growth rates were similar from pH 4-7. Investigations of the cause of low rMnP production at low pH were consistent with the hypothesis that intracellular proteases are released from dead and lysed yeast cells during the fermentation that are active against rMnP at pH less than 5.5.

  10. Decomposição fúngica de ácido tânico e outros compostos em efluente agroindustrial = Fungic decomposition of tannic acid and other compounds from agri-industrial effluent

    Directory of Open Access Journals (Sweden)

    Natalino Perovano Filho

    2011-04-01

    production of enzymes that degrade tannic acid, such as laccase, while Mucor sp. was better to remove the Chemical Oxygen Demand (COD and the total phenol content, followed by Cladosporium sp., Phanerochaete chrysosporium and Geotrichum candidum.

  11. CHARACTERIZATION OF THE OXIDATIVE ENZYME POTENTIAL IN WILD WHITE ROT FUNGI FROM MISIONES (ARGENTINA

    Directory of Open Access Journals (Sweden)

    Maria Isabel FONSECA

    2014-05-01

    Full Text Available This research aimed to evaluate the potential of several native white rot fungi (WRF isolated from subtropical environments of Misiones (Argentina to produce different ligninolytic enzymes. Coriolus versicolor f. antarcticus BAFC 266, Pycnoporus sanguineus BAFC 2126 and Phlebia brevispora BAFC 633 showed the highest phenoloxidase activity. Ganoderma applanatum strain E, P. sanguineus BAFC 2126 and P. brevispora BAFC 633 revealed marked laccase and peroxidase activity. C. versicolor f. antarcticus, G. applanatum (strain A and Trametes villosa, gave high positive reactions with 2,6-dimethoxyphenol oxidation at the lowest tested pH. C. versicolor f. antarcticus, G. applanatum strains D and F, T. elegans BAFC 2127and T. villosa, showed the highest manganese peroxidase activity. C. versicolor f. antarcticus also produced the highest lignin peroxidase activity. Tyrosinase activity was mostly evident in G. applanatum strains (D and F and Phanerochaete chrysosporium HHB 11741. Kraft liquor decolorization results were variable and depended on the fungus and the liquor concentration. Some fungi with moderate ligninolytic activity showed high decolorization rates (e.g. Pleurotus sajor-caju and Steccherinium sp. BAFC 1171 indicating the significance of additional approach to evaluate a potential biotechnological application. Caracterización del potencial enzimático oxidativo de cepas nativas de hongos de pudrición blanca de la selva subtropical de Misiones (ArgentinaEl objetivo de este trabajo fue evaluar el potencial para producir enzimas ligninolíticas de diversas cepas de hongos de pudrición blanca, nativas de la Provincia de Misiones (Argentina. Coriolus versicolor v. antarcticus BAFC 266, Pycnoporus sanguineus BAFC 2126 y Phlebia brevispora BAFC 633 mostraron un gran potencial para producir fenoloxidasas. En Ganoderma applanatum cepa E, P. sanguineus BAFC 2126  y P. brevispora BAFC 633 se observó una marcada actividad lacasa y peroxidasa. C

  12. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    .8-2.0 μm, with a distinct sympodial rachis of up to 70 μm long on which blastoconidia are formed, much like a bunch of grapes. Conidia 2.5-3.5 x 1.6-2.5 μm, one-celled, ellipsoidal to clavate-ellipsoidal, with a rather broad base, pale brownish; conidia...

  13. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660. ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  14. High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples

    OpenAIRE

    Toju, Hirokazu; Tanabe, Akifumi S; Yamamoto, Satoshi; Sato, Hirotoshi

    2012-01-01

    The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS) region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage ...

  15. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application. PMID:26854104

  16. Enhancement of Shelf Life of Button Mushroom, Agaricus bisporus (Higher Basidiomycetes) by Fumigant Application of Lippia alba Essential Oil.

    Science.gov (United States)

    Vishwakarma, Pratima; Pandey, Abhay K; Mishra, Priyanka; Singh, Pooja; Tripathi, N N

    2015-01-01

    Eleven essential oils isolated from higher plant species were assessed against the four isolates of Verticillium fungicola found on fruiting bodies of Agaricus bisporus. Eucalyptus citriodora and Lippia alba oils were more efficacious and completely inhibited the mycelial growth of fungal isolates. L. alba oil was fungistatic and fungicidal at 10- and 20-µL concentrations against all of the isolates, respectively, and was more potent than E. citriodora oil as well as some prevalent synthetic fungicides such as benomyl, ethylene dibromide, and phosphine. Eighty microliters of L. alba oil protected 500 g of fruiting bodies of A. bisporus for up to 7 d from infection of the fungus under in vivo conditions. The findings strengthen the possibility of L. alba oil as a plant-based protectant to enhance the shelf life of A. bisporus fruiting bodies. PMID:25746409

  17. Review on Chaga Medicinal Mushroom, Inonotus obliquus (Higher Basidiomycetes): Realm of Medicinal Applications and Approaches on Estimating its Resource Potential.

    Science.gov (United States)

    Balandaykin, Mikhail E; Zmitrovich, Ivan V

    2015-01-01

    This paper presents a review of the realm of medicinal applications of Inonotus obliquus raw materials, sterile conks I. obliquus, based on the bibliographies of chemical studies of the fungus. The experimental part of the paper is devoted to the presentation of methods of estimating the resource potential of this fungus based on data obtained in the comfort zone of ththis species. A new form, I. obliquus f. sterilis, is formally described. PMID:25746615

  18. Contrasting Diversity and Host Association of Ectomycorrhizal Basidiomycetes versus Root-Associated Ascomycetes in a Dipterocarp Rainforest

    OpenAIRE

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large...

  19. Chemical Composition and Medicinal Value of the New Ganoderma tsugae var. jannieae CBS-120304 Medicinal Higher Basidiomycete Mushroom.

    Science.gov (United States)

    Chan, Jannie Siew Lee; Asatiani, Mikheil D; Sharvit, Lital E; Trabelcy, Beny; Barseghyan, Gayane S; Wasser, Solomon P

    2015-01-01

    In this research, the chemical composition and anticancer and antioxidant activity of the new medicinal mushroom Ganoderma tsugae var. jannieae CBS-120304 were evaluated. The chemical composition assay includes amounts of total carbohydrates and proteins, amino acids, fatty acids, micro- and macroelements, and vitamins. The investigated medicinal mushroom seemed to be a rich source of nutritional components. Mycelium accumulated more than 2-fold more total protein compared with the fruiting body and reached 37% and 16% of dry weight, respectively. Carbohydrate content in the fruiting body seemed to be conspicuously higher than in the mycelium (50% of dry weight) and reached 80% of dry weight. Quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, and linoleic acid were the major fatty acids. Toxic elements, such as silver, arsenic, cadmium, and mercury, were found only in trace amounts in mycelium and were not detected in the fruiting body. Furthermore, the 1,1-diphenyl-2-picrylhydrazyl free radical scavenging assay was used to evaluate antioxidant activity. The highest radical scavenging activity was 9.0 mg/mL (65.9%) by ethanol extract. In addition, mycelial extracts were tested to inhibit MCF7 breast cancer cells. Ganoderma tsugae var. jannieae ethyl acetate extract (GTEAE) extract showed high potential by inhibiting reporter activity by more than 70%. Results demonstrated that GTEAE had a strong effect on inhibitory protein κΒα level in the higher concentration used (200 gg/mL), which could be compared with the effect of parthenolide. Furthermore, GTEAE demonstrated strong inhibition of IκΒα phosphorylation. PMID:26559860

  20. 吉林省担子菌补记(七)%Notes on Basidiomycetes of Jilin Province(Ⅶ)

    Institute of Scientific and Technical Information of China (English)

    范宇光; 图力古尔

    2006-01-01

    报道了吉林省新记录分布担子菌6种,即肉褐鳞环柄菇(Lepiota brunneoincarnata Chodat & C.Martín)、短柄銛囊蘑[Melanoleuca brevipes(Bull.)Pat]、紫皮丽蘑[Calocybe ionides(Bull.)Donk]、皮尔松湿伞(Hygrophorus persoonii Arnolds)、微黄拟锁瑚菌[Clavulinopsis helvola(Pers.)]和弹球菌(Sphaerobolus stellatus Tode).其中,弹球菌属为吉林省新记录属.凭证标本存放于吉林农业大学菌物标本馆(HMJAU).

  1. Complex Enzyme-Assisted Extraction, Purification, and Antioxidant Activity of Polysaccharides from the Button Mushroom, Agaricus bisporus (Higher Basidiomycetes).

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Zhou, Xinghai

    2015-01-01

    Agaricus bisporus polysaccharides (ABP) were extracted by complex enzyme-assisted extraction methodology. The following were optimal conditions for the extraction of crude ABP: complex enzyme amount, 2.2%; temperature, 62°C; time, 3 h; and pH, 4. Under these conditions, the experimental yield of crude ABP was 6.87%. The crude ABP was purified by diethylaminoethyl-cellulose 52 chromatography and Sephadex G-100 chromatography, and one fraction-namely, ABP-1-was produced. The ABP-1 contained 93.67% carbohydrate, 1.46% protein, and 0.62% uronic acid. The constituent monosaccharides were predominantly glucose, galactose, mannose, and xylose. The antioxidant activities of ABP-1 were investigated by measuring its scavenging ability on 2,2-diphenyl-1-picrylhydrazyl and hydroxyl radicals, its ferric-reducing activity power, and the reducing power assay. At a concentration of 1.2 mg/mL, ABP-1 seemed to possess good free radical scavenging activity, with a scavenging value of about 56%. The results indicate that ABP-1 has good antioxidant activity. PMID:26756190

  2. Submerged Culture of Grifola gargal and G. sordulenta (Higher Basidiomycetes) from Argentina as a Source of Mycelia with Antioxidant Activity.

    Science.gov (United States)

    Postemsky, Pablo Daniel; Curvetto, Néstor Raúl

    2015-01-01

    Submerged culture is an alternative mycelium source for Grifola gargal and G. sordulenta, two rare edible mushrooms related to Grifola frondosa. This work studies their mycelia as a source of antioxidants. The efficient concentrations of methanolic extracts in both radical scavenging (RS) and reducing power (RP) abilities in G. gargal and in G. sordulenta showed a high antioxidant activity. In the experimental design used, the antioxidant activity mainly depended on the culture conditions rather than on the media composition. Irrespective of the basal culture medium, mycelium methanolic extracts of G. sordulenta obtained from culture in Erlenmeyer flasks showed equivalents to ascorbic acid (EQ(AA)) RS-EQ(AA) and RP-EQ(AA) contents higher than the corresponding values obtained with jar cultures. Under stationary cultivation, G. sordulenta produced approximately 50% higher content in both RS-EQ(AA) and RP-EQ(AA) than the medicinal mushroom G. frondosa. Phenolics correlated with RS-EQ(AA) and RP-EQ(AA) in G. gargal and with RP-EQ(AA) in G. sordulenta; besides, thin-layer chromatography showed these compounds to be at least in part related to the RS capacity. It is concluded that G. gargal and G. sordulenta mycelia are excellent sources of antioxidant metabolites. PMID:25746407

  3. Purification and characterization of a novel small-molecule polysaccharide from the Maitake medicinal mushroom Grifola frondosa (higher Basidiomycetes).

    Science.gov (United States)

    Zhou, Changyan; Qiao, Yanru; Tang, Qingjiu; Jia, Wei; Liu, Yanfang; Wu, Aizhong

    2013-01-01

    A novel small-molecule polysaccharide with a molecular mass of 2.6 kDa, was isolated from the culinary-medicinal Maitake mushroom Grifola frondosa. GFPS is composed of fucose, rhamnose, galactose, glucose, and mannose; galactose, glucose, and mannose were the dominant monosaccharides. Absorption peaks at 1077 cm-1, 1024 cm-1, and 873 cm-1, as revealed by infrared spectrum, suggesting that GFPS consists of pyranoside. GFPS significantly enhanced the production of nitric oxide and secretion of cytokines (tumor necrosis factor-α, interleukin-1β, and interleukin-δ) from macrophages in vitro. These results indicate that this novel small-molecule polysaccharide might be beneficial for immune defense. PMID:23557366

  4. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos. PMID:27100524

  5. Precipitation diagram and optimization of crystallization conditions at low ionic strength for deglycosylated dye-decolorizing peroxidase from a basidiomycete

    International Nuclear Information System (INIS)

    Precipitation phase diagrams can be rapidly constructed using dispensing-robot technology. These diagrams provide information that assists in optimization of crystal growth. The growth of suitably sized protein crystals is essential for protein structure determination by X-ray crystallography. In general, crystals are grown using a trial-and-error method. However, these methods have been modified with the advent of microlitre dispensing-robot technology and of protocols that rapidly screen for crystal nucleation conditions. The use of one such automatic dispenser for mixing protein drops (1.3–2.0 µl in volume) of known concentration and pH with precipitating solutions (ejecting 2.0 µl droplets) containing salt is described here. The results of the experiments are relevant to a crystallization approach based on a two-step procedure: screening for the crystal nucleation step employing robotics followed by optimization of the crystallization conditions using incomplete factorial experimental design. Large crystals have successfully been obtained using quantities as small as 3.52 mg protein

  6. Species richness and abundance of ectomycorrhizal basidiomycete sporocarps on a moisture gradient in the Tsuga heterophylla zone

    Science.gov (United States)

    O'Dell, Thomas E.; Ammirati, Joseph F.; Schreiner, Edward G.

    1999-01-01

    Sporocarps of epigeous ectomycorrhizal fungi and vegetation data were collected from eight Tsuga heterophylla (Raf.) Sarg. - Pseudotsuga menziesii (Mirb.) Franco stands along a wet to dry gradient in Olympic National Park, Washington, U.S.A. One hundred and fifty species of ectomycorrhizal fungi were collected from a total sample area of 2.08 ha. Over 2 years, fungal species richness ranged from 19 to 67 taxa per stand. Sporocarp standing crop ranged from 0 to 3.8 kg/ha, averaging 0.58 kg/ha, 0.06 kg/ha in spring and 0.97 kg/ha in fall. Sporocarp standing crop and fungal species richness were correlated with precipitation. These results demonstrated that ectomycorrhizal fungal sporocarp abundance and species richness can be partly explained in terms of an environmental gradient.

  7. Protective Effects of Black Hoof Medicinal Mushroom from Korea, Phellinus linteus (Higher Basidiomycetes), on Osteoporosis In Vitro and In Vivo.

    Science.gov (United States)

    Kim, In-Ho; Chung, Min-Yu; Shin, Ji Young; Han, Daeseok

    2016-01-01

    The protective effect of Phellinus linteus (ethanol extract) against osteoporosis was investigated using the Saos-2 human osteoblast-like cell line and osteoclasts. A nontoxic concentration of Ph. linteus (10-2 to 10-8 mg mL-1) increased alkaline phosphatase (ALP) (EC 3.1.3.1) activity to a larger extent than soy did. Ph. linteus also attenuated the number and the activity of tartrate-resistant acid phosphatase-positive multinucleated osteoclasts. These results indicate that Ph. linteus likely regulated both osteoblasts and osteoclasts, contributing to the protection against osteoporosis. The protective effect of Ph. linteus was examined in ovariectomized (OVX) rats. Histological analysis indicates that Ph. linteus improved trabecular bone mass and reduced osteoclast frequency without affecting lipid droplet accumulation in the femur of OVX rats. A Ph. linteus supplementation for 12 weeks also significantly increased serum ALP activity and reduced urinary deoxypyridinoline level in OVX rats. Ultimately, we found that 12-week Ph. linteus supplementation increased the bone accumulation of minerals, including calcium, magnesium, and phosphorus. Collectively, Ph. linteus protected against osteoporosis by balancing the number of osteoblasts and osteoclasts, which was particularly associated with increased ALP activity in vitro and in vivo and mineral accumulation in bone. PMID:27279443

  8. Chemical Constituents of the Basidiomycetes Marasmius maximus Hongo%大皮伞化学成分研究

    Institute of Scientific and Technical Information of China (English)

    牛芸

    2013-01-01

    大皮伞(Marasmius maximus Hongo)是食用菌类,在我国各地均有分布,对其主要化学成分进行研究具有重要的意义.通过运用多种分离与分析方法(CC、TLC、prep.TLC、MPLC、HPLC等)以及波谱学技术(1D NMR、2D NMR、MS、HR-MS、UV/Vis等)并借助必要的化学手段对其发酵液进行化学成分的研究,共分离得到5个化合物.分别为:麦角甾-4,6,8 (14)22-四烯-3-酮、(22E,24R)-麦角甾-7,22-二烯-3β,5α,6β-三醇、邻苯二甲酸二异丁酯、三亚麻油酸甘油酯、5-Hydroxymethl-1-2-呋喃甲醛.

  9. Notes on Basidiomycetes of Jilin Province (Ⅳ)%吉林省担子菌补记(四)

    Institute of Scientific and Technical Information of China (English)

    图力古尔; 李玉

    2003-01-01

    报道了吉林省新分布担子菌6种,即刺孢蜡蘑Laccaria tortilis (Bolt.) S.F.Gray,大型皮伞Marasmius maximus Hongo,粗毛原迷孔菌Protodaedalea hispida Imazeki,巢孔菌 Poronidulus conchifer (Schw.) Murr.中华散尾菌Lysurus sinensis Lioyd和袋形地星Geastrum saccatum (Fr.) Fisch..其中,原迷孔菌属和巢孔菌属为吉林省新记录属.

  10. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  11. Gymnopilus tuxtlensis (Basidiomycetes, Agaricales), especie tropical conocida de México y América del Sur

    OpenAIRE

    Laura Guzm\\u00E1n-D\\u00E1valos; Mar\\u00EDa de Jes\\u00FAs Herrera; Beatriz E. Cardona; Yamill\\u00E9 Saldarriaga

    2006-01-01

    Gymnopilus tuxtlensis fue descrito a partir de ejemplares recolectados en la región de Los Tuxtlas, Veracruz, México. En este trabajo se estudiaron más de 20 materiales recolectados recientemente o depositados en herbarios, con lo que se amplía su distribución conocida en México al registrarla de Jalisco, y se cita por primera vez de América del Sur, con base en especímenes de Colombia y Venezuela. Esta especie crece en regiones tropicales y es muy característica por su basidio...

  12. Gymnopilus tuxtlensis (Basidiomycetes, Agaricales, especie tropical conocida de México y América del Sur

    Directory of Open Access Journals (Sweden)

    Laura Guzm\\u00E1n-D\\u00E1valos

    2006-01-01

    Full Text Available Gymnopilus tuxtlensis fue descrito a partir de ejemplares recolectados en la región de Los Tuxtlas, Veracruz, México. En este trabajo se estudiaron más de 20 materiales recolectados recientemente o depositados en herbarios, con lo que se amplía su distribución conocida en México al registrarla de Jalisco, y se cita por primera vez de América del Sur, con base en especímenes de Colombia y Venezuela. Esta especie crece en regiones tropicales y es muy característica por su basidioma pequeño, de color amarillo-mostaza, con una base estrigosa, por presentar pleurocistidios grandes y de forma característica, y queilocistidios más pequeños.

  13. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Science.gov (United States)

    Tsuji, Masaharu; Yokota, Yuji; Shimohara, Kodai; Kudoh, Sakae; Hoshino, Tamotsu

    2013-01-01

    Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6%) to Mrakia blollopis CBS8921(T) in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD) removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions. PMID:23516630

  14. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  15. An Application of Wastewater Treatment in a Cold Environment and Stable Lipase Production of Antarctic Basidiomycetous Yeast Mrakia blollopis

    OpenAIRE

    Tsuji, Masaharu; Yokota, Yuji; Shimohara, Kodai; Kudoh, Sakae; Hoshino, Tamotsu

    2013-01-01

    Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6%) to Mrakia blollopis CBS8921T in ITS and D1/D2 sequences and had two unique characteristics when ap...

  16. Isolation and Characterization of a Ubiquitin-Like Ribonuclease from the Cultured Deep Root Mushroom, Oudemansiella radicata (Higher Basidiomycetes).

    Science.gov (United States)

    Liu, Qin; Chen, Hao; Wang, Hexiang; Ng, Tzi Bun

    2015-01-01

    The isolation of a novel 13.5-kDa ribonuclease, displaying a ubiquitin-like inner peptide sequence, from dried fruiting bodies of the cultured mushroom Oudemansiella radicata (Relhan: Fr.) Singer (=Xerula radicata) is reported. The purification protocol deployed encompassed sequentially, cation/anion exchange chromatography on CM-cellulose, DEAE-cellulose and SP-Sepharose, and FPLC-gel filtration on a Superdex 75 column. The purified enzyme manifested optimum activity at 70 °C and pH 4.6, respectively. The activity of the RNase was inhibited by the majority of metal ions tested, especially Al3+, Hg2+, and Cd2+ ions, but was promoted by K+ ions. It exhibited the highest ribonucleolytic activity toward poly (C), lower activity toward poly (G), and negligible activity toward poly (U) and poly (A). Compared with mushroom ubiquitin-like RNases reported earlier, O. radicata RNase possesses a larger molecular mass, distinctive chromatographic behavior on DEAE-cellulose, a lower optimum pH, and a unique polyhomoribonucleotide specificity. PMID:26853958

  17. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants. PMID:17898510

  18. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids

    OpenAIRE

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  19. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis. PMID:24526638

  20. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. PMID:20564650

  1. [Kinetics model for batch culture of white rot fungus].

    Science.gov (United States)

    Xiong, Xiao-ping; Wen, Xiang-hua; Xu, Kang-ning; Bian, Bing-hui

    2008-02-01

    In order to understand ligninolytic enzymes production process during culture of white rot fungus, accordingly to direct the design of fermentation process, a kinetics model was built for the batch culture of Phanerochaete chrysosporium. The parameters in the model were calibrated based on the experimental data from free and immobilized culture separately. The difference between each variable's values calculated based on kinetics model and experimental data is within 15%. Comparing parameters for the free and the immobilized culture, it is found that maximum biomass concentrations are both 1.78 g/L; growth rate ratio of immobilized culture (0.6683 d(-1)) is larger than that of free culture (0.5144 d(-1)); very little glucose is consumed for biomass growth in free culture while in immobilized culture much glucose is used and ammonium nitrogen is consumed at a greater rate. Ligninolytic enzymes production process is non-growth related; fungal pellets can produce MnP (231 U/L) in free culture with a production rate of 115.8 U x (g x d)(-1) before peak and 26.1 U x (g x d)(-1) after peak, thus fed-batch is a possible mode to improve MnP production and fermentation efficiency. MnP (410 U/L) and LiP (721 U/L) can be produced in immobilized culture, but MnP and LiP production rate decrease from 80.1 U x (g x d)(-1) and 248.9 U x (g x d)(-1) to 6.04 U x (g x d)(-1) and 0 U x (g x d)(-1), respectively, indicating a proper feed moment is before the enzymes peak during fed-batch culture. PMID:18613526

  2. Microbial liquefaction of peat for the production of synthetic fuels

    Energy Technology Data Exchange (ETDEWEB)

    Gunasekaran, M.

    1988-01-01

    Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungi were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.

  3. Bio-Remediation of Acid Mine Drainage in the Sarcheshmeh Porphyry Copper Mine by Fungi: Batch and Fixed Bed Process

    Directory of Open Access Journals (Sweden)

    Hanieh Soleimanifar

    2012-12-01

    Full Text Available Acid mine drainage (AMD containing high concentrations of iron and sulphate, low pH and variableconcentrations of heavy metals leads to many environmental problems. The concentrations of Cu and Mnare high in the AMD of the Sarcheshmeh porphyry copper mine, Kerman province, south of Iran. In thisstudy, the bio-remediation of Cu and Mn ions from acid mine drainage was investigated using two nativefungi called Aspergillus niger and Phanerochaete chrysosporium which were extracted from the soil andsediment samples of the Shour River at the Sarcheshmeh mine. The live fungi was first harvested andthen killed by boiling in 0.5 N NaOH solution. The biomass was finally dried at 60 C for 24 h andpowdered. The optimum biosorption parameters including pH, temperature, the amount of biosorbent andcontact time were determined in a batch system. The optimum pH varied between 5 and 6. It was foundthat the biosorption process increased with an increase in temperature and the amount of biosorbent.Biosorption data were attempted by Langmuir and Freundlich isotherm models and showed a good match.Kinetic studies were also carried out in the present study. The results show that the second-order kineticsmodel fits well the experimental data. The biosorption experiments were further investigated with acontinuous system to compare the biosorption capacities of two systems. The results show thatbiosorption process using a continuous system increases efficiency up to 99%. A desorption process waseventually performed in order to recover Copper and Manganese ions. This process was successful andfungi could be used again.

  4. Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego; Challacombe, Jean; Morgenstern, Ingo; Hibbett, David; Schmoll, Monika; Kubicek, Christian P.; Ferreira, Patricia; Ruiz-Duenas, Francisco; Martinez, Angel T.; Kersten, Phil; Hammel, Ken; Vanden Wymelenberg, Amber; Gaskell, Jill; Lindquist, Erika; Sabat, Gregorz; Splinter Bondurant, Sandra; Larrondo, Luis F.; Canessa, Paulo; Vicuna, Rafael; Yadev, Jagjit; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Pisabarro, Antonio; Lavin, Jose L.; Oguiza, Jose A.; Master, Emma; Henrissat, Bernard; Coutinho, Pedro M.; Harris, Paul; Magnuson, Jon K.; Baker, Scott E.; Bruno, Kenneth S.; Kenealy, William; Hoegger, Patrik; Kues, Ursula; Ramaiya, Preethi; Lucas, Susan; Salamov, Asaf; Shapiro, Harris; Tu, Hank; Chee, Christine L.; Misra, Monica; Xie, Gary; Teter, Sarah; Yaver, Debbie; James, Tim; Mokrejs, Martin; Pospisek, Martin; Grigoriev, Igor V.; Brettin, T.; Rokhsar, Daniel S.; Berka, Randy; Cullen, Dan

    2009-02-10

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome, and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in media containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative β-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Also upregulated under cellulolytic culture conditions were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H2O2. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H2O2 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. In particular, comparisons between P. placenta and the closely related white-rot fungus, Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which efficient depolymerization of lignin was lost.

  5. Fungal-transformation of surrogate sulphides and carbonaceous matter in refractory gold ores

    International Nuclear Information System (INIS)

    Refractory gold ores contain metal sulphides that encapsulate gold and prevent its dissolution by cyanide, and carbonaceous matter (CM) that adsorbs (or pregrob) gold cyanide complex during cyanidation. Pretreatment is therefore a necessary step to decompose the sulphides and liberate gold before cyanidation, and to deactivate CM and prevent it from adsorbing dissolved gold. To contribute to the pool of knowledge on the development of microbial-treatment techniques for refractory gold ores, this paper presents an overview of on-going research aimed at assessing the capability of the fungus, Phanerochaete chrysosporium, to degrade sulphides and CM. Pure pyrite and arsenopyrite, with initial sulphide sulphur content of 52% and 20% respectively, were used as surrogate for metal sulphides, whereas lignite, bituminous and anthracite coals were used to model the behavior of CM in refractory gold ores. The extent of biotransformation was primarily monitored by measuring sulphide sulphur in the residual sulphidic materials, and by determining the preg-robbing effect of the treated CM. Within 21 days of treatment, there was 18% and 39% oxidation of sulphide sulphur in pyrite and arsenopyrite respectively. During the same period, preg-robbing effect of CM reduced by 70-95% in the order of lignite < bituminous < anthracite. Partial characterization of the treated anthracite using XRD confirmed reduction in the graphitic structure of carbon, whereas in the case of pyrite, there was a decline in the major sulphide peak after microbial pretreatment. The results indicate that the fungus biotransforms mainly by increasing the amorphous nature of the substrates through destruction of the ordered structure, followed by introduction of oxygen groups. The findings suggest a novel and technically viable alternative method for oxidative pretreatment of refractory gold ores. (au)

  6. Perspectives on the use of transcriptomics to advance biofuels

    Directory of Open Access Journals (Sweden)

    Siseon Lee

    2015-11-01

    Full Text Available As a field within the energy research sector, bioenergy is continuously expanding. Although much has been achieved and the yields of both ethanol and butanol have been improved, many avenues of research to further increase these yields still remain. This review covers current research related with transcriptomics and the application of this high-throughput analytical tool to engineer both microbes and plants with the penultimate goal being better biofuel production and yields. The initial focus is given to the responses of fermentative microbes during the fermentative production of acids, such as butyric acid, and solvents, including ethanol and butanol. As plants offer the greatest natural renewable source of fermentable sugars within the form of lignocellulose, the second focus area is the transcriptional responses of microbes when exposed to plant hydrolysates and lignin-related compounds. This is of particular importance as the acid/base hydrolysis methods commonly employed to make the plant-based cellulose available for enzymatic hydrolysis to sugars also generates significant amounts of lignin-derivatives that are inhibitory to fermentative bacteria and microbes. The article then transitions to transcriptional analyses of lignin-degrading organisms, such as Phanerochaete chrysosporium, as an alternative to acid/base hydrolysis. The final portion of this article will discuss recent transcriptome analyses of plants and, in particular, the genes involved in lignin production. The rationale behind these studies is to eventually reduce the lignin content present within these plants and, consequently, the amount of inhibitors generated during the acid/base hydrolysis of the lignocelluloses. All four of these topics represent key areas where transcriptomic research is currently being conducted to identify microbial genes and their responses to products and inhibitors as well as those related with lignin degradation/formation.

  7. Genome, transcriptome, and secretome analysis of wood decay fungus postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego [Los Alamos National Laboratory; Challacombe, Jean F [Los Alamos National Laboratory; Misra, Monica [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Brettin, Thomas [Los Alamos National Laboratory; Morgenstern, Ingo [CLARK UNIV; Hibbett, David [CLARK UNIV.; Schmoll, Monika [UNIV WIEN; Kubicek, Christian P [UNIV WIEN; Ferreira, Patricia [CIB, CSIC, MADRID; Ruiz - Duenase, Francisco J [CIB, CSIC, MADRID; Martinez, Angel T [CIB, CSIC, MADRID; Kersten, Phil [FOREST PRODUCTS LAB; Hammel, Kenneth E [FOREST PRODUCTS LAB; Vanden Wymelenberg, Amber [U. WISCONSIN; Gaskell, Jill [FOREST PRODUCTS LAB; Lindquist, Erika [DOE JGI; Sabati, Grzegorz [U. WISCONSIN; Bondurant, Sandra S [U. WISCONSIN; Larrondo, Luis F [U. CATHOLICA DE CHILE; Canessa, Paulo [U. CATHOLICA DE CHILE; Vicunna, Rafael [U. CATHOLICA DE CHILE; Yadavk, Jagiit [U. CINCINATTI; Doddapaneni, Harshavardhan [U. CINCINATTI; Subramaniank, Venkataramanan [U. CINCINATTI; Pisabarro, Antonio G [PUBLIC U. NAVARRE; Lavin, Jose L [PUBLIC U. NAVARRE; Oguiza, Jose A [PUBLIC U. NAVARRE; Master, Emma [U. TORONTO; Henrissat, Bernard [CNRS, MARSEILLE; Coutinho, Pedro M [CNRS, MARSEILLE; Harris, Paul [NOVOZYMES, INC.; Magnuson, Jon K [PNNL; Baker, Scott [PNNL; Bruno, Kenneth [PNNL; Kenealy, William [MASCOMA, INC.; Hoegger, Patrik J [GEORG-AUGUST-U.; Kues, Ursula [GEORG-AUGUST-U; Ramaiva, Preethi [NOVOZYMES, INC.; Lucas, Susan [DOE JGI; Salamov, Asaf [DOE JGI; Shapiro, Harris [DOE JGI; Tuh, Hank [DOE JGI; Chee, Christine L [UNM; Teter, Sarah [NOVOZYMES, INC.; Yaver, Debbie [NOVOZYMES, INC.; James, Tim [MCMASTER U.; Mokrejs, Martin [CHARLES U.; Pospisek, Martin [CHARLES U.; Grigoriev, Igor [DOE JGI; Rokhsar, Dan [DOE JGI; Berka, Randy [NOVOZYMES; Cullen, Dan [FOREST PRODUCTS LAB

    2008-01-01

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative {beta}-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC{center_dot}MSIMS). Also upregulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H202. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H202 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons to the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost.

  8. Irradiation of Liquid Fungi Isolated Media from Contaminated Sources with Heavy Metals Additive

    International Nuclear Information System (INIS)

    Occupational lead exposure is an important health issue in Egyptian workers, employees of paint factories, workers of copying centres, drivers, and tile making factories are in higher risk of lead toxicity. Wastewater, particularly from electroplating, paint, leather, metal and tanning industries, contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and bio sorption at low cost and in eco-friendly way. Low level lead exposure can significantly induce motor dis functions and cognitive impairment in children. Seventy six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspergillus awamori, Aspergillus flavus, Trichoderma viride) were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi with respect to Pb, Cd, Cr and Ni with maximum uptake of 59.67, 16.25, 0.55 and 0.55 mg/g by fungi Pb3 (Aspergillus terreus), Trichoderma viride, Cr8 (Trichoderma longibrachiatum), and isolate Ni27 (A. niger), respectively. This indicated the potential of these fungi as bio sorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. The F-ratio was 0.55 and gives non-significant as irradiated

  9. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, T.P.S., E-mail: pgalindo@ua.pt [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Pereira, R. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto (Portugal); Freitas, A.C.; Santos-Rocha, T.A.P. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Rasteiro, M.G.; Antunes, F. [Department of Chemical Engineering, University of Coimbra, 3030-290 Coimbra (Portugal); Rodrigues, D. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Soares, A.M.V.M.; Gonçalves, F. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); and others

    2013-08-01

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP.

  10. Extracellular oxidative metabolism of wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Daniel Cullen

    2010-04-21

    Substantial progress has been made toward understanding the fundamental physiology and genetics of wood decay fungi, microbes that are capable of degrading all major components of plant cell walls. Efficient utilization of lignocellulosic biomass has been hampered in part by limitations in our understanding of enzymatic mechanisms of plant cell wall degradation. This is particularly true of woody substrates where accessibility and high lignin content substantially complicate enzymatic 'deconstruction'. The interdisciplinary research has illuminated enzymatic mechanisms essential for the conversion of lignocellulosics to simple carbohydrates and other small molecular weight products. Progress was in large part dependent on substantial collaborations with the Department of Energy's Joint Genome Institute (JGI) in Walnut Creek and Los Alamos, as well as the Catholic University, Santiago, Chile, the Royal Institute of Technology, Stockholm, the University of Minnesota, St. Paul, and colleagues at the University of Wisconsin and the Forest Products Laboratory. Early accomplishments focused on the development of experimental tools (2, 7, 22, 24-26, 32) and characterization of individual genes and enzymes (1, 3-5, 8, 9, 11, 14, 15, 17, 18, 23, 27, 33). In 2004, the genome of the most intensively studied lignin-degrading fungus, Phanerochaete chrysosporium, was published (21). This milestone lead to additional progress on this important model system (6, 10, 12, 13, 16, 28-31) and was further complemented by genome analysis of other important cellulose-degrading fungi (19, 20). These accomplishments have been highly cited and have paved the way for whole new research areas.

  11. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    International Nuclear Information System (INIS)

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP

  12. Inducción fúngica de la biorremediación de suelos contaminados con combustibles

    Directory of Open Access Journals (Sweden)

    Mary Lopretti

    2011-04-01

    Full Text Available La biorremediación de suelos ha sido en los últimos años una de las aplicaciones de los procesos de la biotecnología industrial que se ha desarrollado en busca de soluciones  naturales y eficientes al problema de la contaminación.Varios son los microorganismos que viven en condiciones extremas, desarrollando estrategias metabólicas que les permiten tener sus vías metabólicas aptas para vivir y reproducirse. Dentro de estas estrategias  se encuentra la acción de enzimas hidrolíticas, oxidativas y depolimerizantes que permiten modificar sustratos complejos como lo son los derivados del petróleo  y entre ellos los combustibles.En el presente trabajo se estudió la acción de dos hongos Gloeophylum trabeum y Phanerochaetes chrysosporium actuando en forma consorcial sobre sustratos  contaminados con gasoil y nafta.Se prepararon 4 reactores de fermentación sólida: dos de ellos blanco, contaminados sin inducción, y de los otros dos uno con nafta y el otro con gasoil inoculados ambos con 100cc de medio de propagación con micelios de P.chrysosporium y 50cc de medio de crecimiento con pellets de G. trabeum. Se extrajeron muestras cada 15 días y se evaluó  en el material de cada reactor características fisicoquímicas como %C, humedad y pH.También se realizó la evaluación microbiológica por siembra en placa y dilución en placa con agar malta al 1,25%. En todos los casos se obtuvieron micelios.Por último se determinó la actividad de enzimas lacasa  y peroxidasa. La actividad lacasa se determinó por espectrometría usando 0.5mM de ABTS como sustrato en 0,1M de buffer acetato de sodio pH5 y 1 ml de extracto obtenido por extracción salina. La determinación de actividad Mn peroxidasa se realizó con 0.01% de rojo fenol como sustrato en buffer succinato de sodio 0.1M en presencia de 1 ml de extracto enzimático, MnSO4 0.1M y H2O2 0.1M.Las actividad  de éstas enzimas permitió obtener moléculas mas pequeñas producto de la

  13. Litter degradation by the saprotrophic basidiomycete Hypholoma fasciculare and the changes of microbial community composition in fungus-colonized soil and wood

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Gunneviek, P. K.; do Boer, W.; Baldrian, Petr

    Manchester: BMS, 2007, s. 38-38. [Annual Scientific Meeting 2007. Manchester (GB), 09.09.2007-12.09.2007] R&D Projects: GA ČR GA303/06/0974; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : forest litter * microbial community * degradation Subject RIV: EE - Microbiology, Virology

  14. Cryptococcus randhawai sp. nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India.

    Science.gov (United States)

    Khan, Zia U; Ahmad, Suhail; Hagen, Ferry; Fell, Jack W; Kowshik, Tusharantak; Chandy, Rachel; Boekhout, Teun

    2010-03-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region sequences, the isolate belonged to the Cryptococcus albidus cluster (Filobasidiales, Tremellomycetes) and was closely related to Cryptococcus saitoi, Cryptococcus cerealis and Cryptococcus friedmannii with 98% sequence identity. Phenotypically, the species differed from C. saitoi with respect to growth temperature (up to 37degrees C), presence of a thin capsule, ability to grow in the absence of vitamins, and inability to assimilate citrate and ethylamine. With respect to C. friedmannii, it differed in growth temperature, ability to assimilate lactose, raffinose, L: -rhamnose, myo-inositol, and inability to utilize citrate. Furthermore, our isolate also differed from C. cerealis in growth temperature, presence of capsule and inability to assimilate L: -sorbose. In view of the above phenotypic differences and unique rDNA sequences, we consider that our isolate represents a new species of Cryptococcus, and therefore, a new species, Cryptococcus randhawai is proposed for this taxon. The type strain J11/2002 has been deposited in the culture collection of the Centraalbureau voor Schimmelcultures (CBS10160) and CABI Biosciences (IMI 393306). PMID:20091225

  15. Cryptococcus randhawai sp nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India

    NARCIS (Netherlands)

    Khan, Z.U.; Ahmad, S.; Hagen, F.; Fell, J.W.; Kowshik, T.; Chandy, R.; Boekhout, T.

    2010-01-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region seque

  16. EFFECT OF DIFFERENT CULTURE CONDITIONS AND INDUCERS ON PRODUCTION OF LACCASE BY A BASIDIOMYCETE FUNGAL ISOLATE PLEUROTUS OSTREATUS HP-1 UNDER SOLID STATE FERMENTATION

    Directory of Open Access Journals (Sweden)

    Hardik Patel

    2009-02-01

    Full Text Available The production of laccase by an indigenous strain of Pleurotus ostreatus HP-1 was studied on solid state fermentation. Culture parameters such as type and concentration of substrate, inoculum size, moisture content, pH, surfactant presence, temperature, and nitrogen source were optimized by conventional “one factor at a time” methodology. A maximum laccase yield of 3952 U g-1 of dry substrate optimized was obtained with wheat straw as substrate with five agar plugs as the inoculum, 60% moisture content, pH 5.0, surfactant concentration 0.015 gl-1, and nitrogen source (combination of L-asparagine and NH4NO3 at 10 mM concentration each at incubation temperature 28oC. Enhancement in laccase activity was achieved with the use of various aromatic inducers and copper sulphate. Highest laccase activity of 14189 U g-1 of dry substrate was achieved using 0.28 mM copper sulphate under optimized conditions. Thus, the indigenous isolate seems to be a potential producer of laccase using SSF and can be exploited for further biotechnological applications. The process also promises economic utilization and value addition of agro-residues.

  17. EFFECT OF DIFFERENT CULTURE CONDITIONS AND INDUCERS ON PRODUCTION OF LACCASE BY A BASIDIOMYCETE FUNGAL ISOLATE PLEUROTUS OSTREATUS HP-1 UNDER SOLID STATE FERMENTATION

    OpenAIRE

    Hardik Patel; Akshaya Gupte; Shilpa Gupte

    2009-01-01

    The production of laccase by an indigenous strain of Pleurotus ostreatus HP-1 was studied on solid state fermentation. Culture parameters such as type and concentration of substrate, inoculum size, moisture content, pH, surfactant presence, temperature, and nitrogen source were optimized by conventional “one factor at a time” methodology. A maximum laccase yield of 3952 U g-1 of dry substrate optimized was obtained with wheat straw as substrate with five agar plugs as the inoculum, 60% moist...

  18. Bioinformatic Identification of Potential MicroRNAs and Their Targets in the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes).

    Science.gov (United States)

    Mu, Da-Shuai; Li, Chenyang; Shi, Liang; Zhang, Xuchen; Ren, Ang; Zhao, Ming-Wen

    2015-01-01

    MicroRNAs (miRNAs) are a class of small, endogenous, noncoding RNA molecules that negatively regulate gene expression at the transcriptional or the post-transcriptional level. Although a large number of miRNAs have been identified in many species, especially model plants and animals, miRNAs in fungi remain largely unknown. In this study, based on a database of expressed sequence tags in Ganoderma lucidum, 89 potential miRNAs were identified using computational methods. Real-time polymerase chain reaction analysis of miRNA-like samples prepared from G. lucidum at different development stages revealed that miRNA-like RNAs were differentially expressed in different stages. Furthermore, a total of 28 potential targets were found based on near-perfect or perfect complementarity between the randomly selected 9 miRNA-like RNAs and the target sequences, and potential targets for G. lucidum miRNA-like RNAs were predicted. Finally, we studied the expression pattern of 4 target genes in 3 different development stages of G. lucidum to further understand the mechanism of interaction between miRNA-like RNAs and their target genes. Our analysis paves the way toward identifying fungal miRNA-like RNAs that might be involved in various physiological and cellular differentiation processes. PMID:26559864

  19. Phytochelatin synthase is required for tolerating metal toxicity in a basidiomycete yeast and is a conserved factor involved in metal homeostasis in fungi

    OpenAIRE

    Shine, Alaina M; Shakya, Viplendra PS; Idnurm, Alexander

    2015-01-01

    Background Phytochelatin synthase (PCS) is an enzyme that catalyzes the biosynthesis of phytochelatin from glutathione. Phytochelatins protect cells against the toxic effects of non-essential heavy metals, such as cadmium, and hence growth is restricted in the presence of these metals in mutants in PCS-encoding genes. PCS genes from fungi have been characterized in only two species in the Ascomycota, and these genes are considered sparsely distributed in the fungal kingdom. Results A gene enc...

  20. The physiology of basidiomycete linear organs. III. Uptake and translocation of radiocaesium within differentiated mycelia of Armillaris spp. growing in microcosms and in the field

    International Nuclear Information System (INIS)

    Autoradiography and quantitative image analysis were used to measure 137Cs distribution and translocation through mycelia of A. gallica Marxmuller & Romagn. and A. ostoyae (Romagn.) Herink growing in small microcosms in the laboratory. Rhizomorphs of A. gallica were labelled with 134Cs in the field, and the translocation of radiolabel measured after excavation and destructive harvesting. The flux of radiocaesium through rhizomorphs was estimated to be greater than through undifferentiated hyphae, and greater through rhizomorphs growing in the field than through rhizomorphs grown across homogeneous media in the laboratory. Differentiation within mycelia resulting in melanization or rhizomorph formation gave rise to increased heterogeneity in the 137Cs distribution through laboratory microcosms compared with that through microcosms containing undifferentiated mycelia. Radiocaesium leaked from undifferentiated hyphae into the surrounding medium, but melanized regions of the mycelium appeared to be conservative for radiocaesium. These findings provide further evidence for the importance of filamentous fungi in determining the distribution and rate of release of radiocaesium currently present in the environment as a result of weapons testing and the accident at the Chernobyl nuclear reactor

  1. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp. PMID:24941167

  2. Aqueous extract from a Chaga medicinal mushroom, Inonotus obliquus (higher Basidiomycetes), prevents herpes simplex virus entry through inhibition of viral-induced membrane fusion.

    Science.gov (United States)

    Pan, Hong-Hui; Yu, Xiong-Tao; Li, Ting; Wu, Hong-Ling; Jiao, Chun-Wei; Cai, Mian-Hua; Li, Xiang-Min; Xie, Yi-Zhen; Wang, Yi; Peng, Tao

    2013-01-01

    Chaga medicinal mushroom, Inonotus obliquus, a popular prescription in traditional medicine in Europe and Asia, was used to reduce inflammation in the nasopharynx and to facilitate breathing. The aqueous extract from I. obliquus (AEIO) exhibited marked decrease in herpes simplex virus (HSV) infection (the 50% inhibitory concentration was 3.82 μg/mL in the plaque reduction assay and 12.29 μg/mL in the HSV-1/blue assay) as well as safety in Vero cells (the 50% cellular cytotoxicity was > 1 mg/mL, and selection index was > 80). Using a time course assay, effective stage analysis, and fusion inhibition assay, the mechanism of anti-HSV activity was found against the early stage of viral infection through inhibition of viral-induced membrane fusion. Therefore, AEIO could effectively prevent HSV-1 entry by acting on viral glycoproteins, leading to the prevention of membrane fusion, which is different from nucleoside analog antiherpetics. PMID:23510282

  3. Hepatoprotective Activity of Water Extracts from Chaga Medicinal Mushroom, Inonotus obliquus (Higher Basidiomycetes) Against Tert-Butyl Hydroperoxide-Induced Oxidative Liver Injury in Primary Cultured Rat Hepatocytes.

    Science.gov (United States)

    Hong, Ki Bae; Noh, Dong Ouk; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    We examined the hepatoprotective activity of Inonotus obliquus water extract (IO-W) against tert-butyl hydroperoxide (t-BHP)-induced oxidative liver injury in the primary cultured rat hepatocyte. The 50% radical scavenging concentrations (SC50s) of IO-W for radical-scavenging activity against 2,2'-azino-bis-(3-ethylbenzothi- azoline-6-sulfonic acid) (ABTS) and 1,1-diphenyl-2-picryl-hydrazyl (DPPH) were 5.19 mg/mL and 0.39 mg/mL, respectively. IO-W pretreatment to the primary cultured hepatocytes significantly (p100 µg/ mL). In conclusion, this study demonstrates that IO-W exhibited hepatoprotective activity against t-BHP-induced oxidative liver injury in the primary cultured hepatocyte probably via its abilities of quenching free radicals, inhibiting the leakage of ALT, AST, and LDH, and decreasing MDA formation. PMID:26853962

  4. Inhibitory effects of a polysaccharide extract from the Chaga medicinal mushroom, Inonotus obliquus (higher Basidiomycetes), on the proliferation of human neurogliocytoma cells.

    Science.gov (United States)

    Ning, Xianbin; Luo, Qi; Li, Chuang; Ding, Zhaoyi; Pang, Jinfeng; Zhao, Changfu

    2014-01-01

    This study aimed to investigate the inhibitory roles of a polysaccharide extract from Inonotus obliquus on U251 human neurogliocytoma cells cultured in vitro. After administering the polysaccharide extract from I. obliquus to U251 cells cultivated in vitro, methyl thiazolyl tetrazoliym assay was performed to measure the inhibitory effects of the extract on tumor cell proliferation. The expression of the apoptosis-related proteins Bcl-2 and caspase-3 were determined by Western blotting. Different concentrations of I. obliquus extract (25, 50, 100, 200, and 500 µg/mL) were added to U251 cells at 24, 48, and 72 hours. Methyl thiazolyl tetrazoliym assay showed that the inhibition ratio increased with increased extract concentration and prolonged treatment duration. The I. obliquus extract sharply decreased the expression of Bcl-2 but dramatically increased the expression of caspase-3. This function was gradually enhanced with increased drug concentration and prolonged treatment duration. The I. obliquus extract can inhibit the proliferation of tumor cells. This inhibition function is closely related to the downregulation of Bcl-2 and the upregulation of caspase-3. PMID:24940902

  5. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with degree of soil organic matter humification and available electrolytes

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Soukupová, Lucie; Gryndlerová, Hana; Baldrian, Petr; Hršelová, Hana

    2010-01-01

    Roč. 55, č. 5 (2010), s. 454-460. ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : mixed forest * fungi * community Subject RIV: EE - Microbiology, Virology Impact factor: 0.977, year: 2010

  6. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells.

    Science.gov (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan

    2015-01-01

    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells. PMID:25954906

  7. Hot Water Extracts of the Royal Sun Mushroom, Agaricus brasiliensis (Higher Basidiomycetes), Inhibit Platelet Activation via the P2Y1 Receptor.

    Science.gov (United States)

    Akahane, Katsuyuki; Satoh, Kaneo; Ohta, Masato; Ozaki, Yukio

    2015-01-01

    Hot water extracts of the medicinal mushroom Agaricus brasiliensis were investigated for their inhibition of platelet aggregation. The extracts significantly inhibited human platelet aggregation induced by adenosine 5'-diphosphate (ADP), but not by collagen or thrombin receptor-activating peptide. The extracts also had a significant inhibitory effect on shape change and intracellular calcium mobilization induced by ADP via inhibition of ADP binding to the P2Y1 receptor. In addition, oral administration of the extracts resulted in prolonged tail bleeding time in mice. The marked antiplatelet activity of the mushroom extracts involving the P2Y1 receptor suggests their potential therapeutic use against vascular disorders. PMID:26559862

  8. In vitro anti-Helicobacter pylori effects of medicinal mushroom extracts, with special emphasis on the Lion's Mane mushroom, Hericium erinaceus (higher Basidiomycetes).

    Science.gov (United States)

    Shang, Xiaodong; Tan, Qi; Liu, Ruina; Yu, Kangying; Li, Pingzuo; Zhao, Guo-Ping

    2013-01-01

    Although the medicinal mushroom Hericium erinaceus is used extensively in traditional Chinese medicine to treat chronic superficial gastritis, the underlining pharmaceutical mechanism is yet to be fully understood. In this study, minimum inhibitory concentration (MIC) values of extracts prepared from the fruiting bodies of 14 mushroom species (H. erinaceus, Ganoderma lucidum, Cordyceps militaris, Pleurotus eryngii, P. ostreatus, Agrocybe aegerita, Lentinus edodes, Agaricus brasiliensis, A. bisporus, Coprinus comatus, Grifola frondosa, Phellinus igniarius, Flammulina velutipes, and Hypsizygus marmoreus) were determined against Helicobacter pylori using laboratory strains of ATCC 43504 and SS1 as well as 9 clinical isolates via an in vitro microplate agar diffusion assay. Ethanol extracts (EEs) of 12 mushrooms inhibited the growth of H. pylori in vitro, with MIC values 10 mg/mL). MIC values of ethyl acetate fractions (EAFs) of H. erinaceus against 9 clinical isolates of H. pylori ranged between 62.5 and 250 µg/mL. The bacteriostatic activity of EAFs was found to be concentration-dependant, and the half maximal inhibitory concentration and minimum bactericidal concentration values for H. pylori ATCC 43504 were 73.0 and 200 µg/mL, respectively. The direct inhibitory effect of EEs and EAFs of H. erinaceus against H. pylori could be another pharmaceutical mechanism of medicinal mushrooms-besides the immunomodulating effect of polysaccharides, suggested previously-in the treatment of H. pylori-associated gastrointestinal disorders. Further research to identify the active component(s) is currently undertaking in our laboratory. PMID:23557368

  9. Immunomodulating activities of cultivated maitake medicinal mushroom Grifola frondosa (Dicks.: Fr.) S.F. Gray (higher Basidiomycetes) on peripheral blood mononuclear cells.

    Science.gov (United States)

    Svagelj, Mirjan; Berovic, Marin; Gregori, Andrej; Wraber, Branka; Simcic, Sasa; Boh, Bojana

    2012-01-01

    Grifola frondosa is a culinary-medicinal mushroom that contains several physiologically active compounds, of which polysaccharides, specifically β-glucans, are known to possess immunomodulating properties. Its extracts are studied for application as adjuncts for chemotherapy, and experiments in animal models support the use of this mushroom for cancer treatment. The effect of extracts obtained from mushrooms cultivated on different substrates and their capacity of inducing the secretion of cytokines from human peripheral blood mononuclear cells were studied. The activity of extracts at concentrations 12.5, 100, and 200 μg/mL on induction of TNF-α, IFN-γ, and IL-12 was screened. Two extracts from substrates fortified with olive oil press cakes showed appreciable activity and induced the secretion of TNF-α, IL-12, and INF-γ. The extracts differed from the others in the amount of sugar, protein, and β-glucans, which can explain their higher activity. Present results show that different substrates and different source materials can reasonably modify the bioactivity of cultivated G. frondosa. PMID:23510175

  10. Submerged-Culture Mycelia and Broth of the Maitake Medicinal Mushroom Grifola frondosa (Higher Basidiomycetes) Alleviate Type 2 Diabetes-Induced Alterations in Immunocytic Function.

    Science.gov (United States)

    Chen, Ya-Hui; Lee, Chien-Hsing; Hsu, Tai-Hao; Lo, Hui-Chen

    2015-01-01

    Type 2 Diabetes mellitus (T2DM), a disease with impaired glucose, protein and lipid metabolism, low-grade chronic inflammation, and immune dysfunction, is a global public health crisis. We previously demonstrated that Grifola frondosa has bioactivities in improving glycemic responses in diabetic rats. Herein, we investigated the immunomodulatory effects of the submerged-culture mycelia and broth of G. frondosa on the peripheral blood cells (PBL) and splenocytes. Male Wistar rats were administered with saline (normal rats) or streptozotocin plus nicotinamide (T2DM rats) and were intragastrically administered with placebo, fermented mycelia, broth, or mycelia plus broth (1 g kg-1 day-1) for two weeks. In normal rats, ingestion of mycelia significantly decreased monocytes and ingestion of mycelia and broth significantly decreased the productions of interferon (IFN)-γ and interleukin (IL)-4 from the PBL and splenocytes. In T2DM rats, ingestion of mycelia, broth, and mycelia plus broth significantly alleviated the increases in 2 h postprandial blood glucose and the productions of IFN-γ from the T-leukocytes, IL-4, and IL-6 from the monocytes and IL-4 from the T-splenocytes, as well as significantly improved the productions of tumor-necrosis factor-α from the macrophages. In conclusion, submerged-culture mycelia and broth of G. frondosa may decrease cell-medicated immunity in normal rats and improve hyperglycemia and diabetes-induced alterations in cell-medicated and innate immunities in T2DM rats. PMID:26349512

  11. Effect of Introns and AT-Rich Sequences on Expression of the Bacterial Hygromycin B Resistance Gene in the Basidiomycete Schizophyllum commune

    OpenAIRE

    Scholtmeijer, K.; Wosten, H.A.B.; Springer, J.; Wessels, J.G.H.

    2001-01-01

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation and truncation of transcripts are two independent events that both affect expression of the bacterial hygromycin B resistance gene in S. commune.

  12. Antiviral activity of Basidiomycete mycelia against influenza type A(serotype H1N1) and herpes simplex virus type 2 in cell culture

    Institute of Scientific and Technical Information of China (English)

    Tetiana; Krupodorova; Svetlana; Rybalko; Victor; Barshteyn

    2014-01-01

    In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A(serotype H1N1) and herpes simplex virus type 2(HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47(H1N1) in MDCK cells reducing the infectious titer by 2.0–6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species—Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes—this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index(324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes(amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems.

  13. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav

    2012-01-01

    Roč. 355, č. 1-2 (2012), s. 341-352. ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  14. Heterologous expression, crystallization and preliminary X-ray characterization of CcCel6C, a glycoside hydrolase family 6 enzyme from the basidiomycete Coprinopsis cinerea

    International Nuclear Information System (INIS)

    Crystallization of CcCel6C was carried out by the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.6 Å resolution from the crystal. CcCel6C is a gene that encodes a glycoside hydrolase family 6 (GH6) enzyme in the Coprinopsis cinerea genome. In the evolutionary tree of GH6 enzymes, the encoded enzyme was closely related to Cel6B from Humicola insolens, previously called endoglucanase VI, while its amino-acid sequence revealed a region corresponding to the C-terminal active-site-enclosing loop typical of cellobiohydrolase II. Here, the crystallization of CcCel6C produced in Escherichia coli is reported. The square prismatic crystal belonged to the triclinic space group P1, with unit-cell parameters a = 44.04, b = 45.11, c = 48.90 Å, α = 77.81, β = 87.34, γ = 68.79°. Diffraction data were collected to 1.6 Å resolution

  15. Blue Light Signaling Inactivates the Mating Type Genes-Mediated Repression of Asexual Spore Production in the Higher Basidiomycete Coprinopsis cinerea

    Directory of Open Access Journals (Sweden)

    Prayook Srivilai

    2009-01-01

    Full Text Available Monokaryotic mycelia of several wild-type strains of the homobasidiomycete Coprinopsis cinerea form abundant numbers of oidia both in the light and dark due to the regulation of oidia production by the A and B mating type genes. Nevertheless, little is known about whether and how the mating type loci and light signal regulate the oidiation in C. cinerea. Herein, the experimental results demonstrated that the self-compatible homokaryon AmutBmut strain, the mycelia whose nuclei carry mutations in both the A and B loci, can produce only a few oidia in the dark, whereas the formation of numerous numbers of oidia is induced by the light. The semi-compatible homokaryon AmutB, but not ABmut, has the production and behavior of oidia formation similar to those of AmutBmut. These findings indicated that in AmutBmut strain the mutation at the A locus results in repression of oidiation in the dark and the blue light alleviates this effect, whereas the mutated B genes function has no effects. Since, the oidia production relies on both A and light signal, it is possible that A locus might be linked to the blue light receptor genes. The present results demonstrated for the first time that the secondary hyphal knot formation(skn1, fruiting body maturation (mat and basidiospore formation (bad genes which are essential in the C. cinerea fruiting pathway are not involved in the regulation of asexual sporulation. In addition, the positive light effect on oidiation could also occur in C. cinerea dikaryons.

  16. Cell-based bioreporter assay coupled to HPLC micro-fractionation in the evaluation of antimicrobial properties of the basidiomycete fungus Pycnoporus cinnabarinus.

    Science.gov (United States)

    Järvinen, Päivi; Nybond, Susanna; Marcourt, Laurence; Ferreira Queiroz, Emerson; Wolfender, Jean-Luc; Mettälä, Aila; Karp, Matti; Vuorela, Heikki; Vuorela, Pia; Hatakka, Annele; Tammela, Päivi

    2016-06-01

    Context Identification of bioactive components from complex natural product extracts can be a tedious process that aggravates the use of natural products in drug discovery campaigns. Objective This study presents a new approach for screening antimicrobial potential of natural product extracts by employing a bioreporter assay amenable to HPLC-based activity profiling. Materials and methods A library of 116 crude extracts was prepared from fungal culture filtrates by liquid-liquid extraction with ethyl acetate, lyophilised, and screened against Escherichia coli using TLC bioautography. Active extracts were studied further with a broth microdilution assay, which was, however, too insensitive for identifying the active microfractions after HPLC separation. Therefore, an assay based on bioluminescent E. coli K-12 (pTetLux1) strain was coupled with HPLC micro-fractionation. Results Preliminary screening yielded six fungal extracts with potential antimicrobial activity. A crude extract from a culture filtrate of the wood-rotting fungus, Pycnoporus cinnabarinus (Jacq.) P. Karst. (Polyporaceae), was selected for evaluating the functionality of the bioreporter assay in HPLC-based activity profiling. In the bioreporter assay, the IC50 value for the crude extract was 0.10 mg/mL. By integrating the bioreporter assay with HPLC micro-fractionation, the antimicrobial activity was linked to LC-UV peak of a compound in the chromatogram of the extract. This compound was isolated and identified as a fungal pigment phlebiarubrone. Discussion and conclusion HPLC-based activity profiling using the bioreporter-based approach is a valuable tool for identifying antimicrobial compound(s) from complex crude extracts, and offers improved sensitivity and speed compared with traditional antimicrobial assays, such as the turbidimetric measurement. PMID:26808592

  17. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs. PMID:18083152

  18. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast. PMID:20146402

  19. Neuroregenerative potential of lion's mane mushroom, Hericium erinaceus (Bull.: Fr.) Pers. (higher Basidiomycetes), in the treatment of peripheral nerve injury (review).

    Science.gov (United States)

    Wong, Kah-Hui; Naidu, Murali; David, Rosie Pamela; Bakar, Robiah; Sabaratnam, Vikineswary

    2012-01-01

    We present a model case study of the activity of aqueous extract of Hericium erinaceus fresh fruit bodies in promoting functional recovery following crush injury to the peroneal nerve in adult female Sprague-Dawley rats. The aim was to explore the possible use of this mushroom in nerve repair. The activities of aqueous extract were compared to activities exhibited by mecobalamin (vitamin B12), which has been widely used in the treatment of peripheral nerve disorders. Analysis of walking track indicated that return of hind limb function and normal toe spreading occurred earlier in treated groups than in the negative control (non-treated) group. Regeneration of axons and reinnervation of motor endplates/neuromuscular junction in extensor digitorum longus muscle of rats in treated groups developed better than in the negative control group. Further, immunofluorescence studies also showed that dorsal root ganglia neurons ipsilateral to the crush injury in rats of treated groups expressed higher immunoreactivities for Akt and MAPK signaling pathways as well as c-Jun and c-Fos genes compared to the negative control group. Akt cascade plays a major role in mediating neurotrophin-promoted cell survival, while MAPK cascade is involved in mediating neurite outgrowth. Immediate early gene expression was also involved in the cascade of events leading to regeneration. Local axonal protein synthetic machinery was also enhanced in the distal segments of crushed nerves in treated groups. Therefore, daily oral administration of H. erinaceus could promote the regeneration of injured rat peroneal nerve in the early stage of recovery. PMID:23510212

  20. Gold nanoparticles/water-soluble carbon nanotubes/aromatic diamine polymer composite films for highly sensitive detection of cellobiose dehydrogenase gene

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Guangming, E-mail: zgming@hnu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li Zhen, E-mail: happylizhen@yeah.ne [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Tang Lin; Wu Mengshi; Lei Xiaoxia; Liu Yuanyuan; Liu Can; Pang Ya; Zhang Yi [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2011-05-01

    Highlights: > Gold nanoparticles/multiwalled carbon nanotubes/poly (1,5-naphthalenediamine) modified electrode was fabricated. > The sensor was applied for the detection of cellobiose dehydrogenase genes. > An effective method to distribute MWCNTs and attach to the electrode was proposed. > The composite films greatly improved the sensitivity and enhanced the DNA immobilization. > The DNA biosensor exhibited fairly high sensitivity and quite low detection limit. - Abstract: An electrochemical sensor based on gold nanoparticles (GNPs)/multiwalled carbon nanotubes (MWCNTs)/poly (1,5-naphthalenediamine) films modified glassy carbon electrode (GCE) was fabricated. The effectiveness of the sensor was confirmed by sensitive detection of cellobiose dehydrogenase (CDH) gene which was extracted from Phanerochaete chrysosporium using polymerase chain reaction (PCR). The monomer of 1,5-naphthalenediamine was electropolymerized on the GCE surface with abundant free amino groups which enhanced the stability of MWCNTs modified electrode. Congo red (CR)-functionalized MWCNTs possess excellent conductivity as well as high solubility in water which enabled to form the uniform and stable network nanostructures easily and created a large number of binding sites for electrodeposition of GNPs. The continuous GNPs together with MWCNTs greatly increased the surface area, conductivity and electrocatalytic activity. This electrode structure significantly improved the sensitivity of sensor and enhanced the DNA immobilization and hybridization. The thiol modified capture probes were immobilized onto the composite films-modified GCE by a direct formation of thiol-Au bond and horseradish peroxidase-streptavidin (HRP-SA) conjugates were labeled to the biotinylated detection probes through biotin-streptavidin bond. Scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were used to investigate the film assembly and DNA hybridization processes

  1. Biotransformation of Domestic Wastewater Treatment Plant Sludge by Two-Stage Integrated Processes -Lsb & Ssb

    Directory of Open Access Journals (Sweden)

    Md. Zahangir Alam, A. H. Molla and A. Fakhru’l-Razi

    2012-10-01

    Full Text Available The study of biotransformation of domestic wastewater treatment plant (DWTP sludge was conducted in laboratory-scale by two-stage integrated process i.e. liquid state bioconversion (LSB and solid state bioconversion (SSB processes. The liquid wastewater sludge [4% w/w of total suspended solids (TSS] was treated by mixed filamentous fungi Penicillium corylophilum and Aspergillus niger, isolated, screened and mixed cultured in terms of their higher biodegradation potential to wastewater sludge. The biosolids was increased to about 10% w/w. Conversely, the soluble [i.e. Total dissolve solid (TDS] and insoluble substances (TSS in treated supernatant were decreased effectively in the LSB process. In the developed LSB process, 93.8 g kg-1of biosolids were enriched with fungal biomass protein and nutrients (NPK, and 98.8% of TSS, 98.2% of TDS, 97.3% of turbidity, 80.2% of soluble protein, 98.8% of reducing sugar and 92.7% of chemical oxygen demand (COD in treated sludge supernatant were removed after 8 days of treatment. Specific resistance to filtration (1.39x1012 m/kg was decreased tremendously by the microbial treatment of DWTP sludge after 6 days of fermentation. The treated biosolids in DWTP sludge was considered as pretreated resource materials for composting and converted into compost by SSB process. The SSB process was evaluated for composting by monitoring the microbial growth and its subsequent roles in biodegradation in composting bin (CB. The process was conducted using two mixed fungal cultures, Trichoderma harzianum with Phanerochaete chrysosporium 2094 and (T/P and T. harzianum and Mucor hiemalis (T/M; and two bulking materials, sawdust (SD and rice straw (RS. The most encouraging results of microbial growth and subsequent solid state bioconversion were exhibited in the RS than the SD. Significant decrease of the C/N ratio and germination index (GI were attained as well as the higher value of glucosamine was exhibited in compost; which

  2. A fungal P450 (CYP5136A3 capable of oxidizing polycyclic aromatic hydrocarbons and endocrine disrupting alkylphenols: role of Trp(129 and Leu(324.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available The model white rot fungus Phanerochaete chrysosporium, which is known for its versatile pollutant-biodegradation ability, possesses an extraordinarily large repertoire of P450 monooxygenases in its genome. However, the majority of these P450s have hitherto unknown function. Our initial studies using a genome-wide gene induction strategy revealed multiple P450s responsive to individual classes of xenobiotics. Here we report functional characterization of a cytochrome P450 monooxygenase, CYP5136A3 that showed common responsiveness and catalytic versatility towards endocrine-disrupting alkylphenols (APs and mutagenic/carcinogenic polycyclic aromatic hydrocarbons (PAHs. Using recombinant CYP5136A3, we demonstrated its oxidation activity towards APs with varying alkyl side-chain length (C3-C9, in addition to PAHs (3-4 ring size. AP oxidation involves hydroxylation at the terminal carbon of the alkyl side-chain (ω-oxidation. Structure-activity analysis based on a 3D model indicated a potential role of Trp(129 and Leu(324 in the oxidation mechanism of CYP5136A3. Replacing Trp(129 with Leu (W129L and Phe (W129F significantly diminished oxidation of both PAHs and APs. The W129L mutation caused greater reduction in phenanthrene oxidation (80% as compared to W129F which caused greater reduction in pyrene oxidation (88%. Almost complete loss of oxidation of C3-C8 APs (83-90% was observed for the W129L mutation as compared to W129F (28-41%. However, the two mutations showed a comparable loss (60-67% in C9-AP oxidation. Replacement of Leu(324 with Gly (L324G caused 42% and 54% decrease in oxidation activity towards phenanthrene and pyrene, respectively. This mutation also caused loss of activity towards C3-C8 APs (20-58%, and complete loss of activity toward nonylphenol (C9-AP. Collectively, the results suggest that Trp(129 and Leu(324 are critical in substrate recognition and/or regio-selective oxidation of PAHs and APs. To our knowledge, this is the first

  3. Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter

    International Nuclear Information System (INIS)

    .e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)

  4. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    International Nuclear Information System (INIS)

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H2O, CO2 (aerobic) or CH4 (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions and the rate can be

  5. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    Energy Technology Data Exchange (ETDEWEB)

    Haritash, A.K., E-mail: akharitash@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India); Kaushik, C.P. [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India)

    2009-09-30

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H{sub 2}O, CO{sub 2} (aerobic) or CH{sub 4} (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions

  6. Bioremediation treatment for cleaning up toxic chemical contaminated soil in field trials

    Energy Technology Data Exchange (ETDEWEB)

    Dang Thi Cam Ha; Nguyen Ba Huu; Pham Thi Quynh Vam; Nguyen Thi De; Nguyen Quoc Viet; Nguyen Duong Nha; La Thamh Phuong; Tran Nhu Hoa; Mai Anh Tuan; Pham Huu Ly; Nguyen Van Minh; Le van Hong; Do quang Huy; Dang Vu Minh; Nguyen Duc Hue

    2002-07-01

    : Pharnerochate sordida YK-624, Phanerochaete chrysosporium; Sphingomonas sp. RWI. Sphingomonas wittichii: Pseudomonas st. CA 10, Terrabacter sp. DBF63, yeast etc and recently in International Symposium of dioxin 2001 there are several new 2, 3, 7, 8 TCDD or 3Cl-DD and chlorinated compound degrader such as: Bacillus midousuji (mesophilic bacterium), Proteus sp. Bacillus sp., P. putida, fungus Acremonium sp and other fungal dioxin-bacterium, Proteus sp., Bacillus sp. P. putida, fungus Acremonium sp. and other fungal dioxin-degarder. The most recent, Hiraishi, et. al. had informed capacities of native microbial population could removed 22% dioxin after three month treatment. (Author)

  7. Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter

    Energy Technology Data Exchange (ETDEWEB)

    Hashida, Shin-nosuke; Yoshihara, Toshihiro [Environmental Science Research Laboratory, Central Research Institute of Electric Power Industry, Abiko 1646, Abiko-shi, Chiba (Japan)

    2014-07-01

    .e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)

  8. Evaluation of solid-state bioconversion of domestic wastewater sludge as a promising environmental-friendly disposal technique.

    Science.gov (United States)

    Hossain Molla, Abul; Fakhru'l-Razi, Ahmadun; Zahangir Alam, Md

    2004-11-01

    Natural and environmental-friendly disposal of wastewater sludge is a great concern. Recently, biological treatment has played prominent roles in bioremediation of complex hydrocarbon- rich contaminants. Composting is quite an old biological-based process that is being practiced but it could not create a great impact in the minds of concerned researchers. The present study was conducted to evaluate the feasibility of the solid-state bioconversion (SSB) processes in the biodegradation of wastewater sludge by exploiting this promising technique to rejuvenate the conventional process. The Indah Water Konsortium (IWK) domestic wastewater treatment plant (DWTP) sludge was considered for evaluation of SSB by monitoring the microbial growth and its subsequent roles in biodegradation under two conditions: (i) flask (F) and (ii) composting bin (CB) cultures. Sterile and semi-sterile environments were allowed in the F and the CB, respectively, using two mixed fungal cultures, Trichoderma harzianum with Phanerochaete chrysosporium 2094 (T/P) and T. harzianum with Mucor hiemalis (T/M) and two bulking materials, sawdust (SD) and rice straw (RS). The significant growth and multiplication of both the mixed fungal cultures were reflected in soluble protein, glucosamine and color intensity measurement of the water extract. The color intensity and pH of the water extract significantly increased and supported the higher growth of microbes and bioconversion. The most encouraging results of microbial growth and subsequent bioconversion were exhibited in the RS than the SD. A comparatively higher decrease of organic matter (OM) % and C/N ratio were attained in the CB than the F, which implied a higher bioconversion. But the measurement of soluble protein, glucosamine and color intensity exhibited higher values in the F than the CB. The final pH drop was higher in the CB than the F, which implied that a higher nitrification occurred in the CB associated with a higher release of H+ ions

  9. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  10. TREATMENT OF A PENTACHLOROPHENOL AND CREOSOTE-CONTAMINATED SOIL USING THE LIGNIN-DEGRADING FUNGUS PHANERO- CHAETE SORDIDA: A FIELD DEMONSTRATION

    Science.gov (United States)

    The feasibility of large-scale fungal bioaugmentation was evaluated by assessing the ability of the lignin-degrading fungus Phanerochaete sordida to decrease the soil concentrations of pentachlorophenol (PCP) and 13 priority pollutant polynuclear aromatic (PNA) creosote component...

  11. Optimization of the Yield of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes), Cultivated on a Sunflower Seed Hull Substrate Produced in Argentina: Effect of Olive Oil and Copper.

    Science.gov (United States)

    Bidegain, Maximiliano A; Cubitto, Maria Amelia; Curvetto, Nestor Raul

    2015-01-01

    Sunflower seed hulls were used as the main component of a solid substrate for the cultivation of the lingzhi or reishi medicinal mushroom Ganoderma lucidum. This study evaluated the effects of supplementing the substrate with olive oil and copper (II) on the mushroom production (MP) parameters and fruiting body total triterpenoid content. The addition of 1.5% olive oil increased total MP by 21.7% (dry basis) in 3 flushes. Copper (60 ppm) increased the daily productivity of the first flush (MP per day) by both reducing the time needed to harvest the crop and increasing the MP. However, the MP at the second and third flushes was reduced. When both supplements were combined, the MP at the first flush was 43% higher than with control treatment. No significant change in mushroom total triterpenoid content was observed by the addition of supplements to the substrate. An increase of 145-155% in the mushroom copper content was obtained by the addition of 60 ppm copper to the substrate. It is thus recommended to use substrate formulations containing both olive oil and copper (II) and harvest just the first flush. PMID:26853965

  12. Simple and Reproducible Two-Stage Agitation Speed Control Strategy for Enhanced Triterpene Production by Lingzhi or Reishi Medicinal Mushrooms, Ganoderma lucidum ACCC G0119 (Higher Basidiomycetes) Based on Submerged Liquid Fermentation.

    Science.gov (United States)

    Feng, Jie; Feng, Na; Yang, Yan; Liu, Fang; Zhang, Jingsong; Jia, Wei; Lin, Chi-Chung

    2015-01-01

    Triterpenes are important anticancer agents produced by batch submerged liquid fermentation, with the medicinal mushroom Ganoderma lucidum ACCC G0119, which was investigated under various dissolved oxygen levels by varying agitation speeds. Three kinetic parameters were analyzed: specific mycelial growth rate (μsmg), specific glucose consumption rate (qsgc), and specific triterpene production rate (qstp). High concentration, yield, and productivity of triterpenes were achieved by developing a simple and reproducible two-stage agitation speed control strategy. At the first 40 h, agitation speed was controlled at 150 rpm to obtain the quickest peak qstp for triterpene production, subsequently agitation speed was controlled at 100 rpm to maintain high qstp for high triterpene accumulation. The maximum concentration of triterpenes reached 0.086 g/l with the yield of 6.072 g/kg and the productivity of 6.532 × 10-4 g/(l·h), which were 39.61%, 36.48%, and 49.22%, respectively, better than the best results controlled by fixed agitation speeds. Conceivably, such a triterpene fermentation production strategy would be useful for industrial large-scale production of triterpenes with G. lucidum. PMID:26854102

  13. Study of the combined effect of temperature, pH and water activity on the radial growth rate of the white-rot basidiomycete Physisporinus vitreus by using a hyphal growth model

    CERN Document Server

    Fuhr, M J; Schubert, M; Schwarze, F W M R; Herrmann, H J

    2011-01-01

    The present work investigates environmental effects on the growth of fungal colonies of P. vitreus by using a lattice-free discrete modelling approach called FGM (Fuhr et al. (2010), arXiv:1101.1747), in which hyphae and nutrients are considered as discrete structures. A discrete modelling approach allows studying the underlying mechanistic rule concerning the basic architecture and dynamic of fungal networks on the scale of a single colony. By comparing simulations of the FGM with laboratory experiments of growing fungal colonies on malt extract agar we show that combined effect of temperature, pH and water activity on the radial growth rate of a fungal colony on a macroscopic scale may be explained by a power law for the growth costs of hyphal expansion on a microscopic scale. The information about the response of the fungal mycelium on a microscopic scale to environmental conditions is essential to simulate its behavior in complex structure substrates such as wood, where the impact of the fungus to the woo...

  14. Open-Label Study of the Influence of Food Containing the Royal Sun Mushroom, Agaricus brasiliensis KA21 (Higher Basidiomycetes), on the Quality of Life of Healthy Human Volunteers.

    Science.gov (United States)

    Motoi, Masuro; Motoi, Akitomo; Yamanaka, Daisuke; Ohno, Naohito

    2015-01-01

    We conducted an open-label study in which food containing Agaricus brasiliensis KA21 was consumed continuously for 12 weeks. A questionnaire for subjective evaluation of the efficacy of this food (hereafter, subjective evaluation questionnaire) revealed significant improvements compared with before its intake; there were improvements in the scores of the amounts of hair loss and gray hair, fatigue and general malaise, eye strain, shoulder stiffness, coldness of extremities, difficulty staying awake during the day, and ease of getting out of bed. These findings suggest that intake of food containing A. brasiliensis KA21 results in the above-mentioned subjectively evaluated improvements, and the possibility that A. brasiliensis KA21 improves the body's immunity. Moreover, no issues regarding the safety of the test food were found. PMID:26756293

  15. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  16. Cultivated basidiomycetes as a source of new products: In vitro cultivation development, selection of strains resistant to Trichoderma viride, search for new active compounds, factors influencing plasticity in Grifola frondosa

    OpenAIRE

    Schiff Giovannini, Isabelle; Job, Daniel

    2006-01-01

    Les champignons supérieurs sont une source encore peu explorée et exploitée de nouveaux produits naturels. Ils attirent toujours plus l’intérêt des milieux scientifiques et industriels. Dans ce contexte, nous voulions explorer le potentiel de champignons cultivés dans la recherche de nouveaux composés actifs. Nous avons obtenus les fructifications de 14 espèces de Basidiomycètes selon des techniques développées auparavant dans le laboratoire. De plus, nous avons testé la capacité à fructifier...

  17. 纤维素分解菌的筛选及其不同组合对秸秆降解的效果%Screening of cellulose degrading microbes and the effect of different combinations on straw degradation

    Institute of Scientific and Technical Information of China (English)

    张立霞; 李艳玲; 屠焰; 张乃锋; 刘策; 刁其玉

    2013-01-01

    试验目的是为了获得高效降解纤维素的微生物菌株或者组合,并应用于农作物秸秆的降解,提高其营养价值。利用刚果红纤维素培养基和测定纤维素酶酶活的方法筛选纤维素降解真菌,并与黄孢原毛平革菌组合发酵玉米秸秆,测定降解秸秆的效果。利用刚果红纤维素培养基筛选出黑曲霉、青霉、木霉3株菌,分别与黄孢原毛平革菌组合在PDB中培养7 d,每天测定纤维素降解酶的活性,FPA、β-葡糖苷酶均在第4 d酶活最高,CMCase、木聚糖酶在第2 d的酶活较高。3株纤维素分解菌的酶活性高于其他菌株。与黄孢原毛平革菌进行组合发酵玉米秸秆,纤维素、半纤维素、木质素的降解率较好的组合为PC+黑曲霉+青霉+木霉,分别为29.60%、12.02%、29.10%。本试验得到了一种能较好降解纤维素、半纤维素和木质素的菌株的组合。%The aim of this study was to improve the nutritional value of crop straw by screening high efficient cellulose degrading strains or their combinations. The fungus was screened by us-ing Congo red dye test and the enzyme activity was measured. Then the fungus was combined with Phanerochaete chrysosporium for 7 d in PDB and their effect on the degradation of lignocel-lulose was evaluated. Aspergillus, Penicillium, Trichoderma were finally selected. The enzyme activity of FPA, β-glucosidase were highest on day 4 in the PDB, while CMCase and xylanase activity were highest on 2 d. After 10 days of fermentation on straw, the degradation rate of cel-lulose, hemicellulose and lignin were 29.60%, 12.02%, and 29.10%, respectively. The combina-tion of PC, Aspergillus niger, Penicillium, and Trichoderma was effective in degrading cellulose, hemicellulose and lignin.

  18. Survey on the role of brown hares (Lepus europaeus, Pallas 1778) as carriers of zoonotic dermatophytes

    OpenAIRE

    Francesca Mancianti; Ranieri Verin; Maria Grazia Gallo; Simona Nardoni; Roberto Papini

    2010-01-01

    The occurrence of dermatophytes and keratinophilic fungi was investigated by hair-brush technique on the coat of 986 apparently healthy brown hares (Lepus europaeus, Pallas 1778) caught in 9 restocking and capture zones in Central Italy. Overall, 7.5% hair samples gave positive results. Trichophyton terrestre (2.1%), Chrysosporium sp, Chrysosporium keratinophilum, Microsporum gypseum, Trichophyton gloriae and Trichophyton mentagrophytes (0.6% each), Trichophyton erinacei and Scopulariopsis br...

  19. Geophilic dermatophytes and other keratinophilic fungi in the nests of wetland birds

    OpenAIRE

    Teresa Korniłłowicz-Kowalska; Ignacy Kitowski; Helena Iglik

    2013-01-01

    The frequency and species diversity of keratinophilic fungi in 38 nests of nine species of wetland birds were examined. Nine species of geophilic dermatophytes and 13 Chrysosporium species were recorded. Ch. keratinophilum, which together with its teleomorph (Aphanoascus fulvescens) represented 53% of the keratinolytic mycobiota of the nests, was the most frequently observed species. Chrysosporium tropicum, Trichophyton terrestre and Microsporum gypseum populations were less widespread. The d...

  20. Survey on the role of brown hares (Lepus europaeus, Pallas 1778 as carriers of zoonotic dermatophytes

    Directory of Open Access Journals (Sweden)

    Francesca Mancianti

    2010-02-01

    Full Text Available The occurrence of dermatophytes and keratinophilic fungi was investigated by hair-brush technique on the coat of 986 apparently healthy brown hares (Lepus europaeus, Pallas 1778 caught in 9 restocking and capture zones in Central Italy. Overall, 7.5% hair samples gave positive results. Trichophyton terrestre (2.1%, Chrysosporium sp, Chrysosporium keratinophilum, Microsporum gypseum, Trichophyton gloriae and Trichophyton mentagrophytes (0.6% each, Trichophyton erinacei and Scopulariopsis brevicaulis (0.4% each, Chrysosporium asperatum (0.3%, Arthroderma sp and Microsporum canis (0.1% each were identified in cultures with single isolates, whereas Chrysosporium sp/T. mentagrophytes (0.3%, Chrysosporium sp/T. terrestre and M. gypseum/T. terrestre (0.2% each, Chrysosporium tropicum/T. terrestre, M. canis/T. terrestre and T. ajelloi/T. terrestre (0.1% each were identified in cultures with mixed isolates. T. erinacei and M. canis have not previously been isolated from hares. M. canis, T. erinacei and T. mentagrophytes were the most clinically important dermatophytes found. Altogether, they were isolated only from 1.5% hair samples. Thus, it is concluded that brown hares may play a limited epidemiological role as carriers of zoonotic dermatophytes. Nevertheless, this should be taken into consideration as many people may be exposed to zoonotic agents from brown hares during hunting and trapping activities.

  1. Funga Nordica

    DEFF Research Database (Denmark)

    A funga of +3000 basidiomycetes from the Nordic countries, with descriptive keys to all levels from order to species, and notes on ecology and distribution......A funga of +3000 basidiomycetes from the Nordic countries, with descriptive keys to all levels from order to species, and notes on ecology and distribution...

  2. Prevalence of keratinophilic fungi in usar soils of Uttar Pradesh, India

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Deshmukh

    2011-10-01

    Full Text Available Alkaline soils commonly called as Usar soil having pH 7.5 to 11.0 is commonly found in regions having poor drainage and little percolation. These soils occupy vast tracts of barren lands in the northern parts of India. These areas are frequently visited by man and animals, however there are no reports on the occurrence of keratinophilic fungi from the Usar soils. The purpose of this research was to study the occurrence of keratinophilic fungi in the alkaline Usar soil. To investigate the occurrence of soil keratinophilic fungi from Usar soil, 120 samples were collected from five districts of Uttar Pradesh viz. Lucknow, Bareilly, Azamgarh, Balia and Pratapgarh. Keratinophilic fungi were isolated by the hair baiting techniques using human hair as keratin bait. The cultures were identified using macro- and micro morphological features. Eighty-tow strains of keratinophilic fungi were recovered from 120 (68.33% soil samples. The isolated fungi were composed of ten species of five genera viz. Chrysosporium indicum (19.16%, Microsporum gypseum (12.5%, Chrysosporium tropicum (10.0%, Chrysosporium pannicola (7.5%, Trichophyton terrestre (5.83%, Chrysosporium lucknowense (4.16%, Chrysosporium state of Ctenomyces serratus (3.33%, Gymnascella dankailensis (3.33%, Gymnoascus reessii (1.66 % and Trichophyton mentagrophytes (1.66 %. The presence of keratinophilic fungi in the Usar soils of Uttar Pradesh, India indicates that these fungi do occur at higher alkalinity.

  3. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571. ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  4. Further observations on Sporotrichum and some similar fungi

    NARCIS (Netherlands)

    Arx, von J.A.

    1973-01-01

    Sporotrichum azureum Wright & v. Arx, isolated from wood in Argentina, is described and illustrated. The relationship of the genus Sporotrichum with Ptychogaster is discussed, both may represent conidial states of basidiomycetes ( Tyromyces, Oligoporus).

  5. Optimized protein extraction methods for proteomic analysis of Rhizoctonia solani

    Science.gov (United States)

    Rhizoctonia solani (Teleomorph: Thanatephorus cucumeris) is a basidiomycetous fungus which includes important plant pathogens, saprophytes and mycorrhizae. R. solani displays several hyphal anastomosis groups (AGs) with distinct host plant specializations. In order to facilitate studies on its biol...

  6. Some endophytes of Juncus trifidus from Tatra Mts. in Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Chlebicki

    2013-12-01

    Full Text Available This is a first part of work devoted highland rush endophytes: Penicillium expansum, Cladosporium oxysporum, Arthrinium state of Apiospora montagnei and Aureobasidium pullulans. The basidiomycete strain, possibly Lagarobasidium detriticum was also isolated.

  7. Mass spectrometry looks into the structure of beta-N-acetylhexosaminidase

    Czech Academy of Sciences Publication Activity Database

    Pompach, Petr; Man, Petr; Plíhal, Ondřej; Sklenář, Jan; Ettrich, R.; Bezouška, Karel; Havlíček, Vladimír

    Edinburgh, 2003, s. -. [International Mass Spectrometry Conference /16./. Edinburgh (GB), 31.08.2003-05.09.2003] Institutional research plan: CEZ:AV0Z5020903; CEZ:MSM 113100001 Keywords : glcnac * chitin * basidiomycetes Subject RIV: EE - Microbiology, Virology

  8. Molecular characterization of Cryptococcus gattii genotype AFLP6/VGII isolated from woody debris of divi-divi (Caesalpinia coriaria), Bonaire, Dutch Caribbean

    NARCIS (Netherlands)

    Hagen, F.; Chowdhary, A.; Prakash, A.; Yntema, J.B.; Meis, J.F.G.M.

    2014-01-01

    BACKGROUND: The basidiomycetous yeast Cryptococcus gattii is an emerging and primary pathogen. There is a lack of information about its environmental spread outside outbreak regions in Mediterranean Europe, North and South America. Environmental sampling for C. gattii and molecular characterization

  9. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J;

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  10. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  11. Galeropsidaceae, A New Family for the Mycobiota of Turkey

    OpenAIRE

    HATAT, Gürsel; PEKŞEN, Aysun

    2000-01-01

    The Galeropsidaceae, an interesting basidiomycete family is reported for the first time from Turkey. Galeropsis lateritia (Watling) Moreno, Heykoop & Illana belonging to this family was found in the Samsun province.

  12. The higher fungi of Amchitka and Adak Islands, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Fruiting body collections of higher fungi, basidiomycetes and ascomycetes, were made during a twelve day field study on two of Alaska's Aleutian Islands, Amchitka...

  13. Bandoniozyma gen. nov., a Genus of Fermentative and Non-Fermentative Tremellaceous Yeast Species

    OpenAIRE

    Valente, Patricia; Boekhout, Teun; Landell, Melissa Fontes; Crestani, Juliana; Pagnocca, Fernando Carlos; Sette, Lara Durães; Passarini, Michel Rodrigo Zambrano; Rosa, Carlos Augusto; Luciana R Brandão; Pimenta, Raphael S.; Ribeiro, José Roberto; Garcia, Karina Marques; Lee, Ching-Fu; Suh, Sung-Oui; Péter, Gábor

    2012-01-01

    Background Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. Methodology/Principal Findings The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. Con...

  14. The role of natural chlorinated hydroquinone metabolites in ligninolytic fungi

    OpenAIRE

    Teunissen, P.J.M.

    1999-01-01

    Ligninolytic Basidiomycetes have been reported to produce a wide variety of chloroaromatic compounds as secondary metabolites, which are structurally similar to environmental pollutants. Among these are chlorinated hydroquinone metabolites (CHM), such as 2-chloro-1,4-dimethoxybenzene (2Cl-14DMB), 2,6-dichloro-1,4-dimethoxybenzene (26DCl-14DMB), tetrachloro-1,4-dimethoxybenzene and tetrachloro-4-methoxyphenol, which are synthesized by 11 genera of Basidiomycetes.The biosynthesis of these chlor...

  15. Análisis de las reacciones de hipersensibilidad tipo I a los basidiomicetes en una población alérgica costarricense, durante 2009 Analysis of the reactions of type I hypersensitivity to the Basidiomycetes in a Costa Rican allergic population during 2009

    OpenAIRE

    Daniela Jaikel-Víquez; Olman Riggioni-Cordero

    2012-01-01

    Justificación y objetivos: Costa Rica es un país tropical en donde se ha encontrado una alta concentración de basidiosporas aéreas, las cuales miden alrededor de 4-13µm de diámetro, y son por definición aerobiológicas, capaces de penetrar a tracto respiratorio inferior, irrespetando la barrera nasal. El presente estudio tiene como objetivos encontrar posibles fuentes de contaminación ambiental por basidiomicetes y determinar si en Costa Rica sería necesario analizar, de forma rutinaria, la re...

  16. A preliminary study on the occurrence of Dermatophyles and other keratinophilic fungi in bottom sediments of rivers and lakes

    OpenAIRE

    Krzysztof Ulfig

    2014-01-01

    Sam pies of bottom sediments from the Rivers Nacyna, Ruda and from an eutrophic reservoir holding cooling waters were examined for dermatophytes and correlated fungi. The species isolated were: Trichophyton terrestre complex, T. ajelloi (and its perfect form Anhroderma uncinatum). pathogenic strains of T. mentagrophytes and Microsporum cookei; also isolated were five species of the genus Chrysosporium.

  17. A preliminary study on the occurrence of Dermatophyles and other keratinophilic fungi in bottom sediments of rivers and lakes

    Directory of Open Access Journals (Sweden)

    Krzysztof Ulfig

    2014-08-01

    Full Text Available Sam pies of bottom sediments from the Rivers Nacyna, Ruda and from an eutrophic reservoir holding cooling waters were examined for dermatophytes and correlated fungi. The species isolated were: Trichophyton terrestre complex, T. ajelloi (and its perfect form Anhroderma uncinatum. pathogenic strains of T. mentagrophytes and Microsporum cookei; also isolated were five species of the genus Chrysosporium.

  18. Physical Damages of Wood Fiber in Acacia Mangium due to Biopulping Treatment

    Directory of Open Access Journals (Sweden)

    Ridwan Yahya

    2016-05-01

    chrysosporium to Acacia mangium Willd can reduce lignin and improve holocellulose and cellulose content of the material. Fiber dimension recognized as other important factor for paper properties. The question is how the integrity and dimensions of the wood fiber that has been pretreated with the fungus. The objectives of present study were to know effect of pretreatment of P. chrysosporium to the integrity and dimensions of the fiber. The P. chrysosporium was cultured for 14 days in growth medium, and inoculated to wood chips 5% (w/v and incubated for 0, 15 and 30 days. The inoculated wood chips were chipped into 1 mm x 1 mm x 20 mm and macerated using franklin solution at 60 oC for 48 hours. Forty fibers from each incubated time were analized their physical damages using a light microscope at a 400 magnification. The inoculated fibers were measured theirs dimensions. The physical damage percentage of fibers pretreated using P. chrysosporium was 0%. Length and wall thickness of the pretreated fibers were can be categorized as middle class and thin fibers, respectively.

  19. Correlation between the abundance of cellulolitic fungi and selected soil properties

    Directory of Open Access Journals (Sweden)

    Teresa Korniłłowicz-Kowalska

    2014-08-01

    Full Text Available The study conducted has revealed the general abundance of cellulolytic fungi in the soil is significantly correlated only with the phosphors content. The correlation with specific soil properties was found in the case of the genera Humicola, Penicillium, Fusarium and Chrysosporium of the 10 genera of these fungi isolated most often.

  20. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. PMID:26367180