WorldWideScience

Sample records for basidiomycete phanerochaete chrysosporium

  1. Mating System and Basidiospore Formation in the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Alic, Margaret; Letzring, Celia; Gold, Michael H.

    1987-01-01

    Prototrophic strains recovered from crosses between auxotrophic strains of the lignin-degrading basidiomycete Phanerochaete chrysosporium were induced to fruit. The progeny of most of these self-crosses were prototrophic, indicating that the nuclei of the original prototroph were wild-type recombinants rather than complementary heterokaryons and that the binucleate basidiospores of this organism are homokaryotic. Various wild-type strains were shown to have multinucleate cells lacking clamp c...

  2. Decolorization of Several Polymeric Dyes by the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Glenn, Jeffrey K.; Michael H Gold

    1983-01-01

    The polymeric dyes Poly B-411, Poly R-481, and Poly Y-606 were examined as possible alternatives to the radiolabeled lignin previously used as a substrate in lignin biodegradation assays. Like lignin degradation, the decolorization of these dyes by the white rot basidiomycete Phanerochaete chrysosporium occurred during secondary metabolism, was suppressed in cultures grown in the presence of high levels of nitrogen, and was strongly dependent on the oxygen concentration in the cultures. A var...

  3. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site. PMID:17922847

  4. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium.

    OpenAIRE

    Boominathan, K; Dass, S B; Randall, T A; Kelley, R.L.; Reddy, C A

    1990-01-01

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study we isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin----14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical...

  5. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study the authors isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin →14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical conditions, produced 96 U of lignin peroxidase per liter. Both the wild type and the mutant produced comparable levels of manganese peroxidase and glucose oxidases, a key H2O2-generating secondary metabolic enzyme in P. chrysosporium. Fast protein liquid chromatographic analysis of the concentrated extracellular fluid of the lip mutant confirmed that it produced only heme proteins with manganese peroxidase activities were produced by the wild type. The lip mutant appears to be a regulatory mutant that is defective in the production of all the lignin peroxidases

  6. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD+-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  7. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  8. Formation, Fusion, and Regeneration of Protoplasts from Wild-Type and Auxotrophic Strains of the White Rot Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Gold, Michael H; Cheng, Therese M.; Alic, Margaret

    1983-01-01

    A preparation of two commercial enzymes was used to liberate protoplasts from 16-h-old mycelium of Phanerochaete chrysosporium. Regeneration frequencies of up to 5% were attained when the protoplasts were plated in a medium containing 10% sorbose and 3% agar. Fusion of protoplasts from different auxotrophic strains in polyethylene glycol-Ca2+ produced heterokaryons. Separation of the heterokaryons into their constituent homokaryotic strains could be effected through protoplast release and for...

  9. Formation, fusion, and regeneration of protoplasts from wild-type and auxotrophic strains of the white rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Gold, M.H.; Cheng, T.M.; Alic, M.

    1983-07-01

    A preparation of two commercial enzymes was used to liberate protoplasts from 16-h-old mycelium of Phanerochaete chrysosporium. Regeneration frequencies of up to 5% were attained when the protoplasts were plated in a medium containing 10% sorbose and 3% agar. Fusion of protoplasts from different auxotrophic strains in polyethylene glycol-Ca/sup +2/ produced heterokaryons. Separation of the heterokaryons into their constituent homokaryotic strains could be effected through protoplast release and formation of colonies on regeneration agar. 18 references

  10. Degradation of azo dyes by the lignin-degrading fungus Phanerochaete chrysosporium.

    OpenAIRE

    Spadaro, J T; Gold, M H; Renganathan, V

    1992-01-01

    Under nitrogen-limiting, secondary metabolic conditions, the white rot basidiomycete Phanerochaete chrysosporium extensively mineralized the specifically 14C-ring-labeled azo dyes 4-phenylazophenol, 4-phenylazo-2-methoxyphenol, Disperse Yellow 3 [2-(4'-acetamidophenylazo)-4-methylphenol], 4-phenylazoaniline, N,N-dimethyl-4-phenylazoaniline, Disperse Orange 3 [4-(4'-nitrophenylazo)-aniline], and Solvent Yellow 14 (1-phenylazo-2-naphthol). Twelve days after addition to cultures, the dyes had be...

  11. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica; Floudas, Dimitrios; HIbbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Ruben; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavin, Jose L.; Oguiza, Jose A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kues, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan

    2011-12-06

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.

  12. Biodegradation of azo and heterocyclic dyes by Phanerochaete chrysosporium.

    OpenAIRE

    Cripps, C.; Bumpus, J A; Aust, S D

    1990-01-01

    Biodegradation of Orange II, Tropaeolin O, Congo Red, and Azure B in cultures of the white rot fungus, Phanerochaete chrysosporium, was demonstrated by decolarization of the culture medium, the extent of which was determined by monitoring the decrease in absorbance at or near the wavelength maximum for each dye. Metabolite formation was also monitored. Decolorization of these dyes was most extensive in ligninolytic cultures, but substantial decolorization also occurred in nonligninolytic cult...

  13. BIOPULPING OF WHEAT STRAW WITH PHANEROCHAETE CHRYSOSPORIUM

    Institute of Scientific and Technical Information of China (English)

    Hong Yu; Menghua Qin; Xuemei Lu; Yinbo Qu; Peiji Gao

    2004-01-01

    Wheat straw was cut into a certain size range and treated with a strain of the white rot fungus Phanerochatete Chrysosporium for 5 days before subjected to a chemi-mechanical treatment. Chemical analyses revealed the effects of the white rot fungus on the wheat straw components. SEM was applied to observe the changes in fiber micromorphological structures. CODcr of the effluent from the sulfonation treatment of wheat straw was also discussed. Handsheets made from the treated and untreated wheat straw exhibited different optical and physical properties after chemi-mechanical pulping.

  14. BIOPULPING OF WHEAT STRAW WITH PHANEROCHAETE CHRYSOSPORIUM

    Institute of Scientific and Technical Information of China (English)

    HongYu; MenghuaQin; XuemeiLu; YinboQu; PeijiGao

    2004-01-01

    Wheat straw was cut into a certain size range and treated with a strain of the white rot fungus Phaneroehatete Chrysosporium for 5 days before subjected to a chemi-mechanical treatment. Chemical analyses revealed the effects of the white rot fungus on the wheat straw components. SEM was applied to observe the changes in fiber micromorphological structures. CODcr of the effluent from the sulfonation treatment of wheat straw was also discussed. Handsheets made from the treated anduntreated wheat straw exhibited different optical and physical properties after chemi-mechanical pulping.

  15. Effect of nitrogen concentration in culture mediums on growth and enzyme production of Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    GAO Da-wen; WEN Xiang-hua; QIAN Yi

    2005-01-01

    Effect of different nitrogen concentration in the mediums on growth and enzyme production of Phanerochaete chrysosporium was studied when glucose concentration was 10 g/L. The results showed that the medium contained 0.8 g/L ammonium tartrate is the best. It not only supply abundant nutrients for the growth of Phanerochaete chrysosporium, which make mycelia the best grow compared with the other medium, but also produce higher manganese-dependent peroxidase(Mnp) and laccase(Lac) activity. In addition, it is observed that the variation of mycelia surface is related to ligninolytic enzyme secreted by Phanerochaete chrysosporium. When the surface of mycelium pellets appeared burs, it predicts secondary metabolism begin. This experimentation demonstrated that when the ratio of carbon and nitrogen in nitrogen limited medium is equal to 100:8, growth and enzyme production of Phanerochaete chrysosporium is the best, it could achieve the maximum Mnp and Lac activity.

  16. Polychlorinated biphenyls fractioning assessment in aqueous bioremediation assy with phanerochaete chrysosporium

    OpenAIRE

    Sangely, Matthieu; Sablayrolles, Caroline; Vialle, Claire; Strehaiano, Pierre; Thannberger, Laurent; Vignoles, Mireille

    2009-01-01

    Thanks to growing environmental concerns in public opinion, bioremediation processes are more and more used to decontaminate soils from organic compounds. Polychlorinated biphenyls (PCBs) are known to be world wide spread persistent organic pollutants (POPs). The white rot fungus Phanerochaete chrysosporium is able to degrade PCBs in water, and soil As POPs, PCBs can also be adsorbed onto organic matter, such as Phanerochaete chrysosporium mycelium. This study aims at estimating the fractioni...

  17. Pyranose 2-oxidase from Phanerochaete chrysosporium--expression in E. coli and biochemical characterization.

    Science.gov (United States)

    Pisanelli, Ines; Kujawa, Magdalena; Spadiut, Oliver; Kittl, Roman; Halada, Petr; Volc, Jindrich; Mozuch, Michael D; Kersten, Philip; Haltrich, Dietmar; Peterbauer, Clemens

    2009-06-15

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in yields of approximately 270 mg/l medium. The recombinant enzyme was provided with an N-terminal T7-tag and a C-terminal His(6)-tag to facilitate simple one-step purification. We obtained an apparently homogenous enzyme preparation with a specific activity of 16.5 U/mg. Recombinant P2Ox from P. chrysosporium was characterized in some detail with respect to its physical and catalytic properties, both for electron donor (sugar substrates) and - for the first time - alternative electron acceptors (1,4-benzoquinone, substituted quinones, 2,6-dichloroindophenol and ferricenium ion). As judged from the catalytic efficiencies k(cat)/K(m), some of these alternative electron acceptors are better substrates than oxygen, which might have implications for the proposed in vivo function of pyranose 2-oxidase. PMID:19501263

  18. A Simple Structure Model for Enzyme Production by Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    岑沛霖; 郑重鸣; FOOYinDin; JefferyPhilipObbard; 林建平

    2003-01-01

    In order to understand the behavior of ligninolytic enzyme production by white rot fungi Phanerochaete chrysosporium, study on time courses and a mathematical model for the production of lignin peroxidase (LiP) and manganese peroxidase (MnP) of the fungi was undertaken. Based on the Monod-Jacob operon model, the ligninolytic enzyme would be synthesized in the absence of a related repressor. The repressor is assumed to be active in the presence of ammonia nitrogen, and as combined as co-repressor, it causes the inhibition of enzyme synthesis. The model can explain the mechanism of extracellular ligninolytic enzyme production by white rot fungi. The results,as predicted by the model, correspond closely to those observed in experimental studies. In addition, some light is also shed on unmeasured variables, such as the concentrations of repressor and mRNA that are related to the enzyme synthesis.

  19. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    Science.gov (United States)

    Coconi-Linares, Nancy; Ortiz-Vázquez, Elizabeth; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  20. Biochemical characterization and transcriptional analysis of the epoxide hydrolase from white-rot fungus Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    Nian Li; Yizheng Zhang; Hong Feng

    2009-01-01

    The white-rot basidiomycetes Phanerochaete chrysosporium is a model fungus used to investigate the sec-ondary metabolism and lignin degradation. Genomic sequencing reveals the presence of at least 18 genes encoding putative epoxide hydrolases (EHs). One cDNA encoding EH (designated as PchEHA) was cloned and expressed in Escherichia coli. Transcriptional analysis demonstrated that the transcripts of PchEHA could be detected under the ligninolytic and nonligninolytic con-ditions as well as amended with anthracene. The recom-binant enzyme exhibits broad hydrolytic activity toward several racemic epoxides including styrene oxide, epichlorohydrin, and 1,2-epoxybutane, but with different specificity. Using racemic styrene oxide as the substrate, the optimal pH and temperature are pH 9.0 and 40℃, respectively. The enzyme is not sensitive to EDTA, and is inhibited by H2O2, and several metal ions including Zn2+, Cd2+, and Hg2+ at various extents. Several organic cosoivents including acetone, dimethylsulfoxide, formamide, glycerol and ethanol at 10% (v/v) cause slight or no inhibition of the hydrolytic reaction. More importantly, the recombinant enzyme displays distinct enantioselective preference to several chiral epoxides. The enzyme showed good enantioselec-tivity toward chiral styrene oxide with preferential hydrolysis of (R)-enantiomer. PchEHA is likely a novel soluble EH based on the sequence analysis and catalytic properties, and is a great potential biocatalyst for the preparation of enantiopure styrene oxide in racemic kinetic resolution.

  1. Fungal biodegradation of lignopolystyrene graft copolymers. [Pleurotus ostreatus; Phanerochaete chrysosporium; Trametes versicolor; Gloeophyllum trabeum

    Energy Technology Data Exchange (ETDEWEB)

    Milstein, O.; Gersonde, R.; Huttermann, A. (Forstbotanisches Inst. der Univ. Gottingen (Germany)); MengJiu Chen; Meister, J.J (Univ. of Detroit Mercy, MI (United States))

    1992-10-01

    White rot basidiomycetes were able to biodegrade styrene (1-phenylethene) graft copolymers of lignin containing different proportions of lignin and polystyrene (poly(1-phenylethylene)). The biodegradation tests were run on lignin-styrene copolymerization products which contained 10.3, 32.2, and 50.4{percent} (wt/wt) lignin. The polymer samples were incubated with the white rot fungi Pleurotus ostreatus, Phanerochaete chrysosporium, and Trametes versicolor and the brown rot fungus Gloeophyllum trabeum. White rot fungi degraded the plastic samples at a rate which increased with increasing lignin content in the copolymer sample. Both polystyrene and lignin components of the copolymer were readily degraded. Polystyrene pellets were not degradable in these tests. Degradation was verified for both incubated and control samples by weight loss, quantitative UV spectrophotometric analysis of both lignin and styrene residues, scanning electron microscopy of the plastic surface, and the presence of enzymes active in degradation during incubation. Brown rot fungus did not affect any of the plastics. White rot fungi produced and secreted oxidative enzymes associated with lignin degradation in liquid media during incubation with lignin-polystyrene copolymer.

  2. Lignin and veratryl alcohol are not inducers of the ligninolytic system of Phanerochaete chrysosporium.

    OpenAIRE

    Cancel, A M; Orth, A B; Tien, M

    1993-01-01

    Phanerochaete chrysosporium is a white rot fungus which secretes a family of lignin-degrading enzymes under nutrient limitation. In this work, we investigated the roles of veratryl alcohol and lignin in the ligninolytic system of P. chrysosporium BKM-F-1767 cultures grown under nitrogen-limited conditions. Cultures supplemented with 0.4 to 2 mM veratryl alcohol showed increased lignin peroxidase activity. Addition of veratryl alcohol had no effect on Mn-dependent peroxidase activity and inhib...

  3. Discovery and characterization of new O-methyltransferase from the genome of the lignin-degrading fungus Phanerochaete chrysosporium for enhanced lignin degradation.

    Science.gov (United States)

    Thanh Mai Pham, Le; Kim, Yong Hwan

    2016-01-01

    Using bioinformatic homology search tools, this study utilized sequence phylogeny, gene organization and conserved motifs to identify members of the family of O-methyltransferases from lignin-degrading fungus Phanerochaete chrysosporium. The heterologous expression and characterization of O-methyltransferases from P. chrysosporium were studied. The expressed protein utilized S-(5'-adenosyl)-L-methionine p-toluenesulfonate salt (SAM) and methylated various free-hydroxyl phenolic compounds at both meta and para site. In the same motif, O-methyltransferases were also identified in other white-rot fungi including Bjerkandera adusta, Ceriporiopsis (Gelatoporia) subvermispora B, and Trametes versicolor. As free-hydroxyl phenolic compounds have been known as inhibitors for lignin peroxidase, the presence of O-methyltransferases in white-rot fungi suggested their biological functions in accelerating lignin degradation in white-rot basidiomycetes by converting those inhibitory groups into non-toxic methylated phenolic ones. PMID:26672450

  4. Regulation of Gene Expression during the Onset of Ligninolytic Oxidation by Phanerochaete chrysosporium on Spruce Wood

    OpenAIRE

    Korripally, Premsagar; Hunt, Christopher G.; Houtman, Carl J.; Jones, Don. C.; Kitin, Peter J.; Cullen, Dan; Hammel, Kenneth E.

    2015-01-01

    Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in the cultures. Confocal fluorescence microscopy of the beads showed that extracellular oxidation commenced 2 to 3 days after inoculation, coincident w...

  5. VANILLIN PRODUCTION BY PHANEROCHAETE CHRYSOSPORIUM GROWN ON GREEN COCONUT AGRO-INDUSTRIAL HUSK IN SOLID STATE FERMENTATION

    Directory of Open Access Journals (Sweden)

    Elisabete dos Santos Barbosa

    2008-11-01

    Full Text Available Agro-industrial residues have become an important source for the production of chemical compounds using biological pathways, contributing to preservation of the environment and making the overall process economically supportable. Vanillin is a very important aromatic compound for the food, beverage, and pharmaceutical industries. The aim of the present study was to evaluate the vanillin production by solid-state fermentation on green coconut residue using the basidiomycete Phanerochaete chrysosporium. Solid-state fermentation was carried on a support of green coconut husk treated in two different ways: sun-dried and mechanical-pressed. A Plackett-Burman experimental design was used to screen the compounds of liquid medium culture of the vanillin production. Nineteen variables were studied to optimize the culture conditions, and eleven of them were significant. The screening improved the production of vanillin from 44.4 g/g of support to 52.5 g/g of support in 24 hours of fermentation. Sun-dried coconut husk was found to be superior to mechanical-pressed coconut husk for production of vanillin. HPLC was used for the quantification of vanillin aroma.

  6. THE IMPACT OF CoFeO 4 NANOPARTICLES ON SOLUBLE PROTEIN CONTENT AT WHITE ROT FUNGUS Phanerochaete chrysosporium

    OpenAIRE

    Lacramioara Oprica; Eugen Ungureanu

    2016-01-01

    Experimental investigation focused on influence of different CoFeO4 nanoparticles concentrations on soluble protein and electrophoretic pattern of Phanerochaete chrysosporium fungus. Number of electrophoretic fraction is higher in older mycelium P. chrysosporium 14-day-old compared to that 7-day-old. Moreover, there is an increase in staining intensity of polypeptides of mycelium 14-day-old fact confirmed also by the higher amount of soluble protein. On the other hand, there are n...

  7. Effect of Mn2+ on growth and lignin degradation by phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Influence of Mn2+ (0.03 to 90 μM) in defined basal medium on mycelial dry weight, 14C (lignin) solubilization and mineralization (14CO2 evolution) during 3 weeks by Phanerochaete chrysosporium was investigated. Optimal mycelial growth was obtained at 30 μM Mn2+ level. 14C (lignin) solubilization, and mineralization also increased up to 30 μM Mn2+ and declined at 90 μM level. These result suggest involvement of Mn2+ in both solubilization and mineralization steps of microbial lignin biodegradation. (author)

  8. In vitro depolymerization of lignin by manganese peroxidase of Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Homogeneous manganese peroxidase catalyzed the in vitro partial depolymerization of four different 14C-labeled synthetic lignin preparations. Gel permeation profiles demonstrated significant depolymerization of 14C-sidechain-labeled syringyl lignin, a 14C-sidechain-labeled syringyl-guaiacyl copolymer (angiosperm lignin), and depolymerization of 14C-sidechain- and 14C-ring-labeled guaiacyl lignins (gymnosperm lignin). 3,5-Dimethoxy-1,4-benzo-quinone, 3,5-dimethoxy-1,4-hydroquinone, and syringylaldehyde were identified as degradation products of the syringyl and syringyl-guaiacyl lignins. These results suggest that manganese peroxidase plays a significant role in the depolymerization of lignin by Phanerochaete chrysosporium

  9. A combined biological removal of Cd(2+) from aqueous solutions using Phanerochaete chrysosporium and rice straw.

    Science.gov (United States)

    Zhao, Meihua; Zhang, Chaosheng; Zeng, Guangming; Cheng, Min; Liu, Yang

    2016-08-01

    The removal of Cd(2+) from aqueous solutions by agricultural residues rice straw combined with white rot fungus Phanerochaete chrysosporium (P. chrysosporium) was investigated. The results showed that over 99% of the total Cd(2+) (initial concentration of 150mgL(-1)) was removed at the optimal operating conditions (pH 5.0 at 35°C). We also found that P. chrysosporium could survive under Cd(2+) stress even with an initial Cd(2+) concentration of 250mgL(-1). But when Cd(2+) concentration increased to 250mgL(-1), fungus growth and reproduction were remarkably restrained, and as a result, Cd(2+) removal dropped to 59.2%. It was observed that the fungus biomass and activities of ligninolytic enzymes decreased at some degree under high concentration of Cd(2+) (above 100mgL(-1)). Also, we found that a moderate Cd(2+) stress (below 150mgL(-1)) could stimulate P. chrysosporium's production of the heavy metals chelator - oxalate. This study will provide useful information for the application of biological removal of heavy metal irons from wastewater.

  10. Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium

    KAUST Repository

    Espinosa-Ortiz, Erika J.

    2014-10-24

    The ability of Phanerochaete chrysosporium to reduce the oxidized forms of selenium, selenate and selenite, and their effects on the growth, substrate consumption rate, and pellet morphology of the fungus were assessed. The effect of different operational parameters (pH, glucose, and selenium concentration) on the response of P. chrysosporium to selenium oxyanions was explored as well. This fungal species showed a high sensitivity to selenium, particularly selenite, which inhibited the fungal growth and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency, whereas less than 10 % selenium removal was achieved for incubations with selenate. P. chrysosporium was found to be a selenium-reducing organism, capable of synthesizing elemental selenium from selenite but not from selenate. Analysis with transmission electron microscopy, electron energy loss spectroscopy, and a 3D reconstruction showed that elemental selenium was produced intracellularly as nanoparticles in the range of 30–400 nm. Furthermore, selenite influenced the pellet morphology of P. chrysosporium by reducing the size of the fungal pellets and inducing their compaction and smoothness.

  11. Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

    Directory of Open Access Journals (Sweden)

    Suzuki Hitoshi

    2012-09-01

    Full Text Available Abstract Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.

  12. Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Hitoshi; MacDonald, Jacqueline; Syed, Khajamohiddin; Salamov, Asaf; Hori, Chiaki; Aerts, Andrea; Henrissat, Bernard; Wiebenga, Ad; vanKuyk, Patricia A.; Barry, Kerrie; Lindquist, Erika; LaButti, Kurt; Lapidus, Alla; Lucas, Susan; Coutinho, Pedro; Gong, Yunchen; Samejima, Masahiro; Mahadevan, Radhakrishnan; Abou-Zaid, Mamdouh; de Vries, Ronald P.; Igarashi, Kiyohiko; Yadav, Jagit S.; Grigoriev, Igor V.; Master, Emma R.

    2012-02-17

    Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s) among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.

  13. Simultaneous cadmium removal and 2,4-dichlorophenol degradation from aqueous solutions by Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Anwei; Zeng, Guangming; Chen, Guiqiu; Fan, Jiaqi; Zou, Zhengjun; Li, Hui; Hu, Xinjiang; Long, Fei [Hunan Univ., Changsha (China). College of Environmental Science and Engineering; Ministry of Education, Changsha (CN). Key Lab. of Environmental Biology and Pollution Control (Hunan Univ.)

    2011-08-15

    Phanerochaete chrysosporium has been recognised as an effective bioremediation agent due to its unique degradation to xenobiotic and biosorption ability to heavy metals. However, few studies have focused on the simultaneous removal of heavy metals and organic pollutants. The aim of this work was to study the feasibility of simultaneous cadmium removal and 2,4-dichlorophenol (2,4-DCP) degradation in P. chrysosporium liquid cultures. The removal efficiencies were pH dependent and the maximum removal efficiencies were observed at pH 6.5 under an initial cadmium concentration of 5 mg/L and an initial 2,4-DCP concentration of 20 mg/L. The removal efficiencies for cadmium and 2,4-DCP reached 63.62% and 83.90%, respectively, under the optimum conditions. The high production levels of lignin peroxidase (7.35 U/mL) and manganese peroxidase (8.30 U/mL) resulted in an increase in 2,4-DCP degradation. The protein content decreased with increasing cadmium concentration. The surface characteristics and functional groups of the biomass were studied by scanning electron microscopy and a Fourier-transformed infrared spectrometer. The results showed that the use of P. chrysosporium is promising for the simultaneous removal of cadmium and 2,4-DCP from liquid media. (orig.)

  14. Expression of lignin peroxidase H2 from Phanerochaete chrysosporium by multi-copy recombinant Pichia strain

    Institute of Scientific and Technical Information of China (English)

    WANG Wei; WEN Xianghua

    2009-01-01

    The lipH2 gene, encoding the expression of lignin peroxidase, was cloned from Phanerochaete chrysosporium BKM-F-1767 and expressed in Pichia pastoris X-33, a yeast.The cDNA of LiPH2 was generated from total RNA extracted from P.chrysosporium by PCR with primers that do not contain a P.chrysosporium lignin peroxidase secretion signal.The gene was then successfully inserted into the expression vector pPICZα, resulting in the recombinant vector pPICZα-lipH2.The transformation was conducted in two ways.One was using the wild Pichia pastoris as the recipients, which results in the recombinant P.pastoris with single or low lipH2 gene copy.The second was using P.pastoris and single or low lipH2 gene copy as the recipients, which results in the recombinant P.pastoris with multi-copies of lipH2 genes.This study first expressed the gene lipH2 in P.pastoris and achieved the successful expression of the LiPH2 depending upon the generation of a recombinant strain that contains multiple copies.The lignin peroxidase activity reached a maximum of 15 U/L after 12 h induction.

  15. Lignocellulose degradation during solid-state fermentation: Pleurotus ostreatus versus Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Kerem, Z.; Friesem, D.; Hadar, Y. (Hebrew Univ., Rehovot (Israel))

    1992-04-01

    Lignocellulose degradation and activities related to lignin degradation were studied in the solid-state fermentation of cotton stalks by comparison two white rot fungi, Pleurotus ostreatus and Phanerochaete chrysosporium. P. chrysosporium grew vigorously, resulting in rapid, nonselective degradation of 55% of the organic components of the cotton stalks within 15 days. In contrast, P. ostreatus grew more slowly with obvious selectivity for lignin degradation and resulting in the degradation of only 20% of the organic matter after 30 days of incubation. The kinetics of {sup 14}C-lignin mineralization exhibited similar differences. In cultures of P. chrysosporium, mineralization ceased after 18 days, resulting in the release of 12% of the total radioactivity as {sup 14}CO{sub 2}. In P. ostreatus, on the other hand, 17% of the total radioactivity was released in a steady rate throughout a period of 60 days of incubation. Laccase activity was only detected in water extracts of the P. ostreatus fermentation. No lignin peroxidase activity was detected in either the water extract or liquid cultures of this fungus. 2-Keto-4-thiomethyl butyric acid cleavage to ethylene correlated to lignin degradation in both fungi. A study of fungal activity under solid-state conditions, in contrast to those done under defined liquid culture, may help to better understand the mechanism involved in lignocellulose degradation.

  16. Biosorption of lead by phanerochaete chrysosporium in the form of pellets

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The growth of Phanerochaete chrysosporium (ATCC 24725) in pellets was influenced by culture time, medium pH, C/N, surfactant concentration, spore number in inoculum, and shaking rate. The removal of Pb2+ from aqueous solution by this kind of mycelial pellets was studied. The results indicated that many factors affected biosorption. These factors included pH, Pb2+ concentration, co-ion, adsorption time, and chemical pretreatments of biomass. Under optimum biosorption conditions (pH 4.5, 27℃, 16h), the highest lead uptake of 108 mg/g, was observed with mycelial pellets of 1.5-1.7 mm in diameter which were treated with 0.1 mol/L NaOH solution before adsorption. Pretreatment of biomass with NaOH further increased its biosorption capacity.

  17. Atypical features of a Ure2p glutathione transferase from Phanerochaete chrysosporium.

    Science.gov (United States)

    Thuillier, Anne; Roret, Thomas; Favier, Frédérique; Gelhaye, Eric; Jacquot, Jean-Pierre; Didierjean, Claude; Morel-Rouhier, Mélanie

    2013-07-11

    Glutathione transferases (GSTs) are known to transfer glutathione onto small hydrophobic molecules in detoxification reactions. The GST Ure2pB1 from Phanerochaete chrysosporium exhibits atypical features, i.e. the presence of two glutathione binding sites and a high affinity towards oxidized glutathione. Moreover, PcUre2pB1 is able to efficiently deglutathionylate GS-phenacylacetophenone. Catalysis is not mediated by the cysteines of the protein but rather by the one of glutathione and an asparagine residue plays a key role in glutathione stabilization. Interestingly PcUre2pB1 interacts in vitro with a GST of the omega class. These properties are discussed in the physiological context of wood degrading fungi.

  18. Construction of hybrid cell with Phanerochaete chrysosporium todegrade terephthalic acid wastewater (I) phenotype evidence

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The fungi Phanerochaete chrysosporium (PC) and Saccharomyces cerevisiae Y99 and the native bacterium YZ1 were the three parental strains for construction of hybrid cells through protoplast fusion to degrade terephthalic acid (TPA) wastewater. The results showed that the native bacterium YZ1 protoplasm could integrate with that of PC to form the hybrid cell Fhh and the fungus Y99 protoplasm also could integrate with that of Fhh to form the hybrid cell Fhhh. The protoplasts of YZ1 and Y99 could change the morphology of PC spore and mycelinm for two times. The hybrid cell Fhhh got the best growth and degradation abilities in the wastewater. It suggested that the hybrid strains obtained from the inter-kingdom protoplast fusion of the three parental strains could create potential for the purification of TPA wastewater.

  19. Fungal pretreatment by Phanerochaete chrysosporium for enhancement of biogas production from corn stover silage.

    Science.gov (United States)

    Liu, Shan; Li, Xin; Wu, Shubiao; He, Jing; Pang, Changle; Deng, Yu; Dong, Renjie

    2014-11-01

    Corn stover silage (CSS) was pretreated by Phanerochaete chrysosporium in solid-state fermentation (SSF), to enhance methane production via subsequent anaerobic digestion (AD). Effects of washing of corn stover silage (WCSS) on the lignocellulosic biodegradability in the fungal pretreatment step and on methane production in the AD step were investigated with comparison to the CSS. It was found that P. chrysosporium had the degradation of cellulose, hemicellulose, and lignin of CSS up to 19.9, 32.4, and 22.6 %, respectively. Consequently, CSS pretreated by 25 days achieved the highest methane yield of 265.1 mL/g volatile solid (VS), which was 23.0 % higher than the untreated CSS. However, the degradation of cellulose, hemicellulose, and lignin in WCSS after 30 days of SSF increased to 45.9, 48.4, and 39.0 %, respectively. Surface morphology and Fourier-transform infrared spectroscopy analyses also demonstrated that the WCSS improved degradation of cell wall components during SSF. Correspondingly, the pretreatment of WCSS improved methane production by 19.6 to 32.6 %, as compared with untreated CSS. Hence, washing and reducing organic acids (such as lactic acid, acetic acid, propionic acid, and butyric acid) present in CSS has been proven to further improve biodegradability in SSF and methane production in the AD step.

  20. Degradation of Diuron by Phanerochaete chrysosporium: Role of Ligninolytic Enzymes and Cytochrome P450

    Directory of Open Access Journals (Sweden)

    Jaqueline da Silva Coelho-Moreira

    2013-01-01

    Full Text Available The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μg/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl-3-methylurea] and DCPU [(3,4-dichlorophenylurea], were detected in the culture medium at the concentrations of 0.74 μg/mL and 0.06 μg/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT, a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.

  1. Use of steam explosion liquor from sugar cane bagasse for lignin peroxidase production by Phanerochaete chrysosporium.

    Science.gov (United States)

    Ferrara, Maria Antonieta; Bon, Elba P S; Araujo Neto, Julio Silva

    2002-01-01

    The possibility of using two by-products of the sugar cane industry, molasses and bagasse steam explosion liquor (SEL), for lignin peroxidase (LiP) production by Phanerochaete chrysosporium was investigated. For comparison, the fungus was initially cultivated in synthetic media containing either glucose, sucrose, xylose, or xylan as sole carbon sources. The effect of veratryl alcohol (VA) was also investigated in relation to the enzyme activity levels. Results showed that sucrose was not metabolized by this fungus, which precluded the use of molasses as a carbon source. Glucose, xylose, and xylan promoted equivalent cell growth. Enzyme levels in the absence of VA were lower than 28 UI/L and in the presence of VA reached 109 IU/L with glucose and 85 IU/L with xylose or xylan. SEL was adequate for P. chrysosporium LiP production as LiP activity reached 90 IU/L. When VA was added to this medium, enzyme concentration increased to 155 IU/L.

  2. Biodegradation pathway and detoxification of the diazo dye Reactive Black 5 by Phanerochaete chrysosporium.

    Science.gov (United States)

    Enayatizamir, Naeimeh; Tabandeh, Fatemeh; Rodríguez-Couto, Susana; Yakhchali, Bagher; Alikhani, Hossein A; Mohammadi, Leila

    2011-11-01

    The in vivo biodegradation of the diazo dye Reactive Black 5 (RB5) by Phanerochaete chrysosporium immobilised on cubes of nylon sponge and on sunflower-seed shells (SS) in laboratory-scale bioreactors was investigated. The SS cultivation led to the best results with a decolouration percentage of 90.3% in 72 h for an initial RB5 concentration of 100 mg/L. It was found that the addition of 0.4 mM veratryl alcohol (VA) into the medium considerably increased the decolouration rate in SS cultivation. However, the addition of VA had no effect in the nylon cultivation. Thin layer chromatography (TLC) revealed that RB5 was transformed into one metabolite after 24 h. UV-vis spectroscopy and Fourier Transform Infrared (FT-IR) also confirmed the biodegradation of RB5. Toxicity of RB5 solutions before and after fungal treatment was assayed using Sinorhizobium meliloti as a sensitive soil microorganism. P. chrysosporium transformed the toxic dye RB5 into a non-toxic product.

  3. New pathway for degradation of sulfonated azo dyes by microbial peroxidases of Phanerochaete chrysosporium and Streptomyces chromofuscus.

    OpenAIRE

    Goszczynski, S; Paszczynski, A; Pasti-Grigsby, M B; Crawford, R L; Crawford, D. L.

    1994-01-01

    Pathways for the degradation of 3,5-dimethyl-4-hydroxy-azobenzene-4'-sulfonic acid (I) and 3-methoxy-4-hydroxyazobenzene-4'-sulfonamide (II) by the manganese peroxidase and ligninase of Phanerochaete chrysosporium and by the peroxidase of Streptomyces chromofuscus have been proposed. Twelve metabolic products were found, and their mechanisms of formation were explained. Preliminary oxidative activation of the dyes resulted in the formation of cationic species, making the molecules vulnerable ...

  4. Direct Probing of the Surface Ultrastructure and Molecular Interactions of Dormant and Germinating Spores of Phanerochaete chrysosporium

    OpenAIRE

    Dufrêne, Yves; Boonaert, C J; Gerin, Patrick A.; Asther, M.; Rouxhet, Paul

    1999-01-01

    Atomic force microscopy (AFM) has been used to probe, under physiological conditions, the surface ultrastructure and molecular interactions of spores of the filamentous fungus Phanerochaete chrysosporium. High-resolution images revealed that the surface of dormant spores was uniformly covered with rodlets having a periodicity of 10 +/- 1 nm, which is in agreement with earlier freeze-etching measurements. In contrast, germinating spores had a very smooth surface partially covered with rough gr...

  5. Ethanol production via simultaneous saccharification and fermentation of sodium hydroxide treated corn stover using Phanerochaete chrysosporium and Gloeophyllum trabeum.

    Science.gov (United States)

    Vincent, Micky; Pometto, Anthony L; van Leeuwen, J Hans

    2014-04-01

    Ethanol was produced via the simultaneous saccharification and fermentation (SSF) of dilute sodium hydroxide treated corn stover. Saccharification was achieved by cultivating either Phanerochaete chrysosporium or Gloeophyllum trabeum on the treated stover, and fermentation was then performed by using either Saccharomyces cerevisiae or Escherichia coli K011. Ethanol production was highest on day 3 for the combination of G. trabeum and E. coli K011 at 6.68 g/100g stover, followed by the combination of P. chrysosporium and E. coli K011 at 5.00 g/100g stover. SSF with S. cerevisiae had lower ethanol yields, ranging between 2.88 g/100g stover at day 3 (P. chrysosporium treated stover) and 3.09 g/100g stover at day 4 (G. trabeum treated stover). The results indicated that mild alkaline pretreatment coupled with fungal saccharification offers a promising bioprocess for ethanol production from corn stover without the addition of commercial enzymes.

  6. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    International Nuclear Information System (INIS)

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles

  7. Polyvinyl alcohol-immobilized Phanerochaete chrysosporium and its application in the bioremediation of composite-polluted wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhenzhen [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Zuo, Yanan; Guo, Zhi; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Song, Zhongxian [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming 650500 (China); Niu, Qiuya [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-05-30

    Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles.

  8. Regulation of Gene Expression during the Onset of Ligninolytic Oxidation by Phanerochaete chrysosporium on Spruce Wood.

    Science.gov (United States)

    Korripally, Premsagar; Hunt, Christopher G; Houtman, Carl J; Jones, Don C; Kitin, Peter J; Cullen, Dan; Hammel, Kenneth E

    2015-11-01

    Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in the cultures. Confocal fluorescence microscopy of the beads showed that extracellular oxidation commenced 2 to 3 days after inoculation, coincident with cessation of fungal growth. Whole transcriptome shotgun sequencing (RNA-seq) analyses based on the v.2.2 P. chrysosporium genome identified 356 genes whose transcripts accumulated to relatively high levels at 96 h and were at least four times the levels found at 40 h. Transcripts encoding some lignin peroxidases, manganese peroxidases, and auxiliary enzymes thought to support their activity showed marked apparent upregulation. The data were also consistent with the production of ligninolytic extracellular reactive oxygen species by the action of manganese peroxidase-catalyzed lipid peroxidation, cellobiose dehydrogenase-catalyzed Fe(3+) reduction, and oxidase-catalyzed H2O2 production, but the data do not support a role for iron-chelating glycopeptides. In addition, transcripts encoding a variety of proteins with possible roles in lignin fragment uptake and processing, including 27 likely transporters and 18 cytochrome P450s, became more abundant after the onset of extracellular oxidation. Genes encoding cellulases showed little apparent upregulation and thus may be expressed constitutively. Transcripts corresponding to 165 genes of unknown function accumulated more than 4-fold after oxidation commenced, and some of them may merit investigation as possible contributors to ligninolysis. PMID:26341198

  9. Expression of a Phanerochaete chrysosporium manganese peroxidase gene in the yeast Pichia pastoris.

    Science.gov (United States)

    Gu, Lina; Lajoie, Curtis; Kelly, Christine

    2003-01-01

    A gene encoding manganese peroxidase (mnp1) from Phanerochaete chrysosporium was cloned downstream of a constitutive glyceraldehyde-3-phosphate dehydrogenase promoter in the methylotrophic yeast Pichia pastoris. Three different expression vectors were constructed: pZBMNP contains the native P. chrysosporium fungal secretion signal, palphaAMNP contains an alpha-factor secretion signal derived from Saccharomyces cerevisiae, and pZBIMNP has no secretion signal and was used for intracellular expression. Both the native fungal secretion signal sequence and alpha-factor secretion signal sequence directed the secretion of active recombinant manganese peroxidase (rMnP) from P. pastoris transformants. The majority of the rMnP produced by P. pastoris exhibited a molecular mass (55-100 kDa) considerably larger than that of the wild-type manganese peroxidase (wtMnP, 46 kDa). Deletion of the native fungal secretion signal yielded a molecular mass of 39 kDa for intracellular rMnP in P. pastoris. Treatment of the secreted rMnP with endoglycosidase H (Endo H) resulted in a considerable decrease in the mass of rMnP, indicating N-linked hyperglycosylation. Partially purified rMnP showed kinetic characteristics similar to those of wtMnP. Both enzymes also had similar pH stability profiles. Addition of exogenous Mn(II), Ca(II), and Fe(III) conferred additional thermal stability to both enzymes. However, rMnP was slightly less thermostable than wtMnP, which demonstrated an extended half-life at 55 degrees C. PMID:14524699

  10. VANILLIN PRODUCTION BY PHANEROCHAETE CHRYSOSPORIUM GROWN ON GREEN COCONUT AGRO-INDUSTRIAL HUSK IN SOLID STATE FERMENTATION

    OpenAIRE

    Elisabete dos Santos Barbosa; Daniel Perrone; Ana Lúcia do Amaral Vendramini; Selma Gomes Ferreira Leite

    2008-01-01

    Agro-industrial residues have become an important source for the production of chemical compounds using biological pathways, contributing to preservation of the environment and making the overall process economically supportable. Vanillin is a very important aromatic compound for the food, beverage, and pharmaceutical industries. The aim of the present study was to evaluate the vanillin production by solid-state fermentation on green coconut residue using the basidiomycete Phanerochaete chrys...

  11. Degradation of wheat straw cell wall by white rot fungi Phanerochaete chrysosporium

    Science.gov (United States)

    Zeng, Jijiao

    The main aim of this dissertation research was to understand the natural microbial degradation process of lignocellulosic materials in order to develop a new, green and more effective pretreatment technology for bio-fuel production. The biodegradation of wheat straw by white rot fungi Phanerochaete chrysosporium was investigated. The addition of nutrients significantly improved the performance of P.chrysosporium on wheat straw degradation. The proteomic analysis indicated that this fungus produced various pepetides related to cellulose and lignin degradation while grown on the biomass. The structural analysis of lignin further showed that P.chrysosporium preferentially degraded hydroxycinnamtes in order to access cellulose. In details, the effects of carbon resource and metabolic pathway regulating compounds on manganeses peroxidase (MnP) were studied. The results indicated that MnP activity of 4.7 +/- 0.31 U mL-1 was obtained using mannose as a carbon source. The enzyme productivity further reached 7.36 +/- 0.05 U mL-1 and 8.77 +/- 0.23 U mL -1 when the mannose medium was supplemented with cyclic adenosine monophosphate (cAMP) and S-adenosylmethionine (SAM) respectively, revealing highest MnP productivity obtained by optimizing the carbon sources and supplementation with small molecules. In addition, the effects of nutrient additives for improving biological pretreatment of lignocellulosic biomass were studied. The pretreatment of wheat straw supplemented with inorganic salts (salts group) and tween 80 was examined. The extra nutrient significantly improved the ligninase expression leading to improve digestibility of lignocellulosic biomass. Among the solid state fermentation groups, salts group resulted in a substantial degradation of wheat straw within one week, along with the highest lignin loss (25 %) and ˜ 250% higher efficiency for the total sugar release through enzymatic hydrolysis. The results were correlated with pyrolysis GC-MS (Py

  12. The RT-PCR Analysis of Lignocellulytic Biodegradation-related Gene Expression of Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    Jiang Mingfeng(江明锋); Zhang Yizheng

    2004-01-01

    Expression of lignocellulytic biodegradation-related genes of Phanerochaete chrysosporium grown in 10 kinds of defined media for 5 days and on fir wood chip for 2 to 8 weeks is analyzed by using the RT-PCR method. The result shows that an individual gene of lip gene family responds differently to different nutrient factors. The expression of lipD gene can be promoted by molecular O2 but suppressed by Mn2+. The influence of nitorgen is not the controlling factor for lipD gene expression. No clear relationship is found between nutrient factors and the expression of lipA gene which may be regulated by several nutrient factors through a complex system. Mnp3 gene is not strongly regulated by Mn2+ and other nutrient factors. It can be expressed in different media. CBHI gene family can not be expressed in the presence of glucose as the sole carbon source. Glx expression is regulated by Mn2+ and molecular O2, and depressed when Mn2+ concerntration goes up to 300 mg/L. The transcription patterns of lip gene family grown on fir wood chip are shown to be markedly different from those patterns in defined media. The expression of single lip gene changes with colonized time. No difference is observed between the expression pattern of mnp, cbh, glx gene in defined media and fir wood chips.

  13. Phenotypic classes of phenoloxidase-negative mutants of the lignin-degrading fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    This paper reports the isolation of phenoloxidase-negative mutants of the white-rot fungus Phanerochaete chrysosporium and the results of a survey of idiophasic functions among these mutants. The mutant strains were isolated from a medium containing o-anisidine after gamma irradiation of wild-type spores and fell into four classes, divided by the manner in which they mineralized 14C-lignin wheat lignocellulose. Examples are strain LMT7, which degraded lignin at a rate similar to that of the wild type; strain LMT26, in which degradation was enhanced; strain LMT16, whose degradation rate was apparently unaffected, although the onset of lignin attack was delayed compared with that in the wild type; and strain LMT24, which was unable to evolve significant amounts of 14CO2 from the radiolabeled substrate. The mutants were not necessarily defective in other functions associated with idiophasic activities (intracellular cyclic AMP levels, sporulation, extracellular glucan production, veratryl alcohol synthesis). The authors conclude that phenoloxidase activity as detected by the o-anisidine plate test is not necessary for lignin degradation. In addition, mutations resulting in the loss of lignin-degrading ability were not necessarily pleiotropic with other idiophasic functions

  14. Continuous treatment of coloured industry wastewater using immobilized Phanerochaete chrysosporium in a rotating biological contactor reactor.

    Science.gov (United States)

    Pakshirajan, Kannan; Kheria, Sumeet

    2012-06-30

    Coloured industry wastewaters often contain dyes and other toxic ingredients, and, therefore, pose serious threat to the receiving environment. Among the available methods the eco-friendly biological method has gained maximum attention due to its many advantages over the traditional methods. In the present study, continuous biological treatment of coloured wastewater from a textile dyeing industry was investigated using the white rot fungus Phanerochaete chrysosporium in a rotating biological contactor (RBC) reactor. The raw wastewater was diluted with an equal volume of either distilled water or media containing glucose at varying concentrations to study its effect on the decolourization process. Results revealed that the wastewater could be decolourized to an extent of more than 64% when diluted with media containing glucose; and, a maximum decolourization efficiency of 83% was obtained with 10 g/l glucose concentration. COD removal efficiencies were also found to be consistent with the decolourization efficiencies of the wastewaters. Further, the results were correlated with the enzyme activities of manganese peroxidase (MnP) and lignin peroxidase (LiP) by the fungus, which were found to play some significant role in decolourization of the wastewater. Results of replacing the costly carbon source glucose in the decolourization media with the more cheap molasses, however, revealed very high COD removal efficiency, but low decolourization efficiency of the industry wastewater.

  15. Polycyclic aromatic hydrocarbon biodegradation and extracellular enzyme secretion in agitated and stationary cultures of Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The extracellular enzyme secretion and biodegradation of polycyclic aromatic hydrocarbons (PAHs) were studied in agitated and shallow stationary liquid cultures of Phanerochaete chrysosporium. Veratryl alcohol and Tween80 were added to cultures as lignin peroxidase (LiP) and manganese peroxidase (MnP) inducer, respectively. Shallow stationary cultures were suitable for the production of enzyme, whereas agitated cultures enhanced overall biodegradation by facilitating interphase mass transfer of PAH into aqueous phases. The use of a LiP stimulator, veratryl alcohol, did not increase PAH degradation but significantly enhanced LiP activity. In contrast, Tween80 increased both MnP secretion and PAH degradation in shallow stationary cultures. On the other hand, high PAH degradation was observed in agitated cultures in the absence of detectable LiP and MnP activities. The results suggested that extracellular peroxidase activities are not directly related to the PAH degradation, and the increased solubility rather than enzyme activity may be more important in the promotion of PAH degradation.

  16. Effects of culture conditions on ligninolytic enzymes and protease production by Phanerochaete chrysosporium in air

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The production of ligninolytic enzymes and protease by Phanerochaete chrysosporium was investigated under different culture conditions. Different amounts of medium were employed in free and immobilized culture, together with two kinds of medium with different C/N ratios. Little lignin peroxidase (LiP) (< 2 U/L) was detected in free culture with nitrogen-limited medium (C/N ratio: 56/2.2 mmol/L), while manganese peroxidase (MnP) maximum activity was 231 and 240 U/L in 50 and 100 ml medium culture, respectively. Immobilized culture with 50 ml nitrogen-limited medium gave the highest MnP and LiP production with the maximum values of 410 and 721 U/L separately on day 5; however, flasks containing 100 ml nitrogen-limited medium only produced less MnP with a peak value of 290 U/L. Comparatively, carbon-limited medium (C/N ratio: 28/44 mmol/L) was adopted in culture but produced little MnP and LiP. Medium type had the greatest impact on protease production. Large amount of protease was produced due to glucose limitation. Culture type and medium volume influence protease activity corporately by affecting oxygen supply. The results implied shallow immobilized culture was a possible way to gain high production of ligninolytic enzymes.

  17. Exploring the Synergy between Cellobiose Dehydrogenase from Phanerochaete chrysosporium and Cellulase from Trichoderma reesei.

    Science.gov (United States)

    Wang, Min; Lu, Xuefeng

    2016-01-01

    Recent demands for the production of lignocellulose biofuels boosted research on cellulase. Hydrolysis efficiency and production cost of cellulase are two bottlenecks in "biomass to biofuels" process. The Trichoderma cellulase mixture is one of the most commonly used enzymes for cellulosic hydrolysis. During hydrolytic process cellobiose accumulation causes feedback inhibition against most cellobiohydrolases and endoglucanases. In this study, we demonstrated the synergism effects between cellobiose dehydrogenase (CDH) and cellulase both in vitro and in vivo. The CDH from Phanerochaete chrysosporium was heterologously expressed in Pichia pastoris. Supplementation of the purified CDH in Trichoderma cellulase increased the cellulase activities. Especially β-glucosidase activity was increased by 30-100% varying at different time points. On the other hand, the cdh gene was heterologously expressed in Trichoderma reesei to explore the synergism between CDH and cellulases in vivo. The analyses of gene expression and enzymatic profiles of filter paper activity, carboxymethylcellulase (CMCase) and β-glucosidase show the increased cellulase activity and the enhanced cellulase production in the cdh-expressing strains. The results elucidate a possible mechanism for diminishing the cellobiose inhibition of cellulase by CDH. These findings provide a novel perspective to make more economic enzyme cocktails for commercial application or explore alternative strategies for generating cellulase-producing strains with higher efficiency. PMID:27199949

  18. Identification of metabolites produced by Phanerochaete chrysosporium in the presence of amlodipine orotate using metabolomics.

    Science.gov (United States)

    De Sotto, R B; Kim, K I; Kim, S; Song, K G; Park, Y

    2015-01-01

    Pharmaceuticals are very useful in treating human diseases but they are excreted to the environment sometimes in their original form or as byproducts of human metabolism. Pharmaceuticals and their metabolites have been proven by studies to be harmful to non-target ecological species and may be persistent in different water matrices. In this regard, there is an emergent need to eliminate these compounds to prevent their adverse effects on aquatic species. Biodegradation using white-rot fungi is a promising technology for the removal of recalcitrant compounds; however, products of fungal biodegradation can also be detrimental. In this novel study, we evaluated the ability of Phanerochaete chrysosporium to degrade amlodipine, an anti-hypertensive drug which was recently found in water systems. Analysis of amlodipine metabolites was done using quadrupole time-of-flight liquid chromatography mass spectrometry after the degradation set-up of 120 hours. Pharmaceutical degradation was seen using triple quadrupole liquid chromatography tandem mass spectrometry. Ninety-two significant metabolites (P-value ≤ 0.05) were significantly expressed after false discovery rate adjustment at a significance threshold of q = 0.05. Pyridine derivatives which were identified from samples became the basis of the proposed degradation pathway of amlodipine in this study. PMID:26398029

  19. Biodegradation, biosorption of phenanthrene and its trans-membrane transport by Massilia sp. WF1 and Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    Haiping eGu

    2016-01-01

    Full Text Available Reducing phenanthrene (PHE in the environment is critical to ecosystem and human health. Biodegradation, biosorption and the trans-membrane transport mechanism of PHE by a novel strain, Massilia sp. WF1, and an extensively researched model fungus, Phanerochaete chrysosporium (P. chrysosporium were investigated in aqueous solutions. Results showed that the PHE residual concentration decreased with incubation time and the data fitted well to a first-order kinetic equation, and the t1/2 of PHE degradation by WF1, spores and mycelial pellets of P. chrysosporium were about 2 hours, 87 days, and 87 days, respectively. The biosorbed PHE was higher in P. Chrysosporium than that in WF1, and it increased after microorganisms were inactivated and inhibited, especially in mycelial pellets. The detected intracellular auto-fluorescence of PHE by two-photon excitation microscopy also proved that PHE indeed entered into the cells. Based on regression, the intracellular (Kdin and extracellular (Kdout dissipation rate constants of PHE by WF1 were higher than those by spores and mycelial pellets. In addition, the transport rate constant of PHE from outside solution into cells (KinS/Vout for WF1 were higher than the efflux rate constant of PHE from cells to outside solution (KoutS/Vin, while the opposite phenomena were observed for spores and mycelial pellets. The amount of PHE that transported from outside solution into cells was attributed to the rapid degradation and active PHE efflux in the cells of WF1 and P. Chrysosporium, respectively. Besides, the results under the inhibition treatments of 4 °C, and the presence of sodium azide, colchicine and cytochalasin B demonstrated that a passive trans-membrane transport mechanism was involved in PHE entering into the cells of WF1 and P. Chrysosporium.

  20. Mineralization of sulfonated azo dyes and sulfanilic acid by Phanerochaete chrysosporium and Streptomyces chromofuscus.

    Science.gov (United States)

    Paszczynski, A; Pasti-Grigsby, M B; Goszczynski, S; Crawford, R L; Crawford, D L

    1992-11-01

    Five 14C-radiolabeled azo dyes and sulfanilic acid were synthesized and used to examine the relationship between dye substitution patterns and biodegradability (mineralization to CO2) by a white-rot fungus and an actinomycete. 4-Amino-[U-14C]benzenesulfonic acid and 4-(3-sulfo-4-aminophenylazo)-[U-14C]benzenesulfonic acid were used as representative compounds having sulfo groups or both sulfo and azo groups. Such compounds are not known to be present in the biosphere as natural products. The introduction of lignin-like fragments into the molecules of 4-amino-[U-14C]benzenesulfonic acid and 4-(3-sulfo-4-aminophenylazo)-[U-14C]benzenesulfonic acid by coupling reactions with guaiacol (2-methoxyphenol) resulted in the formation of the dyes 4-(3-methoxy-4-hydroxyphenylazo)-[U-14C]benzenesulfonic acid and 4-(2-sulfo-3'-methoxy-4'-hydroxy-azobenzene-4-azo)-[U-14C]benzenesulf oni c acid, respectively. The synthesis of acid azo dyes 4-(2-hydroxy-1-naphthylazo)-[U-14C]benzenesulfonic acid and 4-(4-hydroxy-1-naphthylazo)-[U-14C]benzenesulfonic acid also allowed the abilities of these microorganisms to mineralize these commercially important compounds to be evaluated. Phanerochaete chrysosporium mineralized all of the sulfonated azo dyes, and the substitution pattern did not significantly influence the susceptibility of the dyes to degradation. In contrast, Streptomyces chromofuscus was unable to mineralize aromatics with sulfo groups and both sulfo and azo groups. However, it mediated the mineralization of modified dyes containing lignin-like substitution patterns. This work showed that lignocellulolytic fungi and bacteria can be used for the biodegradation of anionic azo dyes, which thus far have been considered among the xenobiotic compounds most resistant to biodegradation.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes

    DEFF Research Database (Denmark)

    Manavalan, Arulmani

    2006-01-01

    Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production...

  2. Biodegradation, Biosorption of Phenanthrene and Its Trans-Membrane Transport by Massilia sp. WF1 and Phanerochaete chrysosporium

    Science.gov (United States)

    Gu, Haiping; Lou, Jun; Wang, Haizhen; Yang, Yu; Wu, Laosheng; Wu, Jianjun; Xu, Jianming

    2016-01-01

    Reducing phenanthrene (PHE) in the environment is critical to ecosystem and human health. Biodegradation, biosorption, and the trans-membrane transport mechanism of PHE by a novel strain, Massilia sp. WF1, and an extensively researched model fungus, Phanerochaete chrysosporium were investigated in aqueous solutions. Results showed that the PHE residual concentration decreased with incubation time and the data fitted well to a first-order kinetic equation, and the t1/2 of PHE degradation by WF1, spores, and mycelial pellets of P. chrysosporium were about 2 h, 87 days, and 87 days, respectively. The biosorbed PHE was higher in P. Chrysosporium than that in WF1, and it increased after microorganisms were inactivated and inhibited, especially in mycelial pellets. The detected intracellular auto-fluorescence of PHE by two-photon excitation microscopy also proved that PHE indeed entered into the cells. Based on regression, the intracellular (Kdin) and extracellular (Kdout) dissipation rate constants of PHE by WF1 were higher than those by spores and mycelial pellets. In addition, the transport rate constant of PHE from outside solution into cells (KinS/Vout) for WF1 were higher than the efflux rate constant of PHE from cells to outside solution (KoutS/Vin), while the opposite phenomena were observed for spores and mycelial pellets. The amount of PHE that transported from outside solution into cells was attributed to the rapid degradation and active PHE efflux in the cells of WF1 and P. Chrysosporium, respectively. Besides, the results under the inhibition treatments of 4°C, and the presence of sodium azide, colchicine, and cytochalasin B demonstrated that a passive trans-membrane transport mechanism was involved in PHE entering into the cells of WF1 and P. Chrysosporium. PMID:26858710

  3. Phanerochaete chrysosporium IBL-03 secretes high titers of manganese peroxidase during decolorization of Drimarine Blue K2RL textile dye.

    Science.gov (United States)

    Noreen, Razia; Asgher, Muhammad; Bhatti, Haq Nawaz; Batool, Shaheera; Asad, Muhammad Javaid

    2011-01-01

    A novel indigenous strain, Phanerochaete chrysosporium IBL-03, with high manganese peroxidase (MnP) activities was used for decolorization of a reactive textile dye, Drimarine Blue K2R, which is used extensively in textile units of Pakistan. The initial experiment was run for seven days with 0.01% (w/v) dye solution prepared in Kirk's basal nutrient medium. Samples were removed after every 24 h and the extent of dye decolorization was determined at lambda(max) of the dye. The study revealed that P. chrysosporium caused 65% decolorization of Drimarine Blue K2RL in seven days. By process optimization, 97% colour removal could be achieved in three days using 0.005% (w/v) Drimarine Blue K2RL solution at pH 4.0 and 30 degrees C in defined Kirk's medium with 0.9% (w/v) molasses and 0.2% (w/v) ammonium dihydrogen phosphate added as carbon and nitrogen sources, respectively. Manganese peroxidase was found to be the major enzyme (560 IU/mL) involved in dye decolorization of Drimarine Blue K2RL by P. chrysosporium. The dye adsorption studies showed that the dye initially adsorbed on fungal mats disappeared later on, possibly by the action of MnP secreted by the fungus in secondary metabolism.

  4. Microbial pretreatment of cotton stalks by Phanerochaete chrysosporium for bioethanol production

    Science.gov (United States)

    Shi, Jian

    Lignocellulosic biomass has been recognized as a widespread, potentially low cost renewable source of mixed sugars for fermentation to fuel ethanol. Pretreatment, as the first step towards conversion of lignocellulose to ethanol, remains one of the main barriers to technical and commercial success of the processing technology. Existing pretreatment methods have largely been developed on the basis of physiochemical technologies which are considered relatively expensive and usually involve adverse environmental impacts. In this study, an environmentally benign alternative, microbial pretreatment using Phanerochaete chrysosporium, was explored to degrade lignin in cotton stalks and facilitate their conversion into ethanol. Two submerged liquid pretreatment techniques (SmC), shallow stationary and agitated cultivation, at three inorganic salt concentrations (no salts, modified salts without Mn2+, modified salts with Mn2+) were compared by evaluating their pretreatment efficiencies. Shallow stationary cultivation with no salt was superior to other pretreatment conditions and gave 20.7% lignin degradation along with 76.3% solids recovery and 29.0% carbohydrate availability over a 14 day period. The influence of substrate moisture content (65%, 75% and 80% M.C. wet-basis), inorganic salt concentration (no salts, modified salts without Mn2+ , modified salts with Mn2+) and culture time (0-14 days) on pretreatment effectiveness in solid state (SSC) systems was also examined. It was shown that solid state cultivation at 75% M.C. without salts was the most preferable pretreatment resulting in 27.6% lignin degradation, 71.1% solids recovery and 41.6% carbohydrate availability over a period of 14 days. A study on hydrolysis and fermentation of cotton stalks treated microbially using the most promising SmC (shallow stationary, no salts) and SSC (75% moisture content, no salts) methods resulted in no increase in cellulose conversion with direct enzyme application (10.98% and 3

  5. Screening of static culture and comparison of batch and continuous culture for the textile dye biological decolorization by Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    J. Urra

    2006-09-01

    Full Text Available The production of manganese dependent peroxidase (MnP by Phanerochaete chrysosporium and the level of decolorization of 13 dyes were evaluated using static and agitated batch cultures and continuous cultures. A screening carried out under static conditions showed that the oxidative system has a certain affinity for azoic structures. For concentrations of 100 mg l-1 of Acid Black 1, Reactive Black 5, Reactive Orange 16 and Acid Red 27, decolorization percentages higher than 90% were obtained. In batch cultures with Acid Black 1 and Reactive Black 5 a significant increment in primary post-metabolism biomass was observed. For these last two dyes, it was possible to explore the response of the continuous system during 32 to 47 days, with concentrations between 25 to 400 mg l-1, obtaining decolorization percentages greater than 70% for 400 mg l-1.

  6. Biosorption of 2,4-dichlorophenol from aqueous solution by Phanerochaete chrysosporium biomass: Isotherms, kinetics and thermodynamics

    International Nuclear Information System (INIS)

    The biosorption of 2,4-dichlorophenol (2,4-DCP) from aqueous solution on non-living mycelial pellets of Phanerochaete chrysosporium was studied with respect to pH, initial concentration of 2,4-DCP, temperature and pellet size. The fungal biomass exhibited the highest sorption capacity of 4.09 mg/g at an initial pH of 5.0, initial 2,4-DCP concentration of 50.48 mg/l, 25 deg. C and a pellet size of 1.0-1.5 mm in the investigated pH 2.0-11.0, initial concentrations of 5-50 mg/l, temperature 25-50 deg. C, and pellet size of 1.0-2.5 mm. The Freundlich model exhibited a slightly better fit to the biosorption data of 2,4-DCP than the Langmuir model. The biosorption of 2,4-DCP to biomass followed pseudo second-order adsorption kinetics. The second-order kinetic constants decreased with increasing temperature, and the apparent activation energy of biosorption was estimated to be -16.95 kJ/mol. The thermodynamic analysis indicates that the biosorption process was exothermic and that the adsorption of 2,4-DCP on P. chrysosporium might be physical in nature. Both intraparticle diffusion and kinetic resistances might affect the adsorption rate and that their relative effects varied with operation temperature in the biosorption of 2,4-DCP by mycelial pellets

  7. The effect of heavy metal-induced oxidative stress on the enzymes in white rot fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Zhang, Qihua; Zeng, Guangming; Chen, Guiqiu; Yan, Min; Chen, Anwei; Du, Jianjian; Huang, Jian; Yi, Bin; Zhou, Ying; He, Xiaoxiao; He, Yan

    2015-02-01

    Prevalence of heavy metals in the living environment causes chemical stress and reactive oxygen species (ROS) formation in Phanerochaete chrysosporium (P. chrysosporium). However, the mechanisms involved in ROS defense are still under investigation. In the present study, we evaluated the effect of lead- and cadmium-induced oxidative stress on the activities of catalase (CAT), peroxidase (POD), lignin peroxidase (LiP), and manganese peroxidase (MnP). A time-dependent change in all enzyme activities was observed following exposure to 50 μM cadmium and 25 μM lead. The lowest values were recorded at 4 h after exposure. Both cadmium and lead inhibited CAT and POD. The cytochrome P450 (CYP450) levels increased under 50-100 μM cadmium or lead exposure and decreased when heavy metal concentration was under 50 μM; this suggested that ROS is not the only factor that alters the CYP450 levels. The cadmium removal rate in the sample containing 900 μM taxifolin (inhibitor of CYP450) and 100 μM cadmium was reduced to 12.34 %, 9.73 % lower than that of 100 μM cadmium-induced sample, indicating CYP450 may play an indirect but key role in the process of clearance of heavy metals. The pH of the substrate solution decreased steadily during the incubation process.

  8. Relationship of chemical structures of textile dyes on the pre-adaptation medium and the potentialities of their biodegradation by Phanerochaete chrysosporium

    OpenAIRE

    Martins, M. Adosinda M.; Queiroz, Maria João R. P.; Silvestre, Armando J. D.; Lima, Nelson

    2002-01-01

    Azo dye derivatives of azobenzene constitute the largest group of dyes used in the textile industry and possess recalcitrant chemical groups, such as those of azo and sulphonic acid. Some microorganisms are able to degrade these aromatic compounds. In the present work, decolourisation of culture media containing azo dyes by the ligninolytic fungus Phanerochaete chrysosporium was achieved under nitrogenlimited conditions. The dyes used in the study are derivatives of meta- or para-ami...

  9. Manganese peroxidase production from cassava residue by Phanerochaete chrysosporium in solid state fermentation and its decolorization of indigo carmine

    Institute of Scientific and Technical Information of China (English)

    Huixing Li; Ruijing Zhang; Lei Tang; Jianhua Zhang; Zhonggui Mao

    2015-01-01

    Bioconversion of lignocellulosic wastes to higher value products through fungal fermentation has economic and ecological benefits. In this study, to develop an effective strategy for production of manganese peroxidase (MnP) from cassava residue by Phanerochaete chrysosporium in solid state fermentation, the stimulators of MnP produc-tion were screened and their concentrations were optimized by one-at-a-time experiment and Box–Behnken design. The maximum MnP activity of 186.38 nkat·g−1 dry mass of the sample was achieved after 6 days of fer-mentation with the supplement of 79.5 mmol·L−1·kg−1 acetic acid, 3.21 ml·kg−1 soybean oil, and 28.5 g·kg−1 alkaline lignin, indicating that cassava residue is a promising substrate for MnP production in solid state fermen-tation. Meanwhile, in vitro decolorization of indigo carmine by the crude MnP was also carried out, attaining the ratio of 90.18%after 6 h of incubation. An oxidative mechanism of indigo carmine decolorization by MnP was pro-posed based on the analysis of intermediate metabolites with ultra-high performance liquid chromatography and gas chromatography tandem mass spectrometry. Using the crude MnP produced from cassava residue for indigo carmine decolorization gives an effective approach to treat dyeing effluents.

  10. Decolourization potential of white-rot fungus Phanerochaete chrysosporium on synthetic dye bath effluent containing Amido black 10B

    Directory of Open Access Journals (Sweden)

    S. Senthilkumar

    2014-12-01

    Full Text Available Synthetic azo dyes are extensively used in textile industry and are not easily degraded into the environment due to their complex structure. Due to the low degree of fixation of these dyes to fabrics, more than 10–15% of the dye does not bind to fabrics during colour processing and release into water bodies as effluent cause serious environmental pollution. White-rot fungus is found to be capable of degrading lignin which has a complex structure similar to azo dyes. In this study, the decolourization potential of white-rot fungus Phanerochaete chrysosporium, which is capable of decolourizing synthetic dye bath effluent, was investigated. Maximum decolourization of 98% was achieved on the third day under normal conditions. The rate of decolourization carried out at different concentrations revealed that the increase in dye effluent concentration suppresses the percentage decolourization. The optimized amounts of nutrients were found to be 0.5%, 0.1% and 0.5% of glucose, manganese sulphate and ammonium salts, respectively. The addition of inducers such as starch and lignin increased enzyme production and the rate of decolourization.

  11. Influence of glucose feeding on the ligninolytic enzyme production of the white-rot fungus Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    ZHOU Xiaoyan; WEN Xianghua; FENG Yan

    2007-01-01

    The present work studied the influence of glucose feeding on the ligninolytic enzyme production of Phanerochaete chrysosporium in a nitrogen-limited(C/N ratio is 56/8.8 mmol/L)medium.Several sets of shaking flask experiments were conducted.The results showed that 2g/L glucose feeding on the first day of the culture(24 h after the inoculation)stimulated both fungal biomass growth and enzyme production.The manganese peroxidase(MnP)activity was 2.5 times greater than that produced in cultures without glucose feeding.Furthermore,the glucose feeding mode in fed-batch culture was also investigated.Compared to cultures with glucose feeding every 48 h,cultures with glucose feeding of 1.5 g/L(final concentration)every 24 h produced more enzymes.The peak and total yield of MnP activity were 2.7 and 3 times greater compared to the contrast culture,respectively,and the enzyme was kept stable for 4 days with an activity of over 200 U/L.

  12. Continuous production of manganese peroxidase by Phanerochaete chrysosporium immobilized on polyurethane foam in a pulsed packed-bed bioreactor.

    Science.gov (United States)

    Moreira, M T; Feijoo, G; Palma, C; Lema, J M

    1997-10-20

    The bottleneck of the application of manganese peroxidase (MnP) on an industrial scale in pulp biobleaching or in degradation of hazardous compounds is the lack of an efficient production system. Three main problems arise for the continuous production of MnP during secondary metabolism of Phanerochaete chrysosporium: enzyme production occurs only under specific physiological conditions corresponding to C or N limitation, high O(2) tension, and adequate Mn(+2) concentration; the enzyme that is produced is destabilized by extracellular proteases; and excessive growth of the mycelium blocks effective oxygen transfer. To overcome these drawbacks, continuous production of MnP was optimized by selecting a suitable bioreactor configuration and the environmental and operating conditions affecting both enzyme production and stability. The combination between a proper feed rate and the application of a pulsation in a packed-bed bioreactor permitted the maintenance of continuous secretion of MnP while limiting mycelial growth and avoiding bed clogging. Environmental factors as an Mn(+2) concentration of 5000 microM and high oxygen tension enhanced MnP production. The hydraulics of the bioreactor corresponding to a plug flow model with partial mixing and an operating hydraulic rentention time of 24 h were optimal to achieve stable operating conditions. This policy allowed long operation periods, obtaining higher productivities than the best reported in the literature. (c) 1997 John Wiley & Sons, Inc. Biotechnol Bioeng 56: 130-137, 1997. PMID:18636618

  13. Free hydroxyl radical is not involved in an important reaction of lignin degradation by Phanerochaete chrysosporium Burds.

    Science.gov (United States)

    Kirk, T K; Mozuch, M D; Tien, M

    1985-01-01

    Hydroxyl radical (HO.) has been implicated in the degradation of lignin by Phanerochaete chrysosporium. This study assessed the possible involvement of HO. in degradation of lignin substructural models by intact cultures and by an extracellular ligninase isolated from the cultures. Two non-phenolic lignin model compounds [aryl-C(alpha)HOH-C(beta)HR-C(gamma)H2OH, in which R = aryl (beta-1) or R = O-aryl (beta-O-4)] were degraded by cultures, by the purified ligninase, and by Fenton's reagent (H2O2 + Fe2+), which generates HO.. The ligninase and the cultures formed similar products, derived via an initial cleavage between C(alpha) and C(beta) (known to be an important biodegradative reaction), indicating that the ligninase is responsible for model degradation in cultures. Products from the Fenton degradation were mainly polar phenolics that exhibited little similarity to those from the biological systems. Mass-spectral analysis, however, revealed traces of the same products in the Fenton reaction as seen in the biological reactions; even so, an 18O2-incorporation study showed that the mechanism of formation differed. E.s.r. spectroscopy with a spin-trapping agent readily detected HO. in the Fenton system, but indicated that no HO. is formed during ligninase catalysis. We conclude, therefore that HO. is not involved in fungal C(alpha)-C(beta) cleavage in the beta-1 and beta-O-4 models and, by extension, in the same reaction in lignin. PMID:2986597

  14. A novel knotted cotton-thread carrier:Its potential use in achieving the biomass renewal of Phanerochaete chrysosporium in an immobilized growth system

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    In order to achieve an innovative strategy to renew the biomass of Phanerochaete chrysosporium in an immobilized growth system which can maintain white-rot fungi biomass, a novel knotted cotton-thread carrier was designed and made. By using a high-speed stirring apparatus under the conditions of 1400 r/min stirring speed for 6 min, mycelia immobilized on the knotted cotton-thread carriers were exfoliated completely and homogenized to a proper size. Furthermore, the homogenized mycelia from the immobilized mycelia can resume their growth on the knotted cotton-thread carriers in agitated flask cultures. The average regrowth biomass on the new carriers and the reused carriers was 0.0171 g/carrier and 0.0314 g/carrier, respectively. It proves that the knotted cotton-thread carrier performs perfectly in homogening the immobilized mycelia to achieve the biomass renewal of P. chrysosporium in an immobilized growth system.

  15. A novel knotted cotton-thread carrier: Its potential use in achieving the biomass renewal of Phanerochaete chrysosporium in an immobilized growth system

    Institute of Scientific and Technical Information of China (English)

    ZHOU Cheng; WEN XiangHua

    2009-01-01

    In order to achieve an innovative strategy to renew the biomass of Phanerochaete chrysosporium in an immobilized growth system which can maintain white-rot fungi biomass, a novel knotted cotton-thread carrier was designed and made. By using a high-speed stirring apparatus under the conditions of 1400 r/min stirring speed for 6 min, mycelia immobilized on the knotted cotton-thread carriers were exfoli-ated completely and homogenized to a proper size. Furthermore, the homogenized mycelia from the Immobilized mycalia can resume their growth on the knotted cotton-thread carriers in agitated flask cultures. The average regrowth biomass on the new carriers and the reused carriers was 0.0171 g/carrier and 0.0314 g/carrier, respectively. It proves that the knotted cotton-threed carrier performs perfectly in homogening the immobilized mycelia to achieve the biomass renewal of P. chrysosporium in an immobilized growth system.

  16. Simultaneous saccharification and fermentation of ground corn stover for the production of fuel ethanol using Phanerochaete chrysosporium, Gloeophyllum trabeum, Saccharomyces cerevisiae, and Escherichia coli K011.

    Science.gov (United States)

    Vincent, Micky; Pometto, Anthony L; van Leeuwen, J Hans

    2011-07-01

    Enzymatic saccharification of corn stover using Phanerochaete chrysosporium and Gloeophyllum trabeum and subsequent fermentation of the saccharification products to ethanol by Saccharomyces cerevisiae and Escherichia coli K011 were achieved. Prior to simultaneous saccharification and fermentation (SSF) for ethanol production, solid-state fermentation was performed for four days on ground corn stover using either P. chrysosporium or G. trabeum to induce in situ cellulase production. During SSF with S. cerevisiae or E. coli, ethanol production was the highest on day 4 for all samples. For corn stover treated with P. chrysosporium, the conversion to ethanol was 2.29 g/100 g corn stover with S. cerevisiae as the fermenting organism, whereas for the sample inoculated with E. coli K011, the ethanol production was 4.14 g/100 g corn stover. Corn stover treated with G. trabeum showed a conversion 1.90 and 4.79 g/100 g corn stover with S. cerevisiae and E. coli K011 as the fermenting organisms, respectively. Other fermentation co-products, such as acetic acid and lactic acid, were also monitored. Acetic acid production ranged between 0.45 and 0.78 g/100 g corn stover, while no lactic acid production was detected throughout the 5 days of SSF. The results of our experiment suggest that it is possible to perform SSF of corn stover using P. chrysosporium, G. trabeum, S. cerevisiae and E. coli K011 for the production of fuel ethanol.

  17. Characterization of a Phanerochaete chrysosporium glutathione transferase reveals a novel structural and functional class with ligandin properties.

    Science.gov (United States)

    Mathieu, Yann; Prosper, Pascalita; Buée, Marc; Dumarçay, Stéphane; Favier, Frédérique; Gelhaye, Eric; Gérardin, Philippe; Harvengt, Luc; Jacquot, Jean-Pierre; Lamant, Tiphaine; Meux, Edgar; Mathiot, Sandrine; Didierjean, Claude; Morel, Mélanie

    2012-11-01

    Glutathione S-transferases (GSTs) form a superfamily of multifunctional proteins with essential roles in cellular detoxification processes. A new fungal specific class of GST has been highlighted by genomic approaches. The biochemical and structural characterization of one isoform of this class in Phanerochaete chrysosporium revealed original properties. The three-dimensional structure showed a new dimerization mode and specific features by comparison with the canonical GST structure. An additional β-hairpin motif in the N-terminal domain prevents the formation of the regular GST dimer and acts as a lid, which closes upon glutathione binding. Moreover, this isoform is the first described GST that contains all secondary structural elements, including helix α4' in the C-terminal domain, of the presumed common ancestor of cytosolic GSTs (i.e. glutaredoxin 2). A sulfate binding site has been identified close to the glutathione binding site and allows the binding of 8-anilino-1-naphtalene sulfonic acid. Competition experiments between 8-anilino-1-naphtalene sulfonic acid, which has fluorescent properties, and various molecules showed that this GST binds glutathionylated and sulfated compounds but also wood extractive molecules, such as vanillin, chloronitrobenzoic acid, hydroxyacetophenone, catechins, and aldehydes, in the glutathione pocket. This enzyme could thus function as a classical GST through the addition of glutathione mainly to phenethyl isothiocyanate, but alternatively and in a competitive way, it could also act as a ligandin of wood extractive compounds. These new structural and functional properties lead us to propose that this GST belongs to a new class that we name GSTFuA, for fungal specific GST class A.

  18. Biosorption of copper and cadmium in packed bed columns with live immobilized fungal biomass of Phanerochaete chrysosporium.

    Science.gov (United States)

    Pakshirajan, K; Swaminathan, T

    2009-05-01

    Biosorption of copper (II) and cadmium (II) by live Phanerochaete chrysosporium immobilized by growing onto polyurethane foam material in individual packed bed columns over two successive cycles of sorption-desorption were investigated in this study. Initial pH and concentrations of the metals in their respective solutions were set optimum to each of those: 4.6 and 35 mg x l(-1) in case of copper and 5.3 and 11 mg x l(-1) for cadmium. The breakthrough curves obtained for the two metals during sorption in both the cycles exhibited a constant pattern at various bed depths in the columns. The maximum yield of the columns in removing these metals were found to be, respectively, 57% and 43% for copper and cadmium indicating that copper biosorption by the immobilized fungus in its column was better than for cadmium. Recovery values of the sorbed copper and cadmium metals from the respective loaded columns by using 0.1 N HCl as eluant was observed to be quite high at more than 65% and 75%, respectively, at the end of desorption in both the cycles. Breakthrough models of bed-depth service time, Adams-Bohart, Wolborska, and Clark were fitted to the experimental data on sorption of copper and cadmium in the columns, and only the Clark model could fit the sorption performance of the columns well over the entire range of ratios of concentrations of effluent to influent, i.e., C/C0 for both copper and cadmium biosorption. The kinetic coefficients of mass transfer and other suitable parameters in the system were determined by applying the experimental data at C/C0 ratios lower than 0.5 to the other three models. PMID:18551254

  19. 载体吸附培养黄孢原毛平革菌(Phanerochaete chrysosporium)和云芝(Trametes versicolor) 对染料的脱色%Decolorization of dyes by Phanerochaete chrysosporium and Trametes versicolor growing on adsorptive carriers

    Institute of Scientific and Technical Information of China (English)

    张昊; 李学梅; 张文黎; 花清信; 苌道松; 徐颖; 李雪玲; 任四伟; 陈宣宇; 杨清香

    2012-01-01

    Phanerochaete chrysosporium and Trametes versicolor were cultured on different carriers for continuous decolorization, the performance of different Phanerochaete chrysosporium and Trametes versicolor were researched and compared. In this paper, Phanerochaete chrysosporium and Trametes versicolor were cultured in liquid containing spherical sawdust, corncob and peanut shells under oscillation conditions. During few days of cultivation, large amount of bacteria was grew and attached on the carrier surface in membranous and lump state. After consecutive 4 rounds of decolorization, Phanerochaete chrysosporium and Trametes versicolor growing on sawdust carrier had significant advantage both in continuous decolorization and producing enzymes, so the optimal adsorptive carrier was sawdust. After consecutive 2 rounds and 12 d of reactive black RB5 decolorization, the Phanerochaete chrysosporium culture with sawdust as adsorptive carrier could achieve the decolorization of 97 %; after three rounds of dye supplemented, the cultures also could remove nearly 96% of M-3BE and the maximum production of manganese dependant pcroxidase enzyme (MnP) and lignin peroxidase enzyme (LiP) was 611, 1 477 U/L. In the actual application, Phanerochaete chrysosporium and Trametes versicolor culture with sawdust as carriers should be added to dye wastewater treatment system to strengthen the biological treatment effect.%比较研究了不同载体吸附培养的黄孢原毛平革菌(Phanerochaete chrysosporium)和云芝(Trametes versicolor)对染料连续脱色的效果.结果表明:(1)白腐真菌黄孢原毛平革菌和云芝分别在含有球形的木屑、玉米芯和花生壳载体的液体环境中振荡培养,菌体以膜状或团状形式大量附着生长在载体表面.(2)连续4轮脱色过程中,不论黄孢原毛平革菌还是云芝,都是木屑为载体的培养液的持续脱色和产酶能力最好,宜选择木屑为载体.其中,木屑为载体的黄孢

  20. Saccharification of pumpkin residues by coculturing of Trichoderma reesei RUT-C30 and Phanerochaete chrysosporium Burdsall with delayed inoculation timing.

    Science.gov (United States)

    Yang, Rui; Meng, Demei; Hu, Xiaosong; Ni, Yuanying; Li, Quanhong

    2013-09-25

    Trichoderma reesei and Phanerochaete chrysosporium with different lignocellulose-degrading enzyme systems have received much attention due to their ability to biodegrade lignocellulosic biomass. However, the synergistic effect of the two fungi on lignocellulose degradation is unknown. Herein, a cocultivation of T. reesei RUT-C30 and P. chrysosporium Burdsall for biodegradation of lignocellulosic pumpkin residues (PRS) was developed to produce soluble saccharide. Results indicated that a cocultivation of the two fungi with P. chrysosporium Burdsall inoculation delayed for 1.5 days produced the highest saccharide yield of 53.08% (w/w), and only 20.83% (w/w) of PRS were left after one batch of fermentation. In addition, this strategy increased the activities of secreted cellulases (endoglucanase, cellobiohydrolase, and β-glucosidase) and ligninases (lignin peroxidase and manganese peroxidase), which correlated to the increased saccharide yield. Besides, the resulting monosaccharides including glucose (1.23 mg/mL), xylose (0.13 mg/mL), arabinose (0.46 mg/mL), and fructose (0.21 mg/mL) from cocultures exhibited much higher yields than those from monoculture, which provides basal information for further fermentation research. This bioconversion of PRS into soluble sugars by cocultured fungal species provides a low cost method based on lignocellulose for potential biofuels or other bioproduct production. PMID:24020787

  1. Biodegradation of ddt (1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane) by the white rot fungus phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A.; Aust, S.D.

    1987-01-01

    Extensive biodegradation of 1,1,1-trichloro-2,2bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of (14C) DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the formation of polar and water-soluble metabolites during degradation. Hexane-extractable metabolites identified by gas chromatography-mass spectrometry included 1,1-dichloro-2,2-bis(4-chlorophenyl)ethane(DDD), 2,2,2-trichloro-1,1-bis(4-chlorophenyl)ethanol (dicofol), 2,2-dichloro-1,1-bis(4-chlorophenyl) ethanol (FW-152), and 4,4'-dichlorobenzophenone (DBP). DDD was the first metabolite observed; it appeared after 3 days of incubation and disappeared from culture upon continued incubation. This, as well as the fact that ((14)C) dicofol was mineralized, demonstrates that intermediates formed during DDT degradation are also metabolized. These results demonstrate that the pathway for DDT degradation in P. chrysosporium is clearly different from the major pathway proposed for microbial or environmental degradation of DDT. Like P. chrysosporium ME-446 and BKM-F-1767, the white rot fungi Pleurotus ostreatus, Phellinus weirii, and Polyporus versicolor also mineralized DDT.

  2. In vitro and in vivo inhibitory effects of some fungicides on catalase produced and purified from white-rot fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    Kavakçıoğlu, Berna; Tarhan, Leman

    2014-10-01

    In this study, in vitro and in vivo effects of some commonly used fungicides, antibiotics, and various chemicals on isolated and purified catalase from Phanerochaete chrysosporium were investigated. The catalase was purified 129.10-fold by using 60% ammonium sulfate and 60% ethanol precipitations, DEAE-cellulose anion exchange and Sephacryl-S-200 gel filtration chromatographies from P. chrysosporium growth in carbon- and nitrogen-limited medium for 12 days. The molecular weight of native purified catalase from P. chrysosporium was found to be 290 ± 10 kDa, and sodium dodecyl sulfate (SDS)-PAGE results indicated that enzyme consisted of four apparently identical subunits, with a molecular weight of 72.5 ± 2.5 kDa. Kinetic characterization studies showed that optimum pH and temperature, Km and Vmax values of the purified catalase which were stable in basic region and at comparatively high temperatures were 7.5, 30°C, 289.86 mM, and 250,000 U/mg, respectively. The activity of purified catalase from P. chrysosporium was significantly inhibited by dithiothreitol (DTT), 2-mercaptoethanol, iodoacetamide, EDTA, and sodium dodecyl sulfate (SDS). It was found that while antibiotics had no inhibitory effects, 45 ppm benomyl, 144 ppm captan, and 47.5 ppm chlorothalonil caused 14.52, 10.82, and 38.86% inhibition of purified catalase, respectively. The inhibition types of these three fungicides were found to be non-competitive inhibition with the Ki values of 1.158, 0.638, and 0.145 mM and IC50 values of 0.573, 0.158, 0.010 mM, respectively. The results of in vivo experiments also showed that benomyl, captan and chlorothalonil caused 15.25, 1.96, and 36.70% activity decreases after 24-h treatments compared to that of the control.

  3. Enhanced oxidation of benzo[a]pyrene by crude enzyme extracts produced during interspecific fungal interaction of Trametes versicolor and Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    Linbo Qian; Baoliang Chen

    2012-01-01

    The effects of interspecific fungal interactions between Trametes versicolor and Phanerochaete chrysosporium on laccase activity and enzymatic oxidation of polycyclic aromatic hydrocarbons (PAHs) were investigated.A deadlock between the two mycelia rather than replacement of one fungus by another was observed on an agar medium.The laccase activity in crude enzyme extracts from interaction zones reached a maximum after a 5-day incubation,which was significantly higher than that from regions of T.versicolor or P.chrysosporium alone.The enhanced induction of laccase activity lasted longer in half nutrition than in normal nutrition.A higher potential to oxidize benzo[a]pyrene by a crude enzyme preparation extracted from the interaction zones was demonstrated.After a 48 hr incubation period,the oxidation of benzo[a]pyrene by crude enzyme extracts from interaction zones reached 26.2%,while only 9.5% of benzo[a]pyrene was oxidized by crude extracts from T.versicolor.The oxidation was promoted by the co-oxidant 2,2'-azinobis-3-ethylbenzthiazoline-6-sulphonate diammonium salt (ABTS).These findings indicate that the application of co-culturing of white-rot fungi in bioremediation is a potential ameliorating technique for the restoration of PAH-contaminated soil.

  4. Involvement of a new enzyme, glyoxal oxidase, in extracellular H/sub 2/O/sub 2/ production by Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Kersten, P.J.; Kirk, K.

    1987-05-01

    The importance of extracellular H/sub 2/O/sub 2/ in lignin degradation has become increasingly apparent with the recent discovery of H/sub 2/O/sub 2/-requiring ligninases produced by white-rot fungi. Here the authors describe a new H/sub 2/O/sub 2/-producing activity of Phanerochaete chrysosporium that involves extracellular oxidases able to use simple aldehyde, ..cap alpha..-hydroxycarbonyl, or..cap alpha..-dicarbonyl compounds as substrates. The activity is expressed during secondary metabolism, when the ligninases are also expressed. Analytical isoelectric focusing of the extracellular proteins, followed by activity staining, indicated that minor proteins with broad substrate specificities are responsible for the oxidase activity. Two of the oxidase substrates, glyoxal and methylglyoxal, were also identified, as their quinoxaline derivatives, in the culture fluid as secondary metabolites. The significance of these findings is discussed with respect to lignin degradation and other proposed systems for H/sub 2/O/sub 2/ production in P. chrysosporium.

  5. A Ca-alginate particle co-immobilized with Phanerochaete chrysosporium cells and the combined cross-linked enzyme aggregates from Trametes versicolor.

    Science.gov (United States)

    Li, Yanchun; Wang, Zhi; Xu, Xudong; Jin, Liqiang

    2015-12-01

    For improving stability of immobilized white-rot fungus to treat various effluents, Phanerochaete chrysosporium cells and the combined cross-link enzyme aggregates (combi-CLEAs) prepared from Trametes versicolor were co-immobilized into the Ca-alginate gel particles in this paper. The activity yields of obtained combi-CLEAs were 42.7% for lignin peroxidases (LiPs), 31.4% for manganese peroxidases (MnPs) and 40.4% for laccase (Lac), respectively. And their specific activities were 30.2U/g as combi-CLEAs-LiPs, 9.5 U/g as combi-CLEAs-MnPs and 28.4 U/g as combi-CLEAs-Lac. Further, the present of the combi-CLEAs in the particles extremely improved their ability to degrade the dyes. Compared to the immobilized Ph. chrysosporium without the combi-CLEAs, the co-immobilized particles enhanced the decolorized rate of Acid Violet 7 (from 45.2% to 93.4%) and Basic Fuchsin (from 12.1% to 67.9%). In addition, the addition of the combi-CLEAs improved the adaptability of the white-rot fungal particles to adverse environmental conditions. PMID:26413897

  6. Catabolic fate of Streptomyces viridosporus T7A-Produced, acid precipitable polymeric lignin upon incubation with ligninolytic Streptomyces species and Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Degradation of ground and hot-water-extracted corn stover (Zea mays) lignocellulose by Streptomyces viridosporus T7A generates a water-soluble lignin degradation intermediate termed acid-precipitable polymeric lignin (APPL). The further catabolism of T7A-APPL by S. viridosporus T7A, S. badius 252, and S. setonii75Vi2 was followed for 3 weeks. APPL catabolism by Phanerochaete chrysosporium was followed in stationary cultures in a low-nitrogen medium containing 1% (wt/vol) glucose and 0.05% (wt/vol) T7A-APPL. Metabolism of the APPL was followed by turbidometric assay (600 nm) and by direct measurement of APPL recoverable from the medium. Accumulation and disappearance of soluble low-molecular-weight products of APPL catabolism were followed by gas-liquid chromatography and by high-pressure liquid chromatography, utilizing a diode array detector. Mineralization of a [14C-lignin]APPL was also followed. The percent 14C recovered as 14CO2, 14C-APPL, 14C-labeled water-soluble products, and cell mass-associated radioactivity, were determined for each microorganism after 1 and 3 weeks of incubation in bubbler tube cultures at 370C. P. chrysosporium evolved the most 14CO2, and S. viridosporus gave the greatest decrease in recoverable 14C-APPL. The results show that S. badius was not able to significantly degrade the APPL, while the other microorganisms demonstrated various APPL-degrading abilities

  7. OPTIMASI BIOKRAFT JAMUR Phanerochaete chrysosporium TERHADAP KOMPONEN KIMIA CAMPURAN BATANG DAN LIMBAH CABANG MANGIUM SEBAGAI BAHAN BAKU PULP

    Directory of Open Access Journals (Sweden)

    Devi Silsia

    2010-11-01

    Full Text Available Optimation biokraft of fungi P. Chrysosporium through elongated incubation time on mixed stem and branch waste mangium is a solution to solve the environmental pollution problem, low quality of pulp and limited raw material. Effect of P. Chrysosporium 10 % concentration and 45 days incubation time on pre research could not decrease lignin optimally and exstractive degradation had not occured yet. The aims of the study were to observe the effect of incubation time extension, and to determine the best incubation time of P. Chrysosporium applied at 10 % concentration based on the chemical component percentage, 45, 60 and 75 days on mixed stem and branch as raw material for pulp. Results showed that increasing incubation time decreased extractive and lignin content and increased holocelulosa and alpha celulosa content. Mixed stem and branch with 10% amount and 75 day incubation time of P. Chrysosporium gave the best results for raw material of pulp.

  8. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    International Nuclear Information System (INIS)

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag+ and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag+ to AgNPs

  9. Variation of peroxidase isoenzyme and biofilm of Phanerochaete chrysosporium in continuous membrane bioreactor for Reactive Brilliant Red X3-B treatment

    Institute of Scientific and Technical Information of China (English)

    GAO Shang; CHEN Cheng; TAO Fang; HUANG Minsheng; MA Lihua; WANG Zhonghua; WU Linhui

    2009-01-01

    The influence of a Reactive Brilliant Red X-3B (RBR X-3B) dye on the peroxidase isoenzyme of Phanerochaete chrysosporium was determined, and the biofilm structure in a white rot fungal continuous membrane bioreactor (MBR) was also investigated by scanning electron microscope (SEM). The variation of peroxidase isoenzyme and the decolorization rate in the continuous MBR were evaluated. The results showed that the 100 mg/L RBR X-3B could stimulate the production of the peroxidase isoenzyme in the shaking-flask culture. In addition, two new peroxidase isoenzyme bands with relative mobility (Rf) value of 0.27 and 0.28 appeared, but the activity was lower than the blank control of 11 d. In the continuous MBR, the system worked stably during the first 60 d, the main peroxidase isoenzyme bands existed and three new bands with Rf value of 0.10, 0.27, and 0.28 appeared. Meanwhile, the biofilm grew well and the average decolorization rate could reach 90.6%. But the bands of peroxidase isoenzyme decreased rapidly at day 65, only two bands with Rf value 0.24 and 0.26 existed, and the decolorization rate decreased to 78.3%. Therefore, 5 bottles of P. chrysosporium mycelial pellet were added into the MBR, and then the activity of the peroxidase isoenzyme and the decolorization rate had a slight recovery. Finally, the decolorization rate finally decreased to 75.2%. These results contribute to a comprehensive understanding of the variation of peroxidase isoenzyme and biofilm in continuous MBR by white rot fungi.

  10. Transport, fate, and stimulating impact of silver nanoparticles on the removal of Cd(II) by Phanerochaete chrysosporium in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Zuo, Yanan [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li, Zhongwu; Yan, Ming [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Guo, Zhi; Huang, Zhenzhen; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2015-03-21

    Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag{sup +} and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag{sup +} to AgNPs.

  11. Azo dye degradation by Phanerochaete chrysosporium in the medium enriched with nitrogen in the presence of primary co-substrate

    OpenAIRE

    Marcus Vinicius Freire Andrade; Karla Mayara Lima da Silva; João Paulo da Silva Siqueira; Carlos Ronald Pessoa Wanderley; Rinaldo dos Santos Araújo; Gloria Marinho; Kelly Rodrigues

    2013-01-01

    This work sought to evaluate the ability of fungi Phanerochaete chryosporium to degrade congo red azo dye in batch reactor, evaluate the influence of glucose and wheat bran as co-substrates on the removal of the dye in the medium and investigate the influence of ammonium chloride, ammonium nitrate and ammonium sulfate as the inorganic nitrogen source for the process. Wheat bran was not effective satisfactorily for the removal of dye and organic matter had no desired effect for the removal of ...

  12. The putative endoglucanase PcGH61D from Phanerochaete chrysosporium is a metal-dependent oxidative enzyme that cleaves cellulose.

    Directory of Open Access Journals (Sweden)

    Bjørge Westereng

    Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.

  13. Decolorization of mixtures of different reactive textile dyes by the white-rot basidiomycete Phanerochaete sordida and inhibitory effect of polyvinyl alcohol.

    Science.gov (United States)

    Harazono, Koichi; Nakamura, Kazunori

    2005-03-01

    We tried to decolorize mixtures of four reactive textile dyes, including azo and anthraquinone dyes, by a white-rot basidiomycete Phanerochaete sordida. P. sordida decolorized dye mixtures (200 mg l-1 each) by 90% within 48 h in nitrogen-limited glucose-ammonium media. Decolorization of dye mixtures needed Mn2+ and Tween 80 in the media. Manganese peroxidase (MnP) played a major role in dye decolorization by P. sordida. Decolorization of dye mixtures by P. sordida was partially inhibited by polyvinyl alcohol (PVA) that wastewaters from textile industries often contain. This was caused by an inhibitory effect of PVA on the decolorization of Reactive Red 120 (RR120) with MnP reaction system. Second addition of Tween 80 to the reaction mixtures in the presence of PVA improved the decolorization of RR120. These results suggest that PVA could interfere with lipid peroxidation or subsequent attack to the dye.

  14. Biopulping of lignocarbohydrates residues of cymbopogon martini with phanerochaete chrysosporium: An approach towards energy conservation and waste utilization

    Energy Technology Data Exchange (ETDEWEB)

    Tyagi, C. H.; Dharm, D.; Upadhyaya, J. S.; Upadhyay, A. K.; Garg, A. P. (Department of Paper Technology, Indian Institute of Technology Roorkee, Saharanpur (India))

    2007-07-01

    Lignocarbohydrates residue of Cymboogon martini (Palma rosa grass), cultivated for palma rosa oil, is used for land filling after steam distillation which creates environmental problems. This hitherto unexploited source of lignocarbohydrates biomass can successfully be used for the production of chemical grade pulp by soda and bio soda, alkali 02 and bio alkali 02 pulping processes. Lignocarbohydrates residue left after steam distillation was treated with P. chrysosporium at optimum conditions which degrades lignin, pentosan and holocellulose to 30.11, 62.25 and 18.60% respectively of the original composition of lignocarbohydrates residues of C. martini. Lignocellulosic residues of C. martini produces 44.73 % pulp yield with 22.12 kappa number at H factor 553.21, maximum cooking time 3 hours, maximum cooking temp 150 deg C, alkali dose 14 % (as Na{sub 2}0) and liquor to wood ratio of 5:1. The addition of 0.1 % AQ improves pulp yield by 0.72 % and reduces kappa number by 1.12 units. The 02 pressure 5 kg/cm2 improves pulp yield by 1.07 % and reduces kappa number by 1.65 units. The bio soda and bio alkali 02 pulping processes requires 11 % active alkali doses to get the same kappa number as for soda and alkali 02 pulps with a chemical saving of 3%. (orig.)

  15. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  16. Degradation of azo dyes by the lignin-degrading fungus Phaerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Spadaro, J.T.; Gold, M.H.; Renganathan, V. (Oregon Graduate Inst. of Science and Technology, Beaverton (United States))

    1992-08-01

    Under nitrogen-limiting, secondary metabolic conditions, the white rat basidiomycete Phanerochaete chrysosporium extensively mineralized the specifically [sup 14]C-ring-labeled azo dyes 4-phenylazophenol, 4-phenylazo-2-methoxyphenol, Disperse Yellow 3 [2-(4[prime]-acetamidophenylaso)-4-methylphenol], 4-phenylazoaniline, N,N-dimethyl-4-phenylazoaniline, Disperse Orange 3 [4-(4[prime]-nitrophenylazo)-aniline], and Solvent Yellow 14 (1-phenylazo-2-naphthol). Twelve days after addition to cultures, the dyes had been mineralized 23.1 to 48.1%. Aromatic rings with substituents such as hydroxyl, amino, acetamido, or nitro functions were mineralized to a greater extent than unsubstituted rings. Most of the dyes were degraded extensively only under nitrogen-limiting, ligninolytic conditions. However, 4-phenylazo-[U-[sup 14]C] phenol and 4-phenylazo-[U-[sup 14]C] 2-methoxyphenol were mineralized to a lesser extent under nitrogen-sufficient, nonligninolytic conditions as well. These results suggest that P. chrysosporium has potential applications for the cleanup of textile mill effluents and for the bioremediation of dye-contaminated soil.

  17. BIODEGRADATION OF ENVIRONMENTAL POLLUTANTS BY THE WHITE ROT FUNGUS PHANEROCHATETE CHRYSOSPORIUM: INVOLVEMENT OF THE LIGNIN DEGRADING SYSTEM

    Science.gov (United States)

    The white-rot fungus Phanerochaete chrysosporium has the ability to degrade's wide variety of structurally diverse organic compounds, including a number of environmentall3 persistent organopollutants. he unique biodegradative abilities of this fungus appears to be dependent upon ...

  18. 黄孢原毛平革菌合成的木质素过氧化物酶、锰过氧化物酶及其菌球在染料脱色过程中的作用%Roles of Lignin Peroxidase, Manganese Peroxidase and Pellet of Phanerochaete chrysosporium in Decoloration of Dyes

    Institute of Scientific and Technical Information of China (English)

    章燕芳; 李华钟; 华兆哲; 陈坚

    2002-01-01

    在黄孢原毛平革菌(Phanerochaete chrysosporium)限氮浸没式培养中,获得了含木质素过氧化物酶(LiP)和锰过氧化物酶(MnP)、只含LiP或MnP以及无LiP和MnP的4种培养物,考察了LiP,MnP及菌球在染料脱色过程中的作用. 结果表明,4种培养物对6种染料都有明显的脱色效果,甲基橙、橙I、次甲基蓝脱色率在90(左右,刚果红、直接湖蓝脱色率在80%左右,结晶紫脱色率在60%左右. 无酶情况下染料的脱色主要是菌球的吸附,有酶情况下染料的脱色主要是酶的降解. 菌球在脱色过程中除了吸附染料外,还起到提供H2O2和藜芦醇的作用,促进了染料的降解.

  19. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi.

    Science.gov (United States)

    Riley, Robert; Salamov, Asaf A; Brown, Daren W; Nagy, Laszlo G; Floudas, Dimitrios; Held, Benjamin W; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika A; Sun, Hui; LaButti, Kurt M; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E; Pisabarro, Antonio G; Walton, Jonathan D; Blanchette, Robert A; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David S; Grigoriev, Igor V

    2014-07-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white-rot/brown-rot classification paradigm, we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically informed principal-components analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white-rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown-rot fungi. Our results suggest a continuum rather than a dichotomy between the white-rot and brown-rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay. PMID:24958869

  20. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  1. Improving xylitol production through recombinant expression of xylose reductase in the white-rot fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Hirabayashi, Sho; Wang, Jianqiao; Kawagishi, Hirokazu; Hirai, Hirofumi

    2015-07-01

    We generated an expression construct consisting of the xylose reductase (XR) gene (xr) from Phanerochaete chrysosporium. Transformant X7 exhibited increased xylitol production and markedly higher XR activities than the wild-type strain. RT-PCR analysis demonstrated that the increased XR activity was associated with constant expression of the recombinant xr gene. PMID:25547244

  2. Biodegradation of bioaccessible textile azo dyes by Phanerochaete chrysosporium

    OpenAIRE

    Martins, Maria Adosinda; Ferreira, Isabel C.F.R.; Santos, Isabel; Queiroz, Maria João R. P.; Lima, Nelson

    2000-01-01

    Azo dyes are important chemical pollutants of industrial origin. Textile azo dyes with bioaccessible groups for lignin degrading fungi, such as 2-methoxyphenol (guaiacol) and 2,6-dimethoxyphenol (syringol), were synthesised using different aminobenzoic and aminosulphonic acids as diazo components. The inocula of the best biodegradation assays were obtained from a pre-growth medium (PAM), containing one of the synthesised dyes. The results of the dye biodegradation assays were eval...

  3. Biodegradation of Degradable Plastic Polyethylene by Phanerochaete and Streptomyces Species †

    OpenAIRE

    Lee, Byungtae; Pometto, Anthony L.; Fratzke, Alfred; Bailey, Theodore B.

    1991-01-01

    The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placin...

  4. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  5. Biodegradation of Gaseous Chlorobenzene by White-rot Fungus Phanerochaete chrysosporiurn

    Institute of Scientific and Technical Information of China (English)

    CAN WANG; JIN-YING XI; HONG-YING HU; XIANG-HUA WEN

    2008-01-01

    To evaluate the effect of white rot fungus Phanerochaete chrysosporium on removal of gaseous chlorobenzene.Methods Fungal mycelium mixed with a liquid medium was placed into airtight bottles.A certain amount of chlorobenzene was injected into the headspace of the bottles under different conditions.At a certain interval,the concentrations in the headspace were analyzed to evaluate the degradation of chlorohenzene by P.chtysosporium.Results The degradation effects of P chrysosporium on chlorobenzene under different conditions were investigated.The difference in the optimum temperature for the growth of the fungi and chlorobenzene degradation was observed.The data indicated that a lower temperature (28℃) would promote the degradation of chlorobenzene than the optimum temperature for the growth of the fungi (37℃).A low nitrogen source concentration (30 mg N/L) had a better effect on degrading chlorohenzene than a high nitrogen source concentration (higher than 100 mg N/L).A high initial concentration (over 1100 mg/m3) of chlorobenzene showed an inhibiting effect on degradation by P.chrysosporium.A maximum removal efficiency of 95% was achieved at the initial concentration of 550 mg/m3.Conclusion P.chrysosporium has a rather good ability to remove gaseous chlorobenzene.A low nitrogen source concentration and a low temperature promote the removal of chlorohenzene by P.chrysosporium.However,a high initial chlorobenzene concentration can inhibit chlorobenzene degradation.

  6. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  7. Sorption of heavy metals by four basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dey, S. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Rao, P.R.N. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India); Bhattacharyya, B.C. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Bandyopadhyay, M. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India)

    1995-04-01

    Biosorptions of Pb{sup 2+}, Cr{sup 6+}, Cd{sup 2+} and Ni{sup 2+} were investigated, with special emphasis on the first one, using live and dead fungal mycelia. Of the four fungi, namely Polyporus ostreiformis, Volvariella volvacea, Pleurotus sajor-caju and Phanerochaete chrysosporium, the last one was found to be most effective in Pb{sup 2+} removal. Total biosorption was effected in 6 days up to the Pb{sup 2+} concentration of 6 mg/l, with a specific uptake of 1.33 mg Pb{sup 2+}/g dry cell mass. The removal of other three metals varied between 28.8-73.3% from a medium containing 4 mg/l of each of the metals. (orig.)

  8. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    Directory of Open Access Journals (Sweden)

    García Torres Angélica María

    2003-06-01

    Full Text Available La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de éstas es de gran importancia para la degradación de diversas sus­tancias recalcitrantes que muestran similitudes estructurales con la lignina como son los PAH's, PCB's, DDT, colo­rantes azoicos, etc. El trabajo de investigación se realizó utilizando reactores a nivel de matraces y teniendo como sustrato siete diferentes desechos agroindustriales de la región de Santander ( de los cuales se desconoce su pro­ducción de enzimas lignolíticas: tuza de mazorca, bagazo de caña, hoja de pina, cacota de cacao, cereza de café, tamo de arroz, salvado de trigo y paja de trigo. El objetivo general fue evaluar la capacidad de los Basidiomycetes: Trametes versicolor, Pleurotus floridae y Phanerochaete chrysosporium de crecer sobre los desechos agroindustriales y producir las enzimas lignolíticas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; mediante la técnica de fermentación sólida. Se encontró que la producción de enzimas lignolíticas en los sustratos mencionados fue sensible a la concentración de azúcares reductores, condiciones de pH, contenidos de humedad y, dependiente del tipo de inductor presente en el medio de cultivo. El sustrato que presentó una mejor producción de Lacasa y Manganeso-peroxidasa fue la paja de trigo. Se observó la producción de Lignina-peroxidasa en cultivos de tuza de mazorca y salvado de trigo. Palabras clave: enzimas inducibles; Lacasa; Mn-peroxidasa; Li-peroxidasa; desechos agroindustriales; represi

  9. Mineralization of sulfonated azo dyes and sulfanilic acid by Phanerochaete chrysosporium and Streptomyces chromofuscus.

    OpenAIRE

    Paszczynski, A; Pasti-Grigsby, M B; Goszczynski, S; Crawford, R L; Crawford, D. L.

    1992-01-01

    Five 14C-radiolabeled azo dyes and sulfanilic acid were synthesized and used to examine the relationship between dye substitution patterns and biodegradability (mineralization to CO2) by a white-rot fungus and an actinomycete. 4-Amino-[U-14C]benzenesulfonic acid and 4-(3-sulfo-4-aminophenylazo)-[U-14C]benzenesulfonic acid were used as representative compounds having sulfo groups or both sulfo and azo groups. Such compounds are not known to be present in the biosphere as natural products. The ...

  10. Activity Regulation of Lignin Peroxidase from Phanerochaete chrysosporium in Nonionic Reversed Micellar Medium

    Institute of Scientific and Technical Information of China (English)

    Dan WANG; Xi Rong HUANG; Cai Xia LIU; Yue Zhong LI; Yin Bo QU; Pei Ji GAO

    2005-01-01

    The activity of lignin peroxidase (LiP) in reversed micelles of polyoxyethylene lauryl ether (Brij30) changed with the molar ratio of water to the surfactant and the denaturant concentration of guanidinium chloride. At low water contents the activity of LiP could be enhanced by the denaturant at moderate concentration. This phenomenon, together with the spectral characteristics of the intrinsic fluorescence of LiP, suggested that the conformation of the active center of LiP was flexible.

  11. Biodegradation of degradable plastic polyethylene by phanerochaete and streptomyces species.

    Science.gov (United States)

    Lee, B; Pometto, A L; Fratzke, A; Bailey, T B

    1991-03-01

    The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placing a sheet of plastic into a drying oven at 70 degrees C under atmospheric pressure and air for 0, 4, 8, 12, 16, or 20 days. The effect of 2-, 4-, and 8-week longwave UV irradiation at 365 nm on plastic biodegradability was also investigated. For shake flask cultures, plastics were chemically disinfected and incubated-shaken at 125 rpm at 37 degrees C in 0.6% yeast extract medium (pH 7.1) for Streptomyces spp. and at 30 degrees C for the fungus in 3% malt extract medium (pH 4.5) for 4 weeks along with an uninoculated control for each treatment. Weight loss data were inconclusive because of cell mass accumulation. For almost every 70 degrees C heat-treated film, the Streptomyces spp. demonstrated a further reduction in percent elongation and polyethylene molecular weight average when compared with the corresponding uninoculated control. Significant (P degradation by the fungus was observed. To our knowledge, this is the first report demonstrating bacterial degradation of these oxidized polyethylenes in pure culture. PMID:16348434

  12. A series of Xerophilic Chrysosporium species

    DEFF Research Database (Denmark)

    Skou, Jens-Peder

    1992-01-01

    Xerophilic Chrysosporium species related to C. farinicola were often isolated from uneaten provisions (pollen-and-nectar mixture) of mason bees (Osmia spp.). The fungi have an optimal growth rate on media which are 2 to 3 molar in regard to glucose, exhibit some growth up to 3.6 molar glucose, an......, and initiate a new increased growth rate when the glucose crystallizes out from these supersaturated media. Seven of these species and three varieties are described and separated into a Farinicola series of Chrysosporium species....

  13. Plant-polysaccharide-degrading enzymes from basidiomycetes

    NARCIS (Netherlands)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P; Mäkelä, Miia R; van den Brink, J.

    2014-01-01

    SUMMARY: Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-poly

  14. Primary Cutaneous Chrysosporium Infection following Ear Piercing: A Case Report

    Directory of Open Access Journals (Sweden)

    Poonkiat Suchonwanit

    2015-07-01

    Full Text Available Chrysosporium is a large genus of saprophytic fungi that is commonly found in the soil. Infection caused by this organism is rare in humans and typically occurs in immunocompromised patients. Primary cutaneous Chrysosporium infection is relatively rare and has been reported in a heart transplant patient. The prognosis is usually favorable, but very poor in the setting of persistent profound immunosuppression. We herein report a case of primary cutaneous Chrysosporium infection following ear piercing in an immunocompetent patient. It is important for clinicians to consider this condition in patients with slow-onset skin and soft tissue infection following cutaneous injury, even in an immunocompetent setting.

  15. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  16. Decolourization potential of white-rot fungus Phanerochaete chrysosporium on synthetic dye bath effluent containing Amido black 10B

    OpenAIRE

    Senthilkumar, S.; M. Perumalsamy; H. Janardhana Prabhu

    2014-01-01

    Synthetic azo dyes are extensively used in textile industry and are not easily degraded into the environment due to their complex structure. Due to the low degree of fixation of these dyes to fabrics, more than 10–15% of the dye does not bind to fabrics during colour processing and release into water bodies as effluent cause serious environmental pollution. White-rot fungus is found to be capable of degrading lignin which has a complex structure similar to azo dyes. In this study, the decolou...

  17. Oxidation-reduction potentials and ionization states of extracellular peroxidases from the lignin-degrading fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    The oxidation-reduction potentials of lignin peroxidase isozymes H1, H2, H8, and H10 as well as the Mn-dependent peroxidase isozymes H3 and H4 are reported. The potentiometric titrations involving the ferrous and ferric states of the enzyme had Nernst plots indicating single-electron transfer. The Em7 values of lignin peroxidase isozymes H1, H2, H8, and H10 are -142, -135, -137, and -127 mV versus standard hydrogen electrode, respectively. The Em7 values for the Mn-dependent peroxidase isozymes H3 and H4 are -88 and -93 mV versus standard hydrogen electrode, respectively. The midpoint potential of H1, H8, and H4 remained unchanged in the presence of their respective substrates, veratryl alcohol and Mn(II). The midpoint potential between the ferric and ferrous forms of isozymes H1 and H4 exhibited a pH-dependent change between pH 3.5 and pH 6.5. These results indicate that the reductive half-reaction of the enzymes is the following: ferric peroxidase + le- + H+----ferrous peroxidase. Above pH 6.5, the effect of pH on the midpoint potential is diminished and indicates that an ionization with an apparent pKa equal to approximately 6.6-6.7 occurs in the reduced form of the enzymes. A heme-linked ionization group in the ferrous form of the enzymes was confirmed by studying the effect of pH on the absorption spectra of isozymes H1 and H4. These spectrophotometric pH titration experiments confirmed the electrochemical results indicating pKa values of 6.59 and 6.69 for reduced isozymes H1 and H4, respectively. These results indicate the presence of a heme-linked ionization of an amino acid in the reduced form of the lignin peroxidase isozymes similar to that of other plant peroxidases

  18. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  19. Comparison of different cellulolytic fungi for bioconversion of apple distillery waste

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, J.; Cimerman, A.; Perdih, A.

    1986-08-01

    The suitability of three ascomycetous fungi, Aspergillus niger, A. awamori and Trichoderma reesei, as well as two basidiomycetes, Pleurotus ostreatus and Phanerochaete chrysosporium, for bioconversion of apple distillery slop was compared. Trichoderma and Phanerochaete degraded raw fibres by 20%, producing filter cakes with 17% to 22% raw protein contents. Aspergillus spp. were superior in filtration time and COD reduction and were of the same efficiency in protein synthesis as Trichoderma and Phanerochaete, but did not degrade fibres. Pleurotus ostreatus did not degrade lignin under fermentation conditions used and could not compete with other fungi due to its slower growth.

  20. [Basidiomycetes: A new source of secondary metabolites.].

    Science.gov (United States)

    Brizuela, M A; García, L; Pérez, L; Mansur, M

    1998-06-01

    The area of natural products research is the most rapidly growing field of organic chemistry, due to the great technical developments in the isolation and identification techniques. Today, near to one million natural products -isolated from the most diverse living things- are known. Microorganisms are among the least-studied of these. Nevertheless, they offer large possibilities for the discovery of new structures and biological activities. Among the microorganisms, the Basidiomycetes present a production capacity and a range of biologically active metabolites, which have scarcely been investigated. The wide spectrum of natural products with biological activity produced by Basidiomycetes includes antimicrobial agents, antifungal, antiviral and cytotoxic activities, enzymes, plant growth regulators and flavors. These metabolites are generally grouped by their chemical origin, and the relationship between chemical structure and the different biological activities reported. The main objective of this review is to bring an updated revision of the numerous and interesting biosynthetic pathways from basidiomycetes.

  1. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  2. Effects of Homologous Expression of 1,4-Benzoquinone Reductase and Homogentisate 1,2-Dioxygenase Genes on Wood Decay in Hyper-Lignin-Degrading Fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Mori, Toshio; Koyama, Genki; Kawagishi, Hirokazu; Hirai, Hirofumi

    2016-10-01

    We investigated the function of 1,4-benzoquinone reductase (BQR)- and homogentisate 1,2-dioxygenase (HGD)-like genes in wood degradation by Phanerochaete sordida YK-624, which exhibits high ligninolytic activity and selectivity. We determined homologous expression in the genomic and cDNA sequences of BQR- and HGD-like genes in P. sordida YK-624 (PsBQR and PsHGD). Both genes shared high homology (≥90 % amino acid sequence similarity) with the corresponding genes in Phanerochaete chrysosporium. These genes were co-transformed with a reporter gene into an uracil auxotrophic mutant of P. sordida YK-624. The PsBQR and PsHGD co-transformants exhibited lower holocellulolytic activity and higher ligninolytic selectivity than the control transformants. In liquid culture with vanillin, both co-transformants significantly accelerated vanillin degradation. Thus, we suggest that the rapid metabolism of low-molecular weight lignin fragments, due to the homologous expression of BQR- and HGD-like genes, affects quinone redox cycling to produce hydroxyl radicals, thereby decreasing holocellulose degradation and increasing ligninolytic selectivity. PMID:27363425

  3. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2

  4. Cryopreservation of basidiomycete strains using perlite.

    Science.gov (United States)

    Homolka, L; Lisá, L; Eichlerová, I; Nerud, F

    2001-12-01

    A new alternative method using perlite as a particulate solid carrier in the growth medium with a cryoprotectant was successfully tested for cryopreservation of several basidiomycete species from different genera (Armillaria, Pleurotus, Pluteus, Polyporus) which failed to survive or retain their properties in cryopreservation procedures routinely used in our laboratory. Frozen basidiomycete strains were kept in cryovials submerged in liquid nitrogen and were either immediately after the freezing process or after a 6-month storage thawed and checked for viability, purity and changes in growth, morphology and biochemical characteristics. All cultures survived the cryopreservation procedure and no negative effects of cryopreservation by this method have been observed after 6 months of storage in liquid nitrogen.

  5. Fatal cutaneous mycosis in tentacled snakes caused by the chrysosporium anamorph of nannizziposis vriesii

    DEFF Research Database (Denmark)

    Bertelsen, Mads Frost; Crawshaw, Graham J.; Sigler, Lynne;

    2005-01-01

    The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes......The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes...

  6. [Morphology and structural peculiarities of Basidiomycetes pathogens].

    Science.gov (United States)

    Boĭko, O A; Shevchenko, T P; Boĭko, A A

    2013-01-01

    The materials of studies of morphology and structural peculiarities of viruses, fungi and bacteria, which affect Basidiomycetes under biotechnology process and nature biocenosis conditions are given. The analysis of infection development in button mushroom (Agaricus bisporus) (J.Lge) Imbach and in oyster mushroom (Pleurotus ostreatus Kumm.), which served as model objects in the experiments of various levels of complexity has been carried out. Other kinds of edible and medicinal mushrooms, which were a source of biochemical fractions to form biologicals were investigated. PMID:23866587

  7. Degradation of cellulose by basidiomycetous fungi.

    Science.gov (United States)

    Baldrian, Petr; Valásková, Vendula

    2008-05-01

    Cellulose is the main polymeric component of the plant cell wall, the most abundant polysaccharide on Earth, and an important renewable resource. Basidiomycetous fungi belong to its most potent degraders because many species grow on dead wood or litter, in environment rich in cellulose. Fungal cellulolytic systems differ from the complex cellulolytic systems of bacteria. For the degradation of cellulose, basidiomycetes utilize a set of hydrolytic enzymes typically composed of endoglucanase, cellobiohydrolase and beta-glucosidase. In some species, the absence of cellobiohydrolase is substituted by the production of processive endoglucanases combining the properties of both of these enzymes. In addition, systems producing hydroxyl radicals based on cellobiose dehydrogenase, quinone redox cycling or glycopeptide-based Fenton reaction are involved in the degradation of several plant cell wall components, including cellulose. The complete cellulolytic complex used by a single fungal species is typically composed of more than one of the above mechanisms that contribute to the utilization of cellulose as a source of carbon or energy or degrade it to ensure fast substrate colonization. The efficiency and regulation of cellulose degradation differs among wood-rotting, litter-decomposing, mycorrhizal or plant pathogenic fungi and yeasts due to the different roles of cellulose degradation in the physiology and ecology of the individual groups. PMID:18371173

  8. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  9. PRODUCTION OF EXTRACELLULAR KERATINASE BY CHRYSOSPORIUM TROPICUM AND TRICHOPHYTON AJELLOI

    Directory of Open Access Journals (Sweden)

    Jaroslava Kačinová

    2014-02-01

    Full Text Available Keratinous wastes constitute a troublesome environmental contaminant that is produced in large quantities in companies processing of poultry and their further use has ecological significance. We can use for degradation of keratinous wastes enzymes or strains, which produce these enzymes. The aim of this study was isolation of keratinophilic fungi from the soil samples and optimalization of culture conditions of keratinase producing strains in vitro. For the isolation of our strains, we used hair - baiting method. From the all isolated strains, we used for other screening Chrysosporium tropicum (JK39 and Trichophyton ajelloi (JK82. Production of keratinase we monitored with different time of cultivation (7th, 14th, 21th days, sources of carbon (glucose, fructose, mannitol, sucrose, concentration of carbon sources (1%, 2% and cultivation temperature (20, 25, 30, 37ºC. Keratinase production was studied in a liquid medium containing chicken feathers as a source of keratin. We recorded the maximum production of keratinase (10.51 KU/ml by Chrysosporium tropicum on 21th day of incubation with 1% glucose at 25ºC.

  10. Survey of Basidiomycets and Insect Infested Roadside Trees

    OpenAIRE

    Oga, Shoji; Nomura, Shuhei; Inoue, Susumu

    1995-01-01

    Some biotic and abiotic factors causal to the deterioration of roadside trees were surveyed in Fukuoka City on 23 species planted along 22 main streets. Various fruit bodies of basidiomycete, imperfect fungi and bacterial canker disease as well as insect pests were detected. Forty-six fungi strains were obtained in this survey. Aphyllophorales basidiomycete was the most abundant fungi found in surveyed raodside trees. Fruit bodies of 7 edible mushroom species were identified on the scaffold l...

  11. Penggunaan Bungkil Inti Sawit Fermentasi (Phanerochaete chrysosporium) dan Suplementasi Mineral Zn dalam Ransum terhadap Performans Broiler Umur 0-6 Minggu

    OpenAIRE

    Afrianti, Eva Rustina

    2011-01-01

    This research conducted in Biological Veterinary Laboratory of Animal Husbandry Departement, Faculty of Agriculture North Sumatra University, Prof A. Sofyan no 3 Medan, at December 2009 until January 2010. The experiment objective to know the usage palm kernel cake fermentation and supplementation of mineral Zincum in some levels in feed to feed consumption, increase average weight gain, and feed conversion ratio broiler 0-6 weeks of age. This research was using factorial complete...

  12. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described. PMID:19341364

  13. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  14. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  15. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  16. FIELD EVALUATION OF THE LIGNIN-DEGRADING FUNGUS PHANEROCHAETE SORDIDA TO TREAT CREOSOTE-CONTAMINATED SOIL

    Science.gov (United States)

    A field study to determine the ability of selected lignin-degrading fungi to remediate soil contaminated with creosote was performed at a wood-treating facility in south central Mississippi in the autumn of 1991. The effects of solid-phase bioremediation with Phanerochaete sordid...

  17. Mode of action of Chrysosporium lucknowense C1 a-l-arabinohydrolases

    NARCIS (Netherlands)

    Kuhnel, S.; Westphal, Y.; Hinz, S.W.A.; Schols, H.A.; Gruppen, H.

    2011-01-01

    The mode of action of four Chrysosporium lucknowense C1 a-l-arabinohydrolases was determined to enable controlled and effective degradation of arabinan. The active site of endoarabinanase Abn1 has at least six subsites, of which the subsites -1 to +2 have to be occupied for hydrolysis. Abn1 was able

  18. Chemical constituents from fruiting bodies of Basidiomycete Perenniporia subacida.

    Science.gov (United States)

    Wen, Chun-Nan; Hu, Dong-Bao; Bai, Xue; Wang, Fang; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2016-03-01

    Four new aromatic abietane diterpenoids and two new benzene derivatives, namely perenacidins A-F (1-6), have been isolated from the fruiting bodies of Basidiomycete Perenniporia subacida. The structures were elucidated by means of extensive spectroscopic methods and computational ECD method. The antifungal activities against Canidia albicans and the cytotoxic activities against four cancer cell lines (including K-562, A-549, SMMC-7721, MCF-7) were evaluated in vitro. PMID:26779942

  19. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-12-01

    Full Text Available ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP, which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need of eco-efficient solutions for its colored effluents. White rot basidiomycetous fungi comprise the only group of organisms known to completely degrade lignin. Ligninolytic enzymes have potential applications in a large number of fields, including the chemical, fuel, food, agricultural, paper, textile, cosmetic industrial sectors and more. This ligninolytic system of white-rot fungi is also directly involved in the degradation of various xenobiotic compounds apart from textile dyes. Their capacities to remove xenobiotic substances make them a useful tool for bioremediation purposes. This paper reviews involvement of ligninolytic enzymes of white rot basidiomycetes in the degradation of textiles dyes and xenobiotic compounds for their industrial and biotechnological applications.

  20. BIODEGRADATION OF ENVIRONMENTAL POLLUTANTS BY THE WHITE ROT FUNGUS PHANEROCHAETE CHRYSOPORIUM: INVOLVEMENT OF THE LIGNIN DEGRADING SYSTEM

    Science.gov (United States)

    The white-rot fungus Phanrochaete chrysosporium has the ability to degrade a wide variety of structurally diverse organic compounds, including a number of environmentally persistent organopollutants. The unique biodegradative abilities of this fungus appears to be depend...

  1. Development of novel fermentation systems for the production of nonalcoholic beverages with basidiomycetes

    OpenAIRE

    Zhang, Yanyan

    2015-01-01

    Basidiomycetes represent the highest developed class of fungi. They are able to synthesize pharmacological relevant secondary metabolites, natural flavor compounds, and highly sought after enzymes. Because of their biochemical potential, basidiomycetes are ideal tools for the food industry. With the recent worldwide declining consumption of beer, breweries are eagerly searching for innovative nonalcoholic fermented beverages to compensate for this negative trend. Different from microorgan...

  2. Decolorization of reactive brilliant red K-2BP with the white- rot fungi under non-sterile conditions

    Institute of Scientific and Technical Information of China (English)

    GAO Dawen; WEN Xianghua; QIAN Yi

    2004-01-01

    @@ In recent years, many researches indicate that white rot fungus is a promising microbe in wastewater treatment. The basidiomycete Phanerochaete chrysosporium in white rot fungi is the most extensively studied and discussed[1]. The extracellular ligninolytic enzymes of white rot fungi have the ability to degrade a wide spectrum of recalcitrant organo-pollutants such as chlorinated phenols and various types of synthetic dyes because of their nonspecific characteristics[2-6]. And some significant mineralization (20%-48%) was observed during degradation of azo dyes[7].

  3. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    International Nuclear Information System (INIS)

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  4. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    Energy Technology Data Exchange (ETDEWEB)

    Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.

    2009-07-01

    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  5. BIOSORPTION OF TEXTILE DYE USING IMMOBILIZED BACTERIAL (PSEUDOMONAS AERUGINOSA AND FUNGAL (PHANEROCHATE CHRYSOSPORIUM CELLS

    Directory of Open Access Journals (Sweden)

    Natarajan Saravanan

    2013-01-01

    Full Text Available Wastewater containing dyes presents a serious problem due to its high toxicity which leads to creating enormous environmental pollution and ecological hazards. Therefore the removal of the high stable dyes from the textile effluents is of major importance. The purpose of this study is to remove the reactive dye Procion Blue 2G from textile dye solution by biosorption process using immobilized cells of Pseudomonas aeruginosa and Phanerochate chrysosporium. It was found that maximum dye uptake is 1.648 mg g-1 of bead for P. aeruginosa and it is 1.242 mg g-1 of bead for P. chrysosporium. Both the results are derived from higher initial dye concentration (100 mg L-1 and high cell concentration (in terms of volume of inoculum 20 mL and at low mass of biosorbent (5 g of bead. Comparatively better results are produced by the beads having the cells of P. aeruginosa than P. chrysosporium. Further, due to the cell immobilization, both the cell beads can be utilized repeatedly in continuous reactors by selecting suitable eluent in industrial scale with the advantage of avoiding wash out of cells.

  6. The biodegradation of Olive Oil Mill Wastewaters by Sawdust and by a Phanerochaetae chrysosporium

    Directory of Open Access Journals (Sweden)

    Gonzalez, J.

    2007-12-01

    Full Text Available This paper discusses decolorization and chemical oxygen demand (COD abatement in olive mill wastewaters (OMW by Phanerochaetae chrysosporium grown in static, stirred and immobilized cultures. When P. Chrysosporium is used in cultures, no decolorization of crude OMW is observed. Decolorization occurs only after the removal of polyphenols by adsorption in sawdust, which allows a 39% polyphenol removal. The use of a High lignin peroxides (Lip producing medium, yields the highest OMW decolorization and COD removal efficiencies. The use of P. Chrysosporium immobilized on polyurethane foam leads to significant abatements of OMW polluting characteristics. And COD abatement reached 70%. The reduction of polyphenols reached its highest level at 62%. A significant effluent decolorization is apparent.Este trabajo describe la decoloración y la disminución de la demanda química de oxígeno del alpechín (OMW por Phanerochaetae chrysosporium, crecido en cultivos estáticos, agitados e inmovilizados. Cuando P. chrysosporium fue cultivado en agitación, no se observa ninguna decoloración de OMW crudo, la decoloración ocurre solamente después de eliminar los polifenoles mediante adsorción en el serrín (Disminución del 39% del contenido en polifenoles. La utilización de la lignina peroxidasa generada en el medio da lugar a la mayor decoloración de alpechín y a las eficiencias de eliminación de DQO más altas. Las pruebas de la decoloración realizadas en las muestras de OMW que fueron pretratadas por la adsorción de madera del serrín, y usaron cultivos inmovilizadas demostraron resultados mejores. Por tanto, la eficiencia de eliminación de DQO alcanzó un 70%. La reducción de los polifenoles alcanzó los niveles más altos siempre, i.e. 62%. Se observó una decoloración significativa del efluente.

  7. DESTRUCTION OF XENOBIOTICS BY CULTURE FILTRATE FROM XYLOTROPHIC BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2015-12-01

    Full Text Available The article deals with the efficiency of pollutants biodegradation by xylotrophic basidiomycetes submerged cultures grown on standard glucose-peptone medium (GPM. The efficiency of pollutants biodegradation was determined by the model compound – dye Methyl Orange. The purpose of the work is screening of 19 species 81 strains xylotrophic basidiomycetes cultures on the indicator of the dye oxidative degradation efficiency and exploring the possibility of induction of this indicator by modifying the culture medium. The biodegradation efficiency was determined by following method. Assigned amount of culture filtrate (experiment or medium (control was added to the 0.001% solution of Methyl Orange in sodium acetate buffer. pH of the reaction mixture was 4.4 units. Samples were incubated at +40°C for 48 hours. Then pH of the reaction mixture was set up at 3.1 units using sodium acetate buffer and the optical density of solutions at a wavelength of 506 nm was measured. The efficiency of biodegradation was calculated by the difference of the optical density of control and experiment as a percentage. The most promising strains – F. velutipes F-1105, P. eryngii P-er, T. hirsuta Th-11 and D. quercina Dq-08 were selected. The composition of the glucose-peptone medium was modified for these strains by the introduction in the medium lignosulfonate, Tween 80, Kirk’s minerals solution and selecting the concentration of these components. According to the study for the purpose of pollutants degradation it is advisable to cultivate F. velutipes F-1105 strain on modified GPM, which further comprises at 1 l: lignosulfonate – 3.5 g; Tween 80 – 1.0 g, Kirk’s minerals solution – 70 ml; P. eryngii P-er strain – 5.0 g, 1.0 g, 70 ml; T. hirsuta Th-11 strain – 5.0 g, 1.0 g, 105 ml; and D. quercina Dq-08 strain – 6.5 g, 1.0 g, 105 ml, respectively. This allowed to increase the model compound degradation efficiency by the culture filtrate of strain F

  8. Dermatomycosis in a pet inland bearded dragon (Pogona vitticeps) caused by a Chrysosporium species related to Nannizziopsis vriesii.

    Science.gov (United States)

    Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J

    2009-08-01

    A Chrysosporium sp. related to Nannizziopsis vriesii was isolated in pure culture from squames and biopsies of facial lesions in a pet inland bearded dragon (Pogona vitticeps) in Spain. The presence in histological sections of morphologically consistent fungal elements strongly incriminates this fungus as the aetiological agent of infection. Lesions regressed following treatment with oral ketoconazole and topical chlorhexidine and terbinafine until the lizard was lost to follow up 1 month later. The ITS-5.8S rRNA gene of the isolate was sequenced and a search on the GenBank database revealed a high match with the sequences of two Chrysosporium sp. strains recently isolated from green iguanas (Iguana iguana) with dermatomycosis, also in Spain. Phylogenetic analysis of the sequences revealed that all these strains are related to N. vriesii. This is the first report of dermatomycoses caused by a Chrysosporium species related to N. vriesii in a bearded dragon outside North America. PMID:19659541

  9. Сultivation Features of Higher Basidiomycetes Trametes zonatus for Liquid Medium

    OpenAIRE

    Тітова, Лариса Олександрівна; Клечак, Інна Рішардівна

    2016-01-01

    Background. The basidiomycetes T. zonatus are producers and cellulose oxidative enzymes and polysaccharides with antitumor activity. The feasibility of this study is that the creation of functional food biotechnology from strains of biomass from domestic collections is not enough initial data: fragmentary data on cultivation conditions and culture medium composition, biochemical biomass of T. zonatus.Оbjective. The aim of the study is to conduct screening of basidiomycetes strains T. zonatus ...

  10. Basidiomycete cryopreservation on perlite: evaluation of a new method.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2006-06-01

    A new cryopreservation method using perlite as a carrier was evaluated on a large set of mycelial cultures of basidiomycetes. The viability and some other characteristics--growth, macro- and micromorphology, and laccase production--of 442 strains were tested after 48-h and then after 3-year storage in liquid nitrogen using a perlite protocol (PP). All (100%) of them survived successfully both 48-h storage and 3-year storage in liquid nitrogen without noticeable growth and morphological changes. Also laccase production was unchanged. The viability and laccase production of a part (250) of these strains were compared with those of the strains subjected to an original agar plug protocol (OP). Using OP, 144 strains (57.6%) out of 250 survived a 3-year storage in liquid nitrogen. The results indicate that the cryopreservation protocol used significantly influences survival of the strains. Markedly better results were achieved using the PP.

  11. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Science.gov (United States)

    David-Palma, Márcia; Sampaio, José Paulo; Gonçalves, Paula

    2016-06-01

    In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R) and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD) transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism will benefit from

  12. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Directory of Open Access Journals (Sweden)

    Márcia David-Palma

    2016-06-01

    Full Text Available In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism

  13. SOLID-PHASE TREATMENT OF A PENTACHLOROPHENOL- CONTAMINATED SOIL USING LIGNIN-DEGRADING FUNGI

    Science.gov (United States)

    The abilities of three lignin-degrading fungi, Phanerochaete chrysosporium, Phanerochaete sordida, and Trametes hirsuta, to deplete pentachlorophenol (PCP) from soil contaminated with PCP and creosote were evaluated. A total of seven fungal and three control treatments ...

  14. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  15. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  16. Protease activity in cockroach and basidiomycete allergen extracts.

    Science.gov (United States)

    Wongtim, S; Lehrer, S B; Salvaggio, J E; Horner, W E

    1993-01-01

    Inherent proteolytic activity was estimated in cockroach and basidiomycete extracts by quantifying acid soluble peptides that were released by incubating extracts with 1% bovine serum albumin as measured by Lowry (Sigma). Reference proteases released 740 (Proteinase K, 0.1 U), 248 (Trypsin, 1.0 U), and 533 micrograms/ml (Pronase, 0.5 U) of soluble peptides. American whole body cockroach extract (0.1 mg dry weight) released 330 micrograms/ml of soluble peptides, representing 13 trypsin equivalent units (TEU)/mg. Extracts from spores of the mushroom Pleurotus ostreatus released 230 micrograms/ml (0.9 TEU/mg) and Pleurotus cap extract released 112 micrograms/ml (0.5 TEU/mg). Mycelium of Pleurotus and the mushroom Psilocybe cubensis and spores of Psilocybe and the puffball Calvatia cyathiformis showed negligible amounts of proteolytic activity. The protease inhibitor phenylmethylsulfonyl flouride reduced the proteolytic activity of American whole body cockroach extract by 80% (@1 mM) and the inhibitor ethylene diaminetetraacetic acid inhibited the proteolytic activity of Pleurotus spores by 95% (@1 mM). Loss of allergen activity as determined by RAST inhibition and immunoprinting correlated with protease activity. Thus, in the preparation and handling of allergen extracts, one should employ conditions that minimize proteolysis.

  17. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  18. 黄孢原毛平革菌产酶的简化结构动力学模型%A Simple Structure Model for Enzyme Production by Phanerochaete chrysosporium

    Institute of Scientific and Technical Information of China (English)

    ZHENG Zhongming(郑重鸣); FOO YinDin; Jeffery Philip Obbard; LIN Jianping(林建平); CEN Peilin(岑沛霖)

    2003-01-01

    In order to understand the behavior of ligninolytic enzyme production by white rot fungi Phanerochaetechrysosporium, study on time courses and a mathematical model for the production of lignin peroxidase (LiP) andmanganese peroxidase (MnP) of the fungi was undertaken. Based on the Monod-Jacob operon model, the ligninolyticenzyme would be synthesized in the absence of a related repressor. The repressor is assumed to be active in thepresence of ammonia nitrogen, and as combined as co-repressor, it causes the inhibition of enzyme synthesis. Themodel can explain the mechanism of extracellular ligninolytic enzyme production by white rot fungi. The results,as predicted by the model, correspond closely to those observed in experimental studies. In addition, some lightis also shed on unmeasured variables, such as the concentrations of repressor and mRNA that are related to theenzyme synthesis.

  19. Basidiomycete cultures on perlite survive successfully repeated freezing and thawing in cryovials without subculturing.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2007-06-01

    Mycelial basidiomycete cultures on perlite in cryovials survived successfully three successive cycles of freezing, storage in liquid nitrogen (LN) and thawing without noticeable changes. This indicates that using perlite as a carrier for cryopreservation could in most cases overcome difficulties caused by interrupted supply of LN or electric power during the storage. Cultures on perlite can also be reused for successive inoculations.

  20. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  1. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    Two-component system (TCS) proteins are components of complex signal transduction pathways in fungi, and play essential roles in the regulation of several cellular functions and responses. Species of basidiomycetes have a marked variation in their specific physiological traits, morphological...

  2. Distribution of Brown Blotch Bacteria in Wild and Cultivated Species of Basidiomycetes

    OpenAIRE

    Bessette, Alan E.

    1984-01-01

    Wild and cultivated Basidiomycetes species were cultured to determine the distribution of bacteria causing brown blotch disease of Agaricus bisporus. Colonies from each basidiocarp were screened for brown blotch organisms by the white line and host pathogenicity tests. Isolates causing brown blotch were identified as Pseudomonas tolaasi and an Arthrobacter species.

  3. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  4. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  5. Metabolic pathways of biotransformation and biosynthesis of aromatic compounds for the flavour industry by the basidiomycete Pycnoporus cinnabarinus

    OpenAIRE

    Asther, Marcel; Lomascolo, A.; Asther, M.; Moukha, S.; Lesage-Meessen, L.

    1998-01-01

    Among filamentous fungi, white-rot Basidiomycetes have become a strategic group to generate industrial aromatic flavours. In the course of a basidiomycete screening, the biotechnological potential of #Pycnoporus cinnabarinus$ strains was studied in order to produce, by transformation or de novo, natural aromatic flavours in liquid cultures. Ferulic acid and L-phenylalanine were found to be suitable substrates for vanillin and benzaldehyde (bitter almond aroma) production, respectively. These ...

  6. Cryopreservation of cryosensitive basidiomycete cultures by application and modification of perlite protocol.

    Science.gov (United States)

    Sato, Masanori; Sukenobe, Junji; Nakagiri, Akira

    2012-01-01

    Homolka's perlite protocol (HPP) for cryopreservation of fungal cultures was evaluated in 12 strains (7 species) of cryosensitive basidiomycete cultures maintained in NBRC culture collection by investigating viability, time to recover, and basic morphological study after freezing and storing at -80 degree C for 6 months. The viability of the fungal strains was 60 percent in Phallus hadriani and 100 percent in remaining 11 strains, indicating the efficacy of HPP method for cryopreservation of some cryosensitive basidiomycetes. The HPP method was modified by changing the addition of cryoprotectant (glycerol) from prior precultivation to post precultivation, limiting the cryoprotectant exposure time to 48 hours, and increasing the glycerol concentration from 5 percent to 12 percent. The viability of P. hadriani strain increased from 60 percent to 100 percent with the modified perlite protocol after storage at -80 degree C for 6 months.

  7. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  8. Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi.

    OpenAIRE

    Bakkeren, G; Kronstad, J. W.

    1994-01-01

    Sexual compatibility requires self vs. non-self recognition. Genetically, two compatibility or mating-type systems govern recognition in heterothallic basidiomycete fungi such as the edible and woodrotting mushrooms and the economically important rust and smut phytopathogens. A bipolar system is defined by a single genetic locus (MAT) that can have two or multiple alleles. A tetrapolar system has two loci, each with two or more specificities. We have employed two species from the genus Ustila...

  9. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing basidiomycetes strains

    OpenAIRE

    Moreira Neto, S. L.; Solange I. Mussatto; Machado, K. M. G.; Milagres, Adriane M. F.

    2013-01-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Ciba...

  10. Basidiomycete DyPs: Genomic diversity, structural–functional aspects, reaction mechanism and environmental significance

    OpenAIRE

    Linde, Dolores; Ruiz-Dueñas, Francisco J.; Fernandez-Fueyo, Elena; Guallar, Víctor; Hammel, Kenneth E.; Pogni, Rebecca; Martínez, Angel T.

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes...

  11. Kinesin-3 in the basidiomycete Ustilago maydis transports organelles along the entire microtubule array.

    Science.gov (United States)

    Steinberg, Gero

    2015-01-01

    The molecular motor kinesin-3 transports early endosomes along microtubules in filamentous fungi. It was reported that kinesin-3 from the ascomycete fungi Aspergillus nidulans and Neurospora crassa use a subset of post-translationally modified and more stable microtubules. Here, I show that kinesin-3 from the basidiomycete Ustilago maydis moves along all hyphal microtubules. This difference is likely due to variation in cell cycle control and associated organization of the microtubule array.

  12. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    OpenAIRE

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree...

  13. Four new spiroaxane sesquiterpenes and one new rosenonolactone derivative from cultures of Basidiomycete Trametes versicolor.

    Science.gov (United States)

    Wang, Su-Rui; Zhang, Ling; Chen, He-Ping; Li, Zheng-Hui; Dong, Ze-Jun; Wei, Kun; Liu, Ji-Kai

    2015-09-01

    Four new spiroaxane sesquiterpenes, tramspiroins A-D (1-4), one new rosenonolactone 15,16-acetonide (5), and the known drimane sesquiterpenes isodrimenediol (6) and funatrol D (7) have been isolated from the cultures of Basidiomycete Trametes versicolor. The structures of new compounds were elucidated by means of spectroscopic methods. Compounds 1-7 were investigated for their cytotoxicities against five human cancer cell lines. PMID:26136058

  14. Influence of water activity and temperature on survival of and colony formation by heat-stressed Chrysosporium farinicola aleuriospores.

    OpenAIRE

    Beuchat, L R; Pitt, J. I.

    1990-01-01

    The ability of sublethally heat-stressed aleuriospores of Chrysosporium farinicola to form colonies on yeast extract-glucose agar (YGA) supplemented with sufficient glucose, sorbitol, glycerol, and NaCl to achieve reduced water activity (aw) in the range of 0.88 to 0.95 was determined. The effects of the aw of diluent and incubation temperature during recovery and colony formation were also investigated. Aleuriospores harvested from 14-day-old cultures grown at 25 degrees C were less resistan...

  15. Mn(II) regulation of lignin peroxidases and manganese-dependent peroxidases from lignin-degrading white rot fungi

    International Nuclear Information System (INIS)

    Two families of peroxidases-lignin peroxidase (LiP) and manganese-dependent lignin peroxidase (MnP)-are formed by the lignin-degrading white rot basidiomycete Phanerochaete chrysosporium and other white rot fungi. Isoenzymes of these enzyme families carry out reactions important to the biodegradation of lignin. This research investigated the regulation of LiP and MnP production by Mn(II). In liquid culture, LiP titers varied as an inverse function of and MnP titers varied as a direct function of the Mn(II) concentration. The extracellular isoenzyme profiles differed radically at low and high Mn(II) levels, whereas other fermentation parameters, including extracellular protein concentrations, the glucose consumption rate, and the accumulation of cell dry weight, did not change significantly with the Mn(II) concentration. In the absence of Mn(II), extracellular LiP isoenzymes predominated, whereas in the presence of Mn(II), MnP isoenzymes were dominant. The release of 14CO2 from 14C-labeled dehydrogenative polymerizate lignin was likewise affected by Mn(II). The rate of 14CO2 release increased at low Mn(II) and decreased at high Mn(II) concentrations. This regulatory effect of Mn(II) occurred with five strains of P. chrysosporium, two other species of Phanerochaete, three species of Phlebia, Lentinula edodes, and Phellinus pini

  16. Purification, cloning and characterisation of two forms of thermostable and highly active cellobiohydrolase I (Cel7A) produced by the industrial strain of Chrysosporium lucknowense

    NARCIS (Netherlands)

    Gusakov, A.V.; Sinitsyn, A.P.; Salanovich, T.N.; Bukhtojarov, F.E.; Markov, A.V.; Ustinov, B.B.; Zeijl, C.V.; Punt, P.; Burlingame, R.

    2005-01-01

    Two forms of cellobiohydrolase I (CBH I, Cel7A) were purified from the culture ultrafiltrate of a mutant strain of the fungus Chrysosporium lucknowense, an industrial producer of cellulases and hemicellulases. The enzymes had different molecular masses (52 and 65 kDa, SDS-PAGE data) but the same pI

  17. Molecular Characterization of Reptile Pathogens Currently Known as Members of the Chrysosporium Anamorph of Nannizziopsis vriesii Complex and Relationship with Some Human-Associated Isolates

    Science.gov (United States)

    Hambleton, Sarah; Paré, Jean A.

    2013-01-01

    In recent years, the Chrysosporium anamorph of Nannizziopsis vriesii (CANV), Chrysosporium guarroi, Chrysosporium ophiodiicola, and Chrysosporium species have been reported as the causes of dermal or deep lesions in reptiles. These infections are contagious and often fatal and affect both captive and wild animals. Forty-nine CANV isolates from reptiles and six isolates from human sources were compared with N. vriesii based on their cultural characteristics and DNA sequence data. Analyses of the sequences of the internal transcribed spacer and small subunit of the nuclear ribosomal gene revealed that the reptile pathogens and human isolates belong in well-supported clades corresponding to three lineages that are distinct from all other taxa within the family Onygenaceae of the order Onygenales. One lineage represents the genus Nannizziopsis and comprises N. vriesii, N. guarroi, and six additional species encompassing isolates from chameleons and geckos, crocodiles, agamid and iguanid lizards, and humans. Two other lineages comprise the genus Ophidiomyces, with the species Ophidiomyces ophiodiicola occurring only in snakes, and Paranannizziopsis gen. nov., with three new species infecting squamates and tuataras. The newly described species are Nannizziopsis dermatitidis, Nannizziopsis crocodili, Nannizziopsis barbata, Nannizziopsis infrequens, Nannizziopsis hominis, Nannizziopsis obscura, Paranannizziopsis australasiensis, Paranannizziopsis californiensis, and Paranannizziopsis crustacea. Chrysosporium longisporum has been reclassified as Paranannizziopsis longispora. N. guarroi causes yellow fungus disease, a common infection in bearded dragons and green iguanas, and O. ophiodiicola is an emerging pathogen of captive and wild snakes. Human-associated species were not recovered from reptiles, and reptile-associated species were recovered only from reptiles, thereby mitigating concerns related to zoonosis. PMID:23926168

  18. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. PMID:25637654

  19. The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.

    Science.gov (United States)

    Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-yu; Quintanilla, Rene H; Banuett, Flora

    2014-05-01

    Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi.

  20. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  1. Lignin-Modifying Enzymes of Flavodon flavus, a Basidiomycete Isolated from a Coastal Marine Environment†

    OpenAIRE

    Raghukumar, C.; D’Souza, T. M.; Thorn, R. G.; Reddy, C A

    1999-01-01

    A basidiomycetous fungus Flavodon flavus (Klotzsch) Ryvarden (strain 312), isolated from decaying sea grass from a coral lagoon off the west coast of India, mineralized nearly 24% of 14C-labeled synthetic lignin to 14CO2 in 24 days. When grown in low-nitrogen medium (2.4 mM N) this fungus produced three major classes of extracellular lignin-modifying enzymes (LMEs): manganese-dependent peroxidase (MNP), lignin peroxidase (LIP), and laccase. Low MNP and laccase activities were seen in high-nit...

  2. Role of plants in the vegetative and reproductive growth of saprobic basidiomycetous ground fungi.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2008-11-01

    Non-symbiotic microorganisms engineered or expensively selected to degrade xenobiotic hydrocarbons or modify heavy-metal uptake of plants in soil remediations die back after their introduction into the target soils. Mycelia of saprobic basidiomycetes were therefore inoculated into soil samples of 1 l in glass vessels to record mycelial growth and reproduction in the immediate rhizosphere of up to 11 herbaceous plant species, or to study their responses to the separate volatiles from whole plant swards or their root balls whose emanations had been collected in 1.5-l plastic bags fixed to the glass vessels. Excess CO2 was controlled with NaOH solution. Volatiles from root balls of parsley and pea but not wheat, from unplanted soils, from the fungus-permeated, unplanted substrate soil itself, and from the rooting soil of whole wheat sward increased mycelial densities in Clitocybe sp. more than in Agaricus macrocarpus and indicated thus a higher nutrient state of the mycelia. Organic volatiles proved therefore to be a significant carbon source for certain basidiomycetes in poor natural soils. The contemporary decline in the number of basidiocarp initials to 0 to 36% in both fungi relative to the unplanted and aerated controls was caused by volatiles from rooted and unplanted soil and pointed thus to their ecological role as antibiotics, fumigants, toxins, and hormonal compounds. Aqueous extracts from root balls of wheat stimulated mycelial density and fruiting in A. macrocarpus contemporarily because of their contents in soil-derived macronutrients. They suppressed once more fruiting in the more sensitive Clitocybe sp. by active agents in the aqueous phase. Within plant rhizospheres, densities of Clitocybe sp. mycelia were stimulated in the presence of alfalfa, carrot, red clover, ryegrass, and spinach, whereas those of A. macrocarpus were halved by 7 of 10 plant species including alfalfa, red clover, ryegrass, and spinach. Mycelia of A. macrocarpus may thereby have

  3. Antifungal activity of some metabolites of higher fungi (Basidiomycetes - an overview

    Directory of Open Access Journals (Sweden)

    Teresa Florianowicz

    2014-02-01

    Full Text Available A series of compounds of different chemical structures showing antifungal activity were isolated from higher fungi (Basidiomycetes fruit bodies. Among the microflora against which the examined metabolites showed effective activity, there are pathogenic organisms for people as well as for animals: Candida albicans, Candida tropicalis, Rhodotorula rubra, Aspergillus fumigatus and pathogens attacking plants: Penicillium chrysogenum, Botrytis cinerea, Alternaria solani, Fusarium culmorum, Trichoderma lignorum and Verticillium dahlae. Searching for fungal metabolites having antifungal activity creates possibilities of using them against a range of fungal pathogens of clinical, agronomic and environmental significance.

  4. A comparison of hypoglycemic activity of three species of basidiomycetes rich in vanadium.

    Science.gov (United States)

    Han, Chunchao; Liu, Tongjun

    2009-02-01

    The hypoglycemic activity of fermented mushroom of three fungi of basidiomycetes rich in vanadium was studied in this paper. Alloxan- and adrenalin-induced hyperglycemic mice were used in the study. The blood glucose and the sugar tolerance were determined. After the mice were administered (ig) with Coprinus comatus rich in vanadium, the blood glucose of alloxan-induced hyperglycemic mice decreased (p vanadium and Grifola frondosa rich in vanadium, the hypoglycemic effects of Coprinus comatus rich in vanadium on hyperglycemic animals are significant; it may be used as a hypoglycemic food or medicine for hyperglycemic people.

  5. "Newton's cradle" proton relay with amide-imidic acid tautomerization in inverting cellulase visualized by neutron crystallography.

    Science.gov (United States)

    Nakamura, Akihiko; Ishida, Takuya; Kusaka, Katsuhiro; Yamada, Taro; Fushinobu, Shinya; Tanaka, Ichiro; Kaneko, Satoshi; Ohta, Kazunori; Tanaka, Hiroaki; Inaka, Koji; Higuchi, Yoshiki; Niimura, Nobuo; Samejima, Masahiro; Igarashi, Kiyohiko

    2015-08-01

    Hydrolysis of carbohydrates is a major bioreaction in nature, catalyzed by glycoside hydrolases (GHs). We used neutron diffraction and high-resolution x-ray diffraction analyses to investigate the hydrogen bond network in inverting cellulase PcCel45A, which is an endoglucanase belonging to subfamily C of GH family 45, isolated from the basidiomycete Phanerochaete chrysosporium. Examination of the enzyme and enzyme-ligand structures indicates a key role of multiple tautomerizations of asparagine residues and peptide bonds, which are finally connected to the other catalytic residue via typical side-chain hydrogen bonds, in forming the "Newton's cradle"-like proton relay pathway of the catalytic cycle. Amide-imidic acid tautomerization of asparagine has not been taken into account in recent molecular dynamics simulations of not only cellulases but also general enzyme catalysis, and it may be necessary to reconsider our interpretation of many enzymatic reactions. PMID:26601228

  6. Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii in captive coastal bearded dragons (Pogona barbata).

    Science.gov (United States)

    Johnson, R S P; Sangster, C R; Sigler, L; Hambleton, S; Paré, J A

    2011-12-01

    Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was diagnosed in a group of coastal bearded dragons (Pogona barbata). The outbreak extended over a 6-month period, with four of six lizards from the same zoological outdoor enclosure succumbing to infection. A fifth case of dermatomycosis was identified in a pet lizard originally sourced from the wild. Diagnosis of infection with the CANV was based on similar clinical signs and histopathology in all animals and confirmed by culture and sequencing of the fungus from one animal. This is the first report of the CANV causing disease in a terrestrial reptile species in Australia and the first in the coastal bearded dragon. PMID:22103953

  7. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants. PMID:24502208

  8. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  9. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  10. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants.

  11. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions. PMID:27481160

  12. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  13. In vitro decomposition of Sphagnum-derived acrotelm and mesotelm peat by indigenous and alien basidiomycetous fungi

    Directory of Open Access Journals (Sweden)

    M.N. Thormann

    2011-05-01

    Full Text Available Northern peatlands have accumulated significant quantities of peat, and it has been predicted that rates of peat decomposition may increase due to climate warming. In peatlands, organic matter decomposition in the acrotelm is accomplished primarily by fungi that act differentially through time on various peat constituents. After four months of decomposition in vitro, I show a distinct microbiological limitation to the decomposition of Sphagnum-derived peat (mean mass losses of 1.1–7.1 % by indigenous and alien basidiomycetous fungi of both acrotelm and mesotelm peat (the mesotelm is the lower part of the acrotelm sensu lato, in which conditions fluctuate between oxic and anoxic. Neither acrotelm nor mesotelm Sphagnum peat can be degraded effectively by many fungi (mean mass losses of 2.7 % and 4.3 % for acrotelm and mesotelm peat, respectively, including the ubiquitous wood decomposing basidiomycetes known to decompose some of nature’s most complex polymers. Peatland basidiomycetes caused significantly greater mass losses of acrotelm and mesotelm peat than wood decay basidiomycetes (mean mass losses of 5.7 % and 1.4 %, respectively. Brown rot fungi caused significantly greater mass losses to acrotelm and mesotelm peat than white rot fungi and non-wood-decay fungi (mean mass losses of 10.1 %, 1.7 %, and 2.3 %, respectively. Rates of peat decomposition may not increase to the extent previously predicted, and peatlands may not necessarily be long-term sources of CO2 in response to a warming climate.

  14. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol. PMID:17697987

  15. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  16. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  17. Novel Root-Fungus Symbiosis in Ericaceae: Sheathed Ericoid Mycorrhiza Formed by a Hitherto Undescribed Basidiomycete with Affinities to Trechisporales

    Science.gov (United States)

    Vohník, Martin; Sadowsky, Jesse J.; Kohout, Petr; Lhotáková, Zuzana; Nestby, Rolf; Kolařík, Miroslav

    2012-01-01

    Ericaceae (the heath family) are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM) fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed ‘sheathed ericoid mycorrhiza’, discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity) to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet remain

  18. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  19. Chamigrane Sesquiterpenes from a Basidiomycetous Endophytic Fungus XG8D Associated with Thai Mangrove Xylocarpus granatum

    Science.gov (United States)

    Choodej, Siwattra; Teerawatananond, Thapong; Mitsunaga, Tohru; Pudhom, Khanitha

    2016-01-01

    Six new chamigrane sesquiterpenes, merulinols A‒F (1‒6), and four known metabolites (7‒10) were isolated from the culture of the basidiomycetous fungus XG8D, a mangrove-derived endophyte. Their structures were elucidated mainly by 1D and 2D NMR, while the structures of 1 and 2 were further confirmed by single-crystal X-ray diffraction analysis. The in vitro cytotoxicity of all compounds was evaluated against three human cancer cell lines, MCF-7, Hep-G2, and KATO-3. Compounds 3 and 4 selectively displayed cytotoxicity against KATO-3 cells with IC50 values of 35.0 and 25.3 μM, respectively. PMID:27428984

  20. Chamigrane Sesquiterpenes from a Basidiomycetous Endophytic Fungus XG8D Associated with Thai Mangrove Xylocarpus granatum

    Directory of Open Access Journals (Sweden)

    Siwattra Choodej

    2016-07-01

    Full Text Available Six new chamigrane sesquiterpenes, merulinols A‒F (1‒6, and four known metabolites (7‒10 were isolated from the culture of the basidiomycetous fungus XG8D, a mangrove-derived endophyte. Their structures were elucidated mainly by 1D and 2D NMR, while the structures of 1 and 2 were further confirmed by single-crystal X-ray diffraction analysis. The in vitro cytotoxicity of all compounds was evaluated against three human cancer cell lines, MCF-7, Hep-G2, and KATO-3. Compounds 3 and 4 selectively displayed cytotoxicity against KATO-3 cells with IC50 values of 35.0 and 25.3 μM, respectively.

  1. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  2. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  3. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    Science.gov (United States)

    Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  4. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications. PMID:23558529

  5. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  6. Better One-Eyed than Blind--Challenges and Opportunities of Biomass Measurement During Solid-State Fermentation of Basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-01-01

    Filamentous fungi, especially basidiomycetes, produce a wide range of metabolites, many of which have potential biotechnological and industrial applications. Solid-state fermentation (SSF) is very suitable for the cultivation of basidiomycetes since it mimics the natural habitat of these fungi. Some of the major advantages of SSF are the robustness of the process, the use of low-cost residual materials as substrates, and the reduced usage of water. However, monitoring key variables is difficult, which makes process control a challenge. Specifically, it is very difficult to determine the biomass during SSF process involving basidiomycetes. This is problematic, as the biomass is normally a key variable in mass and energy balance equations. Further, the success of fungal SSF processes is often evaluated, in part, based on the growth of the fungus. Direct determination of the dry weight of biomass is impossible and indirect quantification techniques must be used. Over the years, various determination techniques have been developed for the quantification of fungal biomass in SSF processes. The current review gives an overview of various direct and indirect biomass determination methods, discussing their advantages and disadvantages.

  7. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment. PMID:20585855

  8. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  9. Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20)

    OpenAIRE

    Steve Nicolich; Mohammed Sidhoum; Wendy Balas; Pelin Karakaya; Agamemnon Koutsospyros; Christos Christodoulatos

    2009-01-01

    The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the...

  10. Influence of water activity and temperature on survival of and colony formation by heat-stressed Chrysosporium farinicola aleuriospores.

    Science.gov (United States)

    Beuchat, L R; Pitt, J I

    1990-10-01

    The ability of sublethally heat-stressed aleuriospores of Chrysosporium farinicola to form colonies on yeast extract-glucose agar (YGA) supplemented with sufficient glucose, sorbitol, glycerol, and NaCl to achieve reduced water activity (aw) in the range of 0.88 to 0.95 was determined. The effects of the aw of diluent and incubation temperature during recovery and colony formation were also investigated. Aleuriospores harvested from 14-day-old cultures grown at 25 degrees C were less resistant to heat inactivation compared with aleuriospores from 20-day-cultures. Increased populations of heat-stressed aleuriospores were recovered as the aw of YGA was decreased from 0.95 (glucose and glycerol) and 0.94 (sorbitol) to 0.89 and 0.88, respectively. In NaCl-supplemented YGA, populations recovered at an aw of 0.94 were greatly reduced compared with populations detected at an aw of 0.92; no colonies were formed on NaCl-supplemented YGA at an aw of 0.88. Tolerance to aw values above 0.88 to 0.89 as influenced by solute type was in the order of glucose greater than sorbitol greater than glycerol greater than NaCl. Incubation at 20 degrees generally resulted in an increase in recoverable aleuriospores compared with incubation at 25 degrees C or at 30 degrees C for 14 days followed by 20 degrees C for 10 days. The lethal effect of NaCl on heat-stressed aleuriospores was enhanced at 30 degrees C. The retention of viability of aleuriospores held in sucrose-peptone water diluent (aw, 0.936) for 20 min was essentially the same as that observed when aleuriospores were held in peptone water (aw, 0.997).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2285307

  11. Production of gamma-lactones by the brown-rot basidiomycete Piptoporus soloniensis.

    Science.gov (United States)

    Okamoto, Kenji; Chimori, Mieko; Iwanaga, Fumi; Hattori, Tsutomu; Yanase, Hideshi

    2002-01-01

    A wild strain of brown-rot basidiomycete Piptoporus soloniensis produced a sweet flavor similar to tropical fruits in liquid cultures. The major and minor compounds were identified to be gamma-decalactone and gamma-octanolactone by gas chromatography-mass spectrometry analysis, respectively. The growth and production of gamma-decalactone by P. soloniensis in broth to which fatty acids had been added were investigated. The addition of 12-hydroxystearic acid and ricinoleic acid to the culture markedly enhanced the production of gamma-decalactone. On the other hand, addition of myristic acid, palmitic acid, stearic acid and oleic acid to the culture resulted in a higher production of gamma-octanolactone. The addition of hexanoic acid, octanoic acid, decanoic acid, lauric acid, linoleic acid and linolenic acid to the culture reduced the growth of P. soloniensis and production of gamma-decalactone and gamma-octanolactone. This strain accumulated oxalic acid in liquid culture and grew sufficiently under strongly acidic conditions. PMID:16233291

  12. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. PMID:22954341

  13. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment.

  14. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment. PMID:23350659

  15. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs. PMID:18805521

  16. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis. PMID:16885300

  17. Penarines A-F, (nor-)sesquiterpene carboxylic acids from Hygrophorus penarius (Basidiomycetes).

    Science.gov (United States)

    Otto, Alexander; Porzel, Andrea; Schmidt, Jürgen; Wessjohann, Ludger; Arnold, Norbert

    2014-12-01

    Five sesquiterpene carboxylic acids (1-5) and one nor-sesquiterpene carboxylic acid (6) of the very rare ventricosane type, named penarines A-F, were isolated from fruiting bodies of the basidiomycete Hygrophorus penarius (Hygrophoraceae). This is the first report of (nor)-sesquiterpenes isolated from basidiocarps of the family Hygrophoraceae. Their structures were elucidated on the basis of extensive 1D ((1)H, (13)C) and 2D (HSQC, HMBC, COSY, ROESY) NMR spectroscopic analyses as well as high-resolution mass spectrometry studies. Additionally, the only known member of this rare type of sesquiterpenes, ventricos-7(13)-ene (7), could be identified via headspace GC-MS analysis in a fruiting body of H. penarius. Compounds 1-6 were devoid of remarkable antifungal activity against Cladosporium cucumerinum. Additionally, the cytotoxic activities of compounds 1 and 2 were evaluated against the human prostate cancer cell line PC-3 and the colon cancer cell line HT-29 showing no significant cytotoxic activity. PMID:25269661

  18. Cold-stress responses in the Antarctic basidiomycetous yeast Mrakia blollopis.

    Science.gov (United States)

    Tsuji, Masaharu

    2016-07-01

    Microbes growing at subzero temperatures encounter numerous growth constraints. However, fungi that inhabit cold environments can grow and decompose organic compounds under subzero temperatures. Thus, understanding the cold-adaptation strategies of fungi under extreme environments is critical for elucidating polar-region ecosystems. Here, I report that two strains of the Antarctic basidiomycetous yeast Mrakia blollopis exhibited distinct growth characteristics under subzero conditions: SK-4 grew efficiently, whereas TKG1-2 did not. I analysed the metabolite responses elicited by cold stress in these two M. blollopis strains by using capillary electrophoresis-time-of-flight mass spectrometry. M. blollopis SK-4, which grew well under subzero temperatures, accumulated high levels of TCA-cycle metabolites, lactic acid, aromatic amino acids and polyamines in response to cold shock. Polyamines are recognized to function in cell-growth and developmental processes, and aromatic amino acids are also known to improve cell growth at low temperatures. By contrast, in TKG1-2, which did not grow efficiently, cold stress strongly induced the metabolites of the TCA cycle, but other metabolites were not highly accumulated in the cell. Thus, these differences in metabolite responses could contribute to the distinct abilities of SK-4 and TKG1-2 cells to grow under subzero temperature conditions. PMID:27493768

  19. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  20. The BETA-1, 3-Glucanase of Basidiomycete QM 806: Studies on it's production and application in yeast cell wall hydrolysis

    OpenAIRE

    Ryan, Eleanor

    1986-01-01

    In this project the growth and production of JB-1,3-glucanase by Basidiomycete sp QM 806 was investigated, with a view to studying its application in B-1,3-glucan degradation and in yeast extract production. The effect of various parameters on 3-1 »3-glucanase production was examined. The optimal conditions for enzyme production in submerged shake-flask culture were chosen. Two B-1,3-glucans (laminarin and yeast cell walls) were degraded using the B-1,3-glucanase produced. The degra...

  1. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. PMID:25586306

  2. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period.

  3. A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea.

    Science.gov (United States)

    Ford, Kathryn L; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M; Foster, Gary D

    2016-01-01

    Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974

  4. Lignolytic Enzymes of a Mushroom Stereum ostrea Isolated from Wood Logs

    OpenAIRE

    Praveen, K.; B. Viswanath; Usha, K. Y.; Pallavi, H.; Venkata Subba Reddy, G.; M. Naveen; B. Rajasekhar Reddy

    2011-01-01

    Production of lignolytic enzymes by the mushroom fungus Stereum ostrea in liquid medium under conditions of vegetative growth was examined for 10 days in comparison to the reference culture Phanerochaete chrysosporium. Though growth and secretion of extracellular protein by S. ostrea were comparable to those of P. chrysosporium, yields of laccase enzyme by S. ostrea were higher than laccase titres of P. chrysosporium by more than 2 folds on the peak production time interval (IVth day of incu...

  5. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence. PMID:23814110

  6. Ubc2, an Ortholog of the Yeast Ste50p Adaptor, Possesses a Basidiomycete-Specific Carboxy terminal Extension Essential for Pathogenicity Independent of Pheromone Response.

    Science.gov (United States)

    Proteins involved in the MAP kinase pathway controlling mating, morphogenesis and pathogenicity have been identified previously in the fungus Ustilago maydis. One of these, the Ubc2 adaptor protein, possesses a basidiomycete-specific structure. In addition to containing SAM and RA domains typical of...

  7. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  8. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  9. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi. PMID:25239747

  10. Cryptococcus yokohamensis sp. nov., a basidiomycetous yeast isolated from trees and a Queensland koala kept in a Japanese zoological park.

    Science.gov (United States)

    Alshahni, Mohamed Mahdi; Makimura, Koichi; Satoh, Kazuo; Nishiyama, Yayoi; Kido, Nobuhide; Sawada, Takuo

    2011-12-01

    Three strains were isolated from the nostrils of a koala and the surrounding environment in a Japanese zoological park. Sequence analysis of the nuclear rDNA internal transcribed spacer (ITS) region and the large subunit rDNA D1/D2 domains in addition to physiological and morphological studies indicated that the isolates represent a single novel species belonging to the basidiomycetous genus Cryptococcus (Tremellales, Tremellomycetes, Agaricomycotina). Phylogenetic analysis based on D1/D2 and ITS regions revealed that the novel species belongs to the Fuciformis clade. The name Cryptococcus yokohamensis sp. nov. is proposed to accommodate these isolates with strain JCM 16989(T) (=TIMM 10001(T)=CBS 11776(T)=DSM 23671(T)) as the type strain.

  11. Rhodotorula subericola sp. nov., an anamorphic basidiomycetous yeast species isolated from bark of Quercus suber (cork oak).

    Science.gov (United States)

    Belloch, C; Villa-Carvajal, M; Alvarez-Rodríguez, M L; Coque, J J R

    2007-07-01

    Two yeasts strains, Y-31(T) and Y-20B, pertaining to a previously unknown yeast species were isolated from bark of cork oak in Spain. Physiological characterization revealed a pattern of assimilation of carbon and nitrogen compounds compatible with members of the genus Rhodotorula. From sequence analysis of the D1/D2 region of the 26S rRNA gene, Rhodotorula cycloclastica and Rhodotorula philyla were related to the unknown species. Phylogenetic reconstruction based on the D1/D2 region of the 26S rRNA gene showed that the novel species clustered in a branch together with R. cycloclastica. The name Rhodotorula subericola sp. nov. is proposed, with isolate Y-31(T) (=CECT 11976(T)=CBS 10442(T)) the type strain of this novel taxon in the Microbotryum lineage, subclass Microbotryomycetidae, class Urediniomycetes of basidiomycetous yeasts.

  12. Evidence from Serpula lacrymans that 2,5-dimethoxyhydroquinone Is a lignocellulolytic agent of divergent brown rot basidiomycetes.

    Science.gov (United States)

    Korripally, Premsagar; Timokhin, Vitaliy I; Houtman, Carl J; Mozuch, Michael D; Hammel, Kenneth E

    2013-04-01

    Basidiomycetes that cause brown rot of wood are essential biomass recyclers in coniferous forest ecosystems and a major cause of failure in wooden structures. Recent work indicates that distinct lineages of brown rot fungi have arisen independently from ligninolytic white rot ancestors via loss of lignocellulolytic enzymes. Brown rot thus proceeds without significant lignin removal, apparently beginning instead with oxidative attack on wood polymers by Fenton reagent produced when fungal hydroquinones or catechols reduce Fe(3+) in colonized wood. Since there is little evidence that white rot fungi produce these metabolites, one question is the extent to which independent lineages of brown rot fungi may have evolved different Fe(3+) reductants. Recently, the catechol variegatic acid was proposed to drive Fenton chemistry in Serpula lacrymans, a brown rot member of the Boletales (D. C. Eastwood et al., Science 333:762-765, 2011). We found no variegatic acid in wood undergoing decay by S. lacrymans. We found also that variegatic acid failed to reduce in vitro the Fe(3+) oxalate chelates that predominate in brown-rotting wood and that it did not drive Fenton chemistry in vitro under physiological conditions. Instead, the decaying wood contained physiologically significant levels of 2,5-dimethoxyhydroquinone, a reductant with a demonstrated biodegradative role when wood is attacked by certain brown rot fungi in two other divergent lineages, the Gloeophyllales and Polyporales. Our results suggest that the pathway for 2,5-dimethoxyhydroquinone biosynthesis may have been present in ancestral white rot basidiomycetes but do not rule out the possibility that it appeared multiple times via convergent evolution. PMID:23377930

  13. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  14. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  15. Wood and humus decay strategies by white-rot basidiomycetes correlate with two different dye decolorization and enzyme secretion patterns on agar plates.

    Science.gov (United States)

    Barrasa, José M; Blanco, María N; Esteve-Raventós, Fernando; Altés, Alberto; Checa, Julia; Martínez, Angel T; Ruiz-Dueñas, Francisco J

    2014-11-01

    During several forays for ligninolytic fungi in different Spanish native forests, 35 white-rot basidiomycetes growing on dead wood (16 species from 12 genera) and leaf litter (19 species from 10 genera) were selected for their ability to decolorize two recalcitrant aromatic dyes (Reactive Blue 38 and Reactive Black 5) added to malt extract agar medium. In this study, two dye decolorization patterns were observed and correlated with two ecophysiological groups (wood and humus white-rot basidiomycetes) and three taxonomical groups (orders Polyporales, Hymenochaetales and Agaricales). Depending on the above groups, different decolorization zones were observed on the dye-containing plates, being restricted to the colony area or extending to the surrounding medium, which suggested two different decay strategies. These two strategies were related to the ability to secrete peroxidases and laccases inside (white-rot wood Polyporales, Hymenochaetales and Agaricales) and outside (white-rot humus Agaricales) of the fungal colony, as revealed by enzymatic tests performed directly on the agar plates. Similar oxidoreductases production patterns were observed when fungi were grown in the absence of dyes, although the set of enzyme released was different. All these results suggest that the decolorization patterns observed could be related with the existence of two decay strategies developed by white-rot basidiomycetes adapted to wood and leaf litter decay in the field.

  16. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics.

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-01-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense. PMID:27616058

  17. Biological characteristics of teleomorph and optimized in vitro fruiting conditions of the Hoelen medicinal mushroom, Wolfiporia extensa (Higher Basidiomycetes).

    Science.gov (United States)

    Xu, Zhangyi; Meng, Hu; Xiong, Huan; Bian, Yinbing

    2014-01-01

    Wolfiporia extensa is a basidiomycetous brown rot fungus and is of well-known medicinal import in China, Japan, and other Asiatic countries. Fruiting body induction is of major relevance for basic biological research and for their use in industrial applications. Based on the evaluation of the effects of temperature, time in the dark before induction and culture, and wounding treatment on fruiting, this report describes the most efficient protocol for inducing fruiting of W. extensa growing on agar plates. Furthermore, several biological characteristics of teleomorph, such as the locations of hymenium, the configuration of basidiospores and primary mycelia, and events involved in basidiosporogenesis in W. extensa, were analyzed for the first time using fluorescence microscopy. The results showed that the hymenium born on both sides of the wall of the honeycomb-like structure on the surface of fruiting bodies and the hymenophoral trama situated in the middle. Each basidia has 4 binuclear basidiospores, and the primary mycelia are multinucleate without clamp connections. These results broaden our knowledge about this brown rot fungus and promote further studies of the sexual reproduction, fruiting body development, and advancement of breeding program, new topics related to the contents of pharmacologically active substances in W. extensa fruiting bodies. PMID:25271978

  18. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5. PMID:20652239

  19. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  20. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process. PMID:26797957

  1. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities. PMID:26616098

  2. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process.

  3. Root endophyte symbiosis in vitro between the ectomycorrhizal basidiomycete Tricholoma matsutake and the arbuscular mycorrhizal plant Prunus speciosa.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Yokota, Satoru; Maruyama, Tsuyoshi; Endo, Naoki; Yamamoto, Kohei; Ohira, Tatsuro; Neda, Hitoshi

    2014-05-01

    We previously reported that Tricholoma matsutake and Tricholoma fulvocastaneum, ectomycorrhizal basidiomycetes that associate with Pinaceae and Fagaceae, respectively, in the Northern Hemisphere, could interact in vitro as a root endophyte of somatic plants of Cedrela odorata (Meliaceae), which naturally harbors arbuscular mycorrhizal fungi in South America, to form a characteristic rhizospheric colony or "shiro". We questioned whether this phenomenon could have occurred because of plant-microbe interactions between geographically separated species that never encounter one another in nature. In the present study, we document that these fungi formed root endophyte interactions and shiro within 140 days of inoculation with somatic plants of Prunus speciosa (=Cerasus speciosa, Rosaceae), a wild cherry tree that naturally harbors arbuscular mycorrhizal fungi in Japan. Compared with C. odorata, infected P. speciosa plants had less mycelial sheath surrounding the exodermis, and the older the roots, especially main roots, the more hyphae penetrated. In addition, a large number of juvenile roots were not associated with hyphae. We concluded that such root endophyte interactions were not events isolated to the interactions between exotic plants and microbes but could occur generally in vitro. Our pure culture system with a somatic plant allowed these fungi to express symbiosis-related phenotypes that varied with the plant host; these traits are innately programmed but suppressed in nature and could be useful in genetic analyses of plant-fungal symbiosis. PMID:24158697

  4. Molecular cloning and heterologous expression in Pichia pastoris of X-prolyl-dipeptidyl aminopeptidase from basidiomycete Ustilago maydis.

    Science.gov (United States)

    Juárez-Montiel, Margarita; Ibarra, J Antonio; Chávez-Camarillo, Griselda; Hernández-Rodríguez, César; Villa-Tanaca, Lourdes

    2014-03-01

    Dipeptidyl aminopeptidases are enzymes involved in the posttranslational control of bioactive peptides. Here we identified the gene dapUm in Ustilago maydis by homology with other fungal dipeptidyl aminopeptidases. Analysis of the dapUm-deduced amino acid sequence indicated that it encodes for membrane-type serine protease with a characteristic prolyl oligopeptidase catalytic motif triad: Ser, Asp, His. In order to overexpress the DapUm, the gene encoding for it was cloned and transformed into Pichia. Using this system, we observed a ∼ 125-kDa recombinant protein with an optimal enzymatic activity at pH 6.0 and at 40 °C for the Ala-Pro-p-nitroanilide substrate and an experimental pH of 6.9. U. maydis DapUm was specifically inhibited by phenylmethylsulfonyl fluoride and Pefabloc, confirming the presence of a serine residue in the active site. To our knowledge, this study is the first report on the cloning and expression of a DPP IV dipeptidyl aminopeptidase from a basidiomycete organism. Moreover, the use of recombinant DapUm will allow us to further study and characterize this enzyme, in addition to testing chemical compounds for pharmaceutical purposes.

  5. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  6. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O.V.

    2013-04-01

    Full Text Available A method for obtaining of enzyme preparations of enzyme preparations (EP of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfate at 40-70% saturation of peroxidases and 80% of saturation - for catalase. These solutions protein fractions was further purified by dialysis and gel filtration on Molselekt granules G-50 and G-75. The enzyme solution was subjected to freeze-drying. The individual characteristics of the enzyme preparations were found. The individual characteristics of the enzyme preparations are the activity of enzymes, the protein content and amino-acid composition of enzyme preparations. It was established that strain F. velutipes F-vv was an active producer of intracellular and strain of A. cylindracea 167 was an active producer of extracellular peroxidase. The strains of P. ostreatus P-01 and P-208 were the active producers of extracellular catalase, and the strainsof F. hepatica Fh-08 were active producers of intracellular catalase. The developed methods for producing of enzymes catalase and peroxidase preparations of extra-and intracellular origin provided new antioxidant enzymes, which have their own properties and application prospects in various sectors of industry and science research.

  7. Purification and characterization of a novel detergent- and organic solvent-resistant endo-beta-1,4-glucanase from a newly isolated basidiomycete Peniophora sp. NDVN01

    OpenAIRE

    TRINH, Dinh Kha; Quyen, Dinh Thi; Do, Thi Tuyen; Nghiem, Ngoc Minh

    2013-01-01

    A novel extracellular endoglucanase from a basidiomycete strain Peniophora sp. NDVN01 was purified 2.8-fold to homogeneity through ammonium sulfate precipitation and gel filtration with Bio-Gel P-100 and Sephadex G-75. The endoglucanase had a specific activity of 163.8 U/mg protein and a molecular mass of 32 kDa. Optimum temperature and pH were at 60 °C and 4.5, respectively. The enzyme was stable at up to 42 °C and in the pH range of 3.5-5.5 with a residual activity of over 80% for 24 h of t...

  8. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Science.gov (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) region and fungal internal transcribed spacer 2 (ITS2) region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity. PMID:25884708

  9. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  10. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  11. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  12. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied. PMID:26330322

  13. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes.

  14. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  15. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from Ra-226 from <0.3 to 1.0 ± 0.5 Bq kg(-1) F.W., and K-40 from 56.4 ± 3.0 to 759.0 ± 28.3 Bq kg(-1) F.W. The analysis of the results supported that the bioaccumulation of the studied natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied.

  16. Computational studies on LiP H isolated from Ganoderma lucidum GD88

    Directory of Open Access Journals (Sweden)

    Parambayil Nayana

    2015-01-01

    Full Text Available Ganoderma lucidum is a basidiomycete fungus that produces ligninase for the modification of lignin. Lignin peroxidase (LiP is a glycoprotein that acts on the recalcitrant cell wall component lignin. In the present study, the phylogenetic analysis of Ganoderma lucidum GD88 with the partial coding sequence (cds of other LiP isoforms was performed using MEGA6. After determination of the open reading frame, the +3 frame nucleotide sequence was converted to protein using the EMBOSS Transseq and the secondary structure was predicted using the Chou and Fasman Secondary Structure Prediction server (CFSSP. Protein modeling was also performed by SWISS-MODEL. The obtained result shows that the lipH partial cds of Ganoderma lucidum GD88 is homologous to the lipD gene of Phanerochaete chrysosporium. The secondary structure prediction result revealed that the percent content of the helix (67 is higher than the percent contents of sheet (53.4 and turns (13.6. According to the generated model, LiP H protein is a homodimer with chains A and B. The heme acts as a ligand and plays a major role in structure stabilization.

  17. Fungal bioconversion of lignocellulosic residues; opportunities & perspectives.

    Science.gov (United States)

    Dashtban, Mehdi; Schraft, Heidi; Qin, Wensheng

    2009-01-01

    The development of alternative energy technology is critically important because of the rising prices of crude oil, security issues regarding the oil supply, and environmental issues such as global warming and air pollution. Bioconversion of biomass has significant advantages over other alternative energy strategies because biomass is the most abundant and also the most renewable biomaterial on our planet. Bioconversion of lignocellulosic residues is initiated primarily by microorganisms such as fungi and bacteria which are capable of degrading lignocellulolytic materials. Fungi such as Trichoderma reesei and Aspergillus niger produce large amounts of extracellular cellulolytic enzymes, whereas bacterial and a few anaerobic fungal strains mostly produce cellulolytic enzymes in a complex called cellulosome, which is associated with the cell wall. In filamentous fungi, cellulolytic enzymes including endoglucanases, cellobiohydrolases (exoglucanases) and beta-glucosidases work efficiently on cellulolytic residues in a synergistic manner. In addition to cellulolytic/hemicellulolytic activities, higher fungi such as basidiomycetes (e.g. Phanerochaete chrysosporium) have unique oxidative systems which together with ligninolytic enzymes are responsible for lignocellulose degradation. This review gives an overview of different fungal lignocellulolytic enzymatic systems including extracellular and cellulosome-associated in aerobic and anaerobic fungi, respectively. In addition, oxidative lignocellulose-degradation mechanisms of higher fungi are discussed. Moreover, this paper reviews the current status of the technology for bioconversion of biomass by fungi, with focus on mutagenesis, co-culturing and heterologous gene expression attempts to improve fungal lignocellulolytic activities to create robust fungal strains. PMID:19774110

  18. Fungal Bioconversion of Lignocellulosic Residues; Opportunities & Perspectives

    Directory of Open Access Journals (Sweden)

    Mehdi Dashtban, Heidi Schraft, Wensheng Qin

    2009-01-01

    Full Text Available The development of alternative energy technology is critically important because of the rising prices of crude oil, security issues regarding the oil supply, and environmental issues such as global warming and air pollution. Bioconversion of biomass has significant advantages over other alternative energy strategies because biomass is the most abundant and also the most renewable biomaterial on our planet. Bioconversion of lignocellulosic residues is initiated primarily by microorganisms such as fungi and bacteria which are capable of degrading lignocellulolytic materials. Fungi such as Trichoderma reesei and Aspergillus niger produce large amounts of extracellular cellulolytic enzymes, whereas bacterial and a few anaerobic fungal strains mostly produce cellulolytic enzymes in a complex called cellulosome, which is associated with the cell wall. In filamentous fungi, cellulolytic enzymes including endoglucanases, cellobiohydrolases (exoglucanases and β-glucosidases work efficiently on cellulolytic residues in a synergistic manner. In addition to cellulolytic/hemicellulolytic activities, higher fungi such as basidiomycetes (e.g. Phanerochaete chrysosporium have unique oxidative systems which together with ligninolytic enzymes are responsible for lignocellulose degradation. This review gives an overview of different fungal lignocellulolytic enzymatic systems including extracellular and cellulosome-associated in aerobic and anaerobic fungi, respectively. In addition, oxidative lignocellulose-degradation mechanisms of higher fungi are discussed. Moreover, this paper reviews the current status of the technology for bioconversion of biomass by fungi, with focus on mutagenesis, co-culturing and heterologous gene expression attempts to improve fungal lignocellulolytic activities to create robust fungal strains.

  19. Biotechnological modification of lignin

    Energy Technology Data Exchange (ETDEWEB)

    1989-01-01

    A literature search of organisms capable of degrading lignin was conducted. Four fungi were selected for study and these were Phanerochaete chrysosporium, Chrysosporium pruinosum, Phlebia tremellosus and Trametes versicolor. Other organisms, Pleurotus ostreatus, Pleurotus florida and Lentinus edodes were also tested in preliminary experiments. All cultures were screened for their ability to degrade the lignin component of aspen sawdust and also lignin extracted from steam-exploded wood. This type of screen was followed by analysis of culture filtrates for the presence of ligninase, the marker enzyme for lignin degradation. Phanerochaete chrysosporium and consequently chosen for further studies in fermentors. Considerable efforts were directed to production of ligninase in fermentors. Only when Chrysosporium pruinosum was pre-cultured in a shake flask for 4 days and then transferred to a fermentor could ligninase activity be detected. The enzyme from shake flasks has been concentrated ready for use in bench-scale studies on cell-free depolymerization of lignin. 13 refs., 8 tabs.

  20. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  1. High-level recombinant protein production by the basidiomycetous yeast Pseudozyma antarctica under a xylose-inducible xylanase promoter.

    Science.gov (United States)

    Watanabe, Takashi; Morita, Tomotake; Koike, Hideaki; Yarimizu, Tohru; Shinozaki, Yukiko; Sameshima-Yamashita, Yuka; Yoshida, Shigenobu; Koitabashi, Motoo; Kitamoto, Hiroko

    2016-04-01

    Yeast host-vector systems are useful tools for the production of recombinant proteins. Here, we report the construction of a new high-level expression plasmid pPAX1-neo for the basidiomycetous yeast, Pseudozyma antarctica. pPAX1-neo harbours a xylose-inducible expression cassette under control of the xylanase promoter and terminator of P. antarctica T-34, a selection cassette of neomycin/G418 with an Escherichia coli neomycin resistance gene under control of the homocitrate synthase promoter of strain T-34, and an autonomously replicating sequence fragment of Ustilago maydis (UARS). Biodegradable plastic (BP)-degrading enzymes of P. antarctica JCM10317 (PaE) and Paraphoma-related fungal strain B47-9 (PCLE) were used as reporter proteins and inserted into pPAX1-neo, resulting in pPAX1-neo::PaCLE1 and pPAX1-neo::PCLE, respectively. Homologous and heterologous BP-degrading enzyme production of transformants of P. antarctica T-34 were detected on agar plates containing xylose and emulsified BP. Recombinant PaE were also produced by transformants of other Pseudozyma strains including Pseudozyma aphidis, Pseudozyma rugulosa, and Pseudozyma tsukubaensis. To improve the stability of transformed genes in cells, the UARS fragment was removed from linearized pPAX1-neo::PaCLE1 and integrated into the chromosome of the P. antarctica strain, GB-4(0), which was selected as a PaE producer in xylose media. Two transformants, GB-4(0)-X14 and X49, had an 11-fold higher activity compared with the wild type strain in xylose-containing liquid media. By xylose fed-batch cultivation using a 3-L jar fermentor, GB-4(0)-X14 produced 73.5 U mL(-1) of PaE, which is 13.4-fold higher than that of the wild type strain GB-4(0), which produced 5.5 U mL(-1) of PaE. PMID:26695155

  2. Effect of spent cotton stalks on color removal and chemical oxygen demand lowering in olive oil mill wastewater by white rot fungi.

    Science.gov (United States)

    Kahraman, S; Yeşilada, O

    1999-01-01

    Wastewater from olive oil mill was decolorized (and its chemical oxygen demand reduced in static cultivation) using the fungi Coriolus versicolor, Funalia trogii, Phanerochaete chrysosporium and Pleurotus sajor-caju. The effect of cotton stalk on decolorizing and COD removing capability was demonstrated. P. chrysosporium (in 20% medium with cotton stalk) reduced the COD by 48% and color by 58%, F. trogii (in 30% medium with cotton stalk)) by 51 and 55%, respectively.

  3. Characterization of a novel PQQ-dependent quinohemoprotein pyranose dehydrogenase from Coprinopsis cinerea classified into auxiliary activities family 12 in carbohydrate-active enzymes.

    Science.gov (United States)

    Takeda, Kouta; Matsumura, Hirotoshi; Ishida, Takuya; Samejima, Masahiro; Ohno, Hiroyuki; Yoshida, Makoto; Igarashi, Kiyohiko; Nakamura, Nobuhumi

    2015-01-01

    The basidiomycete Coprinopsis cinerea contains a quinohemoprotein (CcPDH named as CcSDH in our previous paper), which is a new type of pyrroloquinoline-quinone (PQQ)-dependent pyranose dehydrogenase and is the first found among all eukaryotes. This enzyme has a three-domain structure consisting of an N-terminal heme b containing a cytochrome domain that is homologous to the cytochrome domain of cellobiose dehydrogenase (CDH; EC 1.1.99.18) from the wood-rotting basidiomycete Phanerochaete chrysosporium, a C-terminal family 1-type carbohydrate-binding module, and a novel central catalytic domain containing PQQ as a cofactor. Here, we describe the biochemical and electrochemical characterization of recombinant CcPDH. UV-vis and resonance Raman spectroscopic studies clearly reveal characteristics of a 6-coordinated low-spin heme b in both the ferric and ferrous states, as well as intramolecular electron transfer from the PQQ to heme b. Moreover, the formal potential of the heme was evaluated to be 130 mV vs. NHE by cyclic voltammetry. These results indicate that the cytochrome domain of CcPDH possesses similar biophysical properties to that in CDH. A comparison of the conformations of monosaccharides as substrates and the associated catalytic efficiency (kcat/Km) of CcPDH indicates that the enzyme prefers monosaccharides with equatorial C-2, C-3 hydroxyl groups and an axial C-4 hydroxyl group in the 1C4 chair conformation. Furthermore, a binding study shows a high binding affinity of CcPDH for cellulose, suggesting that CcPDH function is related to the enzymatic degradation of plant cell wall. PMID:25679509

  4. Characterization of a novel PQQ-dependent quinohemoprotein pyranose dehydrogenase from Coprinopsis cinerea classified into auxiliary activities family 12 in carbohydrate-active enzymes.

    Directory of Open Access Journals (Sweden)

    Kouta Takeda

    Full Text Available The basidiomycete Coprinopsis cinerea contains a quinohemoprotein (CcPDH named as CcSDH in our previous paper, which is a new type of pyrroloquinoline-quinone (PQQ-dependent pyranose dehydrogenase and is the first found among all eukaryotes. This enzyme has a three-domain structure consisting of an N-terminal heme b containing a cytochrome domain that is homologous to the cytochrome domain of cellobiose dehydrogenase (CDH; EC 1.1.99.18 from the wood-rotting basidiomycete Phanerochaete chrysosporium, a C-terminal family 1-type carbohydrate-binding module, and a novel central catalytic domain containing PQQ as a cofactor. Here, we describe the biochemical and electrochemical characterization of recombinant CcPDH. UV-vis and resonance Raman spectroscopic studies clearly reveal characteristics of a 6-coordinated low-spin heme b in both the ferric and ferrous states, as well as intramolecular electron transfer from the PQQ to heme b. Moreover, the formal potential of the heme was evaluated to be 130 mV vs. NHE by cyclic voltammetry. These results indicate that the cytochrome domain of CcPDH possesses similar biophysical properties to that in CDH. A comparison of the conformations of monosaccharides as substrates and the associated catalytic efficiency (kcat/Km of CcPDH indicates that the enzyme prefers monosaccharides with equatorial C-2, C-3 hydroxyl groups and an axial C-4 hydroxyl group in the 1C4 chair conformation. Furthermore, a binding study shows a high binding affinity of CcPDH for cellulose, suggesting that CcPDH function is related to the enzymatic degradation of plant cell wall.

  5. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  6. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    International Nuclear Information System (INIS)

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  7. GenBank blastx search result: AK061841 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK061841 001-040-E04 S69963.1 mnp2=manganese peroxidase isozyme 2 {heat-shock elements, metal response eleme...nts} [Phanerochaete chrysosporium, Genomic, 3297 nt].|PLN PLN 2e-12 +3 ...

  8. Comparative studies of fungal degradation of single or mixed bioaccessible reactive azo dyes

    OpenAIRE

    Martins, M. Adosinda M.; Lima, Nelson; Silvestre, Armando J. D.; Queiroz, Maria João R. P.

    2003-01-01

    A screening using several fungi (Phanerochaete chrysosporium, Pleurotus ostreatus, Trametes versicolor and Aureobasidium pullulans) was performed on the degradation of syringol derivatives of azo dyes possessing either carboxylic or sulphonic groups, under optimized conditions previously established by us. T. versicolor showed the best biodegradation performance and its potential was confirmed by the degradation of differently substituted fungal bioaccessible dyes. Enzymatic assay...

  9. Studies on the production of fungal peroxidases in Aspergillus niger

    NARCIS (Netherlands)

    Conesa, A.; Hondel, C.A.M.J.J. van den; Punt, P.J.

    2000-01-01

    To get insight into the limiting factors existing for the efficient production of fungal peroxidase in filamentous fungi, the expression of the Phanerochaete chrysosporium lignin peroxidase H8 (lipA) and manganese peroxidase (MnP) H4 (mnp1) genes in Aspergillus niger has been studied. For this purpo

  10. Testing the Tolerance and Growth of eleven Trichoderma Strains to crude oil, naphthalene and phenanthrene

    Energy Technology Data Exchange (ETDEWEB)

    Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.

    2009-07-01

    Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)

  11. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with the degree of soil organic matter humification and available electrolytes.

    Science.gov (United States)

    Gryndler, M; Soukupová, L; Gryndlerová, H; Baldrian, P; Hršelová, H

    2010-09-01

    Spatial distribution of ectomycorrhizae-associated basidiomycetes was determined in oakbirch forest using terminal restriction fragment length polymorphism (T-RFLP) analysis. The data were correlated with actual soil humidity, pH, electric conductivity of the soil extract, absorbance A(465) and A(665) of water and alkali soil extracts and with the ratio A(465)/A(665) (parameter A4/A6). Natural non-homogeneity of the soil parameters was used as experimental gradient. Distance-based redundancy analysis of the T-RFLP data (with soil parameters being taken as environmental parameters) provided significant results when ITS1F-terminanted restriction fragments were analyzed. Among other fungi, a Mycena galericulata related fungus was observed to correlate negatively with A4/A6, indicating its association with highly humified soil organic matter. Positive association of other, unidentified fungi with A4/A6 was also observed. Several other unidentified fungi negatively correlated with electric conductivity of the soil extract. The results may explain nonhomogeneity of the spatial distribution of the fungi associated with ectomycorrhizae as a result of their interaction with non-homogeneous soil environment. PMID:20941580

  12. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi. PMID:16447071

  13. Molecular analysis of ectomycorrhizal basidiomycete communities in a Pinus sylvestris L. stand reveals long-term increased diversity after removal of litter and humus layers.

    Science.gov (United States)

    Smit, Eric; Veenman, Christiaan; Baar, Jacqueline

    2003-07-01

    Abstract The number of fruiting bodies of ectomycorrhizal species in pine forests in The Netherlands has decreased dramatically in recent decades. This decrease has been attributed to an increase in nitrogen deposition and the accumulation of litter and humus. The effects of sod cutting and the removal of litter and humus, to restore ectomycorrhizal diversity in a Scots pine forest in Dwingeloo, The Netherlands, were investigated previously from 1990 to 1993. Removal of the litter and humus resulted in a significant increase in the numbers of species and fruiting bodies of ectomycorrhizal fungi. However, until now all data were obtained by counting fruiting bodies and the effects on mycelial development below ground were not assessed. To investigate hyphal development, DNA was extracted from bulk soil and polymerase chain reaction products were obtained by amplification using basidiomycete-specific internal transcribed spacer (ITS) primers. The differences in diversity between the control plots and the treated plots were analyzed using denaturing gradient gel electrophoresis. To assess the species composition and differences, ITS regions of the amplified fragments were cloned and sequenced. Sequences were compared with sequences from GenBank and from fruiting bodies collected from the same plots. Data indicated increased below-ground ectomycorrhizal diversity in the plots that had been subjected to removal of the litter and humus layers. PMID:19719606

  14. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies.

  15. Screening of basidiomycetes for the production of exopolysaccharide and biomass in submerged culture Triagem de basidiomicetos para a produção de exopolissacarídeos e biomassa em cultura líquida

    OpenAIRE

    Rosana Maziero; Valeria Cavazzoni; Vera Lúcia Ramos Bononi

    1999-01-01

    Fifty-six strains of Basidiomycetes, including native Brazilian fungi isolated from different ecosystems and edible mushrooms, were screened for production of exopolysaccharides and biomass in submerged culture. Agaricus sp. (CCB 280) and Oudemansiella canarii (Jungh.) Hohn (CCB 179) were the highest exopolysaccharide producers (6.01 and 3.54 g dry w./l respectively) after 7 days of incubation. The best producer of biomass was Schizophyllum commune Fr.:Fr. (CCB 473) with 16.68 g dry w./l in 1...

  16. Comparison of ligninolytic activities of selected white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Waldner, R.; Leisola, M.S.A.; Fiechter, A.

    1988-10-01

    Six fast growing ligninolytic white-rot fungi were compared with Phanerochaete chrysosporium. The results showed that the fungi have similar ligninolytic systems, although minor differences exist. Like in P. chrysosporium the ligninolytic system could be induced by veratryl alcohol in Coriolus versicolor and Chrysosporium pruinosum. These three lignin peroxidase producing fungi were the fastest lignin degraders in stationary cultures, whereas in agitated cultures Bjerkandera adusta showed highest lignin degradation rates. Metabolites accumulating during the degradation of veratryl alcohol were analyzed and compared. Peroxidase production seems to be a common feature of all the tested fungi. Polyclonal antibodies against the lignin peroxidase with pl of 4.65 from P. chrysosporium reacted with the extracellular peroxidases of C. pruinosum, C. versicolor and B. adusta, but not with those of Pleurotus ostreatus.

  17. Survey and analysis of simple sequence repeats in the Laccaria bicolor genome, with development of microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2011-01-01

    It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.

  18. Biodegradation of reactive textile dyes by basidiomycetous fungi from brazilian ecosystems Biodegradação de corantes têxteis reativos fungos basidiomicetos do ecossistema brasileiro

    Directory of Open Access Journals (Sweden)

    Kátia M.G. Machado

    2006-12-01

    Full Text Available The potential of Trametes villosa and Pycnoporus sanguineus to decolorize reactive textile dyes used for cotton manufacturing in the State of Minas Gerais, Brazil, was evaluated. Growth and decolorization halos were determined on malt extract agar containing 0.002g L-1 of the dye. T. villosa decolorized all 28 of the tested dyes while P. sanguineus decolorized only 9. The effect of culture conditions (shaking and dye and nitrogen concentration on the degradation of Drimaren Brilliant Blue dye was evaluated during growth of the fungi in liquid synthetic medium. Shaking favored degradation and decolorization was not repressed by nitrogen. In pure culture, T. villosa and P. sanguineus decolorized synthetic effluent consisting of a mixture of 10 dyes. Higher decolorization of the synthetic effluent was observed when a mixed culture of the two fungi was used. This study demonstrated differences between tropical basidiomycete species in terms of their ability to degrade reactive dyes, and reinforces the potential of this group of fungi for the decolorization of textile effluents.O potencial de Trametes villosa e Pycnoporus sanguineus de descolorir corantes têxteis reativos utilizados na manufatura de algodão no estado de Minas Gerais foi avaliado. Halos de crescimento e descoloração foram determinados em agar extrato malte (MEA com 0,002g L-1 do corante. T. villosa descoloriu os 28 corantes testados e P. sanguineus apenas 9. A influência de condições de cultivo (agitação, concentração de corante e concentração de nitrogênio na degradação do corante azul brilhante Drimaren foi avaliada durante crescimento dos fungos em meio líquido sintético. Agitação favoreceu a degradação e não foi observada repressão da descoloração pelo nitrogênio. Em cultura pura, T. villosa e P. sanguineus descoloriram efluente sintético constituído por uma mistura de dez corantes. Maior descoloração do efluente sintético foi observada no cultivo

  19. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants. PMID:26756185

  20. Mineralization of polycyclic aromatic hydrocarbons by the white rot fungus Pleurotus ostreatus

    Energy Technology Data Exchange (ETDEWEB)

    Bezalel, L.; Hadar, Y. [Hebrew Univ. of Jerusalem, Rehovot (Israel); Cerniglia, C.E. [National Center for Toxicological Research, Jefferson, AR (United States)

    1996-01-01

    White rot fungi, including Pleurotus ostreatus, have the ability to efficiently degrade lignin, a naturally occurring aromatic polymer. Previous work has found these organisms were able to degrade PAHs and in some cases to mineralize them; most of the work was done with Phanerochaete chrysosporium. P. ostreatus differs from P. chrysosporium in its lignin degradation mechanism. In this study, enzymatic activities were monitored during P. ostreatus growth in the presence of PAHs and the fungus`s ability to mineralize catechol and various PAHs was demonstrated. 29 refs., 3 figs., 1 tab.

  1. BLEACHING OF SULFONATED CMP FROM BIO-TREATED WHEAT STRAW

    Institute of Scientific and Technical Information of China (English)

    HongYu; MenghuaQin; XuemeiLu; YinboQu; PeijiGao

    2004-01-01

    Wheat straw chemi-mechanical pulp was pretreated with a crude xylanase which was secreted by white rot fungus Phanerochaete Chrysosporium prior to hydrogen peroxide bleaching. The process of xylanase pretreatment and hydrogen peroxide bleaching was optimized. The xylanase treated pulp achieved a brightness gain of 5.8% ISO over the untreated pulp. The xylanase treatment was found to liberate reducing sugars and facilitating lignin removal. Fiber morphology of pulp treated with xylanase was also studied by SEM.

  2. Evaluation of the types of starch for preparation of LDPE/starch blends

    OpenAIRE

    Glória Maria Vinhas; Suzana Moreira de Lima; Lívia Almeida Santos; Maria Alice Gomes de Andrade Lima; Yêda Medeiros Bastos de Almeida

    2007-01-01

    This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w) before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In ...

  3. Visualization of the mycelia of wood-rotting fungi by fluorescence in situ hybridization using a peptide nucleic acid probe.

    Science.gov (United States)

    Nakada, Yuji; Nakaba, Satoshi; Matsunaga, Hiroshi; Funada, Ryo; Yoshida, Makoto

    2013-01-01

    White rot fungus, Phanerochaete chrysosporium, and brown rot fungus, Postia placenta, grown on agar plates, were visualized by fluorescence in situ hybridization (FISH) using a peptide nucleic acid (PNA) probe. Mycelia grown on wood chips were also clearly detected by PNA-FISH following blocking treatment. To the best of our knowledge, this is the first report on the visualization of fungi in wood by FISH. PMID:23391931

  4. Transformation of Industrial Dyes by Manganese Peroxidases from Bjerkandera adusta and Pleurotus eryngii in a Manganese-Independent Reaction

    OpenAIRE

    Heinfling, A.; Martínez, M. J.; Martínez, A. T.; Bergbauer, M.; Szewzyk, U

    1998-01-01

    We investigated the transformation of six industrial azo and phthalocyanine dyes by ligninolytic peroxidases from Bjerkandera adusta and other white rot fungi. The dyes were not oxidized or were oxidized very little by Phanerochaete chrysosporium manganese peroxidase (MnP) or by a chemically generated Mn3+-lactate complex. Lignin peroxidase (LiP) from B. adusta also showed low activity with most of the dyes, but the specific activities increased 8- to 100-fold when veratryl alcohol was includ...

  5. Effect of different carbon sources on decolourisation of an industrial textile dye under alkaline-saline conditions

    OpenAIRE

    Ottoni, C. A.; Lima, Luís; Santos, Cledir; Lima, Nelson

    2014-01-01

    White-rot fungal strains of Trametes versicolor and Phanerochaete chrysosporium were selected to study the decolourisation of the textile dye, Reactive Black 5, under alkaline–saline conditions. Free and immobilised T. versicolor cells showed 100 % decolourisation in the growth medium supplemented with 15 g l-1 NaCl, pH 9.5 at 30 C in liquid batch culture. Continuous culture experiments were performed in a fixed-bed reactor using free and immobilised T. versicolor cel...

  6. Lignin Peroxidase Oxidation of Aromatic Compounds in Systems Containing Organic Solvents

    OpenAIRE

    Vazquez-Duhalt, Rafael; Westlake, Donald W. S.; Fedorak, Phillip M.

    1994-01-01

    Lignin peroxidase from Phanerochaete chrysosporium was used to study the oxidation of aromatic compounds, including polycyclic aromatic hydrocarbons and heterocyclic compounds, that are models of moieties of asphaltene molecules. The oxidations were done in systems containing water-miscible organic solvents, including methanol, isopropanol, N, N-dimethylformamide, acetonitrile, and tetrahydrofuran. Of the 20 aromatic compounds tested, 9 were oxidized by lignin peroxidase in the presence of hy...

  7. Hydrolytic and Oxidative Mechanisms Involved in Cellulose Degradation

    OpenAIRE

    Nutt, Anu

    2006-01-01

    The enzymatic degradation of cellulose is an important process in nature. This thesis has focused on the degradation of cellulose by enzymes from two cellulose-degrading fungi, Hypocrea jecorina and Phanerochaete chrysosporium, including both the action of the individual enzymes and their synergistic interplay. The end-preference of cellobiohydrolases on crystalline cellulose was studied. Cellobiohydrolases belonging to glycosyl hydrolase (GH) family 7 were found to hydrolyse cellulose proce...

  8. Biodegradation of the high explosive hexanitrohexaazaiso-wurtzitane (CL-20).

    Science.gov (United States)

    Karakaya, Pelin; Christodoulatos, Christos; Koutsospyros, Agamemnon; Balas, Wendy; Nicolich, Steve; Sidhoum, Mohammed

    2009-04-01

    The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the CL-20 concentration; levels of carbon (as glycerol) and ammonium sulfate and yeast extract as sources of nitrogen. Cultures that received CL-20 at the time of inoculation transformed CL-20 completely under all nutrient conditions studied. When CL-20 was added to pre-grown cultures, degradation was limited. The extent of mineralization was monitored by the (14)CO(2) time evolution; up to 51% mineralization was achieved when the fungus was incubated with [(14)C]-CL-20. The kinetics of CL-20 biodegradation by Phanerochaete chrysosporium follows the logistic kinetic growth model. PMID:19440524

  9. Bioremediation of Soil Contaminated with Petroleum Using Forced-Aeration Composting

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Laboratory simulation studies and a composting pilot study were conducted to evaluate the capacity of three strains of fungi, indigenous fungus Fusarium sp. and Phanerochaete chrysosporium and Coriolus Versicolor, to remediate petroleum-contaminated soils. In laboratory, the fungi were inoculated into a liquid culture medium and the petroleum-contaminated soil samples for incubation of 40 and 50 days, respectively.In the 200-day pilot study, nutrient contents and moisture were adjusted and maintained under aerobic condition in composting units using concrete container (118.5 cm × 65.5 cm × 12.5 cm) designed specially for this study. The laboratory simulation results showed that all the three fungi were effective in degrading petroleum in the liquid culture medium and in the soil. At the end of both the laboratory incubations, the degradation rates by Phanerochaete chrysosporium were the highest, reaching 66% after incubation in liquid culture for 50 days. This was further demonstrated in the composting pilot study where the degradation rate by P. chrysosporium reached 79% within 200 days, higher than those of the other two fungi (53.1% and 46.1%), indicating that P. chrysosporium was the best fungus for bioremediation of soil contaminated with petroleum. Further research is required to increase degradation rate.Key Words: bioremediation, composting, fungi, petroleum, soil

  10. Investigation of the response of wood-rotting fungi to copper stress by size-exclusion chromatography and capillary zone electrophoresis with ICP MS detection

    Energy Technology Data Exchange (ETDEWEB)

    Vacchina, V.; Szpunar, J. [Group of Bio-inorganic Analytical Chemistry, CNRS UMR 5034, Pau (France); Baldrian, P.; Gabriel, J. [Laboratory of the Biochemistry of the Wood-Rotting Fungi, Institute of Microbiology ASCR, Prague (Czech Republic)

    2002-02-01

    A method based on the coupling of size-exclusion chromatography (SEC) with inductively coupled plasma mass spectrometry (ICP MS) was developed for screening the changes in the bioligand composition of wood-rotting fungi as a function of their exposure to copper stress. Strains of four different species of wood-rotting fungi: Phanerochaete chrysosporium, Schizophyllum commune, Daedalea quercina and Pleurotus ostreatus were examined. Only one, namely Ph. chrysosporium, showed any significant difference in terms of the fingerprint of Cu-binding ligands between control and exposed cells which suggest trapping of Cu(II) by cell walls as the only resistance mechanisms. In the case of Ph. chrysosporium the bioinduction of a new Cu-binding ligand was demonstrated. The presence of a new compound in the SE chromatographic fraction of interest was confirmed by CZE-ICP MS. Attempts to identify the new compound by electrospray MS/MS failed because of insufficient sensitivity. (orig.)

  11. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  12. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  13. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  14. New polymeric model substrates for the study of microbial ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Kawai, S.; Jensen, K.A.; Bao, W.; Hammel, K.E. [Department of Agriculture Forest Products Lab., Madison, WI (United States)

    1995-09-01

    Lignin model dimers are valuable tools for the elucidation of microbial ligninolytic mechanisms, but their low molecular weight (MW) makes them susceptible to nonligninolytic intracellular metabolism. To address this problem, we prepared lignin models in which unlabeled and {alpha}-{sup 14}C-labeled {beta}-O-4-linked dimers were covalently attached to 8,000-MW polyethylene glycol (PEG) or to 45,000-MW polystyrene (PS). The water-soluble PEG-linked model was mineralized extensively in liquid medium and in solid wood cultures by the white rot fungus Phanerochaete chrysosporium, whereas the water-insoluble PS-linked model was not. Gel permeation chromatography showed that P. chrysosporium degraded the PEG-linked model by cleaving its lignin dimer substructure rather than its PEG moiety. C{sub {alpha}}-C{sub {beta}} cleavage was the major fate of the the PEG-linked model after incubation with P. chrysosporium in vivo and also after oxidation with P. chrysosporium lignin peroxidase in vitro. The brown rot fungus Gloeophyllum trabeum, which unlike P. chrysosporium lacks a vigorous extracellular liginolytic system, was unable to degrade the PEG-linked model efficiently. These results show that PEG-linked lignin models are a marked improvement over the low-MW models that have been used in the past. 32 refs., 8 figs., 3 tabs.

  15. A kingdom-specific protein domain HMM library for improved annotation of fungal genomes

    Directory of Open Access Journals (Sweden)

    Oliver Stephen G

    2007-04-01

    Full Text Available Abstract Background Pfam is a general-purpose database of protein domain alignments and profile Hidden Markov Models (HMMs, which is very popular for the annotation of sequence data produced by genome sequencing projects. Pfam provides models that are often very general in terms of the taxa that they cover and it has previously been suggested that such general models may lack some of the specificity or selectivity that would be provided by kingdom-specific models. Results Here we present a general approach to create domain libraries of HMMs for sub-taxa of a kingdom. Taking fungal species as an example, we construct a domain library of HMMs (called Fungal Pfam or FPfam using sequences from 30 genomes, consisting of 24 species from the ascomycetes group and two basidiomycetes, Ustilago maydis, a fungal pathogen of maize, and the white rot fungus Phanerochaete chrysosporium. In addition, we include the Microsporidion Encephalitozoon cuniculi, an obligate intracellular parasite, and two non-fungal species, the oomycetes Phytophthora sojae and Phytophthora ramorum, both plant pathogens. We evaluate the performance in terms of coverage against the original 30 genomes used in training FPfam and against five more recently sequenced fungal genomes that can be considered as an independent test set. We show that kingdom-specific models such as FPfam can find instances of both novel and well characterized domains, increases overall coverage and detects more domains per sequence with typically higher bitscores than Pfam for the same domain families. An evaluation of the effect of changing E-values on the coverage shows that the performance of FPfam is consistent over the range of E-values applied. Conclusion Kingdom-specific models are shown to provide improved coverage. However, as the models become more specific, some sequences found by Pfam may be missed by the models in FPfam and some of the families represented in the test set are not present in FPfam

  16. Enzymatic Strategies and Carbon Use Efficiency of a Litter-Decomposing Fungus Grown on Maize Leaves, Stems, and Roots.

    Science.gov (United States)

    Lashermes, Gwenaëlle; Gainvors-Claisse, Angélique; Recous, Sylvie; Bertrand, Isabelle

    2016-01-01

    Soil microorganisms can control the soil cycles of carbon (C), and depending on their C-use efficiency (CUE), these microorganisms either contribute to C stabilization in soil or produce CO2 when decomposing organic matter. However, little is known regarding the enzyme investment of microbial decomposers and the effects on their CUE. Our objective was to elucidate the strategies of litter-decomposing fungi as a function of litter quality. Fungal biosynthesis and respiration were accounted for by quantifying the investment in enzyme synthesis and enzyme efficiency. The basidiomycete Phanerochaete chrysosporium was grown on the leaves, stems, and roots of maize over 126 days in controlled conditions. We periodically measured the fungal biomass, enzyme activity, and chemical composition of the remaining litter and continuously measured the evolved C-CO2. The CUE observed for the maize litter was highest in the leaves (0.63), intermediate in the roots (0.40), and lowest in the stems (0.38). However, the enzyme efficiency and investment in enzyme synthesis did not follow the same pattern. The amount of litter C decomposed per mole of C-acquiring hydrolase activity was 354 μg C in the leaves, 246 μg C in the roots, and 1541 μg C in the stems (enzyme efficiency: stems > leaves > roots). The fungus exhibited the highest investment in C-acquiring enzyme when grown on the roots and produced 40-80% less enzyme activity when grown on the stems and leaves (investment in enzymes: roots > leaves > stems). The CUE was dependent on the initial availability and replenishment of the soluble substrate fraction with the degradation products. The production of these compounds was either limited because of the low enzyme efficiency, which occurred in the roots, or because of the low investments in enzyme synthesis, which occurred in the stems. Fungal biosynthesis relied on the ability of the fungus to invest in enzyme synthesis and the efficient interactions between the enzymes and

  17. Enzymatic Strategies and Carbon Use Efficiency of a Litter-Decomposing Fungus Grown on Maize Leaves, Stems, and Roots.

    Science.gov (United States)

    Lashermes, Gwenaëlle; Gainvors-Claisse, Angélique; Recous, Sylvie; Bertrand, Isabelle

    2016-01-01

    Soil microorganisms can control the soil cycles of carbon (C), and depending on their C-use efficiency (CUE), these microorganisms either contribute to C stabilization in soil or produce CO2 when decomposing organic matter. However, little is known regarding the enzyme investment of microbial decomposers and the effects on their CUE. Our objective was to elucidate the strategies of litter-decomposing fungi as a function of litter quality. Fungal biosynthesis and respiration were accounted for by quantifying the investment in enzyme synthesis and enzyme efficiency. The basidiomycete Phanerochaete chrysosporium was grown on the leaves, stems, and roots of maize over 126 days in controlled conditions. We periodically measured the fungal biomass, enzyme activity, and chemical composition of the remaining litter and continuously measured the evolved C-CO2. The CUE observed for the maize litter was highest in the leaves (0.63), intermediate in the roots (0.40), and lowest in the stems (0.38). However, the enzyme efficiency and investment in enzyme synthesis did not follow the same pattern. The amount of litter C decomposed per mole of C-acquiring hydrolase activity was 354 μg C in the leaves, 246 μg C in the roots, and 1541 μg C in the stems (enzyme efficiency: stems > leaves > roots). The fungus exhibited the highest investment in C-acquiring enzyme when grown on the roots and produced 40-80% less enzyme activity when grown on the stems and leaves (investment in enzymes: roots > leaves > stems). The CUE was dependent on the initial availability and replenishment of the soluble substrate fraction with the degradation products. The production of these compounds was either limited because of the low enzyme efficiency, which occurred in the roots, or because of the low investments in enzyme synthesis, which occurred in the stems. Fungal biosynthesis relied on the ability of the fungus to invest in enzyme synthesis and the efficient interactions between the enzymes and

  18. Biodecolourisation of reactive red an industrial dye by Phlebia spp. .

    Science.gov (United States)

    Chander, Mukesh; Singh, Daljit; Kaur, Ramandeep

    2014-11-01

    Four white rot fungi namely Phanerochaete chrysosporium, Phlebia floridensis, P. radiata and P. brevispora were selected for their ligninolytic enzymes viz., lignin peroxidase, manganese peroxidase and laccase. Cell free enzyme extracts (as such and concentrated) obtained from these fungi were tested for their ability to decolourise reactive red 28 (Congo red), an industrial dye. The use of cell free enzyme extracts helped to overcome the problem of adsorption of dye to mycelia. Laccase production was best expressed in P. brevispora. Increase in decolourisation percentage by concentrated culture extract was comparable to increase in enzyme activity. P. floridensis proved to be a better dye decolouriser in comparison to Pha. chrysosporium, thus showing its potential for biocleaning of industrial wastes and wastewaters. PMID:25522502

  19. Photochemical and microbial degradation technologies to remove toxic chemicals

    International Nuclear Information System (INIS)

    An effort was made to apply photochemical degradation technology on biodegradation processes to increase the bioremediation potential of microbial actions. For this purpose, we have chosen Phanerochaete chrysosporium, a wood decaying white-rot fungus and a variety of chlorinated pesticides and aromatics as study materials. By using UV-irradiation and benomyl (a commonly used fungicide) as selection methods, a strain of UV-resistant P. chrysosporium was developed. This strain was found to be capable of rapidly degrading these chlorinated chemicals when they were incubated in N-deficient medium which received 1 hr/day of UV-irradiation. UV-irradiation either at 300 or 254 nm showed the beneficial effect of speeding up the rate of degradation on most of test chemicals with the exception of toxaphene and HCH (hexachlorocyclohexane). By adding fresh glucose to the medium it was possible to maintain high degradation capacity for several weeks

  20. Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

    International Nuclear Information System (INIS)

    The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT ampersand E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable for the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs

  1. Animal bioavailability of defined xenobiotic lignin metabolites

    International Nuclear Information System (INIS)

    Lignin has been recognized as a major component of bound pesticide residues in plants and is thought to be undigestible in animals. Two defined ring-U-14C-labeled chloroaniline/lignin metabolites have now been fed to rats, where a release of ∼66% of the bound xenobiotic occurred in the form of simple chloroaniline derivatives. The observed high degree of bioavailability indicates that bound pesticidal residues may possess ecotoxicological significance. In parallel studies, the white-rot fungus Phanerochaete chrysosporium was more efficient, and a soil system was much less efficient, in the degradation of the [ring-U-14C]chloroaniline/lignin metabolites

  2. Inmovilización de hongos ligninolíticos para la remoción del colorante negro reactivo 5

    Directory of Open Access Journals (Sweden)

    Jorge Andrés Fernández

    2009-06-01

    Full Text Available Immobilising lignilolytic fungus for removing reactive black 5 dye Resumen: La presencia de colorantes azoicos en aguas residuales de la industria textil es un problema ambiental y sanitario, porque muchos de estos compuestos son cancerígenos. Los tratamientos biológicos son una alternativa para la remoción de ese tipo de colorantes. En el presente trabajo se evaluó el efecto de tres hongos de podredumbre blanca, Trametes versicolor, Pleurotus ostreatus y Phanerochaete chrysosporium sobre la decoloración de un agua que contiene colorante negro reactivo 5 (NR5, ampliamente usado en la industria textil. Se estudió la inmovilización de estos hongos en dos soportes, espuma de poliuretano y estropajo (L. cylíndrica para seleccionar el mejor soporte y el hongo con mayor capacidad para la decoloración. Ambos soportes fueron igualmente efectivos, pero se seleccionó estropajo por ser un producto natural. El hongo que generó los mayores porcentajes de decoloración en 4 días fue Trametes versicolor, con 96%, 98% y 98% para agua con concentración de NR5 300 ppm, 150 ppm y 75 ppm, respectivamente. La actividad lacasa para cada concentración de NR5 fue 8 U L-1, 7 U L-1 y 5 U L-1.Palabras clave: , Trametes versicolor; Pleurotus ostreatus y Phanerochaete chrysosporium Luffa cylindrinca; espuma de poliuretano y negro reactivo 5. Abstract: Waste water from the textile industry represents a major environmental and health problem because it contains azo dyes whose carcirogenic effect has been tested in research. Biological treatment represents a valuable alternative for removing these dyes. The effect of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium rot fungi on decoloration of water containing reactive black five (NR5 textile dye was evaluated in this work. Immobilising the fungi on polyurethane foam and luffa sponge (Luffa cylindrica supports was studied in order to select the best support and the fungi having the best

  3. SOIL FUNGI: POTENTIAL MYCOREMEDIATORS OF LIGNOCELLULOSIC WASTE

    Directory of Open Access Journals (Sweden)

    Y. Avasn Maruthi

    2010-05-01

    Full Text Available The continual expansion of urbanization and industrial activity has led to the accumulation of a large quantity of lignocellulosic residues throughout the world. In particular, large quantities of paper and bagasse are largely produced in Visakhapatnam. In this work we present the study of the degradability of these substrates with fungi. Three cultures of soil fungi were screened for their ability to degrade cellulose. Aspergillus flavus degraded the most, as shown by the highest CO2 release. Further, Aspergillus flavus was tested with the standard fungus Phanerochaete chrysosporium for cellulose degradation, which showed nearly equivalent potential.

  4. Interacción de Trichoderma viride y agentes químicos antifúngicos en el crecimiento y desarrollo de Sclerotinia sclerotiorum.

    OpenAIRE

    Ordóñez Valencia, Claudia

    2014-01-01

    La presente investigación evaluó los efectos de la interacción entre el bicarbonato de potasio (KHCO3), el fungicida iprodione y el hongo Trichoderma viride, para controlar el crecimiento y desarrollo de Sclerotinia sclerotiorum. Para ello, este trabajo fue dividido en tres capítulos experimentales. El primer capítulo evaluó el potencial antagónico de cuatro hongos filamentosos (Trichoderma viride, Phanerochaete chrysosporium, Trametes sp. y Trametes versicolor) contra Sclerotinia sclerotioru...

  5. Regulation of coal polymer degradation by fungi. Eighth quarterly report, [April--June 1996

    Energy Technology Data Exchange (ETDEWEB)

    Irvine, R.L. [Notre Dame Univ., IN (United States). Dept. of Civil Engineering and Geological Sciences; Bumpus, J.A. [University of Northern Iowa, Cedar Falls, IA (United States). Dept. of Chemistry

    1996-07-28

    This project addresses the solubilization of low-rank coal (leonardite) by lignin degrading fungi. During this reporting period efforts were focused on determining the effect of pH on coal solubilization by oxalate ion and other biologically important compounds that might function as metal chelators, on the role of laccase in coal solubilization and metabolism, on decolorization of soluble coal macromolecule by Phanerochaete chrysosporium and T. versicolor in solid agar media, and on solubilization of coal in slurry cultures and solid phase reactors.

  6. PRODUCTION OF EXTRACELLULAR KERATINASE BY CHRYSOSPORIUM TROPICUM AND TRICHOPHYTON AJELLOI

    OpenAIRE

    Jaroslava Kačinová; Dana Tančinová; Juraj Medo

    2014-01-01

    Keratinous wastes constitute a troublesome environmental contaminant that is produced in large quantities in companies processing of poultry and their further use has ecological significance. We can use for degradation of keratinous wastes enzymes or strains, which produce these enzymes. The aim of this study was isolation of keratinophilic fungi from the soil samples and optimalization of culture conditions of keratinase producing strains in vitro. For the isolation of our strains, we used h...

  7. Transformation behavior of lead fractions during composting of lead-contaminated waste

    Institute of Scientific and Technical Information of China (English)

    LIU Jian-xiao; XU Xiang-min; HUANG Dan-lian; ZENG Guang-ming

    2009-01-01

    The transformation behaviors of Pb fractions during composting of Pb-polluted waste without inoculants and with the inoculants of Phanerochaete chrysosporium were studied. Results show that the active Pb ions with high toxicity and transferability are transformed into the inactive Pb with low toxicity and transferability, confirming that Pb ions can be efficiently immobilized during composting without or with the inoculants. The soluble-exchangeable Pb in composting without inoculants reaches 49.0 mg/kg at day 60, while that with the inoculants is reduced to 0 mg/kg dry mass compost. The higher contents of organic-bound Pb (59.0 mg/kg) and residual Pb (69.2 mg/kg) with low toxicity are found after 60-day composting with inoculants, compared with those without inoculants. The above data indicate the better immobilization effect of Pb and the greater alleviation of Pb hazards in composting with the inoculants of Phanerochaete chrysosporium than without inoculants, which may be due to the more microbial biomass and the higher pH value in composting of Pb-polluted waste with inoculants.

  8. ACCELERATED LABORATORY TEST OF RUBBERWOOD ORIENTED STRANDBOARD EXPOSED TO WOOD DECAY FUNGI

    Directory of Open Access Journals (Sweden)

    Esmeralda Yoshico Arakaki Okino

    2009-10-01

    Full Text Available This work aimed to evaluate the natural durability of oriented strandboards (OSB manufactured with strands of Hevea brasiliensis Müll.Arg. bonded with 5% and 8% of urea-formaldehyde (UF and phenol-formadehyde (FF resins, exposed to xilophagous fungi under laboratory conditions. In accelerated laboratory test decay, samples of OSB were exposed to the following fungi: the brown-rot fungi Gloeophyllum trabeum (Pers. ex Fries Murr., Coniophora puteana (Schumach. : Fr.P. Karst., Meruliporia incrassata (Berk. & M.A. Curtis Murrill as well as the white-rot fungi Fomes annosus (Fr. : Fr. Cooke, Trametes versicolor (L. : Fr. Pilát, Ganoderma applanatum (Pers. Pat., Bjerkandera fumosa (Pers. : Fr. P. Karst. and Phanerochaete chrysosporium Burds. Among the brown-rot fungi, the Gloeophyllum trabeum was the most aggressive, showing the highest loss of mass. Trametes versicolor and Ganoderma applanatum confirmed the preference for broadleave species. All oriented strandboards at lower UF resin contents were more degraded by Phanerochaete chrysosporium, Trametes versicolor, Ganoderma applanatum, Merulia incrassata, Coniophora puteana and Gloeophyllum trabeum, with high rate of loss of mass. Coniophora puteana showed small loss of mass when FF resin was applied. Bjerkandera fumosa showed low loss of mass only at higher resin content. Oriented strandboards exposed to Coniophora puteana showed insignificant OSB degradation.

  9. Utility of four strains of white-rot fungi for the detoxification of 2,4,6-trinitrotoluene in liquid culture

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, K.C.; Chen, J.C.; Huebner, H.J.; Brown, K.W.; Autenrieth, R.L.; Bonner, J.S. [Texas A and M Univ., College Station, TX (United States)

    1997-06-01

    The purpose of this study was to investigate the potential of four different strains of white-rot fungi (Phanerochaete chrysosporium, Phanerochaete sordida, Phlebia brevispora, and Cyathus stercoreus) to degrade 2,4,6-trinitrotoluene (TNT) in liquid medium. Loss of TNT from the culture medium was determined using high-performance liquid chromatography (HPLC), while the mutagenicity of the medium residues were evaluated using the Salmonella/microsome bioassay. The data indicate that within 21 d of incubation, all fungi were able to reduce the TNT concentration in the liquid medium to below detection limits. In this study, P. sordida showed a relatively high growth rate and the fastest rate of TNT degradation. The fungal treatment also produced a significant reduction of TNT mutagenicity. Treatment with C. stercoreus, P. brevispora, P. sordida, and P. chrysosporium resulted in the elimination of 94%, 90%, 87%, and 67% of the initial TNT-amended medium mutagenicity, respectively. The data also demonstrate that during incubation, TNT was eliminated from the culture medium two to eight times faster than the reduction in mutagenic potential. These results suggest that TNT disappearance alone cannot be used as the sole criterion in TNT remediation. Chemical analysis revealed that the major metabolites in the initial transformation of TNT were the monoamino-dinitrotoluenes, which were also degraded by the selected white-rot fungi. The study demonstrated that the white-rot fungi are capable of metabolizing and detoxifying TNT under aerobic conditions in nonligninolytic liquid medium.

  10. Accumulation and degradation of dead-end metabolites during treatment of soil contaminated with polycyclic aromatic hydrocarbons with five strains of white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, B.E. [Centre for Chemistry and Chemical Engineering, Dept. of Biotechnology, Lund Univ. (Sweden); Henrysson, T. [Centre for Chemistry and Chemical Engineering, Dept. of Biotechnology, Lund Univ. (Sweden)

    1996-12-31

    The white-rot fungi Trametes versicolor PRL 572, Trametes versicolor MUCL 28407, Pleurotus ostreatus MUCL 29527, Pleurotus sajor-caju MUCL 29757 and Phanerochaete chrysosporium DSM 1556 were investigated for their ability to degrade the polycyclic aromatic hydrocarbons (PAH) anthracene, benz[a]anthracene and dibenz[a, h]anthracene in soil. The fungi were grown on wheat straw and mixed with artificially contaminated soil. The results of this study show that, in a heterogeneous soil environment, the fungi have different abilities to degrade PAH, with Trametes showing little or no accumulation of dead-end metabolites and Phanerochaete and Pleurotus showing almost complete conversion of anthracene to 9,10-anthracenedione. In contrast to earlier studies, Phanerochaete showed the ability to degrade the accumulated 9,10-anthracenedione while Pleurotus did not. This proves that, in a heterogeneous soil system, the PAH degradation pattern for white-rot fungi can be quite different from that in a controlled liquid system. (orig.)

  11. Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

    Directory of Open Access Journals (Sweden)

    Georgios Koutrotsios

    2014-01-01

    Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.

  12. Utilization of fruit peels as carbon source for white rot fungi biomass production under submerged state bioconversion

    Directory of Open Access Journals (Sweden)

    Olorunnisola Kola Saheed

    2016-04-01

    Full Text Available The present generation of nutrient rich waste streams within the food and hospitality industry is inevitable and remained a matter of concern to stakeholders. Three white rot fungal strains were cultivated under submerged state bioconversion (SmB. Fermentable sugar conversion efficiency, biomass production and substrate utilization constant were indicators used to measure the success of the process. The substrates – banana peel (Bp, pineapple peel (PAp and papaya peel (Pp were prepared in wet and dried forms as substrates. Phanerochaete chrysosporium (P. chrysosporium, Panus tigrinus M609RQY, and RO209RQY were cultivated on sole fruit wastes and their composites. All fungal strains produced profound biomass on dry sole wet substrates, but wet composite substrates gave improved results. P. tigrinus RO209RQY was the most efficient in sugar conversion (99.6% on sole substrates while P. tigrinus M609RQY was efficient on composite substrates. Elevated substrate utilization constant (Ku and biomass production heralded wet composite substrates. P. chrysosporium was the most performing fungal strain for biomass production, while PApBp was the best composite substrate.

  13. Lignolytic Enzymes of a Mushroom Stereum ostrea Isolated from Wood Logs

    Directory of Open Access Journals (Sweden)

    K. Praveen

    2011-01-01

    Full Text Available Production of lignolytic enzymes by the mushroom fungus Stereum ostrea in liquid medium under conditions of vegetative growth was examined for 10 days in comparison to the reference culture Phanerochaete chrysosporium. Though growth and secretion of extracellular protein by S. ostrea were comparable to those of P. chrysosporium, yields of laccase enzyme by S. ostrea were higher than laccase titres of P. chrysosporium by more than 2 folds on the peak production time interval (IVth day of incubation. S. ostrea yielded titres of 25 units of laccase/ml as against 8.9 units of laccase/ml on the IVth day of incubation. Stereum ostrea also exhibited activities of other lignolytic enzymes, lignin peroxidase (LiP and manganese peroxidase (MnP, higher than the reference culture. Growth of S. ostrea on the medium in the presence of Remazol orange 16 resulted in the decolourisation of dye, confirming the presence of lignolytic enzymes. S. ostrea appears to be a promising culture with complete lignolytic system.

  14. Isolation and molecular characterization of polyvinyl chloride (PVC) plastic degrading fungal isolates.

    Science.gov (United States)

    Ali, Muhammad Ishtiaq; Ahmed, Safia; Robson, Geoff; Javed, Imran; Ali, Naeem; Atiq, Naima; Hameed, Abdul

    2014-01-01

    The recalcitrant nature of polyvinyl chloride creates serious environmental concerns during manufacturing and waste disposal. The present study was aimed to isolate and screen different soil fungi having potential to biodegrade PVC films. After 10 months of soil burial experiment, it was observed that a number of fungal strains were flourishing on PVC films. On morphological as well as on 18rRNA gene sequence and phylogenetic basis they were identified as Phanerochaete chrysosporium PV1, Lentinus tigrinus PV2, Aspergillus niger PV3, and Aspergillus sydowii PV4. The biodegradation ability of these fungal isolates was further checked in shake flask experiments by taking thin films of PVC (C source) in mineral salt medium. A significant change in color and surface deterioration of PVC films was confirmed through visual observation and Scanning electron microscopy. During shake flask experiments, P. chrysosporium PV1 produced maximum biomass of about 2.57 mg ml(-1) followed by A. niger PV3. P. chrysosporium PV1 showed significant reduction (178,292 Da(-1)) in Molecular weight of the PVC film than control (200,000 Da(-1)) by gel permeation chromatography. Furthermore more Fourier transform infrared spectroscopy and nuclear magnetic resonance also revealed structural changes in the PVC. It was concluded that isolated fungal strains have significant potential for biodegradation of PVC plastics.

  15. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  16. 三种白腐菌及其组合菌种木质素降解酶比较研究%Comparative studies on lignin degradation enzymes produced by three species of white-rot fungi and combination of the strains

    Institute of Scientific and Technical Information of China (English)

    段传人; 朱丽平; 姚月良

    2009-01-01

    朱红栓菌Trametes cinnabarina、糙皮侧耳Pleurotus ostreatus、黄孢原毛平革菌Phanerochaete chrysosporium是产生木质素降解酶能力强的菌株.对三种白腐菌及其组合菌种产生木质素降解酶能力和行为进行了比较分析和研究.结果表明,最佳培养方式为液体振荡培养;最佳培养基为酵母膏液体培养基.在产漆酶(laccases,lacs)方面,Pleurotus ostreatus和Phanerochaete chrysosporium的组合菌种的酶活最强,在第6天出现峰值,酶活达到450U/L;在产锰过氧化物酶(manganese peroxidases,maps)方面,Trametes cinnabarina和Pleurotus ostreatus的组合菌种的酶活最强,在第10天出现峰值,酶活达到1050U/L;在产木质素过氧化物酶(lignin peroxidases,lips)方面,Trametes cinnabarina和Phanerochaete chrysosporium的组合菌种的酶活最强,在第8天出现产酶峰值,酶活达到2990U/L.筛选结果表明,组合菌种比单菌种产生的三种主要木质素降解酶的活性强,这为白腐菌高效产酶提供了一条新的途径,并为白腐菌研究领域的后续工作奠定基础.%Trametes cinnabarina, Pleurotus ostreatus and Phanerochaete chrysosporium are high-yielding strains producing lignin degradation enzymes. Comparative studies on lignin degradation enzymes produced by these three species of white-rot fungi and combination of the swains were conducted. The results showed that liquid-shaking culture was the best culture method, yeast extract liquid medium was the best medium. As far as laccase (lacs) production was concerned, the enzyme activities of lacs produced by the combination of Pleurotus ostreatus and Phanerochaete chrysosporium were the highest, reaching 450U/L on day 6; the enzyme activities of manganese peroxidases (mnps) produced by the combination of Trametes cinnabarina and Pleurotus ostreatus were the highest, reaching 1050U/L on day 10; the enzyme activities of lignin peroxidases (lips) produced by the combination of Trametes cinnabarina and

  17. Extracellular oxidases and the transformation of solubilised low-rank coal by wood-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ralph, J.P. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Graham, L.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Catcheside, D.E.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences

    1996-12-31

    The involvement of extracellular oxidases in biotransformation of low-rank coal was assessed by correlating the ability of nine white-rot and brown-rot fungi to alter macromolecular material in alkali-solubilised brown coal with the spectrum of oxidases they produce when grown on low-nitrogen medium. The coal fraction used was that soluble at 3.0{<=}pH{<=}6.0 (SWC6 coal). In 15-ml cultures, Gloeophyllum trabeum, Lentinus lepideus and Trametes versicolor produced little or no lignin peroxidase, manganese (Mn) peroxidase or laccase activity and caused no change to SWC6 coal. Ganoderma applanatum and Pycnoporus cinnabarinus also produced no detectable lignin or Mn peroxidases or laccase yet increased the absorbance at 400 nm of SWC6 coal. G. applanatum, which produced veratryl alcohol oxidase, also increased the modal apparent molecular mass. SWC6 coal exposed to Merulius tremellosus and Perenniporia tephropora, which secreted Mn peroxidases and laccase and Phanerochaete chrysosporium, which produced Mn and lignin peroxidases was polymerised but had unchanged or decreased absorbance. In the case of both P. chrysosporium and M. tremellosus, polymerisation of SWC6 coal was most extensive, leading to the formation of a complex insoluble in 100 mM NaOH. Rigidoporus ulmarius, which produced only laccase, both polymerised and reduced the A{sub 400} of SWC6 coal. P. chrysosporium, M. tremellosus and P. tephropora grown in 10-ml cultures produced a spectrum of oxidases similar to that in 15-ml cultures but, in each case, caused more extensive loss of A{sub 400}, and P. chrysosporium depolymerised SWC6 coal. It is concluded that the extracellular oxidases of white-rot fungi can transform low-rank coal macromolecules and that increased oxygen availability in the shallower 10-ml cultures favours catabolism over polymerisation. (orig.)

  18. Low carbon/nitrogen ratio increases laccase production from basidiomycetes in solid substrate cultivation Reduzida relação carbono/nitrogênio aumenta a produção de lacase por basidiomicetos em cultivo de semissólido

    Directory of Open Access Journals (Sweden)

    Érica Clarissa D'Agostini

    2011-06-01

    Full Text Available Basidiomycetes are laccase producers used for hydrolysis of lignocellulosic byproducts in fermentative processes and could be used on biofuel production or ruminant feeding. The objective of this study was to evaluate the effect of concentrations of non-protein nitrogen sources on laccase production and mycelial growth of Pleurotus ostreatus, Lentinula edodes and Agaricus blazei. The fungi were grown on soybean hulls to which urea (U, ammonium sulfate (AS or mixture of AS:U (1:1 were added to achieve carbon/nitrogen (C/N ratios of 5, 15, 20 or 30. The average longitudinal mycelial growth was measured and laccase activity was determined by the oxidation of 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid. Higher C/N ratios increased mycelial growth and decreased laccase production. The highest activities were obtained with a C/N ratio of 5. P. ostreatus, L. edodes and A. blazei produced more laccase when AS, AS:U and U, respectively, were added. In addition, C/N ratios lower than 30 induced laccase syntheses, inhibited mycelial growth and were a better condition for pre-hydrolysis of plant residues.Basidiomicetos são produtores de lacases utilizadas na hidrólise de subprodutos lignocelulósicos em processos fermentativos e pode ser utilizado na produção de biocombustíveis ou na alimentação de ruminantes. Avaliou-se o efeito da adição de fontes e concentrações de nitrogênio não-protéico na produção de lacase e no crescimento micelial de Pleurotus ostreatus, Lentinula edodes e Agaricus blazei. Os fungos foram cultivados em cascas de soja com adição de uréia (U, sulfato de amônio (AS ou AS:U (1:1 de forma a manter a relação carbono/ nitrogênio (C/N de 5, 15, 20 ou 30. O crescimento micelial longitudinal médio foi medido, e a atividade da lacase foi determinada pela oxidação do ácido 2,2'-azino-bis-3-etilbenzotiazolina-6-sulfônico. O crescimento micelial foi diretamente proporcional à relação C/N, enquanto a

  19. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    operating costs and limited applicability. Further, they produce large quantities of sludge, which again creates a problem in its disposal. In recent years, biological decolorization method has been considered as effective, specific, less energy intensive... brown color under and around the fungal colony in guaiacol- supplemented media indicated presence of laccase activity (D’Souza et al. 2006). Theisolateswerescreenedformanganeseperoxidase (MnP) production by growing them on MEA supple- mented with phenol...

  20. A New p-Terphenyl Derivative from Basidiomycetes Boletopsis grisea

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new p-terphenyl derivative 1 was isolated from the fruiting bodies of Boletopsis grisea. Its structure was established as 2, 3-diacetoxy-4', 4", 5, 6-tetrahydroxy-p-terphenyl by spectroscopic and chemical means.

  1. Transgene expression in the basidiomycete root pathogen Armillaria mellea.

    Science.gov (United States)

    Toward development of a genetic transformation system for Armillaria mellea, we used particle bombardment to identify promoters for driving transgene expression. The plasmid tested was pYES-hph-004iGFP, on which the green fluorescence protein gene, gfp, is linked to the Agaricus bisporus gpdII promo...

  2. Gravitropism of basidiomycetous fungi — On Earth and in microgravity

    Science.gov (United States)

    Kern, V. D.

    1999-01-01

    In order to achieve perfect positioning of their lamellae for spore dispersal, fruiting bodies of higher fungi rely on the omnipresent force gravity. Only accurate negatively gravitropic orientation of the fruiting body cap will guarantee successful reproduction. A spaceflight experiment during the STS-55 Spacelab mission in 1993 confirmed that the factor gravity is employed for spatial orientation. Most likely every hypha in the transition zone between the stipe and the cap region is capable of sensing gravity. Sensing presumably involves slight sedimentation of nuclei which subsequently causes deformation of the net-like arrangement of F-actin filament strands. Hyphal elongation is probably driven by hormone-controlled activation and redistribution of vesicle traffic and vesicle incorporation into the vacuoles and cell walls to subsequently cause increased water uptake and turgor pressure. Stipe bending is achieved by way of differential growth of the flanks of the upper-most stipe region. After reorientation to a horizontal position, elongation of the upper flank hyphae decreases 40% while elongation of the lower flank slightly increases. On the cellular level gravity-stimulated vesicle accumulation was observed in hyphae of the lower flank.

  3. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.

    1996-05-01

    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  4. Optimization and kinetics evaluation of biodegradation of synthetic azo reactive dye by fungal consortium.

    Science.gov (United States)

    Chitradevi, V; Sivakumar, V

    2011-10-01

    Wastewater containing direct dyes discharged from various industries, in particular, textile industry, often cause many environmental problems. Among the various effluent treatment methods, biological methods found to be cost effective and do not end up in secondary pollutants. In this study, an attempt has been made to study the decolorization of cibacron yellow S-3R, an azo reactive dye by using fungal cultures such as Coriolus versicolor, Phanerochaete chrysosporium, Pleurotus ostreatus, and Myrothecium verrucaria. The fungi were able to decolorize individually the azo reactive dye cibacron yellow S-3R to an extent of nearly in the range 75 - 85%, whereas the mixed fungal consortium was able to decolorize to an extent of nearly 95%.The study is extended with the kinetics of decolorization of Cibacron yellow S-3R using mixed fungal consortium containing equal proportions of the cultures. The experimental results show that decolorization kinetics follow second order rate equation.

  5. Encapsulation of ligninolytic enzymes and its application in clarification of juice.

    Science.gov (United States)

    Gassara-Chatti, Fatma; Brar, Satinder K; Ajila, C M; Verma, M; Tyagi, R D; Valero, J R

    2013-04-15

    The thermal stability, physico-chemical properties and effect on juice clarification of hydrogel formulations of ligninolytic enzymes from Phanerochaete chrysosporium were evaluated. The results showed that enzyme entrapment increase significantly (Ppectin, 94%, 98%, 88% for laccase, MnP and LiP encapsulated respectively into polyacrylamide/ gelatine and to 87%, 91%, 87% for laccase, MnP and LiP entrapped, respectively into polyacrylamide/carboxymethylcellulose (CMC). When particle size and viscosity of the formulation increased, enzyme stability increased. The polyphenolic reduction and clarity amelioration in mixed juice of berry and pomegranate was more significant (p>0.05) using encapsulated enzymes treatment than free enzymes. This suggested that enzymatic treatment was efficient for the juice clarification.

  6. Effect of different carbon sources on decolourisation of an industrial textile dye under alkaline-saline conditions.

    Science.gov (United States)

    Ottoni, Cristiane; Lima, Luis; Santos, Cledir; Lima, Nelson

    2014-01-01

    White-rot fungal strains of Trametes versicolor and Phanerochaete chrysosporium were selected to study the decolourisation of the textile dye, Reactive Black 5, under alkaline-saline conditions. Free and immobilised T. versicolor cells showed 100 % decolourisation in the growth medium supplemented with 15 g l(-1) NaCl, pH 9.5 at 30 °C in liquid batch culture. Continuous culture experiments were performed in a fixed-bed reactor using free and immobilised T. versicolor cells and allowed 85-100 % dye decolourisation. The immobilisation conditions for the biomass and the additional supply of carbon sources improved the decolourisation performance during a long-term trial of 40 days. Lignin peroxidase, laccase and glyoxal oxidase activities were detected during the experiments. The laccase activity varied depending on carbon source utilized and glycerol-enhanced laccase activity compared to sucrose during extended growth. PMID:23982200

  7. Manganese regulation of manganese peroxidase expression and lignin degradation by the white rot fungus Dichomitus squalens

    International Nuclear Information System (INIS)

    Extracellular manganese peroxidase and laccase activities were detected in cultures of Dichomitus squalens (Polyporus anceps) under conditions favoring lignin degradation. In contrast, neither extracellular lignin peroxidase nor aryl alcohol oxidase activity was detected in cultures grown under a wide variety of conditions. The mineralization of 14C-ring-, -side chain-, and -methoxy-labeled synthetic guaiacyl lignins by D. squalens and the expression of extracellular manganese peroxidase were dependent on the presence of Mn(II), suggesting that manganese peroxidase is an important component of this organism's lignin degradation system. The expression of laccase activity was independent of manganese. In contrast to previous findings with Phanero-chaete chrysosporium, lignin degradation by D. squalens proceeded in the cultures containing excess carbon and nitrogen

  8. Comparison on decolorization of palm oil mill effluent by biological, chemical and physical methods

    Directory of Open Access Journals (Sweden)

    Chantaphaso, S.

    2001-11-01

    Full Text Available Decolorization of palm oil mill effluent pretreated by enzyme from Aspergillus niger ATCC 6275 was investigated. The culture filtrate after separation of suspended solids was used for decolorization by biological, chemical and physical methods. Results indicated that the chemical method (using coagulant was more effective than the biological method (using commercial peroxidase, two strains of white-rot fungi Phanerochaete chrysosporium and Coriolus versicolor and physical method (using activated carbon, pararubber seed and sand filter. Studies on the effect of coagulant concentrations on decolorization revealed that using the combination of 10 ml/l polyferric sulphate and 10 g/l calcium oxide gave the highest color removal of 84.5% and organic matter (in term of chemical oxygen demand, COD removal of 86.5%.

  9. The use of white-rot fungi as active biofilters

    Energy Technology Data Exchange (ETDEWEB)

    Braun-Luellemann, A.; Johannes, C.; Majcherczyk, A.; Huettermann, A. [Univ. Goettingen (Germany). Forstbotanisches Inst.

    1995-12-31

    White-rot fungi, growing on lignocellulosic substrates, have been successfully used as active organisms in biofilters. Filters using these fungi have a very high biological active surface area, allowing for high degrees of retention, a comparatively low pressure drop, and a high physical stability. The unspecific action of the extracellular enzymes of the white-rot fungi allows for the degradation of a wide variety of substances by the same organism. Degradation of several compounds in the gas phase by the white-rot fungi Trametes versicolor, Pleurotus ostreatus, Bjerkandera adusta, and Phanerochaete chrysosporium was tested. Among the aromatic solvents, styrene was the compound that was most readily degraded, followed by ethylbenzene, xylenes, and toluene. Tetrahydrofuran and dichloromethane were also degraded, whereas dioxane could not be attacked by fungi under the conditions used. Acrylonitrile and aniline were degraded very well, whereas pyridine was resistant to degradation. The process for removing styrene is now in the scaling-up stage.

  10. Biodegradation of polycyclic aromatic hydrocarbons (PAHs) by native microflora and combinations of white-rot fungi in a coal-tar contaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Canet, R.; Birnstingl, J.G.; Malcolm, D.G.; Lopez-Real, J.M.; Beck, A.J. [Inst. of Valenciano Invest. Agency, Valencia (Spain)

    2001-07-01

    Four white-rot fungi (Phanerochaete chrysosporium IMI 232175, Pleurotus ostreatus from the University of Alberta Microfungus Collection IMI 341687, Coriolus versicolor IMI210866 and Wye isolate No. 7) and all possible combinations of two or more of these fungi, were incubated in microcosms containing wheat straw and non-sterile coal-tar contaminated soil to determine their potential to degrade polycyclic aromatic hydrocarbons (PAHs). Biotic and abiotic controls were prepared similarly and PAH concentrations remaining in each microcosm were determined after 8, 16 and 32 weeks by GC-MS following extraction with dichloromethane. The greatest PAH losses were in the biotic control. Soil cultures prepared at the end of the experiment showed that though introduced fungi were still alive, they were unable to thrive and degrade PAH in such a highly contaminated soil and remained in a metabolically inactive form.

  11. Lignin peroxidase oxidation of aromatic compounds in systems containing organic solvents.

    Science.gov (United States)

    Vazquez-Duhalt, R; Westlake, D W; Fedorak, P M

    1994-02-01

    Lignin peroxidase from Phanerochaete chrysosporium was used to study the oxidation of aromatic compounds, including polycyclic aromatic hydrocarbons and heterocyclic compounds, that are models of moieties of asphaltene molecules. The oxidations were done in systems containing water-miscible organic solvents, including methanol, isopropanol, N, N-dimethylformamide, acetonitrile, and tetrahydrofuran. Of the 20 aromatic compounds tested, 9 were oxidized by lignin peroxidase in the presence of hydrogen peroxide. These included anthracene, 1-, 2-, and 9-methylanthracenes, acenaphthene, fluoranthene, pyrene, carbazole, and dibenzothiophene. Of the compounds studied, lignin peroxidase was able to oxidize those with ionization potentials of stability characteristics of lignin peroxidase were determined by using pyrene as the substrate in systems containing different amounts of organic solvent. Benzyl alkylation of lignin peroxidase improved its activity in a system containing water-miscible organic solvent but did not increase its resistance to inactivation at high solvent concentrations. PMID:16349176

  12. Melanin synthesis by Sclerotinia sclerotiorum.

    Science.gov (United States)

    Butler, Michael J; Gardiner, Richard B; Day, Alan W

    2009-01-01

    We confirmed that the melanin produced by Sclerotinia sclerotiorum is a dihydroxynaphthalene (DHN). The specific DHN melanogenesis inhibitor test that uses tricyclazole at low levels (typically 2-5 ppm) to cause a confirmatory appearance of soluble red-brown inhibition products does not work when analyzing melanin synthesis in the sclerotia of S. sclerotiorum. We demonstrated the presence of scytalone dehydratase, an enzyme specific to DHN melanogenesis, in melanized sclerotia and melanized nonsclerotial mycelia and observed formation of mycelial nonsclerotial melanin when the fungus was grown on the surface of sterilized dialysis membrane or in rich organic media. Nonsclerotial melanized hyphae in wild type and mutant strains showed the typical excretion of pigmented inhibition products of the DHN pathway in the presence of tricyclazole, and one of these products, 2-hydroxyjuglone, was identified by thin layer chromatography and spectroscopy. We report basic conditions for sclerotial melanin degradation by the white rot fungus Phanerochaete chrysosporium. PMID:19537203

  13. Enzymatic hydrolysis and characterization of waste lignocellulosic biomass produced after dye bioremediation under solid state fermentation.

    Science.gov (United States)

    Waghmare, Pankajkumar R; Kadam, Avinash A; Saratale, Ganesh D; Govindwar, Sanjay P

    2014-09-01

    Sugarcane bagasse (SCB) adsorbes 60% Reactive Blue172 (RB172). Providensia staurti EbtSPG able to decolorize SCB adsorbed RB172 up to 99% under solid state fermentation (SSF). The enzymatic saccharification efficiency of waste biomass after bioremediation of RB172 process (ddSCB) has been evaluated. The cellulolyitc crude enzyme produced by Phanerochaete chrysosporium used for enzymatic hydrolysis of native SCB and ddSCB which produces 0.08 and 0.3 g/L of reducing sugars respectively after 48 h of incubation. The production of hexose and pentose sugars during hydrolysis was confirmed by HPTLC. The effect of enzymatic hydrolysis on SCB and ddSCB has been evaluated by FTIR, XRD and SEM analysis. Thus, during dye biodegradation under SSF causes biological pretreatment of SCB which significantly enhanced its enzymatic saccharification. Adsorption of dye on SCB, its bioremediation under SSF produces wastes biomass and which further utilized for enzymatic saccharification for biofuel production.

  14. Wastewater Treatment for Removal of Recalcitrant Compounds:A Hybrid Process for Decolorization and Biodegradation of Dyes

    Institute of Scientific and Technical Information of China (English)

    Carolyn Palma; Andrea Carvajal; Carlos Vasquez; Elsa Contreras

    2011-01-01

    While conventional wastewater treatments for urban effluents are fairly routine and have proved highly effective,industrial wastewater requires more complex and specific treatments.This paper provides a technological strategy for removal of recalcitrant contaminants based on a hybrid treatment system.The model effluent containing a binary mixture of synthetic dyes is treated by a combination of a preliminary physicochemical stage followed by a biological stage based on ligninolytic enzymes produced by Phanerochaete chrysosporium.This proposal includes biosorption onto peat as pretreatment,which decreases the volume and concentration to be treated in the biological reactor,thereby obtaining a completely decolorized effluent.The treated wastewater can therefore be reused in the dyeing baths with the consequent saving of water resources.

  15. 茶树上冰核活性细菌的分离、鉴定及防治%Identification and control of one strain of ice nucleation active(INA)bacteria isolated from the tea plant

    Institute of Scientific and Technical Information of China (English)

    孙健; 何天良; 江昌俊

    2011-01-01

    霜冻发生时从茶树上分离到1株冰核活性细菌,该菌株在-5℃下在2 min内冻滴率达到85%,一个冰核产生需要的细胞数约为5.4×103个,该菌株具有明显冰核活性.对该菌株进行16S rDNA序列对比分析,判断该菌株为萎蔫短小杆菌(Curtobacterium flaccumfaciens).在-5℃条件下,药剂防治效率顺序为:次氯酸钙>Tween80>藏红>亚甲蓝.在同一生态条件下的土壤中分离出1株拮抗菌,经鉴定该菌株为黄孢原毛平革菌(Phanerochaete chrysosporium).%One of ice nucleation active (INA) bacteria was isolated from the tea plant when frost occurred,and the freezing percentage of this strain was 85% at -5℃ in 2 min. The cells/ice nuclei were about 5.4×103, and the strain shows significant ice nucleation activity. After 16S rDNA sequences of the isolates in GenBank were analyzed, the strain was identified as Curtobacterium flaccumfaciens. The efficiency of chemical control order at - 5℃ was calcium hypochlorite> Tween 80> saffron> methylene blue. Under the same ecological condition, antagonist bacterium was isolated from the soil, which was identified as Phanerochaete chrysosporium.

  16. Oxidative 4-dechlorination of polychlorinated phenols is catalyzed by extracellular fungal lignin peroxidases

    International Nuclear Information System (INIS)

    The extracellular lignin peroxidases (ligninases) of Phanerochaete chrysosporium catalyzed H2O2-dependent spectral changes in several environmentally significant polychlorinated phenols: 2,4-dichloro-, 2,4,5-trichloro-, 2,4,6-trichloro-, and pentachlorophenol. Gas chromatography/mass spectrometry of reduced and acetylated reaction products showed that, in each case, lignin peroxidase catalyzed a 4-dechlorination of the starting phenol to yield a p-benzoquinone. The oxidation of 2,4-dichlorophenol also yielded a dechlorinated coupling dimer, tentatively identified as 2-chloro-6-(2,4-dichlorophenoxy)-p-benzoquinone. Experiments on the stoichiometry of 2,4,6-trichlorophenol oxidation showed that this substrate was quantitatively dechlorinated to give the quinone and inorganic chloride. H218O-labeling experiments on 2,4,6-trichlorophenol oxidation demonstrated that water was the source of the new 4-oxo substituent in 2,6-di-chloro-p-benzoquinone. The results indicate a mechanism whereby lignin peroxidase oxidizes a 4-chlorinated phenol to an electrophilic intermediate, perhaps the 4-chlorocyclohexadienone cation. Nucleophilic attack by water and elimination of HCl then ensue at the 4-position, which produces the quinone. Lignin peroxidases have previously been implicated in the degradation by Phanerochaete of several nonphenolic aromatic pollutants. It appears likely from their results that these peroxidases could also catalyze the initial dechlorination of certain polychlorinated phenols in vivo

  17. Fungal biodegradation of anthracene-polluted cork: A comparative study.

    Science.gov (United States)

    Jové, Patrícia; Olivella, Maria À; Camarero, Susana; Caixach, Josep; Planas, Carles; Cano, Laura; De Las Heras, Francesc X

    2016-01-01

    The efficiency of cork waste in adsorbing aqueous polycyclic aromatic hydrocarbons (PAHs) has been previously reported. Biodegradation of contaminated cork using filamentous fungi could be a good alternative for detoxifying cork to facilitate its final processing. For this purpose, the degradation efficiency of anthracene by three ligninolytic white-rot fungi (Phanerochaete chrysosporium, Irpex lacteus and Pleurotus ostreatus) and three non-ligninolytic fungi which are found in the cork itself (Aspergillus niger, Penicillium simplicissimum and Mucor racemosus) are compared. Anthracene degradation by all fungi was examined in solid-phase cultures after 0, 16, 30 and 61 days. The degradation products of anthracene by P. simplicissimum and I. lacteus were also identified by GC-MS and a metabolic pathway was proposed for P. simplicissimum. Results show that all the fungi tested degraded anthracene. After 61 days of incubation, approximately 86%, 40%, and 38% of the initial concentration of anthracene (i.e., 100 µM) was degraded by P. simplicissimum, P. chrysosporium and I. lacteus, respectively. The rest of the fungi degraded anthracene to a lesser extent (cork itself, could be used as an efficient degrader of PAH-contaminated cork.

  18. Bioremediation of dyes by fungi isolated from contaminated dye effluent sites for bio-usability

    Directory of Open Access Journals (Sweden)

    Babita Rani

    2014-09-01

    Full Text Available Biodegradation and detoxification of dyes, Malachite green, Nigrosin and Basic fuchsin have been carried out using two fungal isolates Aspergillus niger, and Phanerochaete chrysosporium, isolated from dye effluent soil. Three methods were selected for biodegradation, viz. agar overlay and liquid media methods; stationary and shaking conditions at 25 °C. Aspergillus niger recorded maximum decolorization of the dye Basic fuchsin (81.85% followed by Nigrosin (77.47%, Malachite green (72.77% and dye mixture (33.08% under shaking condition. Whereas, P. chrysosporium recorded decolorization to the maximum with the Nigrosin (90.15% followed by Basic fuchsin (89.8%, Malachite green (83.25% and mixture (78.4%. The selected fungal strains performed better under shaking conditions compared to stationary method; moreover the inoculation of fungus also brought the pH of the dye solutions to neutral from acidic. Seed germination bioassay study exhibited that when inoculated dye solutions were used, seed showed germination while uninoculated dyes inhibited germination even after four days of observation. Similarly, microbial growth was also inhibited by uninoculated dyes. The excellent performance of A. niger and P. chrysporium in the biodegradation of textile dyes of different chemical structures suggests and reinforces the potential of these fungi for environmental decontamination.

  19. Bioremediation of dyes by fungi isolated from contaminated dye effluent sites for bio-usability.

    Science.gov (United States)

    Rani, Babita; Kumar, Vivek; Singh, Jagvijay; Bisht, Sandeep; Teotia, Priyanku; Sharma, Shivesh; Kela, Ritu

    2014-01-01

    Biodegradation and detoxification of dyes, Malachite green, Nigrosin and Basic fuchsin have been carried out using two fungal isolates Aspergillus niger, and Phanerochaete chrysosporium, isolated from dye effluent soil. Three methods were selected for biodegradation, viz. agar overlay and liquid media methods; stationary and shaking conditions at 25 °C. Aspergillus niger recorded maximum decolorization of the dye Basic fuchsin (81.85%) followed by Nigrosin (77.47%), Malachite green (72.77%) and dye mixture (33.08%) under shaking condition. Whereas, P. chrysosporium recorded decolorization to the maximum with the Nigrosin (90.15%) followed by Basic fuchsin (89.8%), Malachite green (83.25%) and mixture (78.4%). The selected fungal strains performed better under shaking conditions compared to stationary method; moreover the inoculation of fungus also brought the pH of the dye solutions to neutral from acidic. Seed germination bioassay study exhibited that when inoculated dye solutions were used, seed showed germination while uninoculated dyes inhibited germination even after four days of observation. Similarly, microbial growth was also inhibited by uninoculated dyes. The excellent performance of A. niger and P. chrysporium in the biodegradation of textile dyes of different chemical structures suggests and reinforces the potential of these fungi for environmental decontamination.

  20. Mineralization of 14C-ring-labeled synthetic lignin correlates with the production of lignin peroxidase, not of manganese peroxidase or laccase

    International Nuclear Information System (INIS)

    Recently, Mn(II) has been shown to induce manganese peroxidases (MnPs) and repress lignin peroxidases (LiPs) in defined liquid cultures of several white rot organisms. The present work shows that laccase is also regulated by Mn(II). We therefore used Mn(II) to regulate production of LiP, MnP, and laccase activities while determining the effects of Mn(II) on mineralization of ring-labeled synthetic lignin. At a low Mn(II) level, Phanerochaete chrysosporium and Phlebia brevispora produced relatively high titers of LiPs but only low titers of MnPs. At a high Mn(II) level, MnP titers increased 12- to 20-fold, but LiPs were not detected in crude broths. P. brevispora formed much less LiP then P. chrysosporium, but it also produced laccase activity that increased more than sevenfold at the high Mn(II) level. The rates of synthetic lignin mineralization by these organisms were similar and were almost seven times higher at low than at high Mn(II). Increased synthetic lignin mineralization therefore correlated with increased LiP, not with increased MnP or laccase activities

  1. Effect of microbial pretreatment on enzymatic hydrolysis and fermentation of cotton stalks for ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Jian; Sharma-Shivappa, Ratna R.; Chinn, Mari [Department of Biological and Agricultural Engineering, Campus Box 7625, North Carolina State University, Raleigh, NC 27695-7625 (United States); Howell, Noura [North Carolina School of Science and Mathematics, Durham, NC 27715 (United States)

    2009-01-15

    The potential of microbial pretreatment of cotton stalks by Phanerochaete chrysosporium to degrade lignin and facilitate fuel ethanol production was investigated under two culture conditions: submerged cultivation (SmC) and solid state (SSC) cultivation. Although microbial pretreatments showed significant lignin degradation (LD) (19.38% and 35.53% for SmC and SSC, respectively), a study on hydrolysis and fermentation of the microbial-pretreated cotton stalks showed no increase in cellulose conversion (10.98% and 3.04% for SmC and SSC pretreated samples, respectively) compared to untreated cotton stalks (17.93%). Solid state cultivation demonstrated better selectivity of 0.82 than 0.70 with submerged pretreatment. Washing of pretreated cotton stalks did not significantly increase cellulose conversion. However, heating and washing remarkably improved (P<0.05) cellulose conversion to 14.94% and 17.81% for SmC and SSC 14 day pretreatment, respectively. Ethanol yields, up to 0.027 g ethanol g{sup -1} initial cotton stalks, were low for all untreated and pretreated samples mainly due to the low cellulose conversion. Although potential and some critical aspects of fungal pretreatment using P. chrysosporium have been explored in this study, additional investigation is still required especially to improve the selectivity for preferential LD and to optimize hydrolysis efficiency. The mechanism of catalytic binding of cellulolytic enzymes to cotton stalks as affected by the presence of fungal mycelia also warrants further study. (author)

  2. Evaluation of Potential Fungal Species for the in situ Simultaneous Saccharification and Fermentation (SSF of Cellulosic Material

    Directory of Open Access Journals (Sweden)

    Leeuwen, J.

    2011-01-01

    Full Text Available Three fungal species were evaluated for their abilities to saccharify pure cellulose. The three species chosen represented three major wood-rot molds; brown rot (Gloeophyllum trabeum, white rot (Phanerochaete chrysosporium and soft rot (Trichoderma reesei. After solid state fermentation of the fungi on the filter paper for four days, the saccharified cellulose was then fermented to ethanol by using Saccharomyces cerevisiae. The efficiency of the fungal species in saccharifying the filter paper was compared against a low dose (25 FPU/g cellulose of a commercial cellulase. Total sugar, cellobiose and glucose were monitored during the fermentation period, along with ethanol, acetic acid and lactic acid. Results indicated that the most efficient fungal species in saccharifying the filter paper was T. reesei with 5.13 g/100 g filter paper of ethanol being produced at days 5, followed by P. chrysosporium at 1.79 g/100 g filter paper. No ethanol was detected for the filter paper treated with G. trabeum throughout the five day fermentation stage. Acetic acid was only produced in the sample treated with T. reesei and the commercial enzyme, with concentration 0.95 and 2.57 g/100 g filter paper, respectively at day 5. Lactic acid production was not detected for all the fungal treated filter paper after day 5. Our study indicated that there is potential in utilizing in situ enzymatic saccharification of biomass by using T. reesei and P. chrysosporium that may lead to an economical simultaneous saccharification and fermentation process for the production of fuel ethanol.

  3. Removal of Cr(VI) from aqueous solution by fungal biomass

    Energy Technology Data Exchange (ETDEWEB)

    Ahluwalia, Sarabjeet Singh [Department of Biotechnology, General Shivdev Singh Diwan Gurbachan Singh Khalsa College, Patiala, Punjab (India); Goyal, Dinesh [Department of Biotechnology and Environmental Sciences, Thapar University, Patiala, Punjab (India)

    2010-10-15

    Chromium compounds are released by industrial processes including leather production, mining, petroleum refining, in textile industry and dyeing. They are a significant threat to the environment and public health because of their toxicity. Removal of hexavalent chromium by living biomass of different fungi was effective in the order of Aspergillus terricola>Aspergillus niger>Acremonium strictum>Aureobasidium pullulans>Paecilomyces variotii>Aspergillus foetidus>Cladosporium resinae>Phanerochaete chrysosporium. Non-living dried fungal biomass showed higher potential for metal removal than living cells. Among all fungi dead biomass of P. chrysosporium, C. resinae and P. variotii had the maximum specific chromium uptake capacity, which was 11.02, 10.69 and 10.35 mg/g of dry biomass respectively at pH 4.0-5.0 in batch sorption. Removal of Cr(VI) by P. chrysosporium from multi-metallic synthetic solution as well as chrome effluent was significant by bringing down the residual concentration to 0.1 mg/L in the effluent, which falls within the permissible range and its removal was not affected by the presence of other metal ions such as Fe, Zn and Ni. Fourier transform infrared spectral analysis revealed the presence of carboxylate (C=O) and amine (-NH{sup +}{sub 3}-NH{sup +}{sub 2}) functional groups commonly present on the cell surface of all fungi, with possible involvement in chromium binding. The result indicates that non-living fungal biomass either obtained as a by-product of fermentation industry or mass produced using inexpensive culture media can be used for bioremediation of Cr(VI) from chrome effluent on large scale. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  4. Enhanced enzyme production with the pelleted form of D. squalens in laboratory bioreactors using added natural lignin inducer.

    Science.gov (United States)

    Babič, Janja; Pavko, Aleksander

    2012-03-01

    White-rot fungi are extensively used in various submerged biotechnology processes to produce ligninolytic enzymes. Transfer of the process from the laboratory to the industrial level requires optimization of the cultivation conditions on the laboratory scale. An interesting area of optimization is pellet growth since this morphological form solves problems such as the decreased oxygen concentration, limited heat, and nutrient transport, which usually occur in dispersed mycelium cultures. Many submerged fermentations with basidiomycetes in pellet form were done with Phanerochaete, Trametes, and Bjerkandera species, among others. In our study, another promising basidiomycete, D. squalens, was used for ligninolytic enzyme production. With the addition of wood particles (sawdust) as a natural inducer and optimization of mixing and aeration conditions in laboratory stirred tank (STR) and bubble column (BCR) reactors on pellet growth and morphology, the secretion of laccase and the manganese-dependent peroxidase into the medium was substantially enhanced. The maximum mean pellet radius was achieved after 10 days in the BCR (5.1 mm) where pellets were fluffy and 5 days in the STR (3.5 mm) where they were round and smooth. The maximum Lac activity (1,882 U l(-1)) was obtained after 12 days in the STR, while maximum MnP activity (449.8 U l(-1)) occurred after 18 days in the BCR. The pellet size and morphology depended on the agitation and aeration conditions and consequently influenced a particular enzyme synthesis. The enzyme activities were high and comparable with the activities found for other investigations in reactors with basidiomycetes in the form of pellets. PMID:21922328

  5. Enhanced bioprocessing of lignocellulose: Wood-rot fungal saccharification and fermentation of corn fiber to ethanol

    Science.gov (United States)

    Shrestha, Prachand

    This research aims at developing a biorefinery platform to convert corn-ethanol coproduct, corn fiber, into fermentable sugars at a lower temperature with minimal use of chemicals. White-rot (Phanerochaete chrysosporium), brown-rot (Gloeophyllum trabeum) and soft-rot (Trichoderma reesei) fungi were used in this research to biologically break down cellulosic and hemicellulosic components of corn fiber into fermentable sugars. Laboratory-scale simultaneous saccharification and fermentation (SSF) process proceeded by in-situ cellulolytic enzyme induction enhanced overall enzymatic hydrolysis of hemi/cellulose from corn fiber into simple sugars (mono-, di-, tri-saccharides). The yeast fermentation of hydrolyzate yielded 7.1, 8.6 and 4.1 g ethanol per 100 g corn fiber when saccharified with the white-, brown-, and soft-rot fungi, respectively. The highest corn-to-ethanol yield (8.6 g ethanol/100 g corn fiber) was equivalent to 42 % of the theoretical ethanol yield from starch and cellulose in corn fiber. Cellulase, xylanase and amylase activities of these fungi were also investigated over a week long solid-substrate fermentation of corn fiber. G. trabeum had the highest activities for starch (160 mg glucose/mg protein.min) and on day three of solid-substrate fermentation. P. chrysosporium had the highest activity for xylan (119 mg xylose/mg protein.min) on day five and carboxymethyl cellulose (35 mg glucose/mg protein.min) on day three of solid-substrate fermentation. T. reesei showed the highest activity for Sigma cell 20 (54.8 mg glucose/mg protein.min) on day 5 of solid-substrate fermentation. The effect of different pretreatments on SSF of corn fiber by fungal processes was examined. Corn fiber was treated at 30 °C for 2 h with alkali [2% NaOH (w/w)], alkaline peroxide [2% NaOH (w/w) and 1% H2O 2 (w/w)], and by steaming at 100 °C for 2 h. Mild pretreatment resulted in improved ethanol yields for brown- and soft-rot SSF, while white-rot and Spezyme CP SSFs showed

  6. A biodegradabilidade da blenda de poli(β-Hidroxibutirato-co-Valerato/amido anfótero na presença de microrganismos The Biodegradation of polyhydroxybutyrate-co-valerate/amphiprotic starch in the presence of microorganisms

    Directory of Open Access Journals (Sweden)

    Nadjane S. Coelho

    2008-09-01

    Full Text Available O crescimento do consumo de plásticos vem gerando grandes problemas ambientais, pois um polímero, uma vez descartado no ambiente, necessita de mais de cem anos para se degradar. O plástico ideal deve apresentar propriedades industriais desejáveis e, ao mesmo tempo ser degradável num período considerado satisfatório. Busca-se desenvolver plásticos com boas propriedades para embalagens e que possam ser biodegradados quando descartados ao ambiente. Neste trabalho avaliamos a biodegradação da blenda do copolímero poli(β-hidroxibutirato-co-valerato, PHB-HV, que é um termoplástico natural, biodegradável e biocompatível, e do amido anfótero, na proporção de 75 e 25% m/m, respectivamente. Os resultados foram obtidos através do teste de Sturm, uma metodologia para a avaliação da biodegradação na presença de uma cultura mista dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Os resultados evidenciam a biodegradação da blenda em função do tempo, de acordo com os resultados do teste de Sturm, com o aparecimento de grupos carboxílicos terminais. Foi detectado também o aparecimento de nova simetria cristalina na estrutura polimérica.The increasing consumption of plastics has generated environmental problems because it takes more than a hundred years for a discarded polymer to degrade. The ideal plastic should present desirable industrial properties and be degradable within a satisfactory time period. Researches is conducted to plastics with good properties for packaging, but that are biodegradable when discarded to the environment. In this work we evaluated the biodegradation of the blend of the copolymer poly(hydroxybutyrate-hydroxyvalerate, PHB-HV, which is a natural, biodegradable and biocompatible thermoplastic, and of the starch amphiprotic, in the proportion of 75 and 25% m/m, respectively. The results were obtained through the Sturm test, a methodology for the evaluation of biodegradation in the presence

  7. Enzymantic Conversion of Coal to Liquid Fuels

    Energy Technology Data Exchange (ETDEWEB)

    Richard Troiano

    2011-01-31

    The work in this project focused on the conversion of bituminous coal to liquid hydrocarbons. The major steps in this process include mechanical pretreatment, chemical pretreatment, and finally solubilization and conversion of coal to liquid hydrocarbons. Two different types of mechanical pretreatment were considered for the process: hammer mill grinding and jet mill grinding. After research and experimentation, it was decided to use jet mill grinding, which allows for coal to be ground down to particle sizes of 5 {mu}m or less. A Fluid Energy Model 0101 JET-O-MIZER-630 size reduction mill was purchased for this purpose. This machine was completed and final testing was performed on the machine at the Fluid Energy facilities in Telford, PA. The test results from the machine show that it can indeed perform to the required specifications and is able to grind coal down to a mean particle size that is ideal for experimentation. Solubilization and conversion experiments were performed on various pretreated coal samples using 3 different approaches: (1) enzymatic - using extracellular Laccase and Manganese Peroxidase (MnP), (2) chemical - using Ammonium Tartrate and Manganese Peroxidase, and (3) enzymatic - using the live organisms Phanerochaete chrysosporium. Spectral analysis was used to determine how effective each of these methods were in decomposing bituminous coal. After analysis of the results and other considerations, such as cost and environmental impacts, it was determined that the enzymatic approaches, as opposed to the chemical approaches using chelators, were more effective in decomposing coal. The results from the laccase/MnP experiments and Phanerochaete chrysosporium experiments are presented and compared in this final report. Spectra from both enzymatic methods show absorption peaks in the 240nm to 300nm region. These peaks correspond to aromatic intermediates formed when breaking down the coal structure. The peaks then decrease in absorbance over time

  8. Vegetal waste degradation by microbial strains inoculation Degradación de residuos vegetales mediante inoculación con cepas microbianas

    Directory of Open Access Journals (Sweden)

    Nubia Grijalva Vallejos

    2013-06-01

    Full Text Available (Received: 2013/03/31 - Accepted: 2013/06/02Vegetal waste treatment product of urban, agricultural and industrial processes has severaltechnical problems and constitutes a significant environmental concern. Among them are thepersistence of crop protection products in high concentrations in plant material and the lack ofmicroorganisms that can tolerate such compounds and efficiently decompose the substrate.Bacteria and mainly white rot fungi are the main decomposers of lignin because of their ability tosynthesize extracellular hydrolytic and oxidative enzymes in large quantities. Trichodermareesei, Aspergillus niger, Penicillium sp. and Phanerochaete chrysosporium strains are modelstrains whose hight degradation efficiency with lignocellulose materials even in the presence ofpollutants has been proven. Several studies such as directed mutagenesis, co-culturing andheterologous expression have been done in order to improve the content of some enzymes(cellulase, xylanase, and β-glucosidase in model strains, additionally it has been done newgenetic searches to find other microorganisms with this potential. Its main applications are theindustrial production of ethanol and some seconday metabolites under controlled conditions infermentation processes. This review provides an overview about strategies and methodologiescurrently used for vegetal waste utilization by inoculation of microbial strains.(Recibido: 2013/03/31 - Aceptado: 2013/06/02El tratamiento de los residuos vegetales producto de desechos urbanos, procesos agrícolas eindustriales enfrenta varios problemas técnicos y constituye una preocupación ambientalimportante. Entre ellos se destacan la permanencia de productos fitosanitarios en altasconcentraciones en el material vegetal unido a la carencia de microorganismos que puedantolerar dichos compuestos y logren descomponer eficientemente el sustrato. Las bacterias yprincipalmente los hongos de la podredumbre blanca son los mejores

  9. Evaluation of the types of starch for preparation of LDPE/starch blends

    Directory of Open Access Journals (Sweden)

    Glória Maria Vinhas

    2007-05-01

    Full Text Available This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In spite of the short time that the blends were exposed to the fungi, the microorganisms promoted physical and chemical changes in the structure of the blend, modifying its thermal and mechanical properties. The alteration of the degree of crystallinity and mechanical properties of the blends could be indications of the modification caused by the biodegradation process.Nesse trabalho foi realizado um estudo sobre diferentes tipos de amido quanto ao crescimento, e a atividade amilolítica de culturas mistas e isoladas dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Avaliaram-se também as propriedades térmicas e mecânicas das blendas de polietileno/amido anfótero (na proporção 80/20 (m/m antes e apos a inoculação das culturas mistas desses fungos.O amido regular Amidex 3 e o amido modificado Fox5901 foram os que se destacaram quanto ao crescimento celular e produção da enzima amilase. Apesar do pouco tempo de exposição dos filmes com os fungos, pode-se concluir que os microrganismos promovem mudanças físicas e químicas na estrutura da blenda, modificando suas propriedades térmicas e mecânicas. A alteração do grau de cristalinidade e das propriedades mecânicas das blendas podem ser indícios da modificação provocada pelo processo de biodegradação.

  10. Biodegradation of volatile organic compounds by five fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Qi, B.; Moe, W.M. [Dept. of Civil and Environmental Engineering, Louisiana State Univ., Baton Rouge, LA (United States); Kinney, K.A. [Dept. of Civil Engineering, Univ. of Texas, Austin (United States)

    2002-07-01

    Five fungal species, Cladosporium resinae (ATCC 34066), Cladosporium sphaerospermum (ATCC 200384), Exophiala lecanii-corni (CBS 102400), Mucor rouxii (ATCC 44260), and Phanerochaete chrysosporium (ATCC 24725), were tested for their ability to degrade nine compounds commonly found in industrial off-gas emissions. Fungal cultures inoculated on ceramic support media were provided with volatile organic compounds (VOCs) via the vapor phase as their sole carbon and energy sources. Compounds tested included aromatic hydrocarbons (benzene, ethylbenzene, toluene, and styrene), ketones (methyl ethyl ketone, methyl isobutyl ketone, and methyl propyl ketone), and organic acids (n-butyl acetate, ethyl 3-ethoxypropionate). Experiments were conducted using three pH values ranging from 3.5 to 6.5. Fungal ability to degrade each VOC was determined by observing the presence or absence of visible growth on the ceramic support medium during a 30-day test period. Results indicate that E. lecanii-corni and C. sphaerospermum can readily utilize each of the nine VOCs as a sole carbon and energy source. P. chrysosporium was able to degrade all VOCs tested except for styrene under the conditions imposed. C. resinae was able to degrade both organic acids, all of the ketones, and some of the aromatic compounds (ethylbenzene and toluene); however, it was not able to grow utilizing benzene or styrene under the conditions tested. With the VOCs tested, M. rouxii produced visible growth only when supplied with n-butyl acetate or ethyl 3-ethoxypropionate. Maximum growth for most fungi was observed at a pH of approximately 5.0. The experimental protocol utilized in these studies is a useful tool for assessing the ability of different fungal species to degrade gas-phase VOCs under conditions expected in a biofilter application. (orig.)

  11. Degradation of CL-20 by white-rot fungi.

    Science.gov (United States)

    Fournier, Diane; Monteil-Rivera, Fanny; Halasz, Annamaria; Bhatt, Manish; Hawari, Jalal

    2006-03-01

    In previous studies, we found that the emerging energetic chemical, CL-20 (C6H6N12O12, 2,4,6,8,10,12-hexanitro-2,4,6,8,10,12-hexaazaisowurtzitane), can be degraded following its initial denitration using both aerobic and anaerobic bacteria. The C and N mass balances were not determined due to the absence of labeled starting compounds. The present study describes the degradation of the emerging contaminant by Phanerochaete chrysosporium using ring-labeled [15N]-CL-20 and [14C]-CL-20. Ligninolytic cultures degraded CL-20 with the release of nitrous oxide (N2O) in amounts corresponding to 45% of the nitrogen content of CL-20. When ring-labeled [15N]-CL-20 was used, both 14N14NO and 15N14NO were observed, likely produced from -NO2 and N-NO2, respectively. The incubation of uniformly labeled [14C]-CL-20 with fungi led to the production of 14CO2 (> 80%). Another ligninolytic fungus, Irpex lacteus, was also able to degrade CL-20, but as for P. chrysosporium, no early intermediates were observed. When CL-20 was incubated with manganese peroxidase (MnP), we detected an intermediate with a [M-H]- mass ion at 345 Da (or 351 and 349 Da when using ring-labeled and nitro-labeled [15N]-CL-20, respectively) matching a molecular formula of C6H6N10O8. The intermediate was thus tentatively identified as a doubly denitrated CL-20 product. The concomitant release of nitrite ions (NO2-) with CL-20 degradation by MnP also supported the occurrence of an initial denitration prior to cleavage and decomposition. PMID:16112713

  12. Biological treatment with fungi of olive mill wastewater pre-treated by photocatalytic oxidation with nanomaterials.

    Science.gov (United States)

    Nogueira, V; Lopes, I; Freitas, A C; Rocha-Santos, T A P; Gonçalves, F; Duarte, A C; Pereira, R

    2015-05-01

    Olive mill wastewater (OMW) still is a major environmental problem due to its high chemical oxygen demand (COD) and total phenolic content (TPC), contributing for the high toxicity and recalcitrant nature. Several attempts have been made for developing more efficient treatment processes, but no chemical or biological approaches were found to be totally effective, especially in terms of toxicity reduction. In this context, the main purpose of this study was to investigate the treatability of OMW by the combination of photocatalytic oxidation, using two nanomaterials as catalysts (TiO2 and Fe2O3), with biological degradation by fungi (Pleurotus sajor caju and Phanerochaete chrysosporium). Photocatalytic oxidation was carried out using different systems, nano-TiO2/UV, nano-Fe2O3/UV, nano-TiO2/H2O2/UV and nano-Fe2O3/H2O2/UV. The effectiveness of the treatment was assessed through color (465nm), aromatics (270nm), COD and TPC reductions, as well as by the decrease in toxicity using the bacterium Vibrio fischeri. The chemical treatment with the system nano-TiO2/H2O2/UV promoted 43%, 14%, 38% and 31% reductions in color, aromatics content, COD and TPC, respectively. However no toxicity reduction was observed. The combination with a biological treatment increased the reduction of COD and TPC as well as a reduction in toxicity. The treatment with P. chrysosporium promoted the highest reduction in toxicity, but P. sajor caju was responsible for the best reduction in COD and TPC. However, the biological treatment was more effective when no hydrogen peroxide was used in the pre-treatment.

  13. ИСПОЛЬЗОВАНИЕ ДЕРЕВОРАЗРУШАЮЩИХ ГРИБОВ КЛАССА BASIDIOMYCETES В НЕТРАДИЦИОННОЙ МЕДИЦИНЕ (АМУРСКАЯ ОБЛАСТЬ)

    OpenAIRE

    Кочунова, Наталья

    2014-01-01

    В последние годы, как за рубежом, так и в России усиленно ведутся поиск и испытание новых лекарственных препаратов, полученных из грибов. Перспективным источником целебных веществ являются базидиальные грибы (класс Basidiomycetes ), В статье приводятся литературные сведения и собственные данные относительно лекарственных свойств 52 видов дереворазрушающих базидиальных грибов, распространенных в Амурской области и перспективных для использования местным населением в нетрадиционной медицине. Ра...

  14. Evaluation of Pb (II) biosorption utilizing sugarcane bagasse colonized by Basidiomycetes.

    Science.gov (United States)

    Palin, D; Rufato, K B; Linde, G A; Colauto, N B; Caetano, J; Alberton, O; Jesus, D A; Dragunski, D C

    2016-05-01

    The contamination of water resources by metallic ions is a serious risk to public health and the environment. Therefore, a great emphasis has been given to alternative biosorption methods that are based on the retention of aqueous-solution pollutants; in the last decades, several agricultural residues have been explored as low-cost adsorbent. In this study, the ability of Pb (II) biosorption using sugarcane bagasse modified by different fungal species was evaluated. The presence of carbonyl, hydroxyl, and carboxyl groups in the biosorbent was observed by spectroscopy in the infrared region. By scanning electron microscopy, changes in the morphology of modified material surfaces were observed. The highest adsorption capacity occurred at pH 5.0, while the shorter adsorbate-adsorbent equilibrium was at 20 min, and the system followed the pseudo-second-order model. The maximum biosorption in isotherms was found at 58.34 mg g(-1) for modified residue by Pleurotus ostreatus U2-11, and the system followed the Langmuir isotherm. The biosorption process was energetically spontaneous with low desorption values. This modification showed great potential for filters to remove Pb (II) and provide the preservation of water resources and animal health. PMID:27063515

  15. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  16. Amaurocine: Anti-Trichomonas vaginalis protein produced by the basidiomycete Amauroderma camerarium.

    Science.gov (United States)

    Duarte, Mariana; Seixas, Adriana; Peres de Carvalho, Maira; Tasca, Tiana; Macedo, Alexandre José

    2016-02-01

    Trichomonas vaginalis is the causative agent of trichomoniasis, the most common nonviral STD worldwide. This infection can lead to severe health conditions, especially when women are affected. Metronidazole and tinidazole are the only choices of treatment. In this sense, natural bioactive compounds against T. vaginalis are an interesting approach in the search for more efficient therapies. Herein, amaurocine, a 12 kDa protein, produced by the mushroom Amauroderma camerarium was purified and tested against T. vaginalis, including two fresh clinical isolates. Amaurocine presented MIC values at 2.6 μM against the ATCC isolate 30236, and 5.2 μM against the fresh clinical isolates, TV-LACH1 and TV-LACM2. Furthermore, besides increasing human neutrophils nitric oxide release, amaurocine presented a low toxicity toward those cells, suggesting it exerts a proinflammatory character.

  17. Studies on ectomycorrhizal basidiomycete in pine forest on the Lithuania-Poland transboundary region

    Directory of Open Access Journals (Sweden)

    Danutė Stankovičienė

    2013-12-01

    Full Text Available The diversity of ectomycorrhizal fungi and sporocarps abundance were investigated in 2003-2005 at nine permanent study plots in a 50-year-old pine forest. Diversity of ectomycorrhizal fungi consisted of 53 taxa and the majority of them belonged to the genera Cortinarius, Russula, Amanita and Tricholoma. The most frequent species, whose fruit bodies were found in each study plot, were C. cibarius, L. necator L. rufus, P. involutus, R. aeruginea, T. saponaceum and the most abundant species which made the main part of total sporocarp yield were C. cibarius and P. involutus. The lowest species richness of ectomycorrhizal fungi was in study plots with the densest cover of grasses. Maximum of species over the fruiting period was characteristic for October and for September. It was noticed that some species virtually never occurred together at the same plot (eg. C. cibarius and H. aurantiaca, meanwhile others occurred together quite frequently (eg. H.aurantiaca and X. badius.

  18. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials. PMID:24586250

  19. Genetic characterization of isolates of the basidiomycete Agaricus blazei by RAPD

    Directory of Open Access Journals (Sweden)

    Colauto Nelson Barros

    2002-01-01

    Full Text Available The genetic divergence of five isolates of Agaricus blazei was determined based on RAPD data. Results indicate that there is little genetic variability among the commercialized strains and that RAPD is a feasible and low cost technique that can be used to characterize this fungus.

  20. Genetic characterization of isolates of the basidiomycete Agaricus blazei by RAPD

    OpenAIRE

    Colauto Nelson Barros; Dias Eustáquio Souza; Gimenes Marcos Aparecido; Eira Augusto Ferreira da

    2002-01-01

    The genetic divergence of five isolates of Agaricus blazei was determined based on RAPD data. Results indicate that there is little genetic variability among the commercialized strains and that RAPD is a feasible and low cost technique that can be used to characterize this fungus.

  1. The community structure of macroscopic basidiomycetes (Fungi) in Brazilian mangroves influenced by temporal and spatial variations.

    Science.gov (United States)

    Nogueira-Melo, Georgea Santos; Santos, Paulo Jorge Parreira; Gibertoni, Tatiana Baptista

    2014-12-01

    Mangroves are transitional ecosystems between terrestrial and marine environments, and are dis- tinguished by a high abundance of animals, plants, and fungi. Although macrofungi occur in different types of habitat, including mangroves, little is known about their community structure and dynamic. Therefore the aim of this study was to analyze the diversity of macrofungi in a number of Brazilian mangroves, and the relation- ship between such diversity, precipitation and area of collection. A total of 32 field trips were undertaken from 2009 to 2010, and macrofungi were studied in four 250 x 40 m transects: Timbó and Santa Cruz Channel on the Northern coast, and Maracaipe and Ariquindá on the Southern coast. All basidiomata found along the transects were placed in paper bags, air-dried and identified using existing literature. It was found that Northern areas predominantly featured Avicennia schaueriana mangroves, while Rhizophora mangle dominated in Southern transects. A total of 275 specimens were collected, and 33 species, 28 genera, 14 families and six orders were represented. Overall abundance and species richness did not vary significantly among areas, but varied according to time, being higher during the rainy season. Subtle differences in composition were observed over time and between areas, probably due to variations in plant species occurrence. Further studies with collections during months of greater precipitation in transects dominated by different mangrove species of the same ecosystem are suggested to assess the overall diversity of mycobiota in these ecosystems.

  2. Antioxidant Properties of the Edible Basidiomycete Armillaria mellea in Submerged Cultures

    Directory of Open Access Journals (Sweden)

    Ming-Yeou Lung

    2011-09-01

    Full Text Available Antioxidant components, ascorbic acid, total flavonoids and total phenols are produced effectively by Armillaria mellea submerged cultures. Dried mycelia and mycelia-free broths obtained by A. mellea submerged cultures are extracted with methanol and hot water and investigated for antioxidant properties. Methanolic extracts from dried mycelia (MEM and mycelia-free broth (MEB and hot water extracts from dried mycelia (HWEM by A. mellea submerged cultures show good antioxidant properties as evidenced by low EC50 values (< 10 mg/mL. Total flavonoid is mainly found in hot water extracts; however, total phenol is rich in methanol and hot water extracts from mycelia. Ascorbic acid and total phenol contents are well correlated with the reducing power and the scavenging effect on superoxide anions. Total flavonoid content is dependent on the antioxidant activity and the chelating effect on ferrous ions. Total antioxidant component contents are closely related to the antioxidant activity and the scavenging superoxide anion ability. Results confirm that extracts with good antioxidant properties from fermenting products by A. mellea are potential good substitutes for synthetic antioxidants and can be applied to antioxidant-related functional food and pharmaceutical industries.

  3. Phylogenetic, genomic organization and expression analysis of hydrophobin genes in the ectomycorrhizal basidiomycete Laccaria bicolor

    OpenAIRE

    Plett, Jonathan M.

    2014-01-01

    Hydrophobins are morphogenetic, small secreted hydrophobic fungal proteins produced in response to changing development and environmental conditions. These proteins are important in the interaction between certain fungi and their hosts. In mutualistic ectomycorrhizal fungi several hydrophobins form a subclass of mycorrhizal-induced small secreted proteins that are likely to be critical in the formation of the symbiotic interface with host root cells. In this study, two genomes of the ectomyco...

  4. Studies on ectomycorrhizal basidiomycete in pine forest on the Lithuania-Poland transboundary region

    OpenAIRE

    Danutė Stankovičienė; Jonas Kaspravičius

    2013-01-01

    The diversity of ectomycorrhizal fungi and sporocarps abundance were investigated in 2003-2005 at nine permanent study plots in a 50-year-old pine forest. Diversity of ectomycorrhizal fungi consisted of 53 taxa and the majority of them belonged to the genera Cortinarius, Russula, Amanita and Tricholoma. The most frequent species, whose fruit bodies were found in each study plot, were C. cibarius, L. necator L. rufus, P. involutus, R. aeruginea, T. saponaceum and the most abundant species whic...

  5. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  6. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands

    OpenAIRE

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-01-01

    Background Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and s...

  7. Safety assessment of the royal sun mushroom, Agaricus brasiliensis (higher Basidiomycetes) intake during rat pregnancy.

    Science.gov (United States)

    Gerenutti, Marli; Tribuiani, Natalia; Oliveira, Bruna Ryzik; Rosa-Castro, Raquel Mendonca; Frizo, Italo; Oshima-Franco, Yoko; Grotto, Denise

    2014-01-01

    In this study, we investigated the reproductive capacity of pregnant rats exposed to daily orally administered powder-dehydrated reconstituted of Agaricus brasiliensis (=Agaricus blazei sensu Murrill), the fetal organogenesis, and the development of the pups. Pregnant rats were exposed for the entire gestational period to water (control) and A. brasiliensis at 300 or 600 mg/kg/day. Fertility and body weight of dams were monitored. Pups were monitored for body weight, offspring vitality, morphology, and physical and neurobehavioral development. An increase in sternebrae agenesis was observed at the 600 mg/kg/day dose of A. brasiliensis, while incomplete ossification of sternebrae was seen even at a 300 mg/kg/day dose. In conclusion, this study is the first to demonstrate the impact of maternal exposure to A. brasiliensis on the fetal organogenesis and development of offspring in a rat model. The 600 mg/kg/day dose showed some negative effects, and low toxicity was observed at the 300 mg/kg/day dose.

  8. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens. PMID:27279445

  9. Antioxidant Effects of Medicinal Mushrooms Agaricus brasiliensis and Ganoderma lucidum (Higher Basidiomycetes): Evidence from Animal Studies.

    Science.gov (United States)

    Yurkiv, Borys; Wasser, Solomon P; Nevo, Eviatar; Sybirna, Nataliya O

    2015-01-01

    With diabetes mellitus and increased glucose concentrations, the mitochondria electron transport chain is disrupted, superoxide anions are overproduced, and oxidative stress develops in cells. Thus, preventing oxidative stress can produce a decrease in the antioxidant system activity and an increase in apoptosis in immune cells. The application of medicinal mushrooms is a new possible approach to diabetes mellitus treatment. Therefore, the aim of this work was to investigate the influence of administration of the medicinal mushrooms Agaricus brasiliensis and Ganoderma lucidum on antioxidant enzyme activity in rat leukocytes. Wistar outbred white rats were used in the study. Streptozotocin was intraperitoneally injected once at a dose of 50 mg/kg body weight. Mushroom preparations were orally administered at a dose of 1 g/kg/day for 2 weeks. This revealed that in diabetes mellitus, the level of antioxidant enzyme activity is significantly decreased compared with control values, whereas the levels of lipid peroxidation is increased; this manifested in an increase in the amount of thiobarbituric acid reactive substances (TBARS). The medicinal mushrooms' administration is accompanied by an increase in antioxidant enzyme activity to control values and is even higher in the case of A. brasiliensis administration when compared with the diabetic group. As for the indicators of lipid peroxidation under mushroom administration of A. brasiliensis and G. lucidum, we observed a significant decrease of TBARS levels compared with the diabetic group. Increased activity of antioxidant enzymes and reduction of TBARS level indicate pronounced antioxidant properties of studied mushrooms. PMID:26756186

  10. Ethanol production from high cellulose concentration by the basidiomycete fungus Flammulina velutipes.

    Science.gov (United States)

    Maehara, Tomoko; Ichinose, Hitomi; Furukawa, Takanori; Ogasawara, Wataru; Takabatake, Koji; Kaneko, Satoshi

    2013-03-01

    Ethanol production by Flammulina velutipes from high substrate concentrations was evaluated. F. velutipes produces approximately 40-60 g l(-1) ethanol from 15% (w/v) D-glucose, D-fructose, D-mannose, sucrose, maltose, and cellobiose, with the highest conversion rate of 83% observed using cellobiose as a carbon source. We also attempted to assess direct ethanol fermentation from sugarcane bagasse cellulose (SCBC) by F. velutipes. The hydrolysis rate of 15% (w/v) SCBC with commercial cellulase was approximately 20%. In contrast, F. velutipes was able to produce a significant amount of ethanol from 15% SCBC with the production of β-glucosidase, cellobohydrolase, and cellulase, although the addition of a small amount of commercial cellulase to the culture was required for the conversion. When 9 mg g(-1) biomass of commercial cellulase was added to cultures, 0.36 g of ethanol was produced from 1 g of cellulose, corresponding to an ethanol conversion rate of 69.6%. These results indicate that F. velutipes would be useful for consolidated bioprocessing of lignocellulosic biomass to bioethanol.

  11. Depigmenting Effect of Winter Medicinal Mushroom Flammulna velutipes (Higher Basidiomycetes) on Melanoma Cells.

    Science.gov (United States)

    Nagasaka, Reiko; Ishikawa, Yuki; Inada, Takumi; Ohshima, Toshiaki

    2015-01-01

    In humans, skin pigmentation results from the biochemichal synthesis and accumulation of melanin. We previously revealed that edible winter mushroom Flammulina velutipes extract inhibited melanosis in commercially available edible crustacea. Therefore, the current study was conducted to find if edible mushrooms extracts are useful for the skin whitening and the underlying mechanisms in melanin biosynthesis. Tyrosinase is one of the key enzymes for melanin biosynthesis. This study demonstrated that melanin synthesis and tyrosinase activity were suppressed by the F. velutipes extracts in B16 murine melanoma cells through the slow expression of microphthalmia-associated transcription factor. These results suggested that the F. velutipes extract could contain an effective component in whitening cosmetics and an alternative therapeutic agent for treating hyperpigmentation. PMID:26349509

  12. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes.

    Science.gov (United States)

    Tomsovský, M; Popelárová, P; Baldrian, P

    2009-01-01

    The wood-decomposing fungal species Antrodia macra, A. pulvinascens, Ceriporiopsis aneirina, C. resinascens and Dichomitus albidofuscus were determined for production of laccase (LAC), Mn peroxidase (MnP), lignin peroxidase (LiP), endo-l,4-P-beta-glucanase, endo-l,4-beta-xylanase, cellobiohydrolase, 1,4-beta-glucosidase and 1,4-beta-xylosidase. The results confirmed the brown-rot mode of Antrodia spp. which did not produce the activity of LAC and MnP. The remaining species performed detectable activity of both enzymes while no strain produced LiP. Significant inhibition of LAC production by high nitrogen was found in all white-rot species while only MnP of D. albidofuscus was regulated in the same way. The endoglucanase and endoxylanase activities of white-rotting species were inhibited by glucose in the medium while those of Antrodia spp. were not influenced by glucose concentration. The regulation of enzyme activity and bio-mass production can vary even within a single fungal genus. PMID:19330548

  13. Comparative investigations on wood decay and cellulolytic and xylanolytic activity of some basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Hegarty, B.; Steinfurth, A.; Liese, W.; Schmidt, O.

    1987-10-01

    To evaluate physiological differences between various wood-decay fungi and especially different strains per species, comparative investigations were performed with 13 brown-rot and 6 white-rot fungi with respect to their wood decay as well as cellulolytic and xylanolytic capacities. Pine wood samples were considerably decayed by the brown-rot fungi with the two Poria placenta strains showing highest and the two Serpula himantioides isolates lowest mass losses. Most white-rot fungi degraded beech wood samples stronger than pine. Schizophyllum commune was inactive on both substrates. Whereas cellulolytic activity measurement using the clearing of Walseth cellulose gave negative results for some brownrotters, all white-rotters, especially Merulius tremellosus produced cellulase. The decay of Remazol Brilliant Blue stained Avicel in liquid medium proved to be an unsuitable test method for most Serpula lacrymans strains, one P. placenta isolate and for Coriolus versicolor and M. tremellosus. The new method of quantitative photometrical determination of dye release from stained cellulose in agar provided a suitable cellulase assay for most fungi, although the whiterotters C. versicolor, Heterobasidion annosum and M. tremellosus could metabolise the stain. In shake culture, carboxymethylcellulase was not produced by S. lacrymans, P. placenta, Laetiporus sulphureus of Gloeophyllum abietinum, whereas all fungi were xylanolytic. There was only a slight relation between wood decay and enzymatic capacity and, altogether, a great physiological diversity within the fungi was evident.

  14. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    (Novex, San Diego, Calif.), and pI markers (range, 3.0 to 7.0) provided by the manufacturer were used as standards. A constant voltage of 100 V was applied to the gels for the first hour, 200 V was used for another hour, and 500 V was used for the last 30... the manufacturer’s instructions). Pooled FPLC peak fractions showing MNP, LIP, and laccase activities were subjected to IEF fractionation as described above, and the results obtained were compared to those obtained with the concentrated extracellular fluid. SDS...

  15. Modulation of inflammation-related genes of polysaccharides fractionated from mycelia of medicinal basidiomycete Antrodia camphorata

    Institute of Scientific and Technical Information of China (English)

    Yen-ying WU; Chin-chu CHEN; Charng-cherng CHYAU; Sin-yi CHUNG; Yi-wen LIU

    2007-01-01

    Aim: To investigate the effect of water soluble-ethanol precipitation fraction (AC-1) and alkaline extraction-isoelectric precipitation fraction (AC-2) from Antrodia camphorata (Polyporaceae, Aphyllophorales) on lipopolysaccharide (LPS)-in-duced gene activation in mouse macrophages. Methods: The AC-1 and AC-2fractions were prepared, and their effects on LPS-induced gene expression were monitored by Western blotting and RT-PCR. Results: Our results indicated thatAC-2, but not AC-1 dose-dependently (50--200 mg/L) inhibited LPS-induced nitric oxide production as well as the protein and the mRNA expression of the inducible nitric oxide synthase (iNOS) gene. Neither AC-1 nor AC-2 inhibited LPS-inducedcyclooxygenase-2 gene expression. Using the cytokine array assay, it showed that AC-2 also had the ability to inhibit LPS-induced the protein expression of interleukin (IL)-6, IL-10, the monocyte chemoattractant protein (MCP)-5, and regulated upon activation, normal T-cell expressed, and presumably secreted (RANTES). Like iNOS, AC-2 inhibiting LPS-induced IL-6 and IL-10 secretion resulted from inhibiting their mRNA expression. Conclusion: It was suggested that alkaline extraction-isoelectric precipitated the polysaccharide fraction of A camphorata and had the ability to inhibit LPS-induced iNOS, IL-6, IL-10, MCP-5, and RANTES expression in mouse macrophages.

  16. New triquinane and gymnomitrane sesquiterpenes from fermentation of the basidiomycete Antrodiella albocinnamomea.

    Science.gov (United States)

    Chen, Zi-Ming; Chen, He-Ping; Wang, Fang; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2015-04-01

    Five new triquinane-type sesquiterpenes, antrodins A-E (1-5) and a new gymnomitrane sesquiterpene, antrodin F (6), together with three known compounds 7-9 were isolated from fermentation of Antrodiella albocinnamomea. Their structures were elucidated through extensive spectroscopic methods including 2D NMR and HRMS analyses. The absolute configurations of 1 and 6 were determined using single-crystal X-ray diffraction analyses. The isolated compounds were investigated for their cytotoxicities against five human cancer cell lines. PMID:25704368

  17. Coconut lumber for wood decks (Cocos nucifera L.):decay resistance against Basidiomycetes fungi

    OpenAIRE

    Jourez, Benoît; Verheyen, Cécile; Van Acker, Joris

    2011-01-01

    Since a couple of years, manufactured products of coconut wood for outdoor uses like wood decks have been proposed on the European market. These are presented as an alternative for traditional tropical timbers. In the past, coconut wood was neglected and burned for sanitary reasons and lack of interest at industrial scale. Plantation coconut trees at end of production of copra constitute a renewable resource with high added value. In order to convince the markets, natural durability for outdo...

  18. Activities of chitinolytic enzymes during primary and secondary colonization of wood by basidiomycetous fungi.

    Science.gov (United States)

    Lindahl, Björn D; Finlay, Roger D

    2006-01-01

    The nitrogen (N) content of wood is usually suboptimal for fungal colonization. During decomposition of wood, an increasing fraction of the N becomes incorporated into fungal mycelium. Between 5 and 50% of the N in wood-degrading mycelium may be incorporated into chitin. Chitinolytic enzymes render this N available for re-utilization. Here, the activities of chitinolytic enzymes produced by wood-rotting fungi during degradation of spruce (Picea abies) wood were quantified in situ using fluorogenic 4-methylumbelliferyl substrates. A new method was developed that enables spatial quantification of enzyme activities on solid surfaces. All of the three tested fungi produced endochitinases, chitobiosidases and N-acetylhexosaminidases during colonization of wood. N-acetylhexosaminidase activity, and in some cases also chitobiosidase and endochitinase activities, were higher during secondary overgrowth of another fungus than during primary colonization of noncolonized wood. The results suggest that wood-degrading fungi degrade their own cell walls as well as the hyphae of earlier colonizers. Recycling of cell wall material within single mycelia and between fungal individuals during succession may lead to retention of N within woody debris. PMID:16411941

  19. The community structure of macroscopic basidiomycetes (Fungi) in Brazilian mangroves influenced by temporal and spatial variations.

    Science.gov (United States)

    Nogueira-Melo, Georgea Santos; Santos, Paulo Jorge Parreira; Gibertoni, Tatiana Baptista

    2014-12-01

    Mangroves are transitional ecosystems between terrestrial and marine environments, and are dis- tinguished by a high abundance of animals, plants, and fungi. Although macrofungi occur in different types of habitat, including mangroves, little is known about their community structure and dynamic. Therefore the aim of this study was to analyze the diversity of macrofungi in a number of Brazilian mangroves, and the relation- ship between such diversity, precipitation and area of collection. A total of 32 field trips were undertaken from 2009 to 2010, and macrofungi were studied in four 250 x 40 m transects: Timbó and Santa Cruz Channel on the Northern coast, and Maracaipe and Ariquindá on the Southern coast. All basidiomata found along the transects were placed in paper bags, air-dried and identified using existing literature. It was found that Northern areas predominantly featured Avicennia schaueriana mangroves, while Rhizophora mangle dominated in Southern transects. A total of 275 specimens were collected, and 33 species, 28 genera, 14 families and six orders were represented. Overall abundance and species richness did not vary significantly among areas, but varied according to time, being higher during the rainy season. Subtle differences in composition were observed over time and between areas, probably due to variations in plant species occurrence. Further studies with collections during months of greater precipitation in transects dominated by different mangrove species of the same ecosystem are suggested to assess the overall diversity of mycobiota in these ecosystems. PMID:25720189

  20. Characterization of cell wall degrading enzymes from Chrysosporium lucknowense C1 and their use to degrade sugar beet pulp

    NARCIS (Netherlands)

    Kühnel, S.

    2011-01-01

    Key words: Pectin, arabinan, biorefinery, mode of action, branched arabinose oligomers, ferulic acid esterase, arabinohydrolase, pretreatment Sugar beet pulp is the cellulose and pectin-rich debris remaining after sugar extraction from sugar beets. In order to use sugar beet pulp for biorefinery pu

  1. Multiple roles for lignin peroxidases in the biodegradation of organic pollutants

    Energy Technology Data Exchange (ETDEWEB)

    Bumpus, J.A.; Chang, C.W.; Tatarko, M. [Univ. of Notre Dame, IN (United States)

    1994-12-31

    The wood-rotting fungus Phanerochaete chrysosporium is able to degrade a wide variety of environmentally-persistent organic pollutants to carbon dioxide. The unique biodegradative abilities of this fungus are due, in part, to lignin peroxidases, oxidative enzymes that are secreted in response to nutrient deprivation. Lignin peroxidases catalyze the initial oxidation of many of the organic pollutants that are degraded by this fungus. They also mediate the initial oxidation of N,N,N{prime},N{prime},N{double_prime},N{double_prime}-hexamethylpararosaniline, several azo dyes and certain polycyclic aromatic hydrocarbons. Lignin peroxidases also mediate oxidative dechlorination. For example, lignin peroxidases oxidize pentachlorophenol to 2,3,5,6-tetrachloro-2,5-cyclohexadiene-1,4-dione. Similarly, these enzymes mediate oxidative oligomerization of 4-chloroaniline, resulting in production of several dimers, trimers and tetramers and net dechlorination of the aromatic ring. Interestingly, many, but not all, of the reactions mediated by lignin peroxidases are also mediated by other plant, fungal and oxidation of an intermediate. In the case of phenanthrene degradation, lignin peroxidases do not mediate the initial oxidation. However, these enzymes do mediate the oxidation of 9-phenanthrol, forming phenanthrene-9,10-dione. 92 refs., 3 tabs.

  2. Stable carbon and hydrogen isotopic fractionations of alkane compounds and crude oil during aerobically microbial degradation

    Institute of Scientific and Technical Information of China (English)

    PENG Xianzhi; ZHANG Gan; CHEN Fanzhong; LIU Guoqing

    2004-01-01

    Normal alkane compounds dodecane, pentadecane, hexadecane, octadecane, tetracosane, isoprenoid alkane pristane and a crude oil sample were aerobically biodegraded with a pure bacterial strain GIM2.5 and white rot fungus Phanerochaete Chrysosporium-1767 to monitor the kinetic fractionation of the molecular stable carbon (δ13C) and hydrogen (δD) isotopes in the course of biodegradation. Both δ13C (V-PDB) and δ D (V-SMOW) remained stable for the standard alkane compounds and n-alkane components (from n-C13 to n-C25) of the crude oil, generally varying in the range of ±0.5‰ and ±5‰ respectively, within the range of the instrumental precisions, especially for those molecularly heavier than n-C16 during microbial degradation. These results indicate that molecular stable carbon and hydrogen isotopic fingerprints can be promising indicators for tracing the sources of petroleum-related contaminants in the environment, especially in the case of severe weathering when they are difficult to be unambiguously identified by the chemical fingerprints alone.

  3. Continous monitoring of cellulase action on microcrystalline cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Kremer, S.M.; Wood, P.M. (Bristol Univ. (United Kingdom). Dept. of Biochemistry)

    1992-09-01

    Cellobiose oxidase from Phanerochaete chrysosporium was used for continuous monitoring of cellulase action on microcrystalline cellulose (Avicel). Two protocols are described, the parameter monitored being either the decline in electrode potential as ferricyanide is reduced or consumption of dioxygen. Most experiments used a commercial cellulase preparation from Trichoderma reesei and ferricyanide as acceptor. Within 1 min of an addition of cellulase, ferricyanide reduction reached a steady rate. This was converted into a rate of production of substrate for cellobiose oxidase, in [mu]mol.min[sup -1]. Experiments were conducted either with a constant concentration of cellulase and increasing Avicel, or with constant Avicel and increasing cellulase. Kinetic analysis of the experiments with constant cellulase indicated a K[sub m] of 4.8 [+-] 1.0 (g cellulose).1[sup -1], which was close to the value predicted from binding studies. The specific activity of the cellulase was measured as 375 [+-] 25 [mu]mol.(g cellulase)[sup -1].min[sup -1] in experiments with a high cellulose concentration, but was less than half this value when the cellulose was saturated with cellulase. The maximal rate of cellulose degradation was 9.6 [+-] 1.3 [mu]mol.(g cellulose)[sup -1].min[sup -1]. (orig.).

  4. Solid-state fermentation of rice straw residues for its use as growing medium in ornamental nurseries

    Science.gov (United States)

    Belal, Elsayed B.; El-Mahrouk, M. E.

    2010-11-01

    This work was conducted at a private nursery in Kafr El-Sheikh governorate to investigate the bioconversion of rice straw into a soil-like substrate (SLS) by Phanerochaete chrysosporium and Trichoderma hazianum and the possibility of using rice straw compost in ornamental nurseries as a partial or total replacement of coconut peat (CP) and vermiculite (V) in the growing medium. The results showed that rice straw could be treated better by aerobic fermentation. The authors used five mixtures as follows: (1) Control (CP+V at 1:1 v/v), (2) SLS (100%), (3) SLS+CP (1:1 v/v), (4) SLS+V (1:1 v/v), and (5) SLS+CP+V (1:1:1 v/v/v). Data were recorded as seedling height, no. of leaves, shoot fresh and dry weights, root length and root fresh and dry weights in order to assess the quality of both transplants of Althea rosea (hollyhock) and Calendula officinalis (scotch marigold). Hollyhock seedlings grown in medium containing a mixture of SLS+CP+V displayed quality traits similar to those recorded from the control treatment, while scotch marigold seedlings in the same medium followed the control medium in quality.

  5. Evolutionary divergence of Ure2pA glutathione transferases in wood degrading fungi.

    Science.gov (United States)

    Roret, Thomas; Thuillier, Anne; Favier, Frédérique; Gelhaye, Eric; Didierjean, Claude; Morel-Rouhier, Mélanie

    2015-10-01

    The intracellular systems of detoxification are crucial for the survival of wood degrading fungi. Within these systems, glutathione transferases could play a major role since this family of enzymes is specifically extended in lignolytic fungi. In particular the Ure2p class represents one third of the total GST number in Phanerochaete chrysosporium. These proteins have been phylogenetically split into two subclasses called Ure2pA and Ure2pB. Ure2pB can be classified as Nu GSTs because of shared structural and functional features with previously characterized bacterial isoforms. Ure2pA can rather be qualified as Nu-like GSTs since they exhibit a number of differences. Ure2pA possess a classical transferase activity, a more divergent catalytic site and a higher structural flexibility for some of them, compared to Nu GSTs. The characterization of four members of this Ure2pA subclass (PcUre2pA4, PcUre2pA5, PcUre2pA6 and PcUre2pA8) revealed specific functional and structural features, suggesting that these enzymes have rapidly evolved and differentiated, probably to adapt to the complex chemical environment associated with wood decomposition.

  6. Biomethanation of white rotted and brown rotted rice straw

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, A.; Bhattacharyya, B.C. [Chemical Engineeringg Dept., Biotechnology Unit, IIT Kharagpur, (India)

    1999-04-01

    Biomethanation of white rotted and brown rotted rice straw was taken for the present investigation and their efficiency on biomethanation has been tested. Rice straw was treated with white rot fungus Phanerochaete chrysosporium (P{sub C}) and brown rot fungus Polyporus ostreiformis (P{sub O}). Biogas and methane production was increased by about 34.73% and 46.19% in P{sub C}-treated straw and 21.12% and 31.94% in P{sub O}-treated straw respectively. VFA production has also been increased in P{sub C} and P{sub O} treated straw compared to control straw which were 76.73% and 30.69% respectively. Reduction of COD has also been found during biomethanation. The rate of reduction of COD during the initial period of digestion was 59.01%, 55.55% and 26.00% in P{sub C}-treated, P{sub O}-treated and control straw respectively after 21 days of digestion. (orig.) With 12 figs., 3 tabs., 14 refs.

  7. Decolorization of reactive brilliant red K-2BP by white rot fungus under sterile and non-sterile conditions

    Institute of Scientific and Technical Information of China (English)

    GAO Da-wen; WEN Xiang-hua; QIAN Yi

    2006-01-01

    Almost all the studies both domestic and international using white rot fungus for dye wastewater treatment are performed under sterile conditions. However, it is obviously unpractical that wastewater with dyes is treated under sterile conditions. A feasible study was made for using white rot fungus Phanerochaete chrysosporium to degrade reactive brilliant red K-2BP dye under non-sterile conditions. The results showed that there was no decolorizing effect under non-sterile condition if white rot fungus was incubated under non-sterile condition, and the decolorization was always near to 0% during decolorizing test for 3 d; in the meantime, a lot of yeast funguses were found in liquid medium when white rot fungus was incubated under non-sterile conditions; however, if white rot fungus was incubated under sterile condition firstly, its decolorization was above 90% under non-sterile condition, which was similar to that of sterile condition. So we point out that the treating process for wastewater with dyes should be divided into two stages. The first stage is that white rot fungus should be incubated under sterile conditions, and the second stage is that reactive brilliant red K-2BP is decolorized under non-sterile conditions. The method not only save the operation cost which decolorizing reactive brilliant red K-2BP under sterile condition, but also provide the feasibility for using white rot fungus to degrade wastewater with dyes under non-sterile conditions.

  8. Effects of fungal pretreatment and steam explosion pretreatment on enzymatic saccharification of plant biomass.

    Science.gov (United States)

    Sawada, T; Nakamura, Y; Kobayashi, F; Kuwahara, M; Watanabe, T

    1995-12-20

    The effects of consecutive treatments by a lignin-degrading fungus Phanerochaete chrysosporium and by steam explosion for the enzymatic saccharification of plant biomass were studied experimentally, and the optimal operational conditions for obtaining the maximum saccharification were evaluated. Beech wood-meal was treated by the fungus for 98 days and then by high steam temperatures of 170-230 degrees C with steaming times of 0-10 min. The treatment of the wood-meal by fungus prior to steam explosion enhanced the saccharification of wood-meal. The treated wood-meal was separated into holo-cellulose, water soluble material, methanol soluble lignin, and Klason lignin. The saccharification decreased linearly with the increase in the amount of Klason lignin. It was estimated by the equation for the saccharification of exploded wood-meal expressed as a function of steam temperature and steaming time that the maximum saccharification of wood-meal was obtained by consecutive treatments such as fungal treatment for 28 days and then steam explosion at a steam temperature of 215 degrees C and a steaming time of 6.5 min. (c) 1995 John Wiley & Sons, Inc.

  9. Bio-liquefaction/solubilization of low-rank Turkish lignites and characterization of the products

    Energy Technology Data Exchange (ETDEWEB)

    Yesim Basaran; Adil Denizli; Billur Sakintuna; Alpay Taralp; Yuda Yurum [Hacettepe University, Ankara (Turkey). Department of Environmental Sciences

    2003-08-01

    The effect of some white-rot fungi on the bio-liquefaction/solubilization of two low-rank Turkish coals and the chemical composition of the liquid products and the microbial mechanisms of coal conversion were investigated. Turkish Elbistan and Beypazari lignites were used in this study. The white-rot fungi received from various laboratories used in the bio-liquefaction/solubilization of the lignites were Pleurotus sajor-caju, Pleurotus sapidus, Pleurotus florida, Pleurotus ostreatus, Phanerochaete chrysosporium, and Coriolus versicolor. FT-IR spectra of raw and treated coal samples were measured, and bio-liquefied/solubilized coal samples were investigated by FT-IR and LC-MS techniques. The Coriolus versicolor fungus was determined to be most effective in bio-liquefying/solubilizing nitric acid-treated Elbistan lignite. In contrast, raw and nitric acid-treated Beypazari lignite seemed to be unaffected by the action of any kind of white-rot fungi. The liquid chromatogram of the water-soluble bio-liquefied/solubilized product contained four major peaks. Corresponding mass spectra of each peak indicated the presence of very complicated structures. 17 refs., 9 figs., 2 tabs.

  10. EDXRF Analysis of Some Fungal Species for the Uptake Capacity of 28Ni, 48Cd, and 82Pb Metal Ions From Aqueous Solution

    Directory of Open Access Journals (Sweden)

    SUNIL KUMAR

    2016-02-01

    Full Text Available In this paper, Energy Dispersive X-ray Fluorescence (EDXRF analysis of eight fungi species, namely, Aspergillus niger, Aspergillus terreus, Trichoderma longibrachiatum, Trichoderma fasciculatum, Penicillin Janthinellum, Aspergillus awamori, Phanerochaete chrysosporium, and Rhizopus arrhizus for the uptake capacity of 28Ni, 48Cd, and 82Pb metals ions from aqueous solution have been reported. Fungal samples having superior ion removal capacity through bioaccumulation and biosorption were obtained from sites contaminated with heavy metals. The detection limit in EDXRF set up was improved considerably using selective absorbers in the path of incident photons from the X-ray tube to reduce the background in the desired energy region. It has been observed that all fungi species under present study have greater affinity for 82Pb ions as compared to 28Ni and 48Cd metal ions. The Trichoderma longibrachiatum and Trichoderma fasciculatum fungi species were identified to be more efficient for removal of heavy metal ions from waste water. The measured uptake capacity of Trichoderma longibrachiatum for 28Ni, 48Cd, and 82Pb ions from aqueous solution is 0.52 mg/g, 0.97 mg/g, and 6.4 mg/g, respectively, and for Trichoderma fasciculatum it is 0.43 mg/g, 0.79 mg/g, and 3.5 mg/g, respectively. This indicated the potential of these identified fungi species as biosorbent for removal of high metal ions from waste water and industrial effluents.

  11. The nature of tryptophan radicals involved in the long-range electron transfer of lignin peroxidase and lignin peroxidase-like systems: Insights from quantum mechanical/molecular mechanics simulations.

    Science.gov (United States)

    Bernini, Caterina; Pogni, Rebecca; Basosi, Riccardo; Sinicropi, Adalgisa

    2012-05-01

    A catalytically active tryptophan radical has been demonstrated to be involved in the long-range electron transfer to the heme cofactor of lignin peroxidase (LiP) from Phanerochaete chrysosporium although no direct detection by EPR spectroscopy of the tryptophan radical intermediate has been reported to date. An engineering-based approach has been used to manipulate the microenvironment of the redox-active tryptophan site in LiP and Coprinus cinereus Peroxidase (CiP), allowing the direct evidence of the tryptophan radical species. In light of the newly available EPR experimental data, we performed a quantum mechanical/molecular mechanics computational study to characterize the tryptophan radicals in the above protein matrices as well as in pristine LiP. The nature of the tryptophan radicals is discussed together with the analysis of their environment with the aim of understanding the different behavior of pristine LiP in comparison with that of LiP and CiP variants.

  12. Fungal Biodegradative Oxidants in Lignocellulose: Fluorescence Mapping and Correlation With Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Hammel, Kenneth E. [Univ. of Wisconsin, Madison, WI (United States); Ralph, John [Univ. of Wisconsin, Madison, WI (United States); Hunt, Christopher G. [U.S. Forest Products Lab., Madison, WI (United States); Houtman, Carl J. [U.S. Forest Products Lab., Madison, WI (United States)

    2016-09-06

    This work focused on new methods for the detection of oxidation in natural substrates during the deconstruction of lignocellulose by microoganisms. Oxidation was the focus because all known biological systems that degrade lignin are oxidative. The detection methods involved the used of (a) micrometer-scale beads carrying a fluorescent dye that is sensitive to oxidation, (b) 13C-labeled synthetic lignins whose breakdown products can be assessed using mass spectrometry and nuclear magnetic resonance spectroscopy, and (c) a fluorometric stain that is highly sensitive to incipient oxidation during microbial attack. The results showed (a) that one white rot fungus, Phanerochaete chrysosporium, produces diffusible oxidants on wood, and that the onset of oxidation is coincident with the marked up-regulation of genes that encode ligninolytic peroxidases and auxiliary oxidative enzymes; (b) that a more selectively ligninolytic white rot fungus, Ceriporiopsis subvermispora, produces a highly diastereoselective oxidative system for attack on lignin; (c) that a brown rot fungus, Serpula lacrymans, uses extracellular hydroquinone metabolites to drive the production of lignocellulose-oxidizing free radicals; (d) that both white rot and brown rot fungi produce highly diffusible mild oxidants that modify lignocellulose at the earliest stage of substrate deconstruction; and (e) that lignin degradation in a tropical soil is not inhibited as much as expected during periods of flooding-induced hypoxia, which indicates that unknown mechanisms for attack on lignin remain to be discovered.

  13. Enzymatic production of microthecin by aldos-2-ulose dehydratase from 1,5-anhydro-D-fructose and stability studies of microthecin

    DEFF Research Database (Denmark)

    Yu, Shukun; Andreassen, Mikkel; Lundt, Inge

    2008-01-01

    AF and its natural substrate glucosone, respectively, while its Vmax with AF was 5.5 times higher than that with glucosone. Higher molar conversion of 90% was obtained in a reactor with pH controlled around 5.0 and 248C with de-ionized water as the solvent. Microthecin was found to be most stable.......2.2.13) from glycogen and starch by aldos-2-ulose dehydratase (AUDH; EC 4. 2.1.110). In the current study, the yield and purity of microthecin was examined with respect to pH and buffers using AUDH purified from the fungus Phanerochaete chrysosporium. It was found that AUDH had a Km of 5.4 and 4.9 mM towards...... in de-ionized water at a pH around 7.0 and stable in freeze-dried form. Under acidic conditions microthecin was degraded to 2?-furyl-2-hydroxymethylketone (FHMK). A 13C-NMR method was established to simultaneously monitor the reaction components including AF, microthecin and its intermediates...

  14. Biodelignification of lignocellulose substrates: An intrinsic and sustainable pretreatment strategy for clean energy production.

    Science.gov (United States)

    Chandel, Anuj K; Gonçalves, Bruna C M; Strap, Janice L; da Silva, Silvio S

    2015-01-01

    Lignocellulosic biomass (LB) is a promising sugar feedstock for biofuels and other high-value chemical commodities. The recalcitrance of LB, however, impedes carbohydrate accessibility and its conversion into commercially significant products. Two important factors for the overall economization of biofuel production is LB pretreatment to liberate fermentable sugars followed by conversion into ethanol. Sustainable biofuel production must overcome issues such as minimizing water and energy usage, reducing chemical usage and process intensification. Amongst available pretreatment methods, microorganism-mediated pretreatments are the safest, green, and sustainable. Native biodelignifying agents such as Phanerochaete chrysosporium, Pycnoporous cinnabarinus, Ceriporiopsis subvermispora and Cyathus stercoreus can remove lignin, making the remaining substrates amenable for saccharification. The development of a robust, integrated bioprocessing (IBP) approach for economic ethanol production would incorporate all essential steps including pretreatment, cellulase production, enzyme hydrolysis and fermentation of the released sugars into ethanol. IBP represents an inexpensive, environmentally friendly, low energy and low capital approach for second-generation ethanol production. This paper reviews the advancements in microbial-assisted pretreatment for the delignification of lignocellulosic substrates, system metabolic engineering for biorefineries and highlights the possibilities of process integration for sustainable and economic ethanol production. PMID:24156399

  15. SACCHARIFICATION BY FUNGI AND ETHANOL PRODUCTION BY BACTERIA USING LIGNOCELLULOSIC MATERIALS

    Directory of Open Access Journals (Sweden)

    Srivastava Ajeet Kumar

    2012-05-01

    Full Text Available Lignocellulosic material is one of the most abundant, renewable and inexpensive energy resources for bioethanol production. These materials are mainly composed of three groups of polymers namely cellulose, hemicellulose and lignin. Cellulose and hemicellulose are sugar rich fractions of interest for use in fermentation processes such as ethanol production. Cellulase production by the different fungi like Trichoderma reesei (MTCC-4876, Phanerochaete chrysosporium (MTCC-787 and Aspergillus awamori (MTCC-6652 were studied using different substrates (rice straw, wheat straw and rice husk by keeping the concentration constant at 5g/ 150 ml. The subculture medium was a salt solution consisting of KH2PO4, CaCl2, etc. Fungal cells were sub-cultured in an orbital shaker (180 rpm at 30°C for 1-2 generations (two days for each generation and were then used as inoculums. The maximum cellulase production and saccharification observed in the presence of combination of fungi with treated rice straw. Further Zymomonas mobilis bacteria was used for carrying out fermentation of sugars to ethanol production. Among the three raw materials studied the ethanol yield was observed to be the highest in rice straw ( 9.5 g/l .

  16. Production of bioethanol by direct bioconversion of oil-palm industrial effluent in a stirred-tank bioreactor.

    Science.gov (United States)

    Alam, Md Zahangir; Kabbashi, Nassereldeen A; Hussin, S Nahdatul I S

    2009-06-01

    The purpose of this study was to evaluate the feasibility of producing bioethanol from palm-oil mill effluent generated by the oil-palm industries through direct bioconversion process. The bioethanol production was carried out through the treatment of compatible mixed cultures such as Thrichoderma harzianum, Phanerochaete chrysosporium, Mucor hiemalis, and yeast, Saccharomyces cerevisiae. Simultaneous inoculation of T. harzianum and S. cerevisiae was found to be the mixed culture that yielded the highest ethanol production (4% v/v or 31.6 g/l). Statistical optimization was carried out to determine the operating conditions of the stirred-tank bioreactor for maximum bioethanol production by a two-level fractional factorial design with a single central point. The factors involved were oxygen saturation level (pO(2)%), temperature, and pH. A polynomial regression model was developed using the experimental data including the linear, quadratic, and interaction effects. Statistical analysis showed that the maximum ethanol production of 4.6% (v/v) or 36.3 g/l was achieved at a temperature of 32 degrees C, pH of 6, and pO(2) of 30%. The results of the model validation test under the developed optimum process conditions indicated that the maximum production was increased from 4.6% (v/v) to 6.5% (v/v) or 51.3 g/l with 89.1% chemical-oxygen-demand removal.

  17. Toxicity profile of choline chloride-based deep eutectic solvents for fungi and Cyprinus carpio fish.

    Science.gov (United States)

    Juneidi, Ibrahim; Hayyan, Maan; Mohd Ali, Ozair

    2016-04-01

    An investigation on the toxicological assessment of 10 choline chloride (ChCl)-based deep eutectic solvents (DESs) towards four fungi strains and Cyprinus carpio fish was conducted. ChCl was combined with materials from different chemical groups such as alcohols, sugars, acids and others to form DESs. The study was carried out on the individual DES components, their aqueous mixture before DES formation and their formed DESs. The agar disc diffusion method was followed to investigate their toxicity on four fungi strains selected as a model of eukaryotic microorganisms (Phanerochaete chrysosporium, Aspergillus niger, Lentinus tigrinus and Candida cylindracea). Among these DESs, ChCl:ZnCl2 exhibited the highest inhibition zone diameter towards the tested fungi growth in vitro, followed by the acidic group (malonic acid and p-toluenesulfonic acid). Another study was conducted to test the acute toxicity and determine the lethal concentration at 50 % (LC50) of the same DESs on C. carpio fish. The inhibition range and LC50 of DESs were found to be different from their individual components. DESs were found to be less toxic than their mixture or individual components. The LC50 of ChCl:MADES is much higher than that of ChCl:MAMix. Moreover, the DESs acidic group showed a lower inhibition zone on fungi growth. Thus, DESs should be considered as new components with different physicochemical properties and toxicological profiles, and not merely compositions of compounds. PMID:26743645

  18. Biodelignification of lignocellulose substrates: An intrinsic and sustainable pretreatment strategy for clean energy production.

    Science.gov (United States)

    Chandel, Anuj K; Gonçalves, Bruna C M; Strap, Janice L; da Silva, Silvio S

    2015-01-01

    Lignocellulosic biomass (LB) is a promising sugar feedstock for biofuels and other high-value chemical commodities. The recalcitrance of LB, however, impedes carbohydrate accessibility and its conversion into commercially significant products. Two important factors for the overall economization of biofuel production is LB pretreatment to liberate fermentable sugars followed by conversion into ethanol. Sustainable biofuel production must overcome issues such as minimizing water and energy usage, reducing chemical usage and process intensification. Amongst available pretreatment methods, microorganism-mediated pretreatments are the safest, green, and sustainable. Native biodelignifying agents such as Phanerochaete chrysosporium, Pycnoporous cinnabarinus, Ceriporiopsis subvermispora and Cyathus stercoreus can remove lignin, making the remaining substrates amenable for saccharification. The development of a robust, integrated bioprocessing (IBP) approach for economic ethanol production would incorporate all essential steps including pretreatment, cellulase production, enzyme hydrolysis and fermentation of the released sugars into ethanol. IBP represents an inexpensive, environmentally friendly, low energy and low capital approach for second-generation ethanol production. This paper reviews the advancements in microbial-assisted pretreatment for the delignification of lignocellulosic substrates, system metabolic engineering for biorefineries and highlights the possibilities of process integration for sustainable and economic ethanol production.

  19. Biodegradation of Aged Residues of Atrazine and Alachlor in a Mix-Load Site Soil by Fungal Enzymes

    Directory of Open Access Journals (Sweden)

    Anastasia E. M. Chirnside

    2011-01-01

    Full Text Available Soils from bulk pesticide mixing and loading (mix-load sites are often contaminated with a complex mixture of pesticides, herbicides, and other organic compounds used in pesticide formulations that limits the success of remediation efforts. Therefore, there is a need to find remediation strategies that can successfully clean up these mix-load site soils. This paper examined the degradation of atrazine (2-chloro-4-ethylamino-6-isopropylamino-S-triazine; AT and alachlor (2-chloro-2, 6-diethyl-N-[methoxymethyl]-acetanilide in contaminated mix-load site soil utilizing an extracellular fungal enzyme solution derived from the white rot fungus, Phanerochaete chrysosporium, grown in a packed bed bioreactor. Thirty-two percent of AT and 54% of AL were transformed in the biometers. The pseudo first-order rate constant for AT and AL biodegradation was 0.0882 d−1 and 0.2504 d−1, respectively. The half-life (1/2 for AT and AL was 8.0 and 3.0 days, respectively. Compared to AT, the initial disappearance of AL proceeded at a faster rate and resulted in a greater amount of AL transformed. Based on the net Co2 evolved from the biometers, about 4% of the AT and AL initially present in the soil was completely mineralized.

  20. Evolution of several soil properties following amendment with olive mill wastewater

    Institute of Scientific and Technical Information of China (English)

    Ali Mekki; Abdelhafidh Dhouib; Sami Sayadi

    2009-01-01

    Occurrences of olive mill wastewater (OMW) amendment on several chemical and biochemical properties of soil were investigated. Compared to the control, soils amended with untreated and treated OMW (by an integrated process based on aerobic fungal pre-treat-ment using Phanerochaete chrysosporium DSMZ 6909 followed by anaerobic treatment) showed high levels of organic and mineral mat-ters. Soil amended with untreated OMW presented low levels of total and inorganic nitrogen (0.38 and 0.08 mg g~(-1) dry soil). Treated OMW contained little content of pollutants (COD=4 gl~(-1); phenolic compounds=0.6 gl~(-1)); so, organic matter brought by these res-idues was rapidly mineralized in the soil. The number of heterotrophic bacteria was increased (from 54×10~5 CFU g~(-1) dry soil in control soil to 123×10~5 CFU g~(-1) dry soil) in response to the OMW amendment, mainly after C/N ratio correction. Untreated OMW applica-tion improved the soil carbon content (2.18 times higher), while the specific respiration remained very low. However, the treated OMW application positively affected the soil-specific respiration that increased from 6.1 in control soil to 9.75 in soil amended with treated OMW. This phenomenon was accompanied by an enhancement of nitrifiers number, urease and ammonium oxidases activities.

  1. Bioremediation of heavy metals in liquid media through fungi isolated from contaminated sources.

    Science.gov (United States)

    Joshi, P K; Swarup, Anand; Maheshwari, Sonu; Kumar, Raman; Singh, Namita

    2011-10-01

    Wastewater particularly from electroplating, paint, leather, metal and tanning industries contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and biosorption at low cost and in eco-friendly way. An attempt was, therefore, made to isolate fungi from sites contaminated with heavy metals for higher tolerance and removal of heavy metals from wastewater. Seventy-six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspegillus awamori, Aspergillus flavus, Trichoderma viride) also were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi. With respect to Pb, Cd, Cr and Ni, maximum uptake of 59.67, 16.25, 0.55, and 0.55 mg/g was observed by fungi Pb3 (Aspergillus terreus), Trichoderma viride, Cr8 (Trichoderma longibrachiatum), and isolate Ni27 (A. niger) respectively. This indicated the potential of these fungi as biosorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. PMID:23024411

  2. [Keratinophilic fungal flora isolated from small wild mammals and rabbit-warren in France. Discussion on the fungal species found].

    Science.gov (United States)

    Chabasse, D; Guiguen, C; Couatarmanac'h, A; Launay, H; Reecht, V; de Bièvre, C

    1987-01-01

    The occurrence of dermatophytes and other keratinophilic fungi was investigated in 237 small wild mammals and 125 european rabbit. The purpose of the investigation was to determine what were the species of fungi present in the these animals. Four species of dermatophytes were isolated: Trichophyton ajelloi, Trichophyton terrestre, Trichophyton mentagrophytes, Microsporum persicolor. Trichophyton terrestre was the most frequently isolated and it occurred more frequently than its presence could be explained by the contamination from soil. Members of the genus Chrysosporium were found in many animals: Chrysosporium keratinophilum, Chrysosporium tropicum, Chrysosporium multifidum, Chrysosporium pannorum, Chrysosporium georgii, Chrysosporium merdarium, Chrysosporium anamorph of Arthroderma curreyi, Chrysosporium anamorph of Arthroderma cuniculi, Anixiopsis stercoraria, Chrysosporium parvum. Wild small mammals and european rabbits in France, not only act as carrier of keratinophilic fungi and allied dermatophytes but also provide a suitable habitat for their survival as saprophytes. The recurrence of numerous species present on the coat, isolated fort the first time in France was remarkable.

  3. Decomposição fúngica de ácido tânico e outros compostos em efluente agroindustrial = Fungic decomposition of tannic acid and other compounds from agri-industrial effluent

    Directory of Open Access Journals (Sweden)

    Natalino Perovano Filho

    2011-04-01

    production of enzymes that degrade tannic acid, such as laccase, while Mucor sp. was better to remove the Chemical Oxygen Demand (COD and the total phenol content, followed by Cladosporium sp., Phanerochaete chrysosporium and Geotrichum candidum.

  4. Effects of pH and Temperature on Recombinant Manganese Peroxidase Production and Stability

    Science.gov (United States)

    Jiang, Fei; Kongsaeree, Puapong; Schilke, Karl; Lajoie, Curtis; Kelly, Christine

    The enzyme manganese peroxidase (MnP) is produced by numerous white-rot fungi to overcome biomass recalcitrance caused by lignin. MnP acts directly on lignin and increases access of the woody structure to synergistic wood-degrading enzymes such as cellulases and xylanases. Recombinant MnP (rMnP) can be produced in the yeast Pichia pastoris αMnP1-1 in fed-batch fermentations. The effects of pH and temperature on recombinant manganese peroxidase (rMnP) production by P. pastoris αMnP1-1 were investigated in shake flask and fed-batch fermentations. The optimum pH and temperature for a standardized fed-batch fermentation process for rMnP production in P. pastoris ctMnP1-1 were determined to be pH 6 and 30 °C, respectively. P. pastoris αMnP1-1 constitutively expresses the manganese peroxidase (mnp1) complementary DNA from Phanerochaete chrysosporium, and the rMnP has similar kinetic characteristics and pH activity and stability ranges as the wild-type MnP (wtMnP). Cultivation of P. chrysosporium mycelia in stationary flasks for production of heme peroxidases is commonly conducted at low pH (pH 4.2). However, shake flask and fed-batch fermentation experiments with P. pastoris αMnP1-1 demonstrated that rMnP production is highest at pH 6, with rMnP concentrations in the medium declining rapidly at pH less than 5.5, although cell growth rates were similar from pH 4-7. Investigations of the cause of low rMnP production at low pH were consistent with the hypothesis that intracellular proteases are released from dead and lysed yeast cells during the fermentation that are active against rMnP at pH less than 5.5.

  5. Degradation of PAHs in soil by Lasiodiplodia theobromae and enhanced benzo[a]pyrene degradation by the addition of Tween-80.

    Science.gov (United States)

    Wang, Cuiping; Liu, Haibin; Li, Jing; Sun, Hongwen

    2014-09-01

    Benzo[a]pyrene (BaP), a five-ring polycyclic aromatic hydrocarbon (PAH), which has carcinogenic potency, is highly recalcitrant and resistant to microbial degradation. A novel fungus, Lasiodiplodia theobromae (L. theobromae), which can degrade BaP as a sole carbon source in liquid, was isolated in our laboratory. To prompt the further application of L. theobromae in remediation of sites polluted by BaP and other PAHs, the present study was targeted toward the removal of BaP and PAHs from soil by L. theobromae. The degradation of BaP by L. theobromae was studied using a soil spiked with 50 mg/kg BaP. L. theobromae could remove 32.1 % of the BaP after 35 days of cultivation. Phenanthrene (PHE) inhibited BaP degradation as a competitive substrate. The tested surfactants enhanced BaP degradation in soil by different extents, and a removal rate of 92.1 % was achieved at a Tween-80 (TW-80) concentration of 5 g/kg. It was revealed that TW-80 could not only enhance BaP bioavailability by increasing its aqueous solubility and decreasing the size of its colloid particles but also increase enzyme secretion from L. theobromae and the population of L. theobromae. Moreover, ergosterol content together with the biomass C indicated the increase in L. theobromae biomass during the BaP biodegradation process in soils. Finally, a soil from a historically PAH-contaminated field at Beijing Coking Plant in China was tested to assess the feasibility of applying L. theobromae in the remediation of polluted sites. The total removal rate of PAHs by L. theobromae was 53.3 %, which is 13.1 % higher than that by Phanerochaete chrysosporium (P. chrysosporium), an effective PAH degrader. The addition of TW-80 to the field soil further enhanced PAH degradation to 73.2 %. Hence, L. theobromae is a promising novel strain to be implemented in the remediation of soil polluted by PAHs. PMID:24878554

  6. Review on Chaga Medicinal Mushroom, Inonotus obliquus (Higher Basidiomycetes): Realm of Medicinal Applications and Approaches on Estimating its Resource Potential.

    Science.gov (United States)

    Balandaykin, Mikhail E; Zmitrovich, Ivan V

    2015-01-01

    This paper presents a review of the realm of medicinal applications of Inonotus obliquus raw materials, sterile conks I. obliquus, based on the bibliographies of chemical studies of the fungus. The experimental part of the paper is devoted to the presentation of methods of estimating the resource potential of this fungus based on data obtained in the comfort zone of ththis species. A new form, I. obliquus f. sterilis, is formally described. PMID:25746615

  7. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants. PMID:17898510

  8. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids

    OpenAIRE

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  9. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis. PMID:24526638

  10. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. PMID:20564650

  11. Complex Enzyme-Assisted Extraction, Purification, and Antioxidant Activity of Polysaccharides from the Button Mushroom, Agaricus bisporus (Higher Basidiomycetes).

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Zhou, Xinghai

    2015-01-01

    Agaricus bisporus polysaccharides (ABP) were extracted by complex enzyme-assisted extraction methodology. The following were optimal conditions for the extraction of crude ABP: complex enzyme amount, 2.2%; temperature, 62°C; time, 3 h; and pH, 4. Under these conditions, the experimental yield of crude ABP was 6.87%. The crude ABP was purified by diethylaminoethyl-cellulose 52 chromatography and Sephadex G-100 chromatography, and one fraction-namely, ABP-1-was produced. The ABP-1 contained 93.67% carbohydrate, 1.46% protein, and 0.62% uronic acid. The constituent monosaccharides were predominantly glucose, galactose, mannose, and xylose. The antioxidant activities of ABP-1 were investigated by measuring its scavenging ability on 2,2-diphenyl-1-picrylhydrazyl and hydroxyl radicals, its ferric-reducing activity power, and the reducing power assay. At a concentration of 1.2 mg/mL, ABP-1 seemed to possess good free radical scavenging activity, with a scavenging value of about 56%. The results indicate that ABP-1 has good antioxidant activity. PMID:26756190

  12. Precipitation diagram and optimization of crystallization conditions at low ionic strength for deglycosylated dye-decolorizing peroxidase from a basidiomycete

    International Nuclear Information System (INIS)

    Precipitation phase diagrams can be rapidly constructed using dispensing-robot technology. These diagrams provide information that assists in optimization of crystal growth. The growth of suitably sized protein crystals is essential for protein structure determination by X-ray crystallography. In general, crystals are grown using a trial-and-error method. However, these methods have been modified with the advent of microlitre dispensing-robot technology and of protocols that rapidly screen for crystal nucleation conditions. The use of one such automatic dispenser for mixing protein drops (1.3–2.0 µl in volume) of known concentration and pH with precipitating solutions (ejecting 2.0 µl droplets) containing salt is described here. The results of the experiments are relevant to a crystallization approach based on a two-step procedure: screening for the crystal nucleation step employing robotics followed by optimization of the crystallization conditions using incomplete factorial experimental design. Large crystals have successfully been obtained using quantities as small as 3.52 mg protein

  13. Activity in vitro and in vivo against plant pathogenic fungi of grifolin isolated from the basidiomycete Albatrellus dispansus.

    Science.gov (United States)

    Luo, Du-Qiang; Shao, Hong-Jun; Zhu, Hua-Jie; Liu, Ji-Kai

    2005-01-01

    In the course of screening for novel naturally occurring fungicides from mushrooms in Yunnan province, China, the ethanol extract of the fruiting bodies of Albatrellus dispansus was found to show antifungal activity against plant pathogenic fungi. The active compound was isolated from the fruiting bodies of A. dispansus by bioassay-guided fractionation of the extract and identified as grifolin by IR, 1H and 13C NMR and mass spectral analysis. Its antifungal activities were evaluated in vitro against 9 plant pathogenic fungi and in vivo against the plant disease of Erysiphe graminis. In vitro, Sclerotinina sclerotiorum and Fusarium graminearum were the most sensitive fungi to grifolin, and their mycelial growth inhibition were 86.4 and 80.9% at 304.9 microM, respectively. Spore germination of F. graminearum, Gloeosporium fructigenum and Pyricularia oryzae was almost completely inhibited by 38.1microM grifolin. In vivo, the curative effect of grifolin against E. graminis was 65.5% at 304.9 microM after 8 days. PMID:15787244

  14. Isolation and Characterization of a Ubiquitin-Like Ribonuclease from the Cultured Deep Root Mushroom, Oudemansiella radicata (Higher Basidiomycetes).

    Science.gov (United States)

    Liu, Qin; Chen, Hao; Wang, Hexiang; Ng, Tzi Bun

    2015-01-01

    The isolation of a novel 13.5-kDa ribonuclease, displaying a ubiquitin-like inner peptide sequence, from dried fruiting bodies of the cultured mushroom Oudemansiella radicata (Relhan: Fr.) Singer (=Xerula radicata) is reported. The purification protocol deployed encompassed sequentially, cation/anion exchange chromatography on CM-cellulose, DEAE-cellulose and SP-Sepharose, and FPLC-gel filtration on a Superdex 75 column. The purified enzyme manifested optimum activity at 70 °C and pH 4.6, respectively. The activity of the RNase was inhibited by the majority of metal ions tested, especially Al3+, Hg2+, and Cd2+ ions, but was promoted by K+ ions. It exhibited the highest ribonucleolytic activity toward poly (C), lower activity toward poly (G), and negligible activity toward poly (U) and poly (A). Compared with mushroom ubiquitin-like RNases reported earlier, O. radicata RNase possesses a larger molecular mass, distinctive chromatographic behavior on DEAE-cellulose, a lower optimum pH, and a unique polyhomoribonucleotide specificity. PMID:26853958

  15. Contrasting Diversity and Host Association of Ectomycorrhizal Basidiomycetes versus Root-Associated Ascomycetes in a Dipterocarp Rainforest

    OpenAIRE

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large...

  16. 吉林省担子菌补记(七)%Notes on Basidiomycetes of Jilin Province(Ⅶ)

    Institute of Scientific and Technical Information of China (English)

    范宇光; 图力古尔

    2006-01-01

    报道了吉林省新记录分布担子菌6种,即肉褐鳞环柄菇(Lepiota brunneoincarnata Chodat & C.Martín)、短柄銛囊蘑[Melanoleuca brevipes(Bull.)Pat]、紫皮丽蘑[Calocybe ionides(Bull.)Donk]、皮尔松湿伞(Hygrophorus persoonii Arnolds)、微黄拟锁瑚菌[Clavulinopsis helvola(Pers.)]和弹球菌(Sphaerobolus stellatus Tode).其中,弹球菌属为吉林省新记录属.凭证标本存放于吉林农业大学菌物标本馆(HMJAU).

  17. Anxiolytic Effects of Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) on Ischemia-Induced Anxiety in Rats.

    Science.gov (United States)

    Zhang, Chunjing; Gao, Xiulan; Sun, Yan; Sun, Xiaojie; Wu, Yanmin; Liu, Ying; Yu, Haitao; Cui, Guangcheng

    2015-01-01

    We investigated the anxiolytic effects Agaricus brasiliensis extract (AbSE) on ischemia-induced anxiety using the plus-maze test and the social interaction test. The animals were treated orally with AbSE (4, 8, and 10 mg/kg/d, respectively) for 30 d, followed by middle cerebral artery occlusion-induced cerebral ischemia. Levels of noradrenaline, dopamine, and serotonin in the cerebral cortex of rats, as well as oxidative stress and plasma corticosterone levels were analyzed, respectively. The rota-rod test was carried out to exclude any false positive results in experimental procedures related to anxiety disorders, and the catalepsy test was carried out to investigate whether AbSE induces catalepsy. Our results demonstrate that oral administration of AbSE presented anxiolytic-like effects in the elevated plus-maze test and the social interaction test. Furthermore, AbSE did not induce extrapyramidal symptoms in the catalepsy test. The mechanism underlying the anxiolytic effect of AbSE might be increased brain monoamine levels and plasma corticosterone levels and decreased oxidative stress in cerebral ischemia/reperfusion rats.

  18. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application. PMID:26854104

  19. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos. PMID:27100524

  20. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  1. Enhancement of Shelf Life of Button Mushroom, Agaricus bisporus (Higher Basidiomycetes) by Fumigant Application of Lippia alba Essential Oil.

    Science.gov (United States)

    Vishwakarma, Pratima; Pandey, Abhay K; Mishra, Priyanka; Singh, Pooja; Tripathi, N N

    2015-01-01

    Eleven essential oils isolated from higher plant species were assessed against the four isolates of Verticillium fungicola found on fruiting bodies of Agaricus bisporus. Eucalyptus citriodora and Lippia alba oils were more efficacious and completely inhibited the mycelial growth of fungal isolates. L. alba oil was fungistatic and fungicidal at 10- and 20-µL concentrations against all of the isolates, respectively, and was more potent than E. citriodora oil as well as some prevalent synthetic fungicides such as benomyl, ethylene dibromide, and phosphine. Eighty microliters of L. alba oil protected 500 g of fruiting bodies of A. bisporus for up to 7 d from infection of the fungus under in vivo conditions. The findings strengthen the possibility of L. alba oil as a plant-based protectant to enhance the shelf life of A. bisporus fruiting bodies. PMID:25746409

  2. Multigene assessment of the species boundaries and sexual status of the basidiomycetous yeasts Cryptococcus flavescens and C. terrestris (Tremellales.

    Directory of Open Access Journals (Sweden)

    Andrey Yurkov

    Full Text Available Cryptococcus flavescens and C. terrestris are phenotypically indistinguishable sister species that belong to the order Tremellales (Tremellomycetes, Basidiomycota and which may be mistaken for C. laurentii based on phenotype. Phylogenetic separation between C. flavescens and C. terrestris was based on rDNA sequence analyses, but very little is known on their intraspecific genetic variability or propensity for sexual reproduction. We studied 59 strains from different substrates and geographic locations, and used a multilocus sequencing (MLS approach complemented with the sequencing of mating type (MAT genes to assess genetic variation and reexamine the boundaries of the two species, as well as their sexual status. The following five loci were chosen for MLS: the rDNA ITS-LSU region, the rDNA IGS1 spacer, and fragments of the genes encoding the largest subunit of RNA polymerase II (RPB1, the translation elongation factor 1 alpha (TEF1 and the p21-activated protein kinase (STE20. Phylogenetic network analyses confirmed the genetic separation of the two species and revealed two additional cryptic species, for which the names Cryptococcus baii and C. ruineniae are proposed. Further analyses of the data revealed a high degree of genetic heterogeneity within C. flavescens as well as evidence for recombination between lineages detected for this species. Strains of C. terrestris displayed higher levels of similarity in all analysed genes and appear to make up a single recombining group. The two MAT genes (STE3 and SXI1/SXI2 sequenced for C. flavescens strains confirmed the potential for sexual reproduction and suggest the presence of a tetrapolar mating system with a biallelic pheromone/receptor locus and a multiallelic HD locus. In C. terrestris we could only sequence STE3, which revealed a biallelic P/R locus. In spite of the strong evidence for sexual recombination in the two species, attempts at mating compatible strains of both species on culture media were unsuccessful.

  3. Notes on Basidiomycetes of Jilin Province (Ⅳ)%吉林省担子菌补记(四)

    Institute of Scientific and Technical Information of China (English)

    图力古尔; 李玉

    2003-01-01

    报道了吉林省新分布担子菌6种,即刺孢蜡蘑Laccaria tortilis (Bolt.) S.F.Gray,大型皮伞Marasmius maximus Hongo,粗毛原迷孔菌Protodaedalea hispida Imazeki,巢孔菌 Poronidulus conchifer (Schw.) Murr.中华散尾菌Lysurus sinensis Lioyd和袋形地星Geastrum saccatum (Fr.) Fisch..其中,原迷孔菌属和巢孔菌属为吉林省新记录属.

  4. Chemical Constituents of the Basidiomycetes Marasmius maximus Hongo%大皮伞化学成分研究

    Institute of Scientific and Technical Information of China (English)

    牛芸

    2013-01-01

    大皮伞(Marasmius maximus Hongo)是食用菌类,在我国各地均有分布,对其主要化学成分进行研究具有重要的意义.通过运用多种分离与分析方法(CC、TLC、prep.TLC、MPLC、HPLC等)以及波谱学技术(1D NMR、2D NMR、MS、HR-MS、UV/Vis等)并借助必要的化学手段对其发酵液进行化学成分的研究,共分离得到5个化合物.分别为:麦角甾-4,6,8 (14)22-四烯-3-酮、(22E,24R)-麦角甾-7,22-二烯-3β,5α,6β-三醇、邻苯二甲酸二异丁酯、三亚麻油酸甘油酯、5-Hydroxymethl-1-2-呋喃甲醛.

  5. Species richness and abundance of ectomycorrhizal basidiomycete sporocarps on a moisture gradient in the Tsuga heterophylla zone

    Science.gov (United States)

    O'Dell, Thomas E.; Ammirati, Joseph F.; Schreiner, Edward G.

    1999-01-01

    Sporocarps of epigeous ectomycorrhizal fungi and vegetation data were collected from eight Tsuga heterophylla (Raf.) Sarg. - Pseudotsuga menziesii (Mirb.) Franco stands along a wet to dry gradient in Olympic National Park, Washington, U.S.A. One hundred and fifty species of ectomycorrhizal fungi were collected from a total sample area of 2.08 ha. Over 2 years, fungal species richness ranged from 19 to 67 taxa per stand. Sporocarp standing crop ranged from 0 to 3.8 kg/ha, averaging 0.58 kg/ha, 0.06 kg/ha in spring and 0.97 kg/ha in fall. Sporocarp standing crop and fungal species richness were correlated with precipitation. These results demonstrated that ectomycorrhizal fungal sporocarp abundance and species richness can be partly explained in terms of an environmental gradient.

  6. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    revealed differences when the culture was exposed to anoxic stress. Notable ultrastructural changes occur for example in mitochondrial cristae, irregularly shaped fat globules and the presence of intracellular membrane invaginations. We assume...

  7. Protective Effects of Black Hoof Medicinal Mushroom from Korea, Phellinus linteus (Higher Basidiomycetes), on Osteoporosis In Vitro and In Vivo.

    Science.gov (United States)

    Kim, In-Ho; Chung, Min-Yu; Shin, Ji Young; Han, Daeseok

    2016-01-01

    The protective effect of Phellinus linteus (ethanol extract) against osteoporosis was investigated using the Saos-2 human osteoblast-like cell line and osteoclasts. A nontoxic concentration of Ph. linteus (10-2 to 10-8 mg mL-1) increased alkaline phosphatase (ALP) (EC 3.1.3.1) activity to a larger extent than soy did. Ph. linteus also attenuated the number and the activity of tartrate-resistant acid phosphatase-positive multinucleated osteoclasts. These results indicate that Ph. linteus likely regulated both osteoblasts and osteoclasts, contributing to the protection against osteoporosis. The protective effect of Ph. linteus was examined in ovariectomized (OVX) rats. Histological analysis indicates that Ph. linteus improved trabecular bone mass and reduced osteoclast frequency without affecting lipid droplet accumulation in the femur of OVX rats. A Ph. linteus supplementation for 12 weeks also significantly increased serum ALP activity and reduced urinary deoxypyridinoline level in OVX rats. Ultimately, we found that 12-week Ph. linteus supplementation increased the bone accumulation of minerals, including calcium, magnesium, and phosphorus. Collectively, Ph. linteus protected against osteoporosis by balancing the number of osteoblasts and osteoclasts, which was particularly associated with increased ALP activity in vitro and in vivo and mineral accumulation in bone. PMID:27279443

  8. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  9. Disruption of seven hypothetical aryl alcohol dehydrogenase genes from Saccharomyces cerevisiae and construction of a multiple knock-out strain.

    Science.gov (United States)

    Delneri, D; Gardner, D C; Bruschi, C V; Oliver, S G

    1999-11-01

    By in silicio analysis, we have discovered that there are seven open reading frames (ORFs) in Saccharomyces cerevisiae whose protein products show a high degree of amino acid sequence similarity to the aryl alcohol dehydrogenase (AAD) of the lignin-degrading fungus Phanerochaete chrysosporium. Yeast cultures grown to stationary phase display a significant aryl alcohol dehydrogenase activity by degrading aromatic aldehydes to the corresponding alcohols. To study the biochemical and the biological role of each of the AAD genes, a series of mutant strains carrying deletion of one or more of the AAD-coding sequences was constructed by PCR-mediated gene replacement, using the readily selectable marker kanMX. The correct targeting of the PCR-generated disruption cassette into the genomic locus was verified by analytical PCR and by pulse-field gel electrophoresis (PFGE) followed by Southern blot analysis. Double, triple and quadruple mutant strains were obtained by classical genetic methods, while the construction of the quintuple, sextuple and septuple mutants was achieved by using the marker URA3 from Kluyveromyces lactis, HIS3 from Schizosaccharomyces pombe and TRP1 from S. cerevisiae. None of the knock-out strains revealed any mutant phenotype when tested for the degradation of aromatic aldehydes using both spectrophotometry and high performance liquid chromatography (HPLC). Specific tests for changes in the ergosterol and phospholipids profiles did not reveal any mutant phenotype and mating and sporulation efficiencies were not affected in the septuple deletant. Compared to the wild-type strain, the septuple deletant showed an increased resistance to the anisaldehyde, but there is a possibility that the nutritional markers used for gene replacement are causing this effect.

  10. Extracellular oxidative metabolism of wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Daniel Cullen

    2010-04-21

    Substantial progress has been made toward understanding the fundamental physiology and genetics of wood decay fungi, microbes that are capable of degrading all major components of plant cell walls. Efficient utilization of lignocellulosic biomass has been hampered in part by limitations in our understanding of enzymatic mechanisms of plant cell wall degradation. This is particularly true of woody substrates where accessibility and high lignin content substantially complicate enzymatic 'deconstruction'. The interdisciplinary research has illuminated enzymatic mechanisms essential for the conversion of lignocellulosics to simple carbohydrates and other small molecular weight products. Progress was in large part dependent on substantial collaborations with the Department of Energy's Joint Genome Institute (JGI) in Walnut Creek and Los Alamos, as well as the Catholic University, Santiago, Chile, the Royal Institute of Technology, Stockholm, the University of Minnesota, St. Paul, and colleagues at the University of Wisconsin and the Forest Products Laboratory. Early accomplishments focused on the development of experimental tools (2, 7, 22, 24-26, 32) and characterization of individual genes and enzymes (1, 3-5, 8, 9, 11, 14, 15, 17, 18, 23, 27, 33). In 2004, the genome of the most intensively studied lignin-degrading fungus, Phanerochaete chrysosporium, was published (21). This milestone lead to additional progress on this important model system (6, 10, 12, 13, 16, 28-31) and was further complemented by genome analysis of other important cellulose-degrading fungi (19, 20). These accomplishments have been highly cited and have paved the way for whole new research areas.

  11. Genome, transcriptome, and secretome analysis of wood decay fungus postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego [Los Alamos National Laboratory; Challacombe, Jean F [Los Alamos National Laboratory; Misra, Monica [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Brettin, Thomas [Los Alamos National Laboratory; Morgenstern, Ingo [CLARK UNIV; Hibbett, David [CLARK UNIV.; Schmoll, Monika [UNIV WIEN; Kubicek, Christian P [UNIV WIEN; Ferreira, Patricia [CIB, CSIC, MADRID; Ruiz - Duenase, Francisco J [CIB, CSIC, MADRID; Martinez, Angel T [CIB, CSIC, MADRID; Kersten, Phil [FOREST PRODUCTS LAB; Hammel, Kenneth E [FOREST PRODUCTS LAB; Vanden Wymelenberg, Amber [U. WISCONSIN; Gaskell, Jill [FOREST PRODUCTS LAB; Lindquist, Erika [DOE JGI; Sabati, Grzegorz [U. WISCONSIN; Bondurant, Sandra S [U. WISCONSIN; Larrondo, Luis F [U. CATHOLICA DE CHILE; Canessa, Paulo [U. CATHOLICA DE CHILE; Vicunna, Rafael [U. CATHOLICA DE CHILE; Yadavk, Jagiit [U. CINCINATTI; Doddapaneni, Harshavardhan [U. CINCINATTI; Subramaniank, Venkataramanan [U. CINCINATTI; Pisabarro, Antonio G [PUBLIC U. NAVARRE; Lavin, Jose L [PUBLIC U. NAVARRE; Oguiza, Jose A [PUBLIC U. NAVARRE; Master, Emma [U. TORONTO; Henrissat, Bernard [CNRS, MARSEILLE; Coutinho, Pedro M [CNRS, MARSEILLE; Harris, Paul [NOVOZYMES, INC.; Magnuson, Jon K [PNNL; Baker, Scott [PNNL; Bruno, Kenneth [PNNL; Kenealy, William [MASCOMA, INC.; Hoegger, Patrik J [GEORG-AUGUST-U.; Kues, Ursula [GEORG-AUGUST-U; Ramaiva, Preethi [NOVOZYMES, INC.; Lucas, Susan [DOE JGI; Salamov, Asaf [DOE JGI; Shapiro, Harris [DOE JGI; Tuh, Hank [DOE JGI; Chee, Christine L [UNM; Teter, Sarah [NOVOZYMES, INC.; Yaver, Debbie [NOVOZYMES, INC.; James, Tim [MCMASTER U.; Mokrejs, Martin [CHARLES U.; Pospisek, Martin [CHARLES U.; Grigoriev, Igor [DOE JGI; Rokhsar, Dan [DOE JGI; Berka, Randy [NOVOZYMES; Cullen, Dan [FOREST PRODUCTS LAB

    2008-01-01

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative {beta}-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC{center_dot}MSIMS). Also upregulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H202. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H202 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons to the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost.

  12. Regulation of manganese peroxidase gene transcription by hydrogen peroxide, chemical stress, and molecular oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Li, D.; Alic, M.; Brown, J.A.; Gold, M.H. [Oregon Graduate Institute of Science and Technology, Portland, OR (United States)

    1995-01-01

    The expression of manganese peroxidase (MnP) in nitrogen-limited cultures of the lignin-degrading fungus Phanerochaete chrysosporium is regulated at the level of gene transcription by H{sub 2}O{sub 2} and various chemicals, including ethanol, sodium arsenite, and 2,4-dichlorophenol, as well as by Mn(II) and heat shock. Northern (RNA) blot analysis demonstrates that the addition of 1.0 mM H{sub 2}O{sub 2} to 5-day-old cultures grown in the absence of Mn results in the appearance of mnp mRNA within 15 min. Higher levels of mnp mRNA are obtained with simultaneous induction by Mn and H{sub 2}O{sub 2} than with H{sub 2}O{sub 2} alone. Although neither MnP activity nor associated protein is detectable in H{sub 2}O{sub 2}-induced cultures grown in the absence of Mn, simultaneous induction with Mn and H{sub 2}O{sub 2} results in a 1.6-fold increase in MnP activity compared with the MnP activity resulting resulting from Mn induction alone. In the presence of Mn, purging of low-nitrogen cultures with 100% O{sub 2}, in contrast to incubation under air, results in an increase in the accumulation of mnp mRNA and a 13-fold increase in MnP activity on day 5. However, in contrast to the effects of H{sub 2}O{sub 2} and heat shock, O{sub 2} purging of Mn-deficient cultures results in negligible accumulation of mnp mRNA. 48 refs., 6 figs.

  13. Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, T.P.S., E-mail: pgalindo@ua.pt [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Pereira, R. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto (Portugal); Freitas, A.C.; Santos-Rocha, T.A.P. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Rasteiro, M.G.; Antunes, F. [Department of Chemical Engineering, University of Coimbra, 3030-290 Coimbra (Portugal); Rodrigues, D. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Soares, A.M.V.M.; Gonçalves, F. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); and others

    2013-08-01

    The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP.

  14. Microbial liquefaction of peat for the production of synthetic fuels

    Energy Technology Data Exchange (ETDEWEB)

    Gunasekaran, M.

    1988-01-01

    Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungi were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.

  15. Bio-Remediation of Acid Mine Drainage in the Sarcheshmeh Porphyry Copper Mine by Fungi: Batch and Fixed Bed Process

    Directory of Open Access Journals (Sweden)

    Hanieh Soleimanifar

    2012-12-01

    Full Text Available Acid mine drainage (AMD containing high concentrations of iron and sulphate, low pH and variableconcentrations of heavy metals leads to many environmental problems. The concentrations of Cu and Mnare high in the AMD of the Sarcheshmeh porphyry copper mine, Kerman province, south of Iran. In thisstudy, the bio-remediation of Cu and Mn ions from acid mine drainage was investigated using two nativefungi called Aspergillus niger and Phanerochaete chrysosporium which were extracted from the soil andsediment samples of the Shour River at the Sarcheshmeh mine. The live fungi was first harvested andthen killed by boiling in 0.5 N NaOH solution. The biomass was finally dried at 60 C for 24 h andpowdered. The optimum biosorption parameters including pH, temperature, the amount of biosorbent andcontact time were determined in a batch system. The optimum pH varied between 5 and 6. It was foundthat the biosorption process increased with an increase in temperature and the amount of biosorbent.Biosorption data were attempted by Langmuir and Freundlich isotherm models and showed a good match.Kinetic studies were also carried out in the present study. The results show that the second-order kineticsmodel fits well the experimental data. The biosorption experiments were further investigated with acontinuous system to compare the biosorption capacities of two systems. The results show thatbiosorption process using a continuous system increases efficiency up to 99%. A desorption process waseventually performed in order to recover Copper and Manganese ions. This process was successful andfungi could be used again.

  16. Perspectives on the use of transcriptomics to advance biofuels

    Directory of Open Access Journals (Sweden)

    Siseon Lee

    2015-11-01

    Full Text Available As a field within the energy research sector, bioenergy is continuously expanding. Although much has been achieved and the yields of both ethanol and butanol have been improved, many avenues of research to further increase these yields still remain. This review covers current research related with transcriptomics and the application of this high-throughput analytical tool to engineer both microbes and plants with the penultimate goal being better biofuel production and yields. The initial focus is given to the responses of fermentative microbes during the fermentative production of acids, such as butyric acid, and solvents, including ethanol and butanol. As plants offer the greatest natural renewable source of fermentable sugars within the form of lignocellulose, the second focus area is the transcriptional responses of microbes when exposed to plant hydrolysates and lignin-related compounds. This is of particular importance as the acid/base hydrolysis methods commonly employed to make the plant-based cellulose available for enzymatic hydrolysis to sugars also generates significant amounts of lignin-derivatives that are inhibitory to fermentative bacteria and microbes. The article then transitions to transcriptional analyses of lignin-degrading organisms, such as Phanerochaete chrysosporium, as an alternative to acid/base hydrolysis. The final portion of this article will discuss recent transcriptome analyses of plants and, in particular, the genes involved in lignin production. The rationale behind these studies is to eventually reduce the lignin content present within these plants and, consequently, the amount of inhibitors generated during the acid/base hydrolysis of the lignocelluloses. All four of these topics represent key areas where transcriptomic research is currently being conducted to identify microbial genes and their responses to products and inhibitors as well as those related with lignin degradation/formation.

  17. Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego; Challacombe, Jean; Morgenstern, Ingo; Hibbett, David; Schmoll, Monika; Kubicek, Christian P.; Ferreira, Patricia; Ruiz-Duenas, Francisco; Martinez, Angel T.; Kersten, Phil; Hammel, Ken; Vanden Wymelenberg, Amber; Gaskell, Jill; Lindquist, Erika; Sabat, Gregorz; Splinter Bondurant, Sandra; Larrondo, Luis F.; Canessa, Paulo; Vicuna, Rafael; Yadev, Jagjit; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Pisabarro, Antonio; Lavin, Jose L.; Oguiza, Jose A.; Master, Emma; Henrissat, Bernard; Coutinho, Pedro M.; Harris, Paul; Magnuson, Jon K.; Baker, Scott E.; Bruno, Kenneth S.; Kenealy, William; Hoegger, Patrik; Kues, Ursula; Ramaiya, Preethi; Lucas, Susan; Salamov, Asaf; Shapiro, Harris; Tu, Hank; Chee, Christine L.; Misra, Monica; Xie, Gary; Teter, Sarah; Yaver, Debbie; James, Tim; Mokrejs, Martin; Pospisek, Martin; Grigoriev, Igor V.; Brettin, T.; Rokhsar, Daniel S.; Berka, Randy; Cullen, Dan

    2009-02-10

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome, and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in media containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative β-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Also upregulated under cellulolytic culture conditions were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H2O2. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H2O2 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. In particular, comparisons between P. placenta and the closely related white-rot fungus, Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which efficient depolymerization of lignin was lost.

  18. Irradiation of Liquid Fungi Isolated Media from Contaminated Sources with Heavy Metals Additive

    International Nuclear Information System (INIS)

    Occupational lead exposure is an important health issue in Egyptian workers, employees of paint factories, workers of copying centres, drivers, and tile making factories are in higher risk of lead toxicity. Wastewater, particularly from electroplating, paint, leather, metal and tanning industries, contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and bio sorption at low cost and in eco-friendly way. Low level lead exposure can significantly induce motor dis functions and cognitive impairment in children. Seventy six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspergillus awamori, Aspergillus flavus, Trichoderma viride) were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi with respect to Pb, Cd, Cr and Ni with maximum uptake of 59.67, 16.25, 0.55 and 0.55 mg/g by fungi Pb3 (Aspergillus terreus), Trichoderma viride, Cr8 (Trichoderma longibrachiatum), and isolate Ni27 (A. niger), respectively. This indicated the potential of these fungi as bio sorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. The F-ratio was 0.55 and gives non-significant as irradiated

  19. Inducción fúngica de la biorremediación de suelos contaminados con combustibles

    Directory of Open Access Journals (Sweden)

    Mary Lopretti

    2011-04-01

    Full Text Available La biorremediación de suelos ha sido en los últimos años una de las aplicaciones de los procesos de la biotecnología industrial que se ha desarrollado en busca de soluciones  naturales y eficientes al problema de la contaminación.Varios son los microorganismos que viven en condiciones extremas, desarrollando estrategias metabólicas que les permiten tener sus vías metabólicas aptas para vivir y reproducirse. Dentro de estas estrategias  se encuentra la acción de enzimas hidrolíticas, oxidativas y depolimerizantes que permiten modificar sustratos complejos como lo son los derivados del petróleo  y entre ellos los combustibles.En el presente trabajo se estudió la acción de dos hongos Gloeophylum trabeum y Phanerochaetes chrysosporium actuando en forma consorcial sobre sustratos  contaminados con gasoil y nafta.Se prepararon 4 reactores de fermentación sólida: dos de ellos blanco, contaminados sin inducción, y de los otros dos uno con nafta y el otro con gasoil inoculados ambos con 100cc de medio de propagación con micelios de P.chrysosporium y 50cc de medio de crecimiento con pellets de G. trabeum. Se extrajeron muestras cada 15 días y se evaluó  en el material de cada reactor características fisicoquímicas como %C, humedad y pH.También se realizó la evaluación microbiológica por siembra en placa y dilución en placa con agar malta al 1,25%. En todos los casos se obtuvieron micelios.Por último se determinó la actividad de enzimas lacasa  y peroxidasa. La actividad lacasa se determinó por espectrometría usando 0.5mM de ABTS como sustrato en 0,1M de buffer acetato de sodio pH5 y 1 ml de extracto obtenido por extracción salina. La determinación de actividad Mn peroxidasa se realizó con 0.01% de rojo fenol como sustrato en buffer succinato de sodio 0.1M en presencia de 1 ml de extracto enzimático, MnSO4 0.1M y H2O2 0.1M.Las actividad  de éstas enzimas permitió obtener moléculas mas pequeñas producto de la

  20. Cryptococcus randhawai sp. nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India.

    Science.gov (United States)

    Khan, Zia U; Ahmad, Suhail; Hagen, Ferry; Fell, Jack W; Kowshik, Tusharantak; Chandy, Rachel; Boekhout, Teun

    2010-03-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region sequences, the isolate belonged to the Cryptococcus albidus cluster (Filobasidiales, Tremellomycetes) and was closely related to Cryptococcus saitoi, Cryptococcus cerealis and Cryptococcus friedmannii with 98% sequence identity. Phenotypically, the species differed from C. saitoi with respect to growth temperature (up to 37degrees C), presence of a thin capsule, ability to grow in the absence of vitamins, and inability to assimilate citrate and ethylamine. With respect to C. friedmannii, it differed in growth temperature, ability to assimilate lactose, raffinose, L: -rhamnose, myo-inositol, and inability to utilize citrate. Furthermore, our isolate also differed from C. cerealis in growth temperature, presence of capsule and inability to assimilate L: -sorbose. In view of the above phenotypic differences and unique rDNA sequences, we consider that our isolate represents a new species of Cryptococcus, and therefore, a new species, Cryptococcus randhawai is proposed for this taxon. The type strain J11/2002 has been deposited in the culture collection of the Centraalbureau voor Schimmelcultures (CBS10160) and CABI Biosciences (IMI 393306). PMID:20091225

  1. Cryptococcus randhawai sp nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India

    NARCIS (Netherlands)

    Khan, Z.U.; Ahmad, S.; Hagen, F.; Fell, J.W.; Kowshik, T.; Chandy, R.; Boekhout, T.

    2010-01-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region seque

  2. Antiviral activity of Basidiomycete mycelia against influenza type A(serotype H1N1) and herpes simplex virus type 2 in cell culture

    Institute of Scientific and Technical Information of China (English)

    Tetiana; Krupodorova; Svetlana; Rybalko; Victor; Barshteyn

    2014-01-01

    In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A(serotype H1N1) and herpes simplex virus type 2(HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47(H1N1) in MDCK cells reducing the infectious titer by 2.0–6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species—Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes—this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index(324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes(amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems.

  3. Medicinal and antimicrobial role of the oyster culinary-medicinal mushroom Pleurotus ostreatus (higher Basidiomycetes) cultivated on banana agrowastes in India.

    Science.gov (United States)

    Kunjadia, Prashant D; Nagee, Anju; Pandya, Parth Y; Mukhopadhyaya, Pratap N; Sanghvi, Gaurav V; Dave, Gaurav S

    2014-01-01

    Oyster mushrooms, species of the genus Pleurotus, are recognized for producing secondary metabolites with important medicinal properties. Investigations were carried out to evaluate the antioxidative and antimicrobial properties of the edible mushroom Pleurotus ostreatus (MTCC142) extracts cultivated on banana agrowastes. Ethanolic extracts showed antimicrobial activities against gram-positive and gram-negative bacteria, and their in vitro antifungal activities against all fungi tested revealed a promising role. Qualitative phytochemical analysis of Pleurotus grown on yeast dextrose broth and banana agrowaste confirmed the presence of steroids, cardiac glycosides, terpenoids, and alkaloids, whereas ethanolic extract after 40 days exhibited a phenol concentration of 521.67 µg/mL in banana waste compared to 155 µg/mL in yeast dextrose broth. The minimum inhibitory concentration of ethanolic extracts ranged from 19.74 to 56.84 mg/mL and 35.53 to 102.31 mg/mL in solid-state and submerged grown mycelium extracts, respectively, after 40 days. Moreover, banana agrowaste could be a significant economic source for the production of the oyster mushroom P. ostreatus. The nutritive, medicinal, and antimicrobial properties of P. ostreatus can be used to develop a new nutraceutical formulation; it can also be used as an additive to routine and fast food.

  4. Aqueous extract from a Chaga medicinal mushroom, Inonotus obliquus (higher Basidiomycetes), prevents herpes simplex virus entry through inhibition of viral-induced membrane fusion.

    Science.gov (United States)

    Pan, Hong-Hui; Yu, Xiong-Tao; Li, Ting; Wu, Hong-Ling; Jiao, Chun-Wei; Cai, Mian-Hua; Li, Xiang-Min; Xie, Yi-Zhen; Wang, Yi; Peng, Tao

    2013-01-01

    Chaga medicinal mushroom, Inonotus obliquus, a popular prescription in traditional medicine in Europe and Asia, was used to reduce inflammation in the nasopharynx and to facilitate breathing. The aqueous extract from I. obliquus (AEIO) exhibited marked decrease in herpes simplex virus (HSV) infection (the 50% inhibitory concentration was 3.82 μg/mL in the plaque reduction assay and 12.29 μg/mL in the HSV-1/blue assay) as well as safety in Vero cells (the 50% cellular cytotoxicity was > 1 mg/mL, and selection index was > 80). Using a time course assay, effective stage analysis, and fusion inhibition assay, the mechanism of anti-HSV activity was found against the early stage of viral infection through inhibition of viral-induced membrane fusion. Therefore, AEIO could effectively prevent HSV-1 entry by acting on viral glycoproteins, leading to the prevention of membrane fusion, which is different from nucleoside analog antiherpetics. PMID:23510282

  5. Hepatoprotective Activity of Water Extracts from Chaga Medicinal Mushroom, Inonotus obliquus (Higher Basidiomycetes) Against Tert-Butyl Hydroperoxide-Induced Oxidative Liver Injury in Primary Cultured Rat Hepatocytes.

    Science.gov (United States)

    Hong, Ki Bae; Noh, Dong Ouk; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    We examined the hepatoprotective activity of Inonotus obliquus water extract (IO-W) against tert-butyl hydroperoxide (t-BHP)-induced oxidative liver injury in the primary cultured rat hepatocyte. The 50% radical scavenging concentrations (SC50s) of IO-W for radical-scavenging activity against 2,2'-azino-bis-(3-ethylbenzothi- azoline-6-sulfonic acid) (ABTS) and 1,1-diphenyl-2-picryl-hydrazyl (DPPH) were 5.19 mg/mL and 0.39 mg/mL, respectively. IO-W pretreatment to the primary cultured hepatocytes significantly (p100 µg/ mL). In conclusion, this study demonstrates that IO-W exhibited hepatoprotective activity against t-BHP-induced oxidative liver injury in the primary cultured hepatocyte probably via its abilities of quenching free radicals, inhibiting the leakage of ALT, AST, and LDH, and decreasing MDA formation. PMID:26853962

  6. Inhibitory effects of a polysaccharide extract from the Chaga medicinal mushroom, Inonotus obliquus (higher Basidiomycetes), on the proliferation of human neurogliocytoma cells.

    Science.gov (United States)

    Ning, Xianbin; Luo, Qi; Li, Chuang; Ding, Zhaoyi; Pang, Jinfeng; Zhao, Changfu

    2014-01-01

    This study aimed to investigate the inhibitory roles of a polysaccharide extract from Inonotus obliquus on U251 human neurogliocytoma cells cultured in vitro. After administering the polysaccharide extract from I. obliquus to U251 cells cultivated in vitro, methyl thiazolyl tetrazoliym assay was performed to measure the inhibitory effects of the extract on tumor cell proliferation. The expression of the apoptosis-related proteins Bcl-2 and caspase-3 were determined by Western blotting. Different concentrations of I. obliquus extract (25, 50, 100, 200, and 500 µg/mL) were added to U251 cells at 24, 48, and 72 hours. Methyl thiazolyl tetrazoliym assay showed that the inhibition ratio increased with increased extract concentration and prolonged treatment duration. The I. obliquus extract sharply decreased the expression of Bcl-2 but dramatically increased the expression of caspase-3. This function was gradually enhanced with increased drug concentration and prolonged treatment duration. The I. obliquus extract can inhibit the proliferation of tumor cells. This inhibition function is closely related to the downregulation of Bcl-2 and the upregulation of caspase-3. PMID:24940902

  7. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs. PMID:18083152

  8. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast. PMID:20146402

  9. Determination of Lovastatin, β-glucan, Total Polyphenols, and Antioxidant Activity in Raw and Processed Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lam, Yu Shan; Okello, Edward J

    2015-01-01

    The objective of this study was to quantify a number of bioactive compounds and antioxidant activity of the oyster mushroom, Pleurotus. Ostreatus, and characterize the effects of processing, such as blanching, on these outcomes. Dry matter content was 8%. Lovastatin was not detected in this study. β-glucan content of 23.9% and total polyphenol content of 487.12 mg gallic acid equivalent/100 g of dry matter were obtained in raw P. ostreatus. Antioxidant activities as evaluated by 1,1-diphenyl-2-picrylhydrazyl, Trolox equivalent antioxidant capacity, and ferric reducing antioxidant power assays in raw P. ostreatus were 14.46, 16.51, and 11.21 µmol/g, respectively. Blanching did not significantly affect β-glucan content but caused significant decrease in dry matter content, polyphenol content, and antioxidant activities. Mushroom rolls produced from blanched mushrooms and blanching water contained significantly higher amounts of β-glucan, total polyphenol content, and FRAP antioxidant activity compared to blanched mushrooms. In conclusion, P. ostreatus is a good source for β-glucan, dietary polyphenols, and antioxidants. Although the blanching process could affect these properties, re-addition of the blanching water during the production process of mushroom rolls could potentially recover these properties and is therefore recommended.

  10. Hot Water Extracts of the Royal Sun Mushroom, Agaricus brasiliensis (Higher Basidiomycetes), Inhibit Platelet Activation via the P2Y1 Receptor.

    Science.gov (United States)

    Akahane, Katsuyuki; Satoh, Kaneo; Ohta, Masato; Ozaki, Yukio

    2015-01-01

    Hot water extracts of the medicinal mushroom Agaricus brasiliensis were investigated for their inhibition of platelet aggregation. The extracts significantly inhibited human platelet aggregation induced by adenosine 5'-diphosphate (ADP), but not by collagen or thrombin receptor-activating peptide. The extracts also had a significant inhibitory effect on shape change and intracellular calcium mobilization induced by ADP via inhibition of ADP binding to the P2Y1 receptor. In addition, oral administration of the extracts resulted in prolonged tail bleeding time in mice. The marked antiplatelet activity of the mushroom extracts involving the P2Y1 receptor suggests their potential therapeutic use against vascular disorders. PMID:26559862

  11. EFFECT OF DIFFERENT CULTURE CONDITIONS AND INDUCERS ON PRODUCTION OF LACCASE BY A BASIDIOMYCETE FUNGAL ISOLATE PLEUROTUS OSTREATUS HP-1 UNDER SOLID STATE FERMENTATION

    Directory of Open Access Journals (Sweden)

    Hardik Patel

    2009-02-01

    Full Text Available The production of laccase by an indigenous strain of Pleurotus ostreatus HP-1 was studied on solid state fermentation. Culture parameters such as type and concentration of substrate, inoculum size, moisture content, pH, surfactant presence, temperature, and nitrogen source were optimized by conventional “one factor at a time” methodology. A maximum laccase yield of 3952 U g-1 of dry substrate optimized was obtained with wheat straw as substrate with five agar plugs as the inoculum, 60% moisture content, pH 5.0, surfactant concentration 0.015 gl-1, and nitrogen source (combination of L-asparagine and NH4NO3 at 10 mM concentration each at incubation temperature 28oC. Enhancement in laccase activity was achieved with the use of various aromatic inducers and copper sulphate. Highest laccase activity of 14189 U g-1 of dry substrate was achieved using 0.28 mM copper sulphate under optimized conditions. Thus, the indigenous isolate seems to be a potential producer of laccase using SSF and can be exploited for further biotechnological applications. The process also promises economic utilization and value addition of agro-residues.

  12. Optimization of Liquid Fermentation Medium for Production of Inonotus sanghuang (Higher Basidiomycetes) Mycelia and Evaluation of their Mycochemical Contents and Antioxidant Activities.

    Science.gov (United States)

    Tian, Xue-Mei; Dai, Yu-Cheng; Song, Ai-Rong; Xu, Kun; Ng, Lean Teik

    2015-01-01

    Inonotus sanghuang, an authentic "Sanghuang" mushroom used in traditional Chinese medicine, is known to possess important pharmacological activities. In this study, we aimed to optimize the liquid fermentation medium for I. sanghuang mycelial production and to determine the effects of two-stage cultivation (shake and static) on the yield of total flavonoids, total phenolics, and polysaccharides, as well as the antioxidant activities of I. sanghuang mycelial extracts (ISME). Under an optimized medium composition (38.96 g/L of corn flour, 4.15 g/L of yeast extract, 20.55 g/L of bran and pH 6.39), the predicted and experimental optimal mycelial biomasses were 17.60 g/L and 18.33±0.86 g/L, respectively. The results of two-stage cultivation showed that contents of total flavonoids and total phenolics in mycelia increased by 37.92% and 77.27%, respectively. However, irregular polysaccharide contents were noted throughout the experimental period. Antioxidant assays showed that ISME possessed good free-radical scavenging activity, which is mainly contributed by polyphenolic-type metabolites. PMID:26559702

  13. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.

    2016-02-01

    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  14. Production of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), biomass and polysaccharides by solid state cultivation.

    Science.gov (United States)

    Berovic, Marin; Habijanic, Jozica; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2012-01-01

    Solid state cultivation of Ganoderma lucidum biomass, strain BFWS Gal 4, originally isolated from the Slovenian forest, was studied in a horizontal stirred tank reactor. Periodic mixing of N = 80 rpm, 2 min/day was used. Production of fungal polysaccharides and fungal biomass on solid substrate based on beech sawdust, olive oil, and mineral salts was studied. Optimal moisture of the solid matrix was in the range of 80% to 74%. When the moisture content dropped below 57%, the growth of the mycelium and polysaccharide production stopped, but it revived when wet air was applied in further processing. Final concentration of biomass was 0.68 mg/g of solid substrate, while proportions of extracellular and intracellular polysaccharides were 4.5 mg/g and 1.05 mg/g, respectively.

  15. Bioinformatic Identification of Potential MicroRNAs and Their Targets in the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes).

    Science.gov (United States)

    Mu, Da-Shuai; Li, Chenyang; Shi, Liang; Zhang, Xuchen; Ren, Ang; Zhao, Ming-Wen

    2015-01-01

    MicroRNAs (miRNAs) are a class of small, endogenous, noncoding RNA molecules that negatively regulate gene expression at the transcriptional or the post-transcriptional level. Although a large number of miRNAs have been identified in many species, especially model plants and animals, miRNAs in fungi remain largely unknown. In this study, based on a database of expressed sequence tags in Ganoderma lucidum, 89 potential miRNAs were identified using computational methods. Real-time polymerase chain reaction analysis of miRNA-like samples prepared from G. lucidum at different development stages revealed that miRNA-like RNAs were differentially expressed in different stages. Furthermore, a total of 28 potential targets were found based on near-perfect or perfect complementarity between the randomly selected 9 miRNA-like RNAs and the target sequences, and potential targets for G. lucidum miRNA-like RNAs were predicted. Finally, we studied the expression pattern of 4 target genes in 3 different development stages of G. lucidum to further understand the mechanism of interaction between miRNA-like RNAs and their target genes. Our analysis paves the way toward identifying fungal miRNA-like RNAs that might be involved in various physiological and cellular differentiation processes. PMID:26559864

  16. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    OpenAIRE

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of the D1D2 region of the large subunit (26S) and of the ITS region of ribosomal DNA showed relationship to the Bulleromyces clade of the genus Cryptococcus (order Tremellales) with some Tremella spp. a...

  17. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of th

  18. Isolation of viscous-oil degrading microorganism and biodegradation to resin%稠油降解菌的筛选及其对胶质降解作用

    Institute of Scientific and Technical Information of China (English)

    王大威; 张健; 齐义彬; 马挺

    2012-01-01

    Phanerochaete chrysosporium; laccase; resistant to nutritional repression; regulation of carbon and nitrogen nutrition%[目的]以胶质为唯一碳源,从中海油南堡35-2油田地层水中经富集培养,为海上油田稠油降解及提高稠油采收率研究奠定基础.[方法]利用富集培养和胶质平板法分离胶质降解菌株,对分离菌株通过形态特征、16S rRNA基因进行鉴定,对菌株的理化性质进行分析,并对其降解胶质和稠油的性能进行研究.[结果]分离筛选出细菌菌株21株,并从中筛选出性能较好的4株.经鉴定为分别为Q4-油杆菌(Petrobacter sp.)、QB9-嗜热脂肪地芽胞杆菌(Geobacillus stearothermophilus)、QB26-地衣芽胞杆菌(Bacillus licheniformis)、QB36-白色地芽胞杆菌(Geobacillus pallidus),其中QB26菌株效果最好,对该菌株的理化性质进行了分析,并对其降解胶质和稠油的性能进行了研究.结果显示,该菌株可在厌氧条件下生长,并能适应地层环境.分离菌株作用稠油后,饱和烃相对含量均有不同程度的上升,芳香烃、胶质、沥青质相对含量降低,能使胶质相对含量降低5.1%,沥青质相对含量降低2.7%.[结论]分离菌株对NB35-2油田稠油中的胶质具有一定的降解作用,在微生物采油和原油污染处理方面具有应用潜力.

  19. 表面活性剂对白腐真菌降解石油的影响%EFFECT OF SURFACTANTS ON PETROLEUM DEGRADATION BY WHITE ROT FUNGI

    Institute of Scientific and Technical Information of China (English)

    黄敏; 谭丽泉; 余梅; 吴玉宜

    2012-01-01

    研究了聚氧乙烯(20)失水山梨醇单油酸酯( Tweer80)、辛烷基聚氧乙烯醚(TritonX-100)、十二烷基苯磺酸钠、十二烷基硫酸钠(SDS)、十二烷基磺酸钠、SDS与十二醇(9∶1)的复配剂6种表面活性剂对白腐真菌降解溶液和土壤系统中石油的影响.实验结果表明:表面活性剂的类型、浓度、生物降解性及石油的存在状态等对石油的降解均产生影响.非离子型表面活性剂和阴离子型表面活性剂对溶液体系及土壤体系中石油的降解均有一定的促进作用.在溶液体系中石油的降解率随着表面活性剂浓度的增加而降低,表面活性剂Tween80在浓度为0.2 CMC时对石油的降解率达到62.2%.而土壤体系中,表面活性剂TritionX-100在浓度为5 CMC时降解效果最好,对石油的降解率可达60.17%.%The effect of six surfactants (Tween80, TritonX-100, LAS, SDS, SAS, complex of SDS and dodecanol) on petroleum degradation by Phanerochaete chrysosporium in solution and soil-water system was studied. Results show that the type and concentration of surfactants,biodegradability and the existing state of petroleum contaminant all have impact on the degradation of petroleum. The degradation of petroleum by white rot fungi in both solution and soil system could be promoted by non-ionic surfactant and anionic surfactant in certain extent. In the solution system, the degradation rate of petroleum reduces with the increase of initial surfactant concentration, Tween80 surfactant at a concentration of 0. 2 CMC shows the best performance, a degradation rate of 62. 2%. Whereas TritonX-100 surfactant at a concentration of 5 CMC exhibits the best performance in soil system, the degradation rate of petroleum reaches 60. 17%.

  20. 玉米秸秆木质素降解过程的CP/MAS13CNMR和SEM表征%CP/MAS13CNMR and SEM Characterization of Corn Stover Lignin Degradation

    Institute of Scientific and Technical Information of China (English)

    陈琳; 张全; 孟雪松; 凌凤香

    2013-01-01

    利用黄孢原毛平革茵对玉米秸秆木质素进行降解处理,通过CP/MAS 13CNMR和SEM研究降解过程中木质素的结构变化.CP/MAS 13CNMR结果表明:玉米秸秆木质素降解过程中,作为木质素结构单元主要连接方式的β-O-4键基本上没有被降解;木质素单位苯环的甲氧基含量稍有增加;S/G值降低,推断反应过程中紫丁香基优先参与反应.SEM结果表明:降解后的木质素空穴增多且增大、颗粒物质减少,主要是由于酶解木质素中大量碳水化合物的降解(所)致;比木质素更容易降解的纤维素和半纤维素也存在于样品中.CP/MAS13CNMR为木质纤维原料结构的定性和初步定量提供了可能,是传统定量表征手段的有力补充,具有一定的研究意义.%The structure changes of corn stover lignin treated by Phanerochaete chrysosporium were studied by CP/MAS 13CNMR and SEM.CP/MAS 13CNMR Results showed that bond β-O-4 didn't be degraded,the content of-OCH3 increased after degradation,S/G value decreased,and syringyl structure was priority to take part in the reaction.SEM Results showed that the surface holes of corn stover lignin increased both in number and in volume,and the particle matters reduced,mainly due to the degradation caused by carbohydrate,there were cellulose and hemicellulose more easily degraded than lignin in the sample.CP/MAS 13CNMR Provides the possibility of qualitative and quantitative characterization for wood materials structure,which is a strong supplement to the traditional quantitative characterization methods,and has some research significance.

  1. Gold nanoparticles/water-soluble carbon nanotubes/aromatic diamine polymer composite films for highly sensitive detection of cellobiose dehydrogenase gene

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Guangming, E-mail: zgming@hnu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li Zhen, E-mail: happylizhen@yeah.ne [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Tang Lin; Wu Mengshi; Lei Xiaoxia; Liu Yuanyuan; Liu Can; Pang Ya; Zhang Yi [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)

    2011-05-01

    Highlights: > Gold nanoparticles/multiwalled carbon nanotubes/poly (1,5-naphthalenediamine) modified electrode was fabricated. > The sensor was applied for the detection of cellobiose dehydrogenase genes. > An effective method to distribute MWCNTs and attach to the electrode was proposed. > The composite films greatly improved the sensitivity and enhanced the DNA immobilization. > The DNA biosensor exhibited fairly high sensitivity and quite low detection limit. - Abstract: An electrochemical sensor based on gold nanoparticles (GNPs)/multiwalled carbon nanotubes (MWCNTs)/poly (1,5-naphthalenediamine) films modified glassy carbon electrode (GCE) was fabricated. The effectiveness of the sensor was confirmed by sensitive detection of cellobiose dehydrogenase (CDH) gene which was extracted from Phanerochaete chrysosporium using polymerase chain reaction (PCR). The monomer of 1,5-naphthalenediamine was electropolymerized on the GCE surface with abundant free amino groups which enhanced the stability of MWCNTs modified electrode. Congo red (CR)-functionalized MWCNTs possess excellent conductivity as well as high solubility in water which enabled to form the uniform and stable network nanostructures easily and created a large number of binding sites for electrodeposition of GNPs. The continuous GNPs together with MWCNTs greatly increased the surface area, conductivity and electrocatalytic activity. This electrode structure significantly improved the sensitivity of sensor and enhanced the DNA immobilization and hybridization. The thiol modified capture probes were immobilized onto the composite films-modified GCE by a direct formation of thiol-Au bond and horseradish peroxidase-streptavidin (HRP-SA) conjugates were labeled to the biotinylated detection probes through biotin-streptavidin bond. Scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were used to investigate the film assembly and DNA hybridization processes

  2. Application of compounded microbial inoculants on composting process of excess activated sludge%微生物复合菌剂对污泥好氧堆肥过程的影响

    Institute of Scientific and Technical Information of China (English)

    欧阳建新; 施周; 崔凯龙; 钟华; 梁运姗

    2011-01-01

    研究了黄孢原毛平革菌与枯草芽孢杆菌复合荫剂在剩余污泥静态强制通风好氧堆肥中的作用.结果表明,根据堆肥过程中的温度(0~5d为中温阶段,6~12d为高温阶段,16~28d为腐熟阶段)变化,复合菌剂的变化导致堆体细菌数量明显高于空白堆体,且堆体中的嗜热真菌在高温期显著增多,促进了有机物的降解,加速了堆体的腐熟.试验组萝卜种子发芽指数(GI)相对空白组提前3d达到了50%,表明复合菌剂的加入迅速地降低了堆体的生物毒性,但由于相对浓缩效应使得堆肥产品Cd含量略有增加.%The study focused on the effect of microbial inoculant composite (Bacillus subtili and Phanerochaete chrysosporium) on static composting of excess activated sludge under forced ventilation.According to the temperature change in the composting process (mesophilic(0~5d), thermophilic (6~12d), and maturing(13~28d)), the number of bacterial population of the compost inoculated with the microbes was obviously higher than that of the control, and the population of the thermophilic fungi also significantly increased in the thermophilic stage,effectively enhanceing the degradation of organic matter and accelerateing maturing of the compost.The germination index (GI) of radish seed for the experiment group reached 50% spending 3d less than that for the control one,indicating that addition of the compound microbial inoculant acutely accelerated the decreasing of the compost biological toxicity.However, due to the relative enrichment effect, the Cd (II) content of compost product increased slightly.

  3. Biotransformation of Domestic Wastewater Treatment Plant Sludge by Two-Stage Integrated Processes -Lsb & Ssb

    Directory of Open Access Journals (Sweden)

    Md. Zahangir Alam, A. H. Molla and A. Fakhru’l-Razi

    2012-10-01

    Full Text Available The study of biotransformation of domestic wastewater treatment plant (DWTP sludge was conducted in laboratory-scale by two-stage integrated process i.e. liquid state bioconversion (LSB and solid state bioconversion (SSB processes. The liquid wastewater sludge [4% w/w of total suspended solids (TSS] was treated by mixed filamentous fungi Penicillium corylophilum and Aspergillus niger, isolated, screened and mixed cultured in terms of their higher biodegradation potential to wastewater sludge. The biosolids was increased to about 10% w/w. Conversely, the soluble [i.e. Total dissolve solid (TDS] and insoluble substances (TSS in treated supernatant were decreased effectively in the LSB process. In the developed LSB process, 93.8 g kg-1of biosolids were enriched with fungal biomass protein and nutrients (NPK, and 98.8% of TSS, 98.2% of TDS, 97.3% of turbidity, 80.2% of soluble protein, 98.8% of reducing sugar and 92.7% of chemical oxygen demand (COD in treated sludge supernatant were removed after 8 days of treatment. Specific resistance to filtration (1.39x1012 m/kg was decreased tremendously by the microbial treatment of DWTP sludge after 6 days of fermentation. The treated biosolids in DWTP sludge was considered as pretreated resource materials for composting and converted into compost by SSB process. The SSB process was evaluated for composting by monitoring the microbial growth and its subsequent roles in biodegradation in composting bin (CB. The process was conducted using two mixed fungal cultures, Trichoderma harzianum with Phanerochaete chrysosporium 2094 and (T/P and T. harzianum and Mucor hiemalis (T/M; and two bulking materials, sawdust (SD and rice straw (RS. The most encouraging results of microbial growth and subsequent solid state bioconversion were exhibited in the RS than the SD. Significant decrease of the C/N ratio and germination index (GI were attained as well as the higher value of glucosamine was exhibited in compost; which

  4. A fungal P450 (CYP5136A3 capable of oxidizing polycyclic aromatic hydrocarbons and endocrine disrupting alkylphenols: role of Trp(129 and Leu(324.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available The model white rot fungus Phanerochaete chrysosporium, which is known for its versatile pollutant-biodegradation ability, possesses an extraordinarily large repertoire of P450 monooxygenases in its genome. However, the majority of these P450s have hitherto unknown function. Our initial studies using a genome-wide gene induction strategy revealed multiple P450s responsive to individual classes of xenobiotics. Here we report functional characterization of a cytochrome P450 monooxygenase, CYP5136A3 that showed common responsiveness and catalytic versatility towards endocrine-disrupting alkylphenols (APs and mutagenic/carcinogenic polycyclic aromatic hydrocarbons (PAHs. Using recombinant CYP5136A3, we demonstrated its oxidation activity towards APs with varying alkyl side-chain length (C3-C9, in addition to PAHs (3-4 ring size. AP oxidation involves hydroxylation at the terminal carbon of the alkyl side-chain (ω-oxidation. Structure-activity analysis based on a 3D model indicated a potential role of Trp(129 and Leu(324 in the oxidation mechanism of CYP5136A3. Replacing Trp(129 with Leu (W129L and Phe (W129F significantly diminished oxidation of both PAHs and APs. The W129L mutation caused greater reduction in phenanthrene oxidation (80% as compared to W129F which caused greater reduction in pyrene oxidation (88%. Almost complete loss of oxidation of C3-C8 APs (83-90% was observed for the W129L mutation as compared to W129F (28-41%. However, the two mutations showed a comparable loss (60-67% in C9-AP oxidation. Replacement of Leu(324 with Gly (L324G caused 42% and 54% decrease in oxidation activity towards phenanthrene and pyrene, respectively. This mutation also caused loss of activity towards C3-C8 APs (20-58%, and complete loss of activity toward nonylphenol (C9-AP. Collectively, the results suggest that Trp(129 and Leu(324 are critical in substrate recognition and/or regio-selective oxidation of PAHs and APs. To our knowledge, this is the first

  5. Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter

    International Nuclear Information System (INIS)

    .e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)

  6. Research status of carbonaceous matter in carbonaceous gold ores and bio-oxidation pretreatment%碳质金矿的碳质物及生物氧化预处理研究现状

    Institute of Scientific and Technical Information of China (English)

    杨洪英; 刘倩; 宋襄翎; 董金奎

    2013-01-01

    Carbonaceous gold mines are important refractory gold ores. The previous results demonstrate that the carbonaceous matter is mainly composed of elemental carbon, organic acid and hydrocarbons. The dissolved aurocyanide complex is robbed by adsorption of carbonaceous matter, which is similar to activated carbon in cyanide leaching of gold. The pretreatment methods of carbonaceous gold ores were introduced, including high temperature roasting, bio-oxidation, chemical oxidation, competitive adsorption, barrier inhibition and microwave roasting. Recently, bio-oxidation was developed rapidly due to its advantages such as mild conditions, simple processes, low energy consumption and friendly environment. The known microorganisms related with bio-oxidation pretreatment mainly are chemolithotroph bacteria such as Thiobacillus ferrooxidans, Thiobacillus thiooxidans and Leptospirillum ferrooxidans. The researches on decomposing and passivating carbonaceous matter were commenced by Phanerochaete chrysosporium, Pseudomonadaceae and Streptomyces setonii. Finally, the main problems were analyzed and the application prospect of this technique was looked forward.%碳质金矿是一种重要的难处理金矿。研究发现,其碳质物主要包括元素碳、有机酸和烃类物质。在氰化浸金过程中碳质物可通过类活性炭的吸附方式将已溶解的金劫走。目前,已有的预处理方法主要有高温焙烧法、生物氧化法、化学氧化法、竞争吸附法、覆盖抑制法、微波加热法。生物氧化法因具有条件温和、流程简单、能耗低、环境友好等优点得以迅速发展。与生物氧化预处理有关的微生物主要有氧化亚铁硫杆菌、氧化硫硫杆菌、氧化亚铁钩端螺旋菌等化能无机自养菌。有关黄孢原毛平革菌、假单胞菌、多毛链霉菌在碳质物降解和钝化方面的研究也已展开。最后,分析了该技术存在的问题,并对其应用前景进行了展望。

  7. Bioremediation treatment for cleaning up toxic chemical contaminated soil in field trials

    Energy Technology Data Exchange (ETDEWEB)

    Dang Thi Cam Ha; Nguyen Ba Huu; Pham Thi Quynh Vam; Nguyen Thi De; Nguyen Quoc Viet; Nguyen Duong Nha; La Thamh Phuong; Tran Nhu Hoa; Mai Anh Tuan; Pham Huu Ly; Nguyen Van Minh; Le van Hong; Do quang Huy; Dang Vu Minh; Nguyen Duc Hue

    2002-07-01

    : Pharnerochate sordida YK-624, Phanerochaete chrysosporium; Sphingomonas sp. RWI. Sphingomonas wittichii: Pseudomonas st. CA 10, Terrabacter sp. DBF63, yeast etc and recently in International Symposium of dioxin 2001 there are several new 2, 3, 7, 8 TCDD or 3Cl-DD and chlorinated compound degrader such as: Bacillus midousuji (mesophilic bacterium), Proteus sp. Bacillus sp., P. putida, fungus Acremonium sp and other fungal dioxin-bacterium, Proteus sp., Bacillus sp. P. putida, fungus Acremonium sp. and other fungal dioxin-degarder. The most recent, Hiraishi, et. al. had informed capacities of native microbial population could removed 22% dioxin after three month treatment. (Author)

  8. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    Energy Technology Data Exchange (ETDEWEB)

    Haritash, A.K., E-mail: akharitash@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India); Kaushik, C.P. [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India)

    2009-09-30

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H{sub 2}O, CO{sub 2} (aerobic) or CH{sub 4} (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions

  9. Genetic transformation of lignin degrading fungi facilitated by Agrobacterium tumefaciens

    Directory of Open Access Journals (Sweden)

    Sharma Krishna K

    2010-09-01

    Full Text Available Abstract Background White-rot fungi are primarily the major degraders of lignin, a major obstacle for commercial exploitation of plant byproducts to produce bioethanol and other industrially important products. However, to improve their efficacy for lignin degradation, it has become necessary to genetically modify these organisms using appropriate vectors. Agrobacterium tumefaciens, a soil phytopathogenic bacterium, generally transforms plants by delivering a portion of the resident Ti- plasmid, the T-DNA (transfer DNA. The trans-Kingdom gene transfer is initiated by the activity of Ti-plasmid encoded vir (virulence genes in response to low-molecular-mass phenolic compounds such as acetosyringone. A. tumefaciens played a major role in plant genetic engineering and basic research in molecular biology, accounting for nearly 80% of the transgenic plants produced so far. Initially, it was believed that only dicotyledons, gymnosperms and a few monocotyledonous species could be transformed by this bacterium; but recent reports have totally changed this scenario by demonstrating that many 'recalcitrant' species not included in its natural host range can also be transformed, especially filamentous fungi. Results This paper describes an efficient and convenient Agrobacterium-mediated gene transformation system for successful delivery of T-DNA, carrying the genes coding for β-glucuronidase (uidA, green fluorescent protein (gfp and hygromycin phosphotransferase (hpt to the nuclear genome of lignin degrading white-rot fungi such as Phanerochaete chrysosporium, Ganoderma sp. RCKK-02, Pycnoporous cinnabarinus, Crinipellis sp. RCK-1, Pleurotus sajor-caju and fungal isolate BHR-UDSC without supplementation of acetosyringone. The fungal transformants were confirmed by PCR and Southern hybridization. The expression vector pCAMBIA 1304-RCKK was constructed by the addition of GPD promoter from plasmid p416 to the binary vector backbone pCAMBIA1304, which controls

  10. Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review

    International Nuclear Information System (INIS)

    PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H2O, CO2 (aerobic) or CH4 (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions and the rate can be

  11. Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter

    Energy Technology Data Exchange (ETDEWEB)

    Hashida, Shin-nosuke; Yoshihara, Toshihiro [Environmental Science Research Laboratory, Central Research Institute of Electric Power Industry, Abiko 1646, Abiko-shi, Chiba (Japan)

    2014-07-01

    .e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)

  12. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  13. Laccase production by the aquatic ascomycete Phoma sp. UHH 5-1-03 and the white rot basidiomycete Pleurotus ostreatus DSM 1833 during submerged cultivation on banana peels and enzyme applicability for the removal of endocrine-disrupting chemicals.

    Science.gov (United States)

    Libardi, Nelson; Gern, Regina Maria Miranda; Furlan, Sandra Aparecida; Schlosser, Dietmar

    2012-07-01

    This work aimed to study the production of laccase from Pleurotus ostreatus DSM 1833 and Phoma sp. UHH 5-1-03 using banana peels as alternative carbon source, the subsequent partial purification and characterization of the enzyme, as well the applicability to degrade endocrine disruptors. The laccase stability with pH and temperature, the optimum pH, the K (m) and V(max) parameters, and the molar mass were determined. Tests were conducted for assessing the ability of degradation of the endocrine disruptors t-nonylphenol, bisphenol A, and 17α-ethinylestradiol. Laccase production of 752 and 1,117 U L⁻¹ was obtained for Phoma sp. and P. ostreatus, respectively. Phoma sp. laccase showed higher stability with temperature and pH. The laccase from both species showed higher affinity by syringaldazine. The culture broth with banana peels induced the production of two isoforms of P. ostreatus (58.7 and 21 kDa) and one of Phoma sp. laccase (72 kDa). In the first day of incubation, the concentrations of bisphenol A and 17α-ethinylestradiol were reduced to values close to zero and after 3 days the concentration of t-nonylphenol was reduced in 90% by the P. ostreatus laccase, but there was no reduction in its concentration by the Phoma sp. laccase.

  14. Open-Label Study of the Influence of Food Containing the Royal Sun Mushroom, Agaricus brasiliensis KA21 (Higher Basidiomycetes), on the Quality of Life of Healthy Human Volunteers.

    Science.gov (United States)

    Motoi, Masuro; Motoi, Akitomo; Yamanaka, Daisuke; Ohno, Naohito

    2015-01-01

    We conducted an open-label study in which food containing Agaricus brasiliensis KA21 was consumed continuously for 12 weeks. A questionnaire for subjective evaluation of the efficacy of this food (hereafter, subjective evaluation questionnaire) revealed significant improvements compared with before its intake; there were improvements in the scores of the amounts of hair loss and gray hair, fatigue and general malaise, eye strain, shoulder stiffness, coldness of extremities, difficulty staying awake during the day, and ease of getting out of bed. These findings suggest that intake of food containing A. brasiliensis KA21 results in the above-mentioned subjectively evaluated improvements, and the possibility that A. brasiliensis KA21 improves the body's immunity. Moreover, no issues regarding the safety of the test food were found. PMID:26756293

  15. Cultivated basidiomycetes as a source of new products: In vitro cultivation development, selection of strains resistant to Trichoderma viride, search for new active compounds, factors influencing plasticity in Grifola frondosa

    OpenAIRE

    Schiff Giovannini, Isabelle; Job, Daniel

    2006-01-01

    Les champignons supérieurs sont une source encore peu explorée et exploitée de nouveaux produits naturels. Ils attirent toujours plus l’intérêt des milieux scientifiques et industriels. Dans ce contexte, nous voulions explorer le potentiel de champignons cultivés dans la recherche de nouveaux composés actifs. Nous avons obtenus les fructifications de 14 espèces de Basidiomycètes selon des techniques développées auparavant dans le laboratoire. De plus, nous avons testé la capacité à fructifier...

  16. Screening and fermentation conditions of β-glucanase producing strain from basidiomycetes by multiple mutagensis%β-葡聚糖酶担子菌种复合诱变选育及发酵条件研究

    Institute of Scientific and Technical Information of China (English)

    李蕤; 张洁; 蔡敬民; 吴克; 阚劲松

    2011-01-01

    用平板透明圈法对高温平菇(Pleurotus ostreatus)、金针菇(Flammulina velutipes)、香菇(Lentinus edodes)等担子菌菌种进行筛选.选取高温平菇作为诱变出发菌株进行复合诱变处理并进行初筛.选取透明圈半径与菌落半径比值较大的菌株接种至发酵培养基进行复筛.最终筛选出一株产β-葡聚糖酶能力较强的高温平菇突变菌株P32,并进行产酶条件的优化.结果表明:最佳碳源比为麸皮∶β-葡聚糖∶麦秸粉=9∶1∶1,氮源为4 g/L (NH4)2CO3,起始pH值5.0,培养温度32℃.该菌株在优化条件下产β-葡聚糖酶的能力最强,酶活力达到60.08 IU/mL.%Pleurotus ostreatus, Flam mulina velutipes and Lentinus edodes and so on , were screened by transparent zonesm ethod . Pleurotus ostreatus as initial strain was treated by multiple mutagensis and then the mutants with the bigger ratio of transparent zones radius to colony radius were chosen for further screening . At last, the Pleurotus ostreatus P32 producing high β-glucanase activity was obtained . The results showed that the optinum carbon sources were bran , β-gjucan and barley straw powder in the ratio of 9:1:1 ; the optinum nitrogen source was 4g/L (N H4 )2 CO3; the optinum initial pH and temperature were pH 5 .0 and 32℃ , respectively . Under the optimized conditions, the β-glucanase ability of Pleurotus ostreatus P32 reached as high as 60 .08 IU /m L .

  17. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  18. Evaluation of Anticonvulsant, Antidepressant-, and Anxiolytic-like Effects of an Aqueous Extract from Cultured Mycelia of the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes) in Mice.

    Science.gov (United States)

    Socala, Katarzyna; Nieoczym, Dorota; Grzywnowicz, Krzysztof; Stefaniuk, Dawid; Wlaz, Piotr

    2015-01-01

    Ganoderma lucidum is a well-known medicinal mushroom with a long history of use. This study was designed to assess the anticonvulsant potential of an aqueous extract from cultured G. lucidum mycelium in 3 acute seizure models: timed intravenous pentylenetetrazole infusion, maximal electroshock seizure threshold, and 6-Hz-induced psychomotor seizure tests in mice. Moreover, antidepressant-like and anxiolytic-like effects of G. lucidum were evaluated using the forced swim test and the elevated plus maze test in mice, respectively. No changes in seizure thresholds in the intravenous pentylenetetrazole and maximal electroshock seizure threshold tests after acute treatment with G. lucidum extract (200-600 mg/kg) was observed. However, the studied extract (100-400 mg/kg) significantly increased the threshold for psychomotor seizures in the 6-Hz seizure test. In the forced swim test, G. lucidum (100-400 mg/kg) significantly reduced the duration of immobility. No anxiolytic-like or sedative effects were reported in mice pretreated with the extract (400-600 mg/kg). G. lucidum extract (50-2400 mg/kg) did not produce toxic effects in the chimney test (motor coordination) or grip-strength test (neuromuscular strength). Further studies are required to explain the neuropharmacological effects of G. lucidum and to identify its active ingredients that may affect seizure threshold, mood, or anxiety.

  19. Optimization of the Yield of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes), Cultivated on a Sunflower Seed Hull Substrate Produced in Argentina: Effect of Olive Oil and Copper.

    Science.gov (United States)

    Bidegain, Maximiliano A; Cubitto, Maria Amelia; Curvetto, Nestor Raul

    2015-01-01

    Sunflower seed hulls were used as the main component of a solid substrate for the cultivation of the lingzhi or reishi medicinal mushroom Ganoderma lucidum. This study evaluated the effects of supplementing the substrate with olive oil and copper (II) on the mushroom production (MP) parameters and fruiting body total triterpenoid content. The addition of 1.5% olive oil increased total MP by 21.7% (dry basis) in 3 flushes. Copper (60 ppm) increased the daily productivity of the first flush (MP per day) by both reducing the time needed to harvest the crop and increasing the MP. However, the MP at the second and third flushes was reduced. When both supplements were combined, the MP at the first flush was 43% higher than with control treatment. No significant change in mushroom total triterpenoid content was observed by the addition of supplements to the substrate. An increase of 145-155% in the mushroom copper content was obtained by the addition of 60 ppm copper to the substrate. It is thus recommended to use substrate formulations containing both olive oil and copper (II) and harvest just the first flush.

  20. Study of the combined effect of temperature, pH and water activity on the radial growth rate of the white-rot basidiomycete Physisporinus vitreus by using a hyphal growth model

    CERN Document Server

    Fuhr, M J; Schubert, M; Schwarze, F W M R; Herrmann, H J

    2011-01-01

    The present work investigates environmental effects on the growth of fungal colonies of P. vitreus by using a lattice-free discrete modelling approach called FGM (Fuhr et al. (2010), arXiv:1101.1747), in which hyphae and nutrients are considered as discrete structures. A discrete modelling approach allows studying the underlying mechanistic rule concerning the basic architecture and dynamic of fungal networks on the scale of a single colony. By comparing simulations of the FGM with laboratory experiments of growing fungal colonies on malt extract agar we show that combined effect of temperature, pH and water activity on the radial growth rate of a fungal colony on a macroscopic scale may be explained by a power law for the growth costs of hyphal expansion on a microscopic scale. The information about the response of the fungal mycelium on a microscopic scale to environmental conditions is essential to simulate its behavior in complex structure substrates such as wood, where the impact of the fungus to the woo...

  1. Optimization of the Yield of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes), Cultivated on a Sunflower Seed Hull Substrate Produced in Argentina: Effect of Olive Oil and Copper.

    Science.gov (United States)

    Bidegain, Maximiliano A; Cubitto, Maria Amelia; Curvetto, Nestor Raul

    2015-01-01

    Sunflower seed hulls were used as the main component of a solid substrate for the cultivation of the lingzhi or reishi medicinal mushroom Ganoderma lucidum. This study evaluated the effects of supplementing the substrate with olive oil and copper (II) on the mushroom production (MP) parameters and fruiting body total triterpenoid content. The addition of 1.5% olive oil increased total MP by 21.7% (dry basis) in 3 flushes. Copper (60 ppm) increased the daily productivity of the first flush (MP per day) by both reducing the time needed to harvest the crop and increasing the MP. However, the MP at the second and third flushes was reduced. When both supplements were combined, the MP at the first flush was 43% higher than with control treatment. No significant change in mushroom total triterpenoid content was observed by the addition of supplements to the substrate. An increase of 145-155% in the mushroom copper content was obtained by the addition of 60 ppm copper to the substrate. It is thus recommended to use substrate formulations containing both olive oil and copper (II) and harvest just the first flush. PMID:26853965

  2. Simple and Reproducible Two-Stage Agitation Speed Control Strategy for Enhanced Triterpene Production by Lingzhi or Reishi Medicinal Mushrooms, Ganoderma lucidum ACCC G0119 (Higher Basidiomycetes) Based on Submerged Liquid Fermentation.

    Science.gov (United States)

    Feng, Jie; Feng, Na; Yang, Yan; Liu, Fang; Zhang, Jingsong; Jia, Wei; Lin, Chi-Chung

    2015-01-01

    Triterpenes are important anticancer agents produced by batch submerged liquid fermentation, with the medicinal mushroom Ganoderma lucidum ACCC G0119, which was investigated under various dissolved oxygen levels by varying agitation speeds. Three kinetic parameters were analyzed: specific mycelial growth rate (μsmg), specific glucose consumption rate (qsgc), and specific triterpene production rate (qstp). High concentration, yield, and productivity of triterpenes were achieved by developing a simple and reproducible two-stage agitation speed control strategy. At the first 40 h, agitation speed was controlled at 150 rpm to obtain the quickest peak qstp for triterpene production, subsequently agitation speed was controlled at 100 rpm to maintain high qstp for high triterpene accumulation. The maximum concentration of triterpenes reached 0.086 g/l with the yield of 6.072 g/kg and the productivity of 6.532 × 10-4 g/(l·h), which were 39.61%, 36.48%, and 49.22%, respectively, better than the best results controlled by fixed agitation speeds. Conceivably, such a triterpene fermentation production strategy would be useful for industrial large-scale production of triterpenes with G. lucidum. PMID:26854102

  3. TREATMENT OF A PENTACHLOROPHENOL AND CREOSOTE-CONTAMINATED SOIL USING THE LIGNIN-DEGRADING FUNGUS PHANERO- CHAETE SORDIDA: A FIELD DEMONSTRATION

    Science.gov (United States)

    The feasibility of large-scale fungal bioaugmentation was evaluated by assessing the ability of the lignin-degrading fungus Phanerochaete sordida to decrease the soil concentrations of pentachlorophenol (PCP) and 13 priority pollutant polynuclear aromatic (PNA) creosote component...

  4. 纤维素分解菌的筛选及其不同组合对秸秆降解的效果%Screening of cellulose degrading microbes and the effect of different combinations on straw degradation

    Institute of Scientific and Technical Information of China (English)

    张立霞; 李艳玲; 屠焰; 张乃锋; 刘策; 刁其玉

    2013-01-01

    试验目的是为了获得高效降解纤维素的微生物菌株或者组合,并应用于农作物秸秆的降解,提高其营养价值。利用刚果红纤维素培养基和测定纤维素酶酶活的方法筛选纤维素降解真菌,并与黄孢原毛平革菌组合发酵玉米秸秆,测定降解秸秆的效果。利用刚果红纤维素培养基筛选出黑曲霉、青霉、木霉3株菌,分别与黄孢原毛平革菌组合在PDB中培养7 d,每天测定纤维素降解酶的活性,FPA、β-葡糖苷酶均在第4 d酶活最高,CMCase、木聚糖酶在第2 d的酶活较高。3株纤维素分解菌的酶活性高于其他菌株。与黄孢原毛平革菌进行组合发酵玉米秸秆,纤维素、半纤维素、木质素的降解率较好的组合为PC+黑曲霉+青霉+木霉,分别为29.60%、12.02%、29.10%。本试验得到了一种能较好降解纤维素、半纤维素和木质素的菌株的组合。%The aim of this study was to improve the nutritional value of crop straw by screening high efficient cellulose degrading strains or their combinations. The fungus was screened by us-ing Congo red dye test and the enzyme activity was measured. Then the fungus was combined with Phanerochaete chrysosporium for 7 d in PDB and their effect on the degradation of lignocel-lulose was evaluated. Aspergillus, Penicillium, Trichoderma were finally selected. The enzyme activity of FPA, β-glucosidase were highest on day 4 in the PDB, while CMCase and xylanase activity were highest on 2 d. After 10 days of fermentation on straw, the degradation rate of cel-lulose, hemicellulose and lignin were 29.60%, 12.02%, and 29.10%, respectively. The combina-tion of PC, Aspergillus niger, Penicillium, and Trichoderma was effective in degrading cellulose, hemicellulose and lignin.

  5. Geophilic dermatophytes and other keratinophilic fungi in the nests of wetland birds

    OpenAIRE

    Teresa Korniłłowicz-Kowalska; Ignacy Kitowski; Helena Iglik

    2013-01-01

    The frequency and species diversity of keratinophilic fungi in 38 nests of nine species of wetland birds were examined. Nine species of geophilic dermatophytes and 13 Chrysosporium species were recorded. Ch. keratinophilum, which together with its teleomorph (Aphanoascus fulvescens) represented 53% of the keratinolytic mycobiota of the nests, was the most frequently observed species. Chrysosporium tropicum, Trichophyton terrestre and Microsporum gypseum populations were less widespread. The d...

  6. Survey on the role of brown hares (Lepus europaeus, Pallas 1778 as carriers of zoonotic dermatophytes

    Directory of Open Access Journals (Sweden)

    Francesca Mancianti

    2010-02-01

    Full Text Available The occurrence of dermatophytes and keratinophilic fungi was investigated by hair-brush technique on the coat of 986 apparently healthy brown hares (Lepus europaeus, Pallas 1778 caught in 9 restocking and capture zones in Central Italy. Overall, 7.5% hair samples gave positive results. Trichophyton terrestre (2.1%, Chrysosporium sp, Chrysosporium keratinophilum, Microsporum gypseum, Trichophyton gloriae and Trichophyton mentagrophytes (0.6% each, Trichophyton erinacei and Scopulariopsis brevicaulis (0.4% each, Chrysosporium asperatum (0.3%, Arthroderma sp and Microsporum canis (0.1% each were identified in cultures with single isolates, whereas Chrysosporium sp/T. mentagrophytes (0.3%, Chrysosporium sp/T. terrestre and M. gypseum/T. terrestre (0.2% each, Chrysosporium tropicum/T. terrestre, M. canis/T. terrestre and T. ajelloi/T. terrestre (0.1% each were identified in cultures with mixed isolates. T. erinacei and M. canis have not previously been isolated from hares. M. canis, T. erinacei and T. mentagrophytes were the most clinically important dermatophytes found. Altogether, they were isolated only from 1.5% hair samples. Thus, it is concluded that brown hares may play a limited epidemiological role as carriers of zoonotic dermatophytes. Nevertheless, this should be taken into consideration as many people may be exposed to zoonotic agents from brown hares during hunting and trapping activities.

  7. Funga Nordica

    DEFF Research Database (Denmark)

    A funga of +3000 basidiomycetes from the Nordic countries, with descriptive keys to all levels from order to species, and notes on ecology and distribution......A funga of +3000 basidiomycetes from the Nordic countries, with descriptive keys to all levels from order to species, and notes on ecology and distribution...

  8. Prevalence of keratinophilic fungi in usar soils of Uttar Pradesh, India

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Deshmukh

    2011-10-01

    Full Text Available Alkaline soils commonly called as Usar soil having pH 7.5 to 11.0 is commonly found in regions having poor drainage and little percolation. These soils occupy vast tracts of barren lands in the northern parts of India. These areas are frequently visited by man and animals, however there are no reports on the occurrence of keratinophilic fungi from the Usar soils. The purpose of this research was to study the occurrence of keratinophilic fungi in the alkaline Usar soil. To investigate the occurrence of soil keratinophilic fungi from Usar soil, 120 samples were collected from five districts of Uttar Pradesh viz. Lucknow, Bareilly, Azamgarh, Balia and Pratapgarh. Keratinophilic fungi were isolated by the hair baiting techniques using human hair as keratin bait. The cultures were identified using macro- and micro morphological features. Eighty-tow strains of keratinophilic fungi were recovered from 120 (68.33% soil samples. The isolated fungi were composed of ten species of five genera viz. Chrysosporium indicum (19.16%, Microsporum gypseum (12.5%, Chrysosporium tropicum (10.0%, Chrysosporium pannicola (7.5%, Trichophyton terrestre (5.83%, Chrysosporium lucknowense (4.16%, Chrysosporium state of Ctenomyces serratus (3.33%, Gymnascella dankailensis (3.33%, Gymnoascus reessii (1.66 % and Trichophyton mentagrophytes (1.66 %. The presence of keratinophilic fungi in the Usar soils of Uttar Pradesh, India indicates that these fungi do occur at higher alkalinity.

  9. Further observations on Sporotrichum and some similar fungi

    NARCIS (Netherlands)

    Arx, von J.A.

    1973-01-01

    Sporotrichum azureum Wright & v. Arx, isolated from wood in Argentina, is described and illustrated. The relationship of the genus Sporotrichum with Ptychogaster is discussed, both may represent conidial states of basidiomycetes ( Tyromyces, Oligoporus).

  10. Some endophytes of Juncus trifidus from Tatra Mts. in Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Chlebicki

    2013-12-01

    Full Text Available This is a first part of work devoted highland rush endophytes: Penicillium expansum, Cladosporium oxysporum, Arthrinium state of Apiospora montagnei and Aureobasidium pullulans. The basidiomycete strain, possibly Lagarobasidium detriticum was also isolated.

  11. Calnexin overexpression increases manganese peroxidase production in Aspergillus niger

    NARCIS (Netherlands)

    Conesa, A.; Jeenes, D.; Archer, D.B.; Hondel, C.A.M.J.J. van den; Punt, P.J.

    2002-01-01

    Heme-containing peroxidases from white rot basidiomycetes, in contrast to most proteins of fungal origin, are poorly produced in industrial filamentous fungal strains. Factors limiting peroxidase production are believed to operate at the posttranslational level. In particular, insufficient availabil

  12. Molecular characterization of Cryptococcus gattii genotype AFLP6/VGII isolated from woody debris of divi-divi (Caesalpinia coriaria), Bonaire, Dutch Caribbean

    NARCIS (Netherlands)

    Hagen, F.; Chowdhary, A.; Prakash, A.; Yntema, J.B.; Meis, J.F.G.M.

    2014-01-01

    BACKGROUND: The basidiomycetous yeast Cryptococcus gattii is an emerging and primary pathogen. There is a lack of information about its environmental spread outside outbreak regions in Mediterranean Europe, North and South America. Environmental sampling for C. gattii and molecular characterization

  13. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  14. Environ: E00508 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00508 Polyporus mylittae sclerotium Omphalia Crude drug Proteolytic enzyme, Magnes...ium Polyporus mylittae [TAX:318116] Polyporaceae Polyporus mylittae sclerotium (dried) Crude drugs [BR:br08305] Fungi Basidiomycetes E00508 Polyporus mylittae sclerotium ...

  15. The higher fungi of Amchitka and Adak Islands, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Fruiting body collections of higher fungi, basidiomycetes and ascomycetes, were made during a twelve day field study on two of Alaska's Aleutian Islands, Amchitka...

  16. Materials to knowledage of the geographical distribution of higher fungi in Europe. IV

    Directory of Open Access Journals (Sweden)

    Alina Skirgiełło

    2014-11-01

    Full Text Available The localities of 24 species of Basidiomycetes, recorded from Poland, are presented and their distribution shown by the measuring point method with occasional reference to the geographical range of several trees.

  17. The role of natural chlorinated hydroquinone metabolites in ligninolytic fungi

    OpenAIRE

    Teunissen, P.J.M.

    1999-01-01

    Ligninolytic Basidiomycetes have been reported to produce a wide variety of chloroaromatic compounds as secondary metabolites, which are structurally similar to environmental pollutants. Among these are chlorinated hydroquinone metabolites (CHM), such as 2-chloro-1,4-dimethoxybenzene (2Cl-14DMB), 2,6-dichloro-1,4-dimethoxybenzene (26DCl-14DMB), tetrachloro-1,4-dimethoxybenzene and tetrachloro-4-methoxyphenol, which are synthesized by 11 genera of Basidiomycetes.The biosynthesis of these chlor...

  18. Physical Damages of Wood Fiber in Acacia Mangium due to Biopulping Treatment

    Directory of Open Access Journals (Sweden)

    Ridwan Yahya

    2016-05-01

    chrysosporium to Acacia mangium Willd can reduce lignin and improve holocellulose and cellulose content of the material. Fiber dimension recognized as other important factor for paper properties. The question is how the integrity and dimensions of the wood fiber that has been pretreated with the fungus. The objectives of present study were to know effect of pretreatment of P. chrysosporium to the integrity and dimensions of the fiber. The P. chrysosporium was cultured for 14 days in growth medium, and inoculated to wood chips 5% (w/v and incubated for 0, 15 and 30 days. The inoculated wood chips were chipped into 1 mm x 1 mm x 20 mm and macerated using franklin solution at 60 oC for 48 hours. Forty fibers from each incubated time were analized their physical damages using a light microscope at a 400 magnification. The inoculated fibers were measured theirs dimensions. The physical damage percentage of fibers pretreated using P. chrysosporium was 0%. Length and wall thickness of the pretreated fibers were can be categorized as middle class and thin fibers, respectively.

  19. Correlation between the abundance of cellulolitic fungi and selected soil properties

    Directory of Open Access Journals (Sweden)

    Teresa Korniłłowicz-Kowalska

    2014-08-01

    Full Text Available The study conducted has revealed the general abundance of cellulolytic fungi in the soil is significantly correlated only with the phosphors content. The correlation with specific soil properties was found in the case of the genera Humicola, Penicillium, Fusarium and Chrysosporium of the 10 genera of these fungi isolated most often.

  20. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O’Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.