Digital monitoring of mycelium growth kinetics and vigor of shiitake (Lentinula edodes (Berk. Pegler on agar medium Monitoramento digital do crescimento e vigor do shiitake (Lentinula edodes (Berk. Pegler em meio de cultura

Directory of Open Access Journals (Sweden)

Renato Mamede de Castro Montini

2006-03-01

Full Text Available The mycelium growth kinetics and vigor of shiitake (Lentinula edodes (Berk. Pegler strains LE 96/17, LE 98/51, LE 98/53, and LE 98/56 were studied under different agar medium compositions. The strains were from the mycological collection of the Módulo de Cogumelos, Faculdade de Ciências Agronômicas, Unesp-Botucatu, Brazil. Mycelium fragments from stock cultures were transferred to Petri dishes with Sawdust extract-Dextrose-Agar medium. The area of growth and vigor (density of the mycelia were daily recorded with a digital camera, during incubation, until the complete colonization of the Petri dish. The images were analyzed by the freeware UTHSCSA ImageTool, v. 2.0, developed by the University of Texas Health Science Center, San Antonio. The kinetics of mycelium growth, as measured by the mycelium area (mm², has as a deterministic component an exponential function of Gompertz. The vigor, as evaluated by mycelium color in gray scale, was similar for all strains, reached a maximal value between the 4th and 5th day of incubation and decreased further on. The velocity of growth of L. edodes strains was lower in enriched culture media, while vigor was higher. Digital monitoring permits a objective evaluation of the growth kinetics of L. edodes in vitro.Avaliou-se o crescimento e vigor das linhagens LE 96/17, LE 98/51, LE 98/53 e LE 98/56 de Lentinula edodes (Berk Pegler em diferentes composições de meio de cultura. As linhagens foram provenientes da Micoteca do Módulo de Cogumelos da Faculdade de Ciências Agronômicas, Unesp, Campus de Botucatu. Os isolados foram obtidos por propagação vegetativa, pela transferência asséptica do micélio para o meio de cultura de extrato de serragem-dextrose-ágar. O crescimento e vigor do micélio foi fotografado diariamente com uma câmera digital, durante a incubação, até a colonização total da placa de Petri. As imagens foram analisadas pelo programa UTHSCSA ImageTool (freeware, versão 2

Development and Molecular Characterization of Novel Polymorphic Genomic DNA SSR Markers in Lentinula edodes.

Science.gov (United States)

Moon, Suyun; Lee, Hwa-Yong; Shim, Donghwan; Kim, Myungkil; Ka, Kang-Hyeon; Ryoo, Rhim; Ko, Han-Gyu; Koo, Chang-Duck; Chung, Jong-Wook; Ryu, Hojin

2017-06-01

Sixteen genomic DNA simple sequence repeat (SSR) markers of Lentinula edodes were developed from 205 SSR motifs present in 46.1-Mb long L. edodes genome sequences. The number of alleles ranged from 3-14 and the major allele frequency was distributed from 0.17-0.96. The values of observed and expected heterozygosity ranged from 0.00-0.76 and 0.07-0.90, respectively. The polymorphic information content value ranged from 0.07-0.89. A dendrogram, based on 16 SSR markers clustered by the paired hierarchical clustering' method, showed that 33 shiitake cultivars could be divided into three major groups and successfully identified. These SSR markers will contribute to the efficient breeding of this species by providing diversity in shiitake varieties. Furthermore, the genomic information covered by the markers can provide a valuable resource for genetic linkage map construction, molecular mapping, and marker-assisted selection in the shiitake mushroom.

Growth evaluation of Lentinula edodes in solid medium cultures for mycelium production as inoculum

Directory of Open Access Journals (Sweden)

Valeska Villegas E

2007-07-01

Full Text Available Shitake (Lentinula edodes Pegler jumbo strain growth was evaluated in different solid mediums and growth substrates for spawn production. Mycelium growth was tested in three culture mediums (MYA, OMYA, PDYA at two pHs (5, 5.5, using two eucalyptus sawdust percentages (0.3%, 0.2%. Analysing variance revealed significant differences in culture medium (P0.05. The liquid inoculation technique was used for evaluating mushroom spawn production using five different combinations of eucalyptus sawdust and wheat grain, finding significant differences between treatments, the best combination for shiitake growth being 80% wheat grain and 20% eucalyptus sawdust.

A fileira de produção em troncos Shitake (Lentinula Edodes) na Terrius

OpenAIRE

Zuzarte, Maria Miguel Lobo Borralho de Sousa

2014-01-01

Este trabalho realizou-se em colaboração com a empresa Terrius cuja sede se situa na Serra de São Mamede – Marvão, onde são vendidos produtos da região e transformados de forma original e natural, incluindo produtos à base de cogumelos. Esta entidade também tem uma pequena exploração de cogumelos saprófitas – Shitake (Lentinula edodes) - em Portalegre, onde decorreu o presente trabalho. A exploração consiste em duas estufas rede de 600m2 onde se encontram cerca de 40 ton de madeira inocula...

Selective ligninolysis of wheat straw and wood chips by the white-rot fungus Lentinula edodes and its influence on in vitro rumen degradability

NARCIS (Netherlands)

Kuijk, van S.J.A.; Rio, del José C.; Rencoret, Jorge; Gutiérrez, Ana; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

2016-01-01

Background: The present work investigated the influence of lignin content and composition in the fungal
treatment of lignocellulosic biomass in order to improve rumen degradability. Wheat straw and wood chips,
differing in lignin composition, were treated with Lentinula edodes for 0, 2, 4, 8

Lentinula edodes based GIS mapping, biometabolites and antiinflamatory activity of wild edible mushrooms

Science.gov (United States)

Khaund, Polashree; Joshi, S R

2016-03-01

The biodiversity rich state of Meghalaya, India located in the realms of mega-biodiversity hotspots, is home to numerous species of wild edible macrofungi that are used extensively by the mycophillic ethnic population, as a part of their traditional cuisine and medicine systems. However, habitat loss, due to deforestation and climate change, is destroying the natural population of these mushrooms, depleting their availability to the local communities. In the present investigation, a GIS guided habitat search, using Lentinula edodes as a representative species, was used in mapping the habitats of wild edible macrofungi of the study region. Sampling of around 4 000 specimens per distinct morphological type available in the traditional markets and “sacred grove” forests indicated presence of ten common genera, belonging to nine different families of wild edible mushrooms. Nutritional profiling of the representative species Lentinula edodes was carried out by evaluation of its moisture, total fat, crude protein and carbohydrates contents by standard methods. Similarly, bioactive components determination was performed by estimation of total phenols, flavonoids, ascorbic acid, β-carotene and lycopenes. Bioactivity of the mushrooms extracts was studied using the DPPH radical scavenging and Human Red Blood Cell (HRBC) membrane stabilization assays. The present investigation successfully attempted to explore remote sensing technologies and GIS (Geographic Information System) based system to predict the natural habitats of wild edible mushrooms of Meghalaya, India which we believe will lead to the generation of a mushroom specific non-wood forest resource mapping system in the near future. Results of nutritional profiling and biological activity studies on the representative species of wild edible mushrooms from the studied region revealed that it is a rich source of essential nutrients and antioxidants.

The reactivity of phenolic and non-phenolic residual kraft lignin model compounds with Mn(II)-peroxidase from Lentinula edodes.

Science.gov (United States)

Crestini, C; D'Annibale, A; Sermanni, G G; Saladino, R

2000-02-01

Three phenolic model compounds representing bonding patterns of residual kraft lignin were incubated with manganese peroxidase from Lentinula edodes. Extensive degradation of all the phenolic models, mainly occurring via side-chain benzylic oxidation, was observed. Among the tested model compounds the diphenylmethane alpha-5 phenolic model was found to be the most reactive, yielding several products showing oxidation and fragmentation at the bridging position. The non-phenolic 5-5' biphenyl and 5-5' diphenylmethane models were found unreactive.

Cloning of the Lentinula edodes B mating-type locus and identification of the genetic structure controlling B mating.

Science.gov (United States)

Wu, Lin; van Peer, Arend; Song, Wenhua; Wang, Hong; Chen, Mingjie; Tan, Qi; Song, Chunyan; Zhang, Meiyan; Bao, Dapeng

2013-12-01

During the life cycle of heterothallic tetrapolar Agaricomycetes such as Lentinula edodes (Berk.) Pegler, the mating type system, composed of unlinked A and B loci, plays a vital role in controlling sexual development and resulting formation of the fruit body. L. edodes is produced worldwide for consumption and medicinal purposes, and understanding its sexual development is therefore of great importance. A considerable amount of mating type factors has been indicated over the past decades but few genes have actually been identified, and no complete genetic structures of L. edodes B mating-type loci are available. In this study, we cloned the matB regions from two mating compatible L. edodes strains, 939P26 and 939P42. Four pheromone receptors were identified on each new matB region, together with three and four pheromone precursor genes in the respective strains. Gene polymorphism, phylogenetic analysis and distribution of pheromone receptors and pheromone precursors clearly indicate a bipartite matB locus, each sublocus containing a pheromone receptor and one or two pheromone precursors. Detailed sequence comparisons of genetic structures between the matB regions of strains 939P42, 939P26 and a previously reported strain SUP2 further supported this model and allowed identification of the B mating type subloci borders. Mating studies confirmed the control of B mating by the identified pheromone receptors and pheromones in L. edodes. © 2013 Elsevier B.V. All rights reserved.

Crescimento micelial de dois isolados de Lentinula edodes (Berk. Pegler, em resíduos ligninocelulósicos - DOI: 10.4025/actascibiolsci.v30i2.3622 Mycelial growth of two isolated strains of Lentinula edodes (Berk. Pegler in lignocellulose residue - DOI: 10.4025/actascibiolsci.v30i3.3622

Directory of Open Access Journals (Sweden)

Eraldo Schunck da Silva

2008-05-01

Full Text Available Com a finalidade de verificar o crescimento micelial de dois isolados, 42 e 47, de Lentinula edodes, utilizaram-se os substratos: serragens de Eucalyptus sp., de Grevillea robusta e de Melia azedarach; resíduo de algodão e folhas de Panicum maximum em diferentes composições e suplementados com farelos de soja e de arroz. Verificou-se crescimento micelial por meio de medidas do raio avaliadas pela Análise de Dados Longitudinais. Os dados obtidos foram submetidos à analise estatística (Manova. O crescimento foi significativamente diferente ao longo do tempo e este influenciou marcadamente o comportamento dos isolados nos diferentes resíduos. Observaram-se quatro padrões de comportamento para o isolado 42 e cinco, para o 47. As serragens de Eucalyptus sp. e de G. robusta mostraram-se as mais propícias ao crescimento dos dois isolados de L. edodes, confirmando ser essa espécie essencialmente de hábito lignícola.With the purpose of verifying the mycelial growth of two isolated strains of Lentinula edodes – 42 and 47 –, the following substrates were used: sawdusts of Eucalyptus sp., Grevillea robusta and Melia azedarach; cotton residue and leaves of Panicum maximum, in different compositions and complemented with crumbs of soy and rice. Mycelial growth was verified through radius measurements as evaluated by Longitudinal Data Analysis. The obtained data was submitted to statistical analysis (Manova. The growth was significantly different along time, and this influenced remarkably the behavior of the isolated strains in the different residues. Four patterns of behavior were observed for isolate 42, and five for number 47. The sawdusts of Eucalyptus sp. and of G. robusta proved to the most favorable for growing the two isolates of L. edodes, confirming this species to be essentially lignous.

Analysis and evaluation of tasty components in the pileus and stipe of Lentinula edodes at different growth stages.

Science.gov (United States)

Chen, Wanchao; Li, Wen; Yang, Yan; Yu, Hailong; Zhou, Shuai; Feng, Jie; Li, Xiaobei; Liu, Yanfang

2015-01-28

Tasty components in Lentinula edodes pileus and stipe at different growth stages were studied. Mannitol, trehalose, arabitol, and glucose were the main soluble polyols and sugars, whereas succinic acid, malic acid, and citric acid were the main organic acids. Mannitol contents were the highest in the pileus and increased at mature growth stages, although arabitol contents were the highest in the stipe and peaked at stage 5. Succinic acid contents peaked at stage 5 in the pileus and stipe during mature growth stages. Threonine (sweet taste) values were the highest among all the detected amino acids, followed by glutamic acid (MSG-like taste). MSG-like 5'-nucleotide contents could account for nearly 50% of the total 5'-nucleotides. Equivalent umami concentration (EUC) values of stage 5 exhibited higher levels during mature growth stages. Tasty components in the stipe were rich and EUC values were high, which might be useful for further processing and byproduct development of L. edodes.

Defense Response and Suppression of Phytophthora Blight Disease of Pepper by Water Extract from Spent Mushroom Substrate of Lentinula edodes

Directory of Open Access Journals (Sweden)

Dae-Sun Kang

2017-06-01

Full Text Available The spent mushroom substrate (SMS of Lentinula edodes that was derived from sawdust bag cultivation was used as materials for controlling Phytophthora blight disease of pepper. Water extract from SMS (WESMS of L. edodes inhibited mycelial growth of Phytophthora capsici, suppressed Phytophthora blight disease of pepper seedlings by 65% and promoted growth of the plant over 30%. In high performance liquid chromatography (HPLC analysis, oxalic acid was detected as the main organic acid compound in WESMS and inhibited the fungal mycelium at a minimum concentration of 200 mg/l. In quantitative real-time PCR, the transcriptional expression of CaBPR1 (PR protein 1, CaBGLU (β-1,3-glucanase, CaPR-4 (PR protein 4, and CaPR-10 (PR protein 10 were significantly enhanced on WESMS and DL-β-aminobutyric acid (BABA treated pepper leaves. In addition, the salicylic acid content was also increased 4 to 6 folds in the WESMS and BABA treated pepper leaves compared to water treated leaf sample. These findings suggest that WESMS of L. edodes suppress Phytophthora blight disease of pepper through multiple effects including antifungal activity, plant growth promotion, and defense gene induction.

Hydrolytic enzyme activities in shiitake mushroom (Lentinula edodes) strains cultivated on coffee pulp.

Science.gov (United States)

Mata, Gerardo; Salmones, Dulce; Pérez-Merlo, Rosalía

Hydrolytic enzyme production (cellulases, laminarinases and xylanases) was studied in cultures of Lentinula edodes on sterilized coffee pulp. Samples of substrate colonized by mycelia were taken after 7, 14, 21, 28 and 35 days of incubation at 25°C (W1 to W5) and during the fruiting period at different stages: formation of primordia (PF), first harvest (H) and one week after the first harvest (PH). The enzymatic activity was lower during the early mycelial growth and showed higher levels during the formation and development of fruiting bodies. During the reproductive stage of the fungus, the samples were subjected to a soaking treatment; however, it was not possible to relate this soaking treatment to the increase in enzyme production. The levels of enzymatic activity suggest that secretion of the studied enzymes does not influence the adaptability of the strains to the substrate. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth.

Science.gov (United States)

Mata, Juan Luis; Mishra, Nutan Tulapurkar

2015-01-01

Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

[Auxin synthesis by the higher fungus Lentinus edodes (Berk.) Sing in the presence of low concentrations of indole compounds].

Science.gov (United States)

Tsivileva, O M; Loshchinina, E A; Makarov, O E; Nikitina, V E

2012-01-01

The auxin formation in a submerged culture of the xylotrophic basidiomycete Lentinus edodes (Berk.) Sing (Lentinula edodes (Berk.) Pegler) (shiitake) is studied. Biologically active substances of an indole nature are identified, "the effect of small doses" of which lies in not only the stimulation of growth of the mycelium (indole-3-acetic acid, 2 x 10(-7)-2 x 10(-4) g/l), but also in the induction of tryptophan-independent paths of auxin biosynthesis. The above-mentioned path is realized in the presence of exogenous indole (1 x 10(-3)-1 x 10(-4) g/l), as well as while inducing the biosynthesis of indole-3-acetic acid by its microadditives (1 x 10(-5)-1 x 10(-8) g/l), and is accompanied by the formation of anthranilic acid (up to 1.5 mg/l). Induction of the generative development stage ofshiitake by indole derivatives is revealed. It was found that among the studied compounds only indoleacetamide at a concentration of an order of x 10(-4) g/l in the culture fluid of L. edodes had a pronounced stimulatory effect on the formation of shiitake's brown mycelial film.

A metabolomics approach to evaluate the effects of shiitake mushroom (Lentinula edodes) treatment in undernourished young rats

Energy Technology Data Exchange (ETDEWEB)

Molz, Patrícia [Nutrition Course, Department of Physical Education and Health, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Graduate Program in Health Promotion, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Ellwanger, Joel Henrique [Biological Sciences Course, Department of Biology and Pharmacy, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Eliete Iochims dos Santos, Carla; Dias, Johnny Ferraz [Ion Implantation Laboratory, Physics Institute, Federal University of Rio Grande do Sul, Porto Alegre, RS (Brazil); Campos, Deivis de [Biological Sciences Course, Department of Biology and Pharmacy, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Corbellini, Valeriano Antonio [Graduate Program in Health Promotion, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Prá, Daniel [Graduate Program in Health Promotion, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Biological Sciences Course, Department of Biology and Pharmacy, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Putzke, Marisa Terezinha Lopes [Biological Sciences Course, Department of Biology and Pharmacy, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Franke, Silvia Isabel Rech, E-mail: silviafr@unisc.br [Nutrition Course, Department of Physical Education and Health, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil); Graduate Program in Health Promotion, University of Santa Cruz do Sul, Santa Cruz do Sul, RS (Brazil)

2014-01-01

Undernourishment is characterized by a decrease of the metabolic rate as a result of lack of nutrients important to life. Shiitake mushroom (Lentinula edodes) can be an alternative to reverse undernourishment. The aim of this study was to explore the metabolic changes and consequent elemental concentrations found in undernourished rats and undernourished rats treated with shiitake mushroom (n = 12 rats each group). To determine the elemental concentration, blood samples were analyzed by Particle Induced X-ray Emission (PIXE). For metabolomics, blood samples were tested under Fourier Transform Infrared Spectroscopy (FT-IR). The results indicated that the supplementation with shiitake mushroom in undernourished rats altered the composition of blood proteins, elements and volume. Several strong correlations were observed between the elemental concentrations and metabolic parameters.

A metabolomics approach to evaluate the effects of shiitake mushroom (Lentinula edodes) treatment in undernourished young rats

International Nuclear Information System (INIS)

Molz, Patrícia; Ellwanger, Joel Henrique; Eliete Iochims dos Santos, Carla; Dias, Johnny Ferraz; Campos, Deivis de; Corbellini, Valeriano Antonio; Prá, Daniel; Putzke, Marisa Terezinha Lopes; Franke, Silvia Isabel Rech

2014-01-01

Undernourishment is characterized by a decrease of the metabolic rate as a result of lack of nutrients important to life. Shiitake mushroom (Lentinula edodes) can be an alternative to reverse undernourishment. The aim of this study was to explore the metabolic changes and consequent elemental concentrations found in undernourished rats and undernourished rats treated with shiitake mushroom (n = 12 rats each group). To determine the elemental concentration, blood samples were analyzed by Particle Induced X-ray Emission (PIXE). For metabolomics, blood samples were tested under Fourier Transform Infrared Spectroscopy (FT-IR). The results indicated that the supplementation with shiitake mushroom in undernourished rats altered the composition of blood proteins, elements and volume. Several strong correlations were observed between the elemental concentrations and metabolic parameters

Extracts from Lentinula edodes (Shiitake) Edible Mushrooms Enriched with Vitamin D Exert an Anti-Inflammatory Hepatoprotective Effect.

Science.gov (United States)

Drori, Ariel; Shabat, Yehudit; Ben Ya'acov, Ami; Danay, Ofer; Levanon, Dan; Zolotarov, Lidya; Ilan, Yaron

2016-04-01

Vitamin D has been known for its anti-inflammatory properties. Extracts derived from Lentinula edodes (Shiitake) edible mushroom exert an anti-inflammatory effect. These extracts contain high levels of ergosterol, which converts into ergocalciferol (vitamin D2) following exposure to ultraviolet light, followed by absorption and hydroxylation into the active form 25-hydroxyvitamin D [25(OH)D]. To determine the anti-inflammatory effect of overexpression of vitamin D in edible mushrooms, L. edodes mushrooms were exposed to ultraviolet-B light, freeze-dried, followed by measurement of vitamin D2 contents, in their dry weight. C57B1/6 mice were orally treated with vitamin D2-enriched or nonenriched mushroom extract prior and during concanavalin A-immune-mediated liver injury. Exposure to ultraviolet light increased vitamin D2 content in Shiitake edible mushrooms. Following feeding of vitamin D-enriched mushroom extracts to mice with immune-mediated hepatitis, a significant decrease in liver damage was noted. This was shown by a decrease in alanine aminotransferase and aspartate aminotransferase serum levels, a decrease in proportion of mice with severe liver injury, and by improvement in liver histology. These effects were associated with a decrease in serum interferon gamma levels. A synergistic effect was noted between the anti-inflammatory effect of the mushroom extracts and that of vitamin D. Oral administration of vitamin D-enriched L. edodes edible mushroom exerts a synergistic anti-inflammatory effect in the immune-mediated hepatitis. The data support its potential use as safe immunomodulatory adjuvant for the treatment of HCV and nonalcoholic steatohepatitis.

Biodegradation of 2,4-dichlorophenol by shiitake mushroom (Lentinula edodes) using vanillin as an activator.

Science.gov (United States)

Tsujiyama, S; Muraoka, T; Takada, N

2013-07-01

The white-rot shiitake mushroom, Lentinula edodes, was used to degrade an environmentally hazardous compound, 2,4-dichlorophenol (DCP), using vanillin as an activator. Vanillin increased the mycelial growth from 74 to 118 mg/150 ml culture and accelerated laccase and Mn-peroxidase production from the maximum on days 24-28 without vanillin to days 10-14. It eliminated 92% of 100 mM DCP with 50 mg vanillin/l compared with only 15% without vanillin. GC-MS revealed that a diaryl ether dimer of DCP was formed in the culture without vanillin, whereas dimer formation was diminished with vanillin addition. This indicates that vanillin enhances the degradation of DCP and disrupts the formation of the toxic dimer. Therefore, lignin-derived phenol such as vanillin can be used as natural and eco-friendly activators to control white-rot mushrooms, thereby facilitating the effective degradation of environmentally hazardous compounds.

Effects of Aeration of Sawdust Cultivation Bags on Hyphal Growth of Lentinula edodes.

Science.gov (United States)

Lee, Hwa-Yong; Ham, Eun-Ju; Yoo, Young-Jin; Kim, Eui-Sung; Shim, Kyu-Kwang; Kim, Myung-Kon; Koo, Chang-Duck

2012-09-01

The effects of aeration through lid filters on the hyphal growth of Lentinula edodes (oak mushroom) in sawdust cultivation bags were investigated. The aeration treatment levels were traditional 27 mm hole cotton plugs, cotton balls and combinations of seven hole sizes × two hole positions (up and under) in the lids covering plastic bags containing 1.4 kg sawdust medium at 63% moisture that had been autoclaved for one hour and inoculated with sawdust spawn of L. edodes strain 921. Aeration treatment effects were measured based on the CO(2) concentration at the 15th wk, as well as the hyphal growth rate and degree of weight loss of bags every 14 days for 15 wk. In bags with traditional cotton plugs, the CO(2) concentration was 3.8 ± 1.3%, daily mean hyphal growth was 2.3 ± 0.6 mm and daily mean weight loss was 0.84 ± 0.26 g. In the bags with 15 mm diameter holes, the CO(2) concentration was 6.0 ± 1.6%, daily hyphal growth was 2.8 ± 0.2 mm and daily weight loss was 0.86 ± 0.4 g. The bags with 15 mm holes had a higher CO(2) concentration and lower water loss than bags with other hole sizes, but the hyphal growth was not significantly different from that of other bags. The weight loss of bags increased proportionally relative to the lid hole sizes. Taken together, these results indicate that traditional cotton plugs are economically efficient, but 15 mm hole lids are the most efficient at maintaining hyphal growth and controlling water loss while allowing CO(2) emissions.

Production evaluation of Lentinula edodes Pegler fungi in synthetic logs based on agricultural wastes Evaluación de la producción del hongo Lentinula edodes Pegler en bloques sintéticos a base de residuos agroindustriales

Directory of Open Access Journals (Sweden)

Clara Arredondo

2007-12-01

Full Text Available Production of Lentinula edodes, medicinal and gourmet mushroom commonly known as shiitake, was evaluated in synthetic blocks with the aim of using agroindustrial wastes not jet studied quantitatively and environmentally problematical for many industries. Fifty five different combinations of substrates were analyzed using two agroindustrial wastes (cocoa husk and cotton waste, one wood supplement (oak, one nitrogen source (wheat bran, one pH controller (CaCO3, and one growth stimulator (CaSO4. It was found that the substrate formulation has a considerable effect upon the colonization time of the block (P El cultivo de Lentinula edodes, hongo comestible, medicinal y comúnmente llamado shiitake, se evaluó en bloques sintéticos con el fin de aprovechar diferentes residuos agroindustriales no estudiados hasta el momento cuantitativamente, y que representan un problema ambiental para algunas empresas. Se realizaron 55 diferentes combinaciones de sustratos utilizando dos residuos agroindustriales (cascarilla de cacao y motosa de algodón, un suplemento maderable (viruta de roble, una fuente de nitrógeno (salvado de trigo, un controlador de pH (CaCO3 y un estimulador de crecimiento (CaSO4. Se encontró que la formulación del sustrato tiene un gran efecto sobre el tiempo de colonizaci´on del bloque (P < 0,05, siendo la viruta de roble un elemento esencial para la reducci´on del tiempo de colonizaci´on. Adicionalmente, se halló que la cascarilla de cacao no es un buen suplemento para la producción del macromiceto. Los tratamientos que proporcionaron mejores condiciones para la formación de cuerpos fructíferos contenían 75% de viruta de roble en combinación con salvado de trigo (20 − 25% o motosa de algodón (25%. Dependiendo del tratamiento evaluado, se obtuvieron eficiencias biol´ogicas entre un 5,3 a un 21,5%, tamaños de píleo entre 4,7 y 9,3 cm para la primera cosecha, precocidades de colonizaci´on entre 69 y 125 d´ıas, con

Effect of Agaricus brasiliensis and Lentinula edodes mushrooms on the infection of passionflower with Cowpea aphid-borne mosaic virus

Directory of Open Access Journals (Sweden)

Robson Marcelo Di Piero

2010-04-01

Full Text Available The objective of the present study was to evaluate the protection of passion fruit plants against CABMV by using preparations from Agaricus brasiliensis and Lentinula edodes mushrooms. In experiments carried out in the greenhouse, the fruiting body extracts from some of the isolates of both mushrooms significantly reduced CABMV incidence in passion fruit plants. This protective effect occurred when the plant leaves, pre-treated with extracts, were later inoculated mechanically with the virus. However, the extracts did not protect the plants in experiments involving CABMV transmission by aphid vectors. An inhibitory effect of mushroom extracts on the virus particles was also demonstrated on Chenopodium quinoa, a CABMV local lesion host, by inoculating the plants with a mixture of extracts and virus suspension. Still in C. quinoa, the mushroom extracts from some isolates induced systemic resistance against the virus. These results showed that aqueous extracts from A. brasiliensis and L. edodes fruiting bodies had CABMV infectivity inhibitors, but that was not enough to control the viral disease on passion fruit plants at all, considering they were infected through a vector.O endurecimento dos frutos do maracujazeiro, causado pelo Cowpea aphid-borne mosaic virus (CABMV, é um dos problemas mais sérios que atingem a cultura. Tentativas de se obter plantas resistentes ao vírus ou estirpes fracas premunizantes não apresentaram sucesso até o momento. O objetivo do presente estudo foi o de avaliar a proteção das plantas de maracujá contra o CABMV, utilizando preparações dos cogumelos Lentinula edodes e Agaricus blazei, através da indução de resistência. Em experimentos conduzidos no interior de casa de vegetação, os extratos de basidiocarpos de ambos os cogumelos reduziram significativamente a incidência da virose em plantas de maracujá que tiveram as folhas pré-tratadas com esses extratos e que foram posteriormente inoculadas

Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

Science.gov (United States)

Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

2014-07-20

We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

Anti-HCV effect of Lentinula edodes mycelia solid culture extracts and low-molecular-weight lignin.

Science.gov (United States)

Matsuhisa, Koji; Yamane, Seiji; Okamoto, Toru; Watari, Akihiro; Kondoh, Masuo; Matsuura, Yoshiharu; Yagi, Kiyohito

2015-06-19

Lentinula edodes mycelia solid culture extract (MSCE) contains several bioactive molecules, including some polyphenolic compounds, which exert immunomodulatory, antitumor, and hepatoprotective effects. In this study, we examined the anti-hepatitis C virus (HCV) activity of MSCE and low-molecular-weight lignin (LM-lignin), which is the active component responsible for the hepatoprotective effect of MSCE. Both MSCE and LM-lignin inhibited the entry of two HCV pseudovirus (HCVpv) types into Huh7.5.1 cells. LM-lignin inhibited HCVpv entry at a lower concentration than MSCE and inhibited the entry of HCV particles in cell culture (HCVcc). MSCE also inhibited HCV subgenome replication. LM-lignin had no effect on HCV replication, suggesting that MSCE contains additional active substances. We demonstrate here for the first time the anti-HCV effects of plant-derived LM-lignin and MSCE. The hepatoprotective effect of LM-lignin suggests that lignin derivatives, which can be produced in abundance from existing plant resources, may be effective in the treatment of HCV-related diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

Screening of inducers for laccase production by Lentinula edodes in liquid medium Seleção de indutores para produção de lacase por Lentinula edodes

Directory of Open Access Journals (Sweden)

José Renato P. Cavallazzi

2005-12-01

Full Text Available Laccases are enzymes involved in lignin degradation and are produced by various organisms. Due to their low substrate specificity their potential to be used in biotechnological applications has received attention. The addition of laccase inducers to the culture medium of microorganisms can enhance laccase production and facilitate its purification and utilization. The aim of this study was to investigate the effect of some compounds as laccase inducers in cultures of Lentinula edodes (shiitake. First, it was selected a culture medium suitable for laccase production by shiitake using two levels of N (2.6 and 26 mM and seven levels of Cu (0, 50, 100, 150, 200, 250 and 300 µM. The medium with 2.6 mM N and 250 µM Cu was found to provide the highest laccase activity. To the selected medium it were added gallic acid (1 mM, catechol (1 mM, ammonium tartrate (55 µM, hydroxybenzoic acid (1 mM and vanillin (1 mM. The two first compounds completely inhibited laccase activity and a 30 day time course experiment was carried out with the remaining compounds. Only cultures with ammonium tartrate exhibited laccase activity higher than control cultures, reaching 251 U/mL of extract after 30 days. A native-PAGE was performed and showed only one band, suggesting that no isozyme was produced.Lacases são enzimas envolvidas na degradação da lignina e produzidas por diversos organismos. Devido à sua baixa especificidade por substratos, seu potencial para utilização em aplicações biotecnológicas tem sido objeto de investigação. A adição de indutores de lacases ao meio de cultivo de microrganismos aumenta a produção dessas enzimas, facilitando sua purificação e utilização. Este trabalho teve como objetivo investigar o efeito de alguns compostos utilizados como indutores de lacases em fungos na produção destas enzimas por Lentinula edodes (shiitake. Previamente a utilização de indutores, foi selecionado um meio de cultura para a produção de

Occurrence of dsRNA Mycovirus (LeV-FMRI0339 in the Edible Mushroom Lentinula edodes and Meiotic Stability of LeV-FMRI0339 among Monokaryotic Progeny

Directory of Open Access Journals (Sweden)

Jung-Mi Kim

2013-12-01

Full Text Available dsRNA was found in malformed cultures of Lentinula edodes strain FMRI0339, one of the three most popular sawdust cultivated commercial strains of shiitake, and was also found in healthy-looking fruiting bodies and actively growing mycelia. Cloning of the partial genome of the dsRNA revealed the presence of the RdRp sequence of a novel L. edodes mycovirus (LeV, and sequence comparison of the cloned amplicon showed identical sequences sequence to known RNA-dependent RNA polymerase genes of LeV found in strain HKA. The meiotic stability of dsRNA was examined by measuring the ratio of the presence of dsRNA among sexual monokaryotic progeny. More than 40% of the monokaryotic progeny still contained the dsRNA, indicating the persistence of dsRNA during sexual reproduction. Comparing the mycelia growth of monokaryotic progeny suggested that there appeared to be a tendency toward a lower frequency of virus incidence in actively growing progeny.

Quantitative changes in the biochemical composition of lignocellulosic residues during the vegetative growth of Lentinula edodes

Directory of Open Access Journals (Sweden)

Rigoberto Gaitán-Hernández

2011-03-01

Full Text Available The chemical changes in barley-straw (BS, wheat-straw (WS and vineyard-pruning (VP substrates were determined during colonization of Lentinula edodes mycelia (during primordium development in solid state fermentation. Primordia appeared 39-50 days after inoculation. VP appeared to promote early sporophore initiation. The concentration of hemicellulose in BS and VP decreased gradually from 25.5% to 15.6% and from 15.8% to 12.3%, respectively. However in WS, hemicellulose decreased from 27.2% to 9.5%. Lignin broke down continuously in BS and WS, with 31.8% and 34.4% degradation, respectively; higher than that of cellulose. During the pinning stage, the C:N ratio decreased in VP and BS, but not in WS. On all substrates the phenols decreased notably throughout the first week of mycelial growth. The time elapsed (days to pinning was positively correlated with cellulose content (r=0.89, total sugar (r=0.85 and inversely correlated to lignin (r=-1.00 and phenol content (r=-0.55.

ANALYSES OF GENETIC VARIABILITY IN LENTINULA EDODES THROUGH MYCELIA RESPONSES TO DIFFERENT ABIOTIC CONDITIONS AND RAPD MOLECULAR MARKERS

Directory of Open Access Journals (Sweden)

Maki Cristina Sayuri

2001-01-01

Full Text Available The growth of thirty-four Lentinula edodes strains submitted to different mycelial cultivation conditions (pH and temperature was evaluated and strain variability was assessed by RAPD molecular markers. The growth at three pH values (5, 6 and 7 and four different temperatures (16, 25, 28 and 37ºC was measured using the in vitro mycelial development rate and water retention as parameters. Mycelial cultivation was successful at all pH tested, while the ideal temperature for mycelial cultivation ranged between 25 and 28ºC. The water content was lower in strains grown at 37ºC. Among 20 OPA primers (Operon Technologies, Inc. used for the RAPD analyses, seventeen presented good polymorphism (OPA01 to OPA05, OPA07 to OPA14, OPA17 to OPA20. The clustering based on similarity coefficients allowed the separation of strain in two groups with different geographic origins.

Production evaluation of Lentinula edodes Pegler fungi in synthetic logs based on agricultural wastes

International Nuclear Information System (INIS)

Villegas Escobar, Valeska; Perez, Ana Milena; Clara Arredondo

2007-01-01

Production of Lentinula edodes, medicinal and gourmet mushroom commonly known as shiitake, was evaluated in synthetic blocks with the aim of using agroindustrial wastes not jet studied quantitatively and environmentally problematical for many industries. Fifty five different combinations of substrates were analyzed using two agroindustrial wastes (cocoa husk and cotton waste), one wood supplement (oak), one nitrogen source (wheat bran), one pH controller (CaC0 3 ), and one growth stimulator (CaS0 4 ). It was found that the substrate formulation has a considerable effect upon the colonization time of the block (P < 0.05), being the oak supplement essential for the time colonization reduction. Furthermore, the cocoa husk Was not a good waste for shiitake production. The treatments that gave the best conditions for shiitake culture contained 75% of oak, and 20 to 25% of wheat bran or 25% of cotton waste. Depending on the treatment evaluated, the biological efficiency achieved were between 5.3 to 21.5%, the pileo size from 4.7 to 9.3 cm for the first flush and the colonization precocity between 69 to 125 days with C/N relationship superior to 110 and with better nutritional value to those reported by other researchers

Genotoxicity and antigenotoxicity assessment of shiitake (Lentinula edodes (Berkeley Pegler using the Comet assay

Directory of Open Access Journals (Sweden)

CK Miyaji

2004-01-01

Full Text Available The mushroom shiitake (Lentinula edodes (Berkeley Pegler is been widely consumed in many countries, including Brazil, because of its pleasant flavor and reports of its therapeutic properties, although there is little available information on the genotoxicity and/or antigenotoxicity of this mushroom. We used the Comet assay and HEp-2 cells to evaluate the in vitro genotoxic and antigenotoxic activity of aqueous extracts of shiitake prepared in three different concentrations (0.5, 1.0 and 1.5 mg/mL and three different temperatures (4, 22 and 60 °C, using methyl methanesulfonate (MMS as a positive control and untreated cells as a negative control. Two concentrations (1.0 and 1.5 mg/mL of extract prepared at 4 °C and all of the concentrations prepared at 22 ± 2 and 60 °C showed moderate genotoxic activity. To test the protective effect of the three concentrations of the extracts against the genotoxicity induced by methyl methanesulfonate, three protocols were used: pre-treatment, simultaneous-treatment and post-treatment. Treatments were repeated for all combinations of preparation temperature and concentration. Two extracts (22 ± 2 °C 1.0 mg/mL (simultaneous-treatment and 4 °C 0.5 mg/mL (post-treatment showed antigenotoxic activity.

Process Parameters Affecting the Synthesis of Natural Flavors by Shiitake (Lentinula edodes during the Production of a Non-Alcoholic Beverage

Directory of Open Access Journals (Sweden)

Sibel Özdemir

2017-04-01

Full Text Available A novel alcohol-free beverage with a fruity, slightly sour, sweetish, fresh, and plum-like flavor was produced by incorporating the edible mushroom shiitake (Lentinula edodes into the fermentation process. Shiitake pellets were used as a biocatalyst to promote the synthesis of the fruity esters methyl 2-methylbutanoate and 2-phenylethanol from amino acids and an organic acid present in the wort. We investigated the impact of two critical process parameters (volumetric power input and inoculum concentration on the morphology of, and flavor production by, the shiitake pellets in a 1 L stirred bioreactor. Increasing the volumetric power input and biomass concentration influenced the morphology of the pellets and promoted the production of the most important flavor compound methyl 2-methylbutanoate in the beverage. Furthermore the worty off-flavor methional was degraded during the cultivation in stirred bioreactor by shiitake pellets. These findings provide useful information to facilitate the scale-up of the biotransformation and fermentation process in bioreactors.

Avaliação de resíduos lignocelulósicos para a produção de Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes

OpenAIRE

Claudia Paganelli Lacerda de Azevedo

2000-01-01

Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes foram produzidos, em condições controladas, com resíduos lignocelulósicos em seis composições; (1) resíduo sólido de indústria de cerveja+ bagaço de cana de açúcar + sais minerais (2) resíduo sólido de indústria de cerveja + serragem de euca/yptus + sais minerais (3) resíduo sólido de indústria de cerveja + palha de arroz + sais minerais (4) resíduo sólido de indústria de cerveja + bagaço de cana de açúcar (5) resíduo sólido de indústr...

A Kinetic Model for Predicting the Relative Humidity in Modified Atmosphere Packaging and Its Application in Lentinula edodes Packages

Directory of Open Access Journals (Sweden)

Li-xin Lu

2013-01-01

Full Text Available Adjusting and controlling the relative humidity (RH inside package is crucial for ensuring the quality of modified atmosphere packaging (MAP of fresh produce. In this paper, an improved kinetic model for predicting the RH in MAP was developed. The model was based on heat exchange and gases mass transport phenomena across the package, gases heat convection inside the package, and mass and heat balances accounting for the respiration and transpiration behavior of fresh produce. Then the model was applied to predict the RH in MAP of fresh Lentinula edodes (one kind of Chinese mushroom. The model equations were solved numerically using Adams-Moulton method to predict the RH in model packages. In general, the model predictions agreed well with the experimental data, except that the model predictions were slightly high in the initial period. The effect of the initial gas composition on the RH in packages was notable. In MAP of lower oxygen and higher carbon dioxide concentrations, the ascending rate of the RH was reduced, and the RH inside packages was saturated slowly during storage. The influence of the initial gas composition on the temperature inside package was not much notable.

Evaluation of host quality of life and immune function in breast cancer patients treated with combination of adjuvant chemotherapy and oral administration of Lentinula edodes mycelia extract

Directory of Open Access Journals (Sweden)

Nagashima Y

2013-07-01

Full Text Available Yukiko Nagashima,1 Noriko Maeda,2 Shigeru Yamamoto,2 Shigefumi Yoshino,2 Masaaki Oka21Department of Breast and Thyroid Surgery, Shakaihoken Shimonoseki Kosei Hospital, Shimonoseki City, Yamaguchi, Japan; 2Department of Digestive Surgery and Surgical Oncology, Yamaguchi University Graduate School of Medicine, Ube City, Yamaguchi, JapanPurpose: Anthracycline-based chemotherapies for breast cancer are well known to have adverse effects and can also negatively affect host immune function. There is therefore a necessity for an adjuvant that maintains the quality of life (QOL and immune function of cancer patients receiving anthracycline-based chemotherapies.Patients and methods: The present study investigated the effectiveness of the concomitant use of Lentinula edodes mycelia extract (LEM, an oral immunomodulator, with FEC75 (5-fluorouracil + epirubicin + cyclophosphamide therapy on host QOL and immune function in breast cancer patients with nodal metastases. Ten breast cancer patients with nodal metastases receiving surgery were enrolled in this study. Treatment with 5-fluorouracil (500 mg/m2, epirubicin (75 mg/m2, and cyclophosphamide (500 mg/m2 was performed every 21 days for two courses, and LEM (1800 mg/day by mouth was administered during the second course.Results: In the first course, hematological toxicity was observed and host QOL and immune function were exacerbated. In the second course, however, the number of white blood cells and lymphocytes did not decrease and host QOL was maintained. Furthermore, the cytotoxic activities of natural killer (NK and lymphokine-activated killer cells and the proportion of activated NK and NK T-cells in lymphocytes were maintained in the second course.Conclusion: It has been suggested that the concomitant use of LEM with FEC75 therapy can maintain host QOL and immune function, and offer important implications for an application of LEM as a useful oral adjuvant to anthracycline-based chemotherapies

Use of spent mushroom substrates from Agaricus subrufescens (syn. A. blazei, A. brasiliensis) and Lentinula edodes productions in the enrichment of a soil-based potting media for lettuce (Lactuca sativa) cultivation: Growth promotion and soil bioremediation.

Science.gov (United States)

Ribas, L C C; de Mendonça, M M; Camelini, C M; Soares, C H L

2009-10-01

This study aimed to assess physicochemical and microbiological properties of fresh spent mushroom substrates (SMSs)--without post-crop heat treatment--from Agaricus subrufescens and Lentinula edodes production to optimize the use of these residues in the soil enrichment for lettuce growth promotion and soil remediation. Organic matter and C content of both SMSs were high. Fresh A. subrufescens SMS was a good source of N, P and K. On the other hand, L. edodes SMS presented a lower concentration of these nutrients and a high level of immaturity. Both SMSs presented high electric conductivity values (2.5-3.4 mS/cm). Microbiological analysis, based upon enumeration of culturable bacteria (thermophilic and mesophilic) and fungi, and also evolution of CO(2), showed that SMSs played higher microbial diversity than soil control. Laccase activity from A. subrufescens SMS tended to remain constant during a 2-month period, while L. edodes SMS presented low laccase activity throughout the same period. Agaricus subrufescens and L. edodes were able to grow on a PDA (Potato Dextrose Agar) media supplemented with different concentrations of atrazine (1-50 microg/ml), degraded the herbicide, attaining rates of 35% and 26%, respectively. On experiments of lettuce growth promotion using a soil-based potting media with different SMS rates, 5% and 10% (dw) rates of A. subrufescens SMS resulted in higher lettuce aerial dry weights than the rates of 25% and 40%, the chemical fertilization (NPK) and the control (soil). At 10% supplementation, lettuce aerial dry weight increased 2.2 and 1.3 times compared to the control and the NPK treatment, respectively. Protein content increased along with SMS rates. Fresh A. subrufescens SMS was an excellent supplement for lettuce growth promotion and showed potential for remediation of biocides possibly due to improved microbial diversity and enzymatic activity. Fresh L. edodes SMS was not a good fertilizer, at least under the conditions tested

Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

Science.gov (United States)

Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

2015-01-01

Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

Directory of Open Access Journals (Sweden)

Simone Parola

2017-10-01

Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

Energy Technology Data Exchange (ETDEWEB)

Hong, J. S.; Kim, D.H.

1981-01-01

Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

Effect of Media Components on the Mycelial Film Formation in Submerged Culture of Lentinus edodes (Shiitake

Directory of Open Access Journals (Sweden)

Olga M. Tsivileva

2005-01-01

Full Text Available A relationship between the chemical composition of nutrient medium, the activity of extracellular lectins of Lentinus edodes (Berk. Sing Lentinula edodes (Berk. Pegler (shiitake, and the formation of pigmented mycelial film in liquid culture has been found. A possibility to regulate the lectin activity of shiitake using the synthetic components has been shown. The formulation of medium, on which the brown mycelial film appears in several days of submerged cultivation, has been proposed. Among the natural amino acids studied as nitrogen sources, and nine divalent metal cations as inorganic additives, L-asparagine and Ca2+ (Mn2+ in the simultaneous presence exhibited the explicit positive effect in respect to the above without regard to the age of the culture. Quantum chemical methods and QSAR were applied to test our supposition that a differential character of interaction between the studied amino acids and Ca2+ (Mn2+ cations should be related not to the distinct electron structures of zwitter ions, but most likely to their differing hydrophobicities. The results obtained seem to make some contribution to the present notion of biochemicalprocesses that give rise to the occurrence of the aforesaid morphological structure of shiitake.

A Novel Apoptosis Correlated Molecule: Expression and Characterization of Protein Latcripin-1 from Lentinula edodes C_91–3

Directory of Open Access Journals (Sweden)

Min Huang

2012-05-01

Full Text Available An apoptosis correlated molecule—protein Latcripin-1 of Lentinula edodes C_91-3—was expressed and characterized in Pichia pastoris GS115. The total RNA was obtained from Lentinula edodes C_91–3. According to the transcriptome, the full-length gene of Latcripin-1 was isolated with 3'-Full Rapid Amplification of cDNA Ends (RACE and 5'-Full RACE methods. The full-length gene was inserted into the secretory expression vector pPIC9K. The protein Latcripin-1 was expressed in Pichia pastoris GS115 and analyzed by Sodium Dodecylsulfonate Polyacrylate Gel Electrophoresis (SDS-PAGE and Western blot. The Western blot showed that the protein was expressed successfully. The biological function of protein Latcripin-1 on A549 cells was studied with flow cytometry and the 3-(4,5-Dimethylthiazol-2-yl-2,5-Diphenyl-tetrazolium Bromide (MTT method. The toxic effect of protein Latcripin-1 was detected with the MTT method by co-culturing the characterized protein with chick embryo fibroblasts. The MTT assay results showed that there was a great difference between protein Latcripin-1 groups and the control group (p < 0.05. There was no toxic effect of the characterized protein on chick embryo fibroblasts. The flow cytometry showed that there was a significant difference between the protein groups of interest and the control group according to apoptosis function (p < 0.05. At the same time, cell ultrastructure observed by transmission electron microscopy supported the results of flow cytometry. The work demonstrates that protein Latcripin-1 can induce apoptosis of human lung cancer cells A549 and brings new insights into and advantages to finding anti-tumor proteins.

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

Science.gov (United States)

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

Effects of AHCC® on Immune and Stress Responses in Healthy Individuals.

Science.gov (United States)

Takanari, Jun; Sato, Atsuya; Waki, Hideaki; Miyazaki, Shogo; Uebaba, Kazuo; Hisajima, Tatsuya

2018-01-01

AHCC® is a functional food from the basidiomycete Lentinula edodes. We evaluated the effects of AHCC® on subjects under different kinds of stress and at rest. Physical stress was imposed using an active standing test, known as Schellong's test. Sympathetic nervous activity in the standing position was significantly greater in AHCC®-treated subjects than in a placebo group. In contrast, AHCC® significantly increased parasympathetic nervous activity at rest. Under mental stress, AHCC® increased sympathetic nervous activity, with no difference in the parasympathetic nervous system. In subjects with chronic mental stress, self-reported "initiation and maintenance of sleep" was significantly greater in the AHCC®-intake period than in the placebo intake period, and natural killer cell activity also increased after AHCC® intake, suggesting a possible mechanism of action of AHCC®. Our findings indicate that AHCC® is potentially effective in stress management and may be useful in the treatment of depression.

ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH

Directory of Open Access Journals (Sweden)

Paccola Edneia A. de Souza

2001-01-01

Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.

Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

Directory of Open Access Journals (Sweden)

E.P. Vetchinkina

2017-05-01

Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

Lentinula edodes-derived polysaccharide rejuvenates mice in terms of immune responses and gut microbiota.

Science.gov (United States)

Xu, Xiaofei; Yang, Jiguo; Ning, Zhengxiang; Zhang, Xuewu

2015-08-01

Aging is characterized by impaired immunity and unbalanced gut microbiota. Prebiotics have the capability to prevent or reverse age-related declines in health by modulating gut microbiota. Mushroom polysaccharides have been suggested to be potential prebiotics. However, their effects on the immunity and gut microbiota in aged mice have not been determined. This study firstly assessed the effects of a heteropolysaccharide L2 isolated from the fruit body of L. edodes on the immune response of aged mice, and then compared the composition of fecal microbiota in adult (N), old (O) and L2-treated old (Oa) mice using the high-throughput pyrosequencing technique. The results showed that L2 can restore the age-attenuated immune responses by increasing cytokine levels in peripheral blood. Moreover, L2 can partly reverse the age-altered composition of gut microbiota. The Euclidean distances (De) among 3 groups (N, O and Oa) are determined to be De(O, N) = 0.19, De(O, Oa) = 0.20, and De(N, Oa) = 0.10, i.e. there is a marked reduction in the distance from 0.19 to 0.1 by L2. This suggests the beneficial effects of L2 on enhancing immunity and improving gut health.

The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster.

Science.gov (United States)

Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis

2014-01-01

Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

Science.gov (United States)

Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

2017-04-01

The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

Lentinus edodes promotes fat removal in hypercholesterolemic mice.

Science.gov (United States)

Yang, Hyun; Hwang, Inho; Kim, Sun; Hong, Eui-Ju; Jeung, Eui-Bae

2013-12-01

Lentinus (L.) edodes (shiitake mushroom) is used as a traditional medicine in Asia. One of the components of L. edodes , eritadenine (an adenosine analog alkaloid), has been shown to reduce cholesterol levels. The hypocholesterolemic action of eritadenine appears to be achieved through the modification of hepatic phospholipid metabolism. In the present study, the effects of L. edodes in a mouse model of hypercholesterolemia were investigated. Hypercholesterolemia was induced by the consumption of a high-fat diet (HFD). The animals were divided into six groups, which were fed a normal diet, HFD alone, HFD containing eritadenine [10 mg/kg of body weight (BW)] or HFD with 5, 10 or 20% L. edodes , respectively, for 4 weeks (from 5 to 9 weeks of age). The mice in the six groups had similar BW gains. Total serum cholesterol (T-CHO), low-density lipoprotein (LDL) and triglyceride (TG) levels were increased in the HFD-fed group compared with those in the normal diet group. However, the levels of high-density lipoprotein (HDL) were not significantly altered. In mice treated with L. edodes (5, 10 or 20%), the T-CHO, LDL and TG serum levels were reduced in a dose-dependent manner. The mRNA expression of cholesterol 7-α-hydroxylase 1 (CYP7A1) was decreased in hypercholesterolemic mice and increased by eritadenine and L. edodes (5, 10 and 20%) supplementation. In liver tissues, it was observed that lipid accumulation was reduced by treatment with eritadenine and L. edodes . In addition, it was revealed that the formation of atherosclerotic plaques due to the HFD was also suppressed by eritadenine and L. edodes . The results of the study indicated that the consumption of an HFD may inhibit CYP7A1 expression in the liver by increasing serum T-CHO, LDL and TG levels. L. edodes may help regulate lipid metabolism, suggesting that this fungus ameliorates hypercholesterolemia in mice by regulating CYP7A1 expression in the liver.

Mating system of five edible species of the mushroom, genus Lentinus

Directory of Open Access Journals (Sweden)

Dhitaphichit, P.

2006-03-01

Full Text Available The aim of this research was to determine the types of mating system of five edible mushrooms in the genus Lentinus, i.e. Lentinus squarrosulus, L. polychrous, L. strigosus, L. giganteus and L. sajor-caju including the well-known edible, medicinal and industrialized species, Lentinula edodes. Lentinus and Lentinula are closely related species. The experiments were carried out by crossing each pair of 12 single spore isolates (SSIs, monokaryons from one single fruiting body of each species in all combinations by placing each pair of the inocula, about 2 cm apart, on a PDA plate at 30oC for 1 week for all species of Lentinus, or on a MEA plate at 25oC for 2-3 weeks for Lentinula edodes, followed by examination of clamp connections on the hyphae at the contact zone. The presence or absence of clamps indicates compatible or incompatible mating, respectively. The ratios of the number of compatible matings to the number of total matings of all the species were determined to be 1:4. This ratio indicated that the sexuality of all the six species is bifactorial (tetrapolar heterothallism. These results indicated to some extent that species belonged to the same or related genus tend to have the same mating type. This is the first report about mating system of Lentinus species except that of Lentinula edodes. The results of the 12 SSIs were also separated into four groups according to their four mating types (i.e. A1B1, A1B2, A2B1 and A2B2.

Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes.

Science.gov (United States)

Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin

2015-01-01

Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

Preventive effects of Lentinus edodes on homocysteinemia in mice.

Science.gov (United States)

Yang, Hyun; Hwang, Inho; Kim, Sun; Ahn, Changhwan; Hong, Eui-Ju; Jeung, Eui-Bae

2013-08-01

Homocysteinemia is associated with cardiovascular and neuronal degenerative diseases. Deficiencies of the B vitamins lead to high homocysteine serum levels. Lentinus edodes ( L. edodes) is also known as the Shiitake mushroom and may have beneficial effects on vascular and lipid metabolic diseases, including hypertension, homocysteinemia and lipidemia. In this study, we induced a homocysteinemia-like condition in mice by the administration of a folate- and vitamin B12-deficient diet and evaluated the effect of L. edodes on the homocysteinemia-like condition. Homocysteinemia was induced by the administration of a diet deficient in folate and vitamin B12 (DFV) for 6 weeks to mice aged 4-10 weeks. The homocysteinemic mice were treated with L. edodes flour (5, 10 and 20%), eritadenine (10 mg/kg) or DFV only (negative control) for 2 weeks. The DFV induced a significant increase in serum homocysteine levels. The increased homocysteine serum levels were reduced by eritadenine and L. edodes flour (5, 10 and 20%). Hepatic levels of S-adenosyl-L-homocysteine hydrolase (SAH) were significantly higher under DFV administration and the elevated SAH levels were reduced by treatment with L. edodes in a dose-dependent manner. The mRNA expression levels of DNA methyl transferases, DNMT1 and DNMT3a, were reduced in the DFV group, and the reduced levels of DNMT1 and DNMT3a mRNA expression were recovered in the eritadenine and L. edodes (5, 10 and 20%) groups. These results suggest that components of L. edodes , including eritadenine may have beneficial effects on hyperhomocysteinemia and its therapeutic effects may be involved in the regulation of DNA methylation-related genes in mice.

Spent bleaching clay (SBC) from oil refining as a substrate for the ...

African Journals Online (AJOL)

Therefore, the utilization of SBC in shiitatke spawn production not only considerably reduces the costs of shiitake production but also bring about substantial environmental benefits. Keywords: Spent bleaching clay, shiitake mushroom, Lentinula edodes, vegetable oils, spawn production, mycelial growth, components ...

Application to Food of Lentinus edodes Flour with Extrusion Cooking

OpenAIRE

岡村, 徳光; 上杉, 誓子; 星野, 由紀子; 奥田, 展子; 大杉, 匡弘; Tokumitsu, Okamura; Seiko, Uesugi; Yukiko, Hoshino; Nobuko, Okuda; Masahiro, Ohsugi

1997-01-01

We report the application to food using Lentinus edodes (Shiitake) flour, which is a good vegetable for health, rich in protein, fiber and vitamins (B_1, B_2, niacin). The wheat flour contained Lentinus edodes flour was expansed and textured by a twin screw extruder. The snack contained 1% Lentinus edodes flour was most prefered in the points of taste, flavor, color and appearance.

Fungal treatment of lignocellulosic biomass: Importance of fungal species, colonization and time on chemical composition and in vitro rumen degradability

NARCIS (Netherlands)

Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

2015-01-01

The aim of this study is to evaluate fungal treatments to improve in vitro rumen degradability of lignocellulosic biomass. In this study four selective lignin degrading fungi, Ganoderma lucidum, Lentinula edodes, Pleurotus eryngii and Pleurotus ostreatus, were used to pre-treat lignocellulosic

Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

Science.gov (United States)

Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

2014-01-01

SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

Shorten fungal treatment of lignocellulosic waste with additives to improve rumen degradability

NARCIS (Netherlands)

Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

2014-01-01

Selective lignin degrading fungi can be used as pre-treatment to make cellulose in plant cell walls accessible for rumen microbes. According to previous studies, Ceriporiopsis subvermispora and Lentinula edodes can increase the in vitro rumen degradability of lignocellulosic biomass in 7 to 8 weeks.

Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

Science.gov (United States)

Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

2016-01-01

Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

Decolorization of laundry effluent by filamentous fungi | Miranda ...

African Journals Online (AJOL)

After selecting, the best fungi were subjected to an experimental design and evaluation of the production of the ligninolytics enzymes. Fungi Phanerochaete chrysosporum CCT 1999, Lentinula edodes CCT 4519 and Curvularia lunata UFPEDA 885 reduced 100% the color of the effluent during growth under agitation while ...

Polysaccharides in Lentinus edodes: isolation, structure, immunomodulating activity and future prospective.

Science.gov (United States)

Xu, Xiaofei; Yan, Huidan; Tang, Jian; Chen, Jian; Zhang, Xuewu

2014-01-01

Lentinus edodes has been valued as edible and medical resources. Polysaccharides have been known to be the most potent antitumor and immunomodulating substance in Lentinus edodes. In this review, we summarize the current knowledge of the polysaccharides isolated from Lentinus edodes, including extraction and purification methods, chemical structure and chain conformation, the effects on innate and adaptive immunity and their mechanism, relationship between structure and function, and the future prospects.

Fungicide selective for basidiomycetes.

Science.gov (United States)

Edgington, L V; Walton, G S; Miller, P M

1966-07-15

Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

The effect of adding urea, manganese and linoleic acid to wheat straw and wood chips on lignin degradation by fungi and subsequent

NARCIS (Netherlands)

Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

2016-01-01

The aim of this study was optimizing Ceriporiopsis subvermispora and Lentinula edodes pre-treatment of wheat straw and wood chips by adding urea, manganese and linoleic acid. Optimization was defined as more lignin degradation and an increase in in vitro gas

The effect of particle size and amount of inoculum on fungal treatment of wheat straw and wood chips

NARCIS (Netherlands)

Kuijk, van Sandra J.A.; Sonnenberg, Anton S.M.; Baars, Johan J.P.; Hendriks, Wouter H.; Cone, John W.

2016-01-01

Background: The aim of this study was to optimize the fungal treatment of lignocellulosic biomass by stimulating the colonization. Wheat straw and wood chips were treated with Ceriporiopsis subvermispora and Lentinula edodes with various amounts of colonized millet grains (0.5, 1.5 or 3.0 % per g

Browse Title Index

African Journals Online (AJOL)

Items 101 - 150 of 11090 ... Asma Murtaza, Shazia Shafique, Tehmina Anjum, Sobiya Shafique. Vol 12, No 46 (2013), In vitro cultivation of Pleurotus ostreatus and Lentinula edodes in lignocellulosic residues from Amazon, Abstract PDF. Ceci Sales-Campos, Diego A. Pires, Samira R. L. Barbosa, Raimunda Liége S. Abreu, ...

Polyethylene glycol (PEG)-mediated transformation of the fused egfp ...

African Journals Online (AJOL)

Yomi

2012-03-06

Mar 6, 2012 ... pUC19 vector. Enhanced green fluorescent protein-encoding gene (egfp) and a selection marker, the hygromycin ... agro-industrial waste bioconversion (Shabtay et al., 2009;. Salvachúa et al., 2011); and .... gene, two pairs of primers were designed based on the Lentinula edodes sequences published by ...

African Journal of Biotechnology - Vol 12, No 46 (2013)

African Journals Online (AJOL)

In vitro cultivation of Pleurotus ostreatus and Lentinula edodes in lignocellulosic residues from Amazon · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ceci Sales-Campos, Diego A. Pires, Samira R. L. Barbosa, Raimunda Liége S. Abreu, Meire C. N. Andrade, 6526- ...

Extracellular Enzymes Produced by the Cultivated Mushroom Lentinus edodes during Degradation of a Lignocellulosic Medium

Science.gov (United States)

Leatham, Gary F.

1985-01-01

Although the commercially important mushroom Lentinus (= Lentinula) edodes (Berk.) Sing. can be rapidly cultivated on supplemented wood particles, fruiting is not reliable. This study addressed the problem by developing more information about growth and development on a practical oakwood-oatmeal medium. The study determined (i) the components degraded during a 150-day incubation at 22°C, (ii) the apparent vegetative growth pattern, (iii) the likely growth-limiting nutrient, and (iv) assays that can be used to study key extracellular enzymes. All major components of the medium were degraded, lignin selectively so. The vegetative growth rate was most rapid during the initial 90 days, during which weight loss correlated with glucosamine accumulation (assayed after acid hydrolysis). The rate then slowed; in apparent preparation for fruiting, the cultures rapidly accumulated glucosamine (or its oligomer or polymer). Nitrogen was growth limiting. Certain enzyme activities were associated with the pattern of medium degradation, with growth, or with development. They included cellulolytic system enzymes, hemicellulases, the ligninolytic system, (gluco-)amylase, pectinase, acid protease, cell wall lytic enzymes (laminarinase, 1,4-β-d-glucosidase, β-N-acetyl-d-glucosaminidase, α-d-galactosidase, β-d-mannosidase), acid phosphatase, and laccase. Enzyme activities over the 150-day incubation period with and without a fruiting stimulus are reported. These results provide a basis for future investigations into the physiology and biochemistry of growth and fruiting. PMID:16346918

Effect of fungal treatments of fibrous agricultural by-products on chemical composition and in vitro rumen fermentation and methane production

NARCIS (Netherlands)

Tuyen, D.V.; Phuong, H.N.; Cone, J.W.; Baars, J.J.P.; Sonnenberg, A.S.M.; Hendriks, W.H.

2013-01-01

Maize stover, rice straw, oil palm fronds and sugarcane bagasse were treated with the white-rot fungi Ceriporiopsis subvermispora, Lentinula edodes, Pleurotus eryngii, or Pleurotus ostreatus at 24 °C for 0–6 weeks. The fungi increased total gas production from oil palm fronds by 68–132%, but none of

Effective removal of cadmium ions from a simulated gastrointestinal fluid by Lentinus edodes.

Science.gov (United States)

Qiao, Xin; Huang, Wen; Bian, Yinbing

2014-12-01

Lentinus edodes, a functional food, was evaluated as a potential antidote for adsorption/removal of cadmium ion from simulated gastrointestinal fluids. An adsorption/removal capacity of 65.12 mg/g was achieved by L. edodes in solutions with a pH ranging from 2.5 to 6.0, while little if any adsorption was observed in solutions with a pH under 2.5. In solutions with pH 6.0, 84% of the cadmium adsorption by L. edodes occurred in the first minute. Scanning electronic microscopic examination showed that the cell wall polysaccharides of L. edodes provided a rough sponge-like surface for effective cadmium adsorption. FTIR indicated that the carboxyl, hydroxyl and -NH groups of the cell wall polysaccharides and proteins were the primary functional groups that chemically bind with cadmium ions. The energy dispersive spectrometry further revealed that cation exchange might be attributed to cadmium biosorption. These results suggested that L. edodes was effective for cadmium detoxication, especially in low concentration.

Comparative Genome Analysis of Basidiomycete Fungi

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

2012-03-19

Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

Effective Removal of Cadmium Ions from a Simulated Gastrointestinal Fluid by Lentinus edodes

Directory of Open Access Journals (Sweden)

Xin Qiao

2014-12-01

Full Text Available Lentinus edodes, a functional food, was evaluated as a potential antidote for adsorption/removal of cadmium ion from simulated gastrointestinal fluids. An adsorption/removal capacity of 65.12 mg/g was achieved by L. edodes in solutions with a pH ranging from 2.5 to 6.0, while little if any adsorption was observed in solutions with a pH under 2.5. In solutions with pH 6.0, 84% of the cadmium adsorption by L. edodes occurred in the first minute. Scanning electronic microscopic examination showed that the cell wall polysaccharides of L. edodes provided a rough sponge-like surface for effective cadmium adsorption. FTIR indicated that the carboxyl, hydroxyl and –NH groups of the cell wall polysaccharides and proteins were the primary functional groups that chemically bind with cadmium ions. The energy dispersive spectrometry further revealed that cation exchange might be attributed to cadmium biosorption. These results suggested that L. edodes was effective for cadmium detoxication, especially in low concentration.

Assessment of the Safety of the Shiitake Culinary-Medicinal Mushroom, Lentinus edodes (Agaricomycetes), in Rats: Biochemical, Hematological, and Antioxidative Parameters.

Science.gov (United States)

Grotto, Denise; Bueno, Daiane Cristovam Rosa; Ramos, Gabriela Karine de Almeida; da Costa, Susi Rosa; Spim, Sara Rosicler Vieira; Gerenutti, Marli

2016-01-01

Lentinus edodes is an edible mushroom studied for use, or as an adjunct, in the prevention of illnesses such as hypertension, hypercholesterolemia, diabetes, and cancer. Despite the functional properties of L. edodes, the doses commonly reported in experimental studies are much higher than those actually consumed. Thus, we aimed to establish the optimum intake levels of L. edodes in vivo. Four groups of male Wistar rats received dry and powdered L. edodes reconstituted in water for 30 days: control (water only), L. edodes 100 mg/kg, L. edodes 400 mg/kg, and L. edodes 800 mg/kg. Biochemical and hematological parameters were assessed using commercial kits. Antioxidant parameters were quantified spectrophotometrically. Neither cholesterol, triglycerides, glucose, nor transaminase activity was different among any of the L. edodes concentrations. However, fructosamine concentrations were significantly decreased in groups consuming L. edodes at 100 or 400 mg/kg. A significant decrease in hemoglobin concentration was found in the 400 and 800 mg/kg/day L. edodes groups, and leukopenia occurred in rats that consumed L. edodes 800 mg/kg/day compared with the control group. L. edodes at 100 and 400 mg/kg increased amounts of reduced glutathione compared with the control group. L. edodes was effective as an antioxidant at 100 and 400 mg/kg, but at 400 and 800 mg/kg some disturbances were observed, such as reductions in hemoglobin and leukocytes. In summary, this study has potential benefits for scientific development because the safe daily intake of L. edodes (at 100 mg/kg) is, to our knowledge, reported for the first time in a preclinical study.

Biodegradation of lignin by Shiitake Lentinus edodes (berk. ) sing

Energy Technology Data Exchange (ETDEWEB)

Oki, T.; Watanabe, H.; Ishikawa, H.

1981-01-01

Each strain of L. edodes destroyed all of the structural components of wood (Fagus crenata) at almost the same rate during the loss of approximately 30% of the total weight of wood. The activities of the extracellular enzymes, i.e. peroxidase, laccase, and polyphenol oxidase, in the wood powder and lignin-containing cultures increased during the early period of mycelial growth, and then declined rapidly, while the activity of Beta-glucosidase increased gradually throughout the growth period. Functional group analysis, nitrobenzene oxidation, and spectroscopic characterization showed that dioxane lignin from F. crenata degraded by L. edodes or in crude enzyme solution isolated from wood-containing culture had a higher content of carboxyl groups than the sound dioxane lignin, whereas the content of methoxyl group was lower in the degraded dioxane lignin than in sound dioxane lignin. The building units of dioxane lignin, which yield aromatic aldehydes on nitrobenzene oxidation, were attacked preferentially by L. edodes under the above conditions.

Cadmium determination in Lentinus edodes mushroom species

Directory of Open Access Journals (Sweden)

Vera Akiko Maihara

2012-09-01

Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

Mn(II) regulation of lignin peroxidases and manganese-dependent peroxidases from lignin-degrading white rot fungi

International Nuclear Information System (INIS)

Bonnarme, P.; Jeffries, T.W.

1990-01-01

Two families of peroxidases-lignin peroxidase (LiP) and manganese-dependent lignin peroxidase (MnP)-are formed by the lignin-degrading white rot basidiomycete Phanerochaete chrysosporium and other white rot fungi. Isoenzymes of these enzyme families carry out reactions important to the biodegradation of lignin. This research investigated the regulation of LiP and MnP production by Mn(II). In liquid culture, LiP titers varied as an inverse function of and MnP titers varied as a direct function of the Mn(II) concentration. The extracellular isoenzyme profiles differed radically at low and high Mn(II) levels, whereas other fermentation parameters, including extracellular protein concentrations, the glucose consumption rate, and the accumulation of cell dry weight, did not change significantly with the Mn(II) concentration. In the absence of Mn(II), extracellular LiP isoenzymes predominated, whereas in the presence of Mn(II), MnP isoenzymes were dominant. The release of 14 CO 2 from 14 C-labeled dehydrogenative polymerizate lignin was likewise affected by Mn(II). The rate of 14 CO 2 release increased at low Mn(II) and decreased at high Mn(II) concentrations. This regulatory effect of Mn(II) occurred with five strains of P. chrysosporium, two other species of Phanerochaete, three species of Phlebia, Lentinula edodes, and Phellinus pini

Can fungi compete with marine sources for chitosan production?

Science.gov (United States)

Ghormade, V; Pathan, E K; Deshpande, M V

2017-11-01

Chitosan, a β-1,4-linked glucosamine polymer is formed by deacetylation of chitin. It has a wide range of applications from agriculture to human health care products. Chitosan is commercially produced from shellfish, shrimp waste, crab and lobster processing using strong alkalis at high temperatures for long time periods. The production of chitin and chitosan from fungal sources has gained increased attention in recent years due to potential advantages in terms of homogenous polymer length, high degree of deacetylation and solubility over the current marine source. Zygomycetous fungi such as Absidia coerulea, Benjaminiella poitrasii, Cunninghamella elegans, Gongrenella butleri, Mucor rouxii, Mucor racemosus and Rhizopus oryzae have been studied extensively. Isolation of chitosan are reported from few edible basidiomycetous fungi like Agaricus bisporus, Lentinula edodes and Pleurotus sajor-caju. Other organisms from mycotech industries explored for chitosan production are Aspergillus niger, Penicillium chrysogenum, Saccharomyces cerevisiae and other wine yeasts. Number of aspects such as value addition to the existing applications of fungi, utilization of waste from agriculture sector, and issues and challenges for the production of fungal chitosan to compete with existing sources, metabolic engineering and novel applications have been discussed to adjudge the potential of fungal sources for commercial chitosan production. Copyright © 2017 Elsevier B.V. All rights reserved.

An update on organohalogen metabolites produced by basidiomycetes

NARCIS (Netherlands)

Field, J.A.; Wijnberg, J.B.P.A.

2003-01-01

Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

Homogenate extraction of crude polysaccharides from Lentinus edodes and evaluation of the antioxidant activity

Directory of Open Access Journals (Sweden)

Leqin KE

2016-01-01

Full Text Available Abstract Crude polysaccharides of Lentinus edodes were extracted using homogenate method. Factors affecting the yield of crude polysaccharides were investigated and optimized by response surface methodology. The homogenate extraction method was compared with traditional heating extraction method. The antioxidant activity of crude polysaccharides from Lentinus edodes was evaluated. Results showed that, the optimal conditions of homogenate extraction were as follows: solvent pH, 10; liquid-solid ratio, 30: 1 (mL: g, extraction time, 66 s; number of extraction, 1. Under these conditions, the yield of crude polysaccharides was (13.2 ± 0.9%, which was 29.82% higher than that of traditional heating extraction. Crude polysaccharides of Lentinus edodes had good DPPH scavenging activity. Compared with the traditional heating extraction, the homogenate extraction had notable advantages including good extraction yield, short extraction time and low extraction temperature. It is an efficient way to extract crude polysaccharides from Lentinus edodes.

Shiitake Culinary-Medicinal Mushroom, Lentinus edodes (Agaricomycetes): A Species with Antioxidant, Immunomodulatory, and Hepatoprotective Activities in Hypercholesterolemic Rats.

Science.gov (United States)

Nisar, Jaweria; Mustafa, Imtiaz; Anwar, Haseeb; Sohail, Muhammad Umar; Hussain, Ghulam; Ullah, Muhammad Irfan; Faisal, Muhammad Naeem; Bukhari, Shazia Anwer; Basit, Abdul

2017-01-01

Lentinus edodes is a culinary-medicinal mushroom that has an established history of use in Asian therapies. The mushroom offers well-documented beneficial health effects such as antihypercholesterolemic, antitumor, and antibacterial activities. In this study, dried powder of L. edodes fruiting bodies was used to evaluate immunomodulatory, hepatoprotective, and antioxidant effects in hypercholesterolemic rats. Albino rats (n = 24) were divided into 3 groups: the control (CON) group, the hypercholesterolemia-only group (HCG), and the L. edodes group (LEG). Hypercholesterolemia was induced in rats in the HCG and LEG by feeding cholesterol and cholic acid in a chow maintenance diet (CMD) for 24 days. The CON group was fed the CMD throughout the experiment. The HCG continued on the high-cholesterol diet without any L. edodes supplement. The LEG was fed the high-cholesterol diet supplemented with L. edodes for an additional 42 days. Various biological health biomarkers, such as total antioxidant capacity, total oxidant status, arylesterase, paraoxonase activity, and liver enzymes in serum were studied to evaluate antioxidant and hepatoprotective responses. Cell-mediated immunity was evaluated in each group through a delayed type of hypersensitivity reaction. The total oxidant status decreased significantly (P ≤ 0.05) after administration of L. edodes in the diet. The cell-mediated immune response significantly increased (P ≤ 0.05) in the LEG. The significant decrease in liver enzymes supports the hepatoprotective effect of L. edodes. In conclusion, the results show the immunomodulatory, hepatoprotective, and antioxidant activities of L. edodes supplementation in hypercholesterolemic rats.

Structural Identification of Lentinus edodes Cellulose Derivative that ...

African Journals Online (AJOL)

edodes cellulose in water surroundings that can efficiently inhibit aflatoxin production by Aspergillus flavus. .... blowing instrument, dissolved in methanol, and ... with NaBH4, neutralized with 50 % acetic acid, ... saccharides and peptides.

Mushroom Shiitake, is it mutagenic or antimutagenic agent? Shiitake, um cogumelo mutagênico ou antimutagênico?

Directory of Open Access Journals (Sweden)

Ilce Mara de Syllos Cólus

2001-11-01

Full Text Available Mushrooms have been consumed by eastern populations due to their edible and medicinal properties, for a long time. Over the years, there has also been a gradual increase in the consumption of mushrooms in the western countries, including Brazil. However, the benefits or harms that these mushrooms may cause to the human health are still uncertain. Shiitake (Lentinula edodes (Berk. Pegler is one of the most appreciated fungi in the Brazilian cuisine and its functional and nutritional properties have been extensively studied. Other characteristics of this basidiomycet have also been reported, including its antitumoral, antiviral, bactericidal properties, as well as being a homeostasis and biorhythm regulator. However, studies regarding its mutagenic and antimutagenic potential in prokaryotic and eukaryotic organisms are scarce. Knowledge of these biological properties is essential before a product can be recommended as food and/or drug. Therefore, its indication as a beneficial product to human health is premature since it is necessary to broaden studies on the mutagenic and antimutagenic activities of the mushroom Shiitake or of its active compounds.   Desde a antigüidade, os cogumelos vêm sendo consumidos pelos povos orientais devido às suas  propriedades medicinais e comestíveis e ao longo dos anos tem-se observado um aumento gradativo no consumo também nos países ocidentais, inclusive o Brasil. No entanto, ainda há dúvidas quanto aos benefícios ou prejuízos à saúde, decorrentes do uso destes cogumelos pelas populações humanas. Entre os cogumelos muito apreciados na culinária brasileira, destaca-se o Shiitake (Lentinula edodes (Berk. Pegler, um dos fungos comestíveis mais estudados quanto às suas propriedades funcionais e nutricionais. Já se tem conhecimento sobre várias atividades deste basidiomiceto superior, como antitumoral, antiviral, bactericida, regulador da homeostase e do biorritmo. No entanto, poucos trabalhos

Preservation of live cultures of basidiomycetes - recent methods.

Science.gov (United States)

Homolka, Ladislav

2014-02-01

Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Recycling of Vineyard and Winery Wastes as Nutritive Composts for Edible Mushroom Cultivation

Science.gov (United States)

Petre, Marian; Teodorescu, Alexandru

2011-01-01

Every year, in Romania huge amounts of wine and vine wastes cause serious environmental damages in vineyards as well as nearby winery factories, for instance, by their burning on the soil surface or their incorporation inside soil matrix. The optimal and efficient way to solve these problems is to recycle these biomass wastes as main ingredients in nutritive composts preparation that could be used for edible mushrooms cultivation. In this respect, the main aim of this work was to establish the best biotechnology of winery and vine wastes recycling by using them as appropriate growth substrata for edible and medicinal mushrooms. According to this purpose, two mushroom species of Basidiomycetes, namely Lentinula edodes as well as Pleurotus ostreatus were used as pure mushroom cultures in experiments. The experiments of inoculum preparation were set up under the following conditions: constant temperature, 23° C; agitation speed, 90-120 rev min-1 pH level, 5.0-6.0. All mycelia mushroom cultures were incubated for 120-168 h. In the next stage of experiments, the culture composts for mushroom growing were prepared from the lignocellulose wastes as vine cuttings and marc of grapes in order to be used as substrata in mycelia development and fruit body formation. The tested culture variants were monitored continuously to keep constant the temperature during the incubation as well as air humidity, air pressure and a balanced ratio of the molecular oxygen and carbon dioxide. In every mushroom culture cycle all the physical and chemical parameters that could influence the mycelia growing as well as fruit body formation of L. edodes and P. ostreatus were compared to the same fungal cultures that were grown on poplar logs used as control samples.

Effect of superfine grinding on the physico-chemical, morphological and thermogravimetric properties of Lentinus edodes mushroom powders.

Science.gov (United States)

Ming, Jian; Chen, Long; Hong, Hui; Li, Jinlong

2015-09-01

Lentinus edodes is an edible mushroom commonly known as shiitake, which is the second most produced and consumed edible mushroom in the world and is an important nutrient source in the human diet. To fully use L. edodes, the mushrooms are occasionally ground into powder as a flavourful and functional food additive. This study produces powders from the cap and stipe of Lentinus edodes mushrooms through superfine grinding. These powders are composed of sub-micron range particles with various size distributions. The superfine grinding process is then compared with shear pulverisation to determine the different effects on both the cap and stipe powders in terms of particle size and physico-chemical, morphological and thermogravimetric properties. When average particle size was reduced to 0.54 and 0.46 µm, respectively, the moisture and protein content, angles of repose and slide, and water holding capacity of the powders decreased to varied extents. However, soluble dietary fibre, water solubility index, and swelling capacity increased. Scanning electron microscope images suggested that the superfine grinding process effectively changed the original surface structure of the L. edodes powders. The curves of thermogravimetric analysis and those of the derivatives of thermogravimetry indicated that superfine grinding can improve the thermostability of L. edodes powders. Furthermore, superfinely ground L. edodes powders may be used as pharmaceutical or food additives in various fields. The present study suggests that superfinely ground L. edodes powders may be applied in various fields as pharmaceutical or food additives. © 2014 Society of Chemical Industry.

ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

Directory of Open Access Journals (Sweden)

Gabriela Popa

2016-11-01

Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

Cadmium determination in Lentinus edodes mushroom species Determinação de cádmio em cogumelos da espécie Lentinus edodes

Directory of Open Access Journals (Sweden)

Vera Akiko Maihara

2012-09-01

Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.Muitos estudos têm encontrado elementos tóxicos em cogumelos. Sabe-se que algumas espécies de cogumelos comestíveis acumulam elevados níveis de contaminantes inorgânicos, como cádmio, mercúrio e chumbo. Há cerca de duas mil espécies de cogumelos comestíveis, mas apenas 25 espécies são cultivadas e usadas como alimentos. No Brasil, as espécies mais comercializadas e consumidas são Agaricus bisporus, conhecida como Champignon de Paris; Lentinus edodes ou Shitake, e Pleurotus sp, também chamada de Shimeji ou Hiratake. Neste trabalho, o cádmio (Cd foi determinado em amostras de cogumelos da espécie Lentinus edodes cultivadas em diversas cidades do Estado de São Paulo e algumas amostras importadas do Japão e da China. O cádmio foi determinado por espectrometria de absor

Comparative genome analysis of Basidiomycete fungi

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

2013-08-07

Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

Science.gov (United States)

Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

2017-02-01

The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

Turmeric bioprocessed with mycelia from the shiitake culinary-medicinal mushroom lentinus edodes (agaricomycetes) protects mice against salmonellosis

Science.gov (United States)

Extracts of the shiitake mushroom Lentinus edodes and the spice tumeric (Curcuma longa) have both been reported to have health-promoting properties. The present study investigated the suppressive mechanisms of a bioprocessed Lentinus edodes liquid mushroom mycelia culture supplemented with turmeric ...

SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

Directory of Open Access Journals (Sweden)

Fedotov О. V.

2014-02-01

Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

Preparation, characterization and antioxidant activity of polysaccharide from spent Lentinus edodes substrate.

Science.gov (United States)

Zhu, Hongji; Tian, Li; Zhang, Lei; Bi, Jingxiu; Song, Qianqian; Yang, Hui; Qiao, Jianjun

2018-06-01

This study explored the potential of spent Lentinus edodes substrate, a by-product of mushroom industries causing environmental pollution, serving as materials to produce antioxidant polysaccharide. The extraction process of spent Lentinus edodes substrate polysaccharide (SLSP) was optimized and the effects of drying methods on chemical composition, morphological property and antioxidant activity were investigated. Results showed that freeze-dried SLSP (SLSP-F) exhibited the best quality in terms of the polysaccharide yield (13.00%) and antioxidant activity. The EC 50 values of SLSP-F on DPPH, ABTS and superoxide anion radicals was 0.051mg/mL, 0.379mg/mL, 0.719mg/mL, respectively, which was significantly lower than that of freeze-dried Lentinus edodes polysaccharide (LP-F). After purification by Sephadex G-150, the purified SLSP-F (PSP) has a molecular weight of 16.77kDa. Compared with LP-F, PSP has more reducing sugars and uronic acids in chemical composition and higher contents of xylose, glucose and galactose in monosaccharide composition. FT-IR and NMR spectroscopy analysis revealed that PSP has both α and β glycosidic bonds and massive acetyl groups, which is different from LP-F mainly composed of 1, 3 linked α-D-Manp residue with some acetyl groups. The findings provided a reliable approach for the development of antioxidant polysaccharide from spent Lentinus edodes substrate. Copyright © 2018 Elsevier B.V. All rights reserved.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

Science.gov (United States)

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Effect of Tree Species on Enzyme Secretion by the Shiitake Medicinal Mushroom, Lentinus edodes (Agaricomycetes).

Science.gov (United States)

Plotnikov, Evgeny V; Glukhova, Lubov B; Sokolyanskaya, Ludmila O; Karnachuk, Olga V; Solioz, Marc

2016-01-01

We compared cold and hot wood extracts of 3 endemic Siberian trees-namely, Prunus padus (bird cherry), Populus tremula (aspen), and Betula sp. (birch)-on biomass production and laccase and peroxidase secretion in submerged cultures by the medicinal mushroom Lentinus edodes. Of the conditions tested, only hot Prunus extracts stimulated biomass production, whereas all extracts stimulated laccase and peroxidase secretion, albeit to different extents. A large, differential stimulation of manganese peroxidase was observed by hot Prunus extracts. The results highlight important differences between tree species in the stimulation of biomass and enzyme production by L. edodes and point to potentially interesting stimulatory factors present in hot Prunus extracts. These findings are of relevance in the use of L. edodes for medicinal or biotechnological applications.

Green Synthesis and Antibacterial Activities of Silver Nanoparticles Using Extracellular Laccase of Lentinus edodes

Directory of Open Access Journals (Sweden)

Agbaje LATEEF

2015-12-01

Full Text Available This study reports the multi-step mutagenesis of Lentinus edodes towards optimization of the production of laccase and novel application of laccase in the biosynthesis of silver nanoparticles (AgNPs which could be used to develop an eco-friendly method for the rapid biosynthesis of AgNPs. The wild strain of L. edodes was subjected to UV irradiation at 254 nm and the resultant viable mutant was further treated with acridine orange, a chemical mutagen. The strains were evaluated for the production of laccase and the crude laccase of the UV mutant (UV10 was used for the green synthesis of AgNPs. The particles were characterized by UV-Visible spectroscopy, Fourier transform infrared (FTIR spectroscopy and scanning electron microscopy (SEM. Laccase activities of wild, UV10 and UV10ACR8 strains of L. edodes were obtained as 2.6, 10.6 and 2.8 U/ml/min respectively after 7 days of fermentation, showing laccase yield improvement of 4.08-fold for UV10 mutant. UV-Visible spectroscopy indicated the formation of AgNPs at absorption band of 430 nm. FTIR result indicated that proteins were responsible for AgNP synthesis, while SEM analysis confirmed the formation of walnut-shaped nanoparticles with size range of 50-100 nm. The biosynthesized nanoparticles revealed effective inhibition against clinical isolates of Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae. To the best of the authors’ knowledge, this result represents the first report on the biosynthesis of AgNPs using L. edodes metabolite. The report adds to the growing relevance of L. edodes as potential industrially viable organism, used for diverse biotechnological applications.

Diversity and evolution of ABC proteins in basidiomycetes.

Science.gov (United States)

Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

2013-01-01

ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

Science.gov (United States)

Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

2007-04-01

Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

Bacterial communities in the fruit bodies of ground basidiomycetes

Science.gov (United States)

Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

2015-06-01

Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

Phylogeny and comparative genome analysis of a Basidiomycete fungi

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

2011-03-14

Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

Lectins from Mycelia of Basidiomycetes

Directory of Open Access Journals (Sweden)

Valentina E. Nikitina

2017-06-01

Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

ITS1/5.8S/ITS2, a Good Marker for Initial Classification of Shiitake Culinary-Medicinal Lentinus edodes (Agaricomycetes) Strains in China.

Science.gov (United States)

Song, Xiao-Xia; Zhao, Yan; Song, Chun-Yan; Li, Chuan-Hua; Song, Ying; Chen, Ming-Jie; Bao, Da-Peng; Tan, Qi

2018-01-01

China is home to rich wild and cultivated strains of Lentinus edodes, an important edible and medicinal mushroom. Artificial selection of L. edodes has a long history, and the widely cultivated strains belong to populations different from those of most wild strains. Internal transcribed spacer (ITS) regions have been used as good markers to identify L. edodes populations. But because ITS regions exhibit incomplete concerted evolution, the use of an ITS to identify L. edodes populations has been questioned. The objective of this study was to determine whether the ITS region is suitable for identifying L. edodes populations and which populations the widely cultivated strains and the most wild strains belong to by investigating intraindividual and differential ITS polymorphisms between 44 cultivars and 44 wild strains of L. edodes in China. Intraindividual ITS polymorphism is common in L. edodes strains, and most strains possessed 2 different ITS sequences, which came from their heterokaryons. The genetic polymorphisms of ITS1, 5.8S, and ITS2 in L. edodes strains are distinct. All strains were divided into one 5.8S type (5.8S-A), 2 ITS1 types (ITS1-A and ITS1-B), and 2 ITS2 types (ITS2-A and ITS2-B), which were subdivided into 2 branches (ITS2-A1 and ITS2-A2; ITS2-B1 and ITS2-B2). ITS1/5.8S/ITS2 could be used as a good marker in preliminary classification of L. edodes strains in China. It not only exhibited classified information of ITS1, 5.8S, and ITS2 for each strain at the same time, it also indicated whether the strain was heterozygous. The 44 cultivated strains were mainly the A/A/A1 type, and the 44 wild strains were mainly the A/A/A2 and other mixed types.

Green Synthesis and Antibacterial Activities of Silver Nanoparticles Using Extracellular Laccase of Lentinus edodes

Directory of Open Access Journals (Sweden)

Agbaje LATEEF

2015-12-01

Full Text Available This study reports the multi-step mutagenesis of Lentinus edodes towards optimization of the production of laccase and novel application of laccase in the biosynthesis of silver nanoparticles (AgNPs which could be used to develop an eco-friendly method for the rapid biosynthesis of AgNPs. The wild strain of L. edodes was subjected to UV irradiation at 254 nm and the resultant viable mutant was further treated with acridine orange, a chemical mutagen. The strains were evaluated for the production of laccase and the crude laccase of the UV mutant (UV10 was used for the green synthesis of AgNPs. The particles were characterized by UV-Visible spectroscopy, Fourier transform infrared (FTIR spectroscopy and scanning electron microscopy (SEM. Laccase activities of wild, UV10 and UV10ACR8 strains of L. edodes were obtained as 2.6, 10.6 and 2.8 U/ml/min respectively after 7 days of fermentation, showing laccase yield improvement of 4.08-fold for UV10 mutant. UV-Visible spectroscopy indicated the formation of AgNPs at absorption band of 430 nm. FTIR result indicated that proteins were responsible for AgNP synthesis, while SEM analysis confirmed the formation of walnut-shaped nanoparticles with size range of 50-100 nm. The biosynthesized nanoparticles revealed effective inhibition against clinical isolates of Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae. To the best of the authors’ knowledge, this result represents the first report on the biosynthesis of AgNPs using L. edodes metabolite. The report adds to the growing relevance of L. edodes as potential industrially viable organism, used for diverse biotechnological applications.

Densidade básica da madeira de sete espécies e três clones de eucalipto antes e durante o cultivo de shiitake = Basic density of wood from seven species and three clones of eucalyptus before and during shiitake cultivation

Directory of Open Access Journals (Sweden)

Meire Cristina Nogueira de Andrade

2009-04-01

Full Text Available Avaliou-se a densidade básica da madeira e casca de sete espécies (E. saligna, E. grandis, E. urophylla, E. camaldulensis, E. citriodora, E. paniculata e E. pellita e três clones de eucalipto (híbridos de E. grandis x E. urophylla antes e durante o cultivo das linhagens LE-95/01 e LE-96/18 de shiitake (Lentinula edodes em toras. Cada linhagem de shiitake foi inoculada em nove toras de cada tipo de eucalipto com 1 m de comprimento e 9 a 14 cm de diâmetro. Assim, o delineamento experimental foi inteiramente casualizado, com 20tratamentos e 9 repetições, sendo cada repetição correspondente a uma tora. As toras foram mantidas em estufa climatizada, com temperatura de 25 ± 5ºC e umidade relativa do ar entre 60-80% durante 12 meses. Para a determinação da densidade básica, analisaram-secunhas de discos e cascas de eucalipto recém-cortadas (sem inoculação das linhagens de L. edodes e em cunhas de discos retirados de toras já inoculadas com as linhagens de L. edodes após 8 e 12 meses de incubação. Verificou-se que a densidade básica da madeira, aolongo do ciclo de cultivo, foi reduzida em todos os tipos de eucalipto.Basic density of the wood and bark of seven eucalyptus species (E. saligna, E. grandis, E. urophylla, E. camaldulensis, E. citriodora, E.paniculata and E. pellita and three eucalyptus clones (E. grandis x E. urophylla hybrids were evaluated before and during the cultivation of shiitake (Lentinula edodes strains LE-95/01and LE-96/18 in logs. Each shiitake strain was inoculated into 9 logs of each type of eucalyptus with length of 1 m and diameter of 9 to 14 cm. Thus, the experimental design was totally randomized, with 20 treatments and 9 repetitions, with each repetition corresponding to one log. The logs were kept in a greenhouse, under the temperature of25 ± 5ºC and relative air humidity between 60-80 %, during 12 months. To determine basic density, newly cut disks and barks wedges of eucalyptus (without the

Selected aspects of Lentinus edodes (Berk. Sing. biology in Poland

Directory of Open Access Journals (Sweden)

Łukasz Brodziak

2014-08-01

Full Text Available Glucose, mannose, maltose and starek have been shown to be the optimal carbon sources for Lentinus edodes. The most intensive growth took place at 35°C and pH 3.5. The greatest increase In mass occurred at 25°C.

Characterization of the Effects of the Shiitake Culinary-Medicinal Mushroom, Lentinus edodes (Agaricomycetes), on Severe Gestational Diabetes Mellitus in Rats.

Science.gov (United States)

Maschio, Bianca Hessel; Gentil, Bianca Carvalho; Caetano, Erika Leão Ajala; Rodrigues, Lucas Silva; Laurino, Leticia Favara; Spim, Sara Rosicler Vieira; Jozala, Angela Faustino; Dos Santos, Carolina Alves; Grotto, Denise; Gerenutti, Marli

2017-01-01

This study evaluated the protective effect of Lentinus edodes in rats with streptozotocin-induced gestational diabetes mellitus (STZ-GDM) when administered orally. The rats received from the 1st to the 19th day of gestation daily doses of 100 or 200 mg/kg of lyophilized and reconstituted L. edodes; the animals in the saline control group and diabetic control group received a saline solution (DS). Gestational diabetes mellitus was induced by streptozotocin (80 mg/kg, administered intraperitoneally) on the fourth day of pregnancy; blood glucose > 180 mg/dL was considered to indicate STZ-GDM. L. edodes reduced catalase in plasma. We also observed reduced glucose in plasma, urea, triglycerides, and aspartate aminotransferase. There was a decrease in preimplantation loss when compared with the DS group. The doses of L. edodes used here had a protective effect on the preimplantation parameters in STZGDM. However, the mushroom was not able to reverse the deleterious effects caused by streptozotocin throughout the evolution of pregnancy.

Use of molecular markers for the study of wild fungus basidiomycetes

Directory of Open Access Journals (Sweden)

Blanca Estela Gómez Luna

2012-09-01

Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

Armillaria mellea: an ozonophilic basidiomycete

Energy Technology Data Exchange (ETDEWEB)

Berliner, M D

1963-01-19

Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

Biosorption potential of synthetic dyes by heat-inactivated and live Lentinus edodes CCB-42 immobilized in loofa sponges.

Science.gov (United States)

Gimenez, Gabriela Gregolin; Ruiz, Suelen Pereira; Caetano, Wilker; Peralta, Rosane Marina; Matioli, Graciette

2014-12-01

Lentinus edodes CCB-42 was immobilized in loofa sponges and applied to the biosorption of the synthetic dyes congo red, bordeaux red and methyl violet. Live immobilized microorganisms achieved average decolorations of congo red, bordeaux red and methyl violet of 97.8, 99.7 and 90.6 %, respectively. The loofa sponge was the support and the coadjuvant promoting dye adsorption. The biosorption conditions were optimized for each dye, yielding 30 °C, pH 5.0 and a 12 h reaction time for congo red; 25 °C, pH 3.0 and 36 h for bordeaux red; and 25 °C, pH 8.0 and 24 h for methyl violet. Operational stability was evaluated over five consecutive cycles, with both bordeaux red and congo red exhibiting decolorations above 90 %, while the decoloration of methyl violet decreased after the third cycle. In the sixth month of storage, congo red, bordeaux red and methyl violet had decolorations of 93.1, 79.4 and 73.8 %, respectively. Biosorption process best fit the pseudo-second-order kinetic and Freundlich isotherm models. Maximum biosorption capacity of heat-treated L. edodes immobilized in loofa sponge was determined as 143.678, 500.00 and 381.679 mg/g for congo red, bordeaux red and methyl violet, respectively. Treatment with immobilized L. edodes reduced the phytotoxicity of the medium containing dyes. FT-Raman experiments suggested the occurrence of interactions between loofa sponge fibers, L. edodes and dye. L. edodes CCB-42 immobilized in loofa sponges represents a promising new mode of treatment of industrial effluents.

The dynamics of Lentinus edodes (Berk. Stng. fructification on various substrates

Directory of Open Access Journals (Sweden)

Jerzy Ważny

2014-08-01

Full Text Available The dynamics of fructification of Lentinum edodes on substrates of sawdust and bark from oak, pine and alder and rye straw and mixtures of these substances during one year of pot culture. The optimum substrate composition was determined.

Bioconcentration factors and potential human health risks of heavy metals in cultivated Lentinus edodes in Chengdu, People's Republic of China.

Science.gov (United States)

Pei, Donghui; Xie, Han; Song, Haihai; Xu, Heng; Wu, Yumeng

2015-02-01

Lentinus edodes is one of the most popular edible mushrooms in the market. However, it contains heavy metals that are poisonous to humans even at trace concentrations. The concentrations and bioconcentration factors of five heavy metals in cultivated L. edodes in Chengdu were studied, and the potential health risks to local residents associated with the cultivated L. edodes consumption were evaluated. Total concentrations of cadmium (Cd), lead (Pb), chromium (Cr), arsenic (As), and mercury were determined in the fruiting bodies and the substrate from three agricultural areas. Fruiting bodies samples were collected at different growing times (2, 4, 6, and 8 days). The bioconcentration factors of heavy metals from the substrate to the fruiting bodies were estimated, and the potential health risks of local L. edodes were assessed. Because antioxidant enzymes can resist the creation of reactive oxygen species and defend against heavy metals, the activities of three antioxidant enzymes (superoxide dismutase, catalase, and peroxidase) in the fruiting bodies were also determined. A gradual change in heavy metal concentrations occurred across the growing time of the fruiting bodies. Cd transferred from the substrate to the fruiting bodies in larger concentrations than did Pb, Cr, and As. However, Chengdu residents were not exposed to significant health risks associated with consumption of local L. edodes. Nevertheless, more attention should be focused on children because of their higher sensitivity to metal pollutants.

Evaluation of immunostimulatory and immunotherapeutic effects of tropical mushroom (Lentinus edodes) against eimeriasis in chicken.

Science.gov (United States)

Ullah, Muhammad Irfan; Akhtar, Masood; Awais, Mian Muhammad; Anwar, Muhammad Irfan; Khaliq, Kashfa

2018-01-01

Mushrooms (Lentinus edodes) were processed for hot water (HWE), methanolic (ME), and polysaccharide (PSE) extracts. Polysaccharides were isolated through ion exchange (DEAE cellulose) and size exclusion (Sephadex G-100) chromatography. Monosaccharides including maltose (0.282%), glucose (0.113%), and mannose (0.451%) were identified, qualitatively and quantitatively, from the isolated polysaccharides through high-performance liquid chromatography. The whole study was divided into two experiments. Experiment 1 was meant for the evaluation of HWE and ME; whereas, experiment 2 was meant for the evaluation of PSE for immunostimulatory and immunotherapeutic activities. The cellular and humoral immune responses were demonstrated through lymphoproliferative response to phytohemagglutinin-P (PHA-P) and anti-body response to sheep red blood cells (SRBCs), respectively. The immunotherapeutic effects of these extracts were demonstrated against eimeriasis in terms of lesion scoring, oocysts per gram of droppings, and percent protection. Cell-mediated immune responses observed at 24, 48, and 72 h post-PHA-P injection were significantly higher (P edodes as compared to controls. In conclusion, L. edodes extracts showed immunostimulatory potential which persisted against eimeriasis in chicken.

EVALUATION OF ENDOGLUCANASE, EXOGLUCANASE, LACCASE, AND LIGNIN PEROXIDASE ACTIVITIES ON TEN WHITE-ROT FUNGI

Directory of Open Access Journals (Sweden)

Sandra Montoya B

2014-12-01

Full Text Available This paper presents a way of tracking the production of lignocellulolytic enzymes in ten species of white rot fungi: Lentinula edodes, Schizophyllum commune, Trametes trogii, Coriolus versicolor, Pycnoporus sanguineus, Ganoderma applanatum, Ganoderma lucidum, Grifola frondosa, Pleurotus ostreatus and Auricularia delicata. These species were first screened on solid culture media containing carboxymethyl cellulose, crystalline cellulose, ABTS (2,2´-azino-bis(3-ethylbenzothiazoline-6-sulphonate and azure B, which showed the production of endoglucanase, exoglucanase, laccase and lignin peroxidase (LiP enzymes. Cellulolytic activities were detected after five days of incubation with congo red indicator, forming a clear-white halo in areas where cellulose was degraded. For ligninases, the tracking consisted of the monitoring in the formation of green halos due to ABTS oxidation for laccase, and decolorization halos on azure B for LiP during 14 days of incubation. From this qualitative screening, four strains were selected (G. lucidum, L. edodes, C. versicolor and T. trogii as the best producers of cellulolytic and ligninolytic enzymes. These four species were inoculated on a substrate of sawdust oak, yielding 51,8% of lignin degraded by L. edodes and 22% of cellulose degraded by C. versicolor.

Antioxidative activities and chemical characterization of polysaccharide extracts from the widely used mushrooms Ganoderma applanatum, Ganoderma lucidum, Lentinus edodes and Trametes versicolor

NARCIS (Netherlands)

Kozarski, M.; Klaus, A.; Niksic, M.; Vrvic, M.M.; Todorovic, N.; Jakovljevic, D.; Griensven, van L.J.L.D.

2012-01-01

Antioxidant activities of polysaccharide extracts of four of the most widely known mushrooms often used in medicinal applications as well as in tea and food, namely Ganoderma applanatum, Ganoderma lucidum, Lentinus edodes and Trametes versicolor, were studied. G. applanatum and L edodes extracts

A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

Science.gov (United States)

Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

2017-08-25

The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

Science.gov (United States)

Johnson, Eric A

2013-09-01

Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

OpenAIRE

Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

2015-01-01

The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

Degradation of cellulose by basidiomycetous fungi

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Valášková, Vendula

2008-01-01

Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

Physicochemical properties of polysaccharides from Lentinus edodes under high pressure cooking treatment and its enhanced anticancer effects.

Science.gov (United States)

Li, Weiwei; Wang, Jingya; Chen, Zhongqin; Gao, Xudong; Chen, Yue; Xue, Zihan; Guo, Qingwen; Ma, Qiqi; Chen, Haixia

2018-04-22

This study was to investigate the physicochemical properties and anticancer effects of polysaccharides from Lentinus edodes extracted under high pressure cooking treatment (HPLPS) in vitro and in vivo. The extraction efficiency was improved. The main molecular weight of HPLPS was about 540 and about 227 kDa. And the inhibitory effects on HepG2 and HeLa cells of HPLPS were significantly increased (p Lentinus edodes might be effectively used for the treatment of hepatocellular carcinoma through its antioxidant and immunomodulatory effects. Copyright © 2018 Elsevier B.V. All rights reserved.

Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.

Science.gov (United States)

Morales, Viviana; Sánchez, Jose E

2017-01-01

The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.

BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

Directory of Open Access Journals (Sweden)

Chaika A. V.

2013-12-01

Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

Science.gov (United States)

Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

2017-01-01

The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

Directory of Open Access Journals (Sweden)

Javier Ribera

Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

Protection of the Extracts of Lentinus edodes Mycelia against Carbon-Tetrachloride-Induced Hepatic Injury in Rats

Directory of Open Access Journals (Sweden)

Mei-Fen Chen

2012-01-01

Full Text Available Lentinus edodes is the medicinal macrofungus showing potential for therapeutic applications in infectious disorders including hepatitis. In an attempt to develop the agent for handling hepatic injury, we used the extracts of Lentinus edodes mycelia (LEM to screen the effect on hepatic injury in rats induced by carbon tetrachloride (CCl4. Intraperitoneal administration of CCl4 not only increased plasma glutamic oxaloacetic transaminase (GOT and glutamic pyruvic transaminase (GPT but also decreased hepatic superoxide dismutase (SOD and glutathione peroxidase (GPx levels in rats. Similar to the positive control silymarin, oral administration (three times daily of this product (LEM for 8 weeks significantly reduced plasma GOT and GPT. Also, the activities of antioxidant enzymes of SOD and GPx were elevated by LEM. in liver from CCl4-treated rats, indicating that mycelium can increase antioxidant-like activity. Moreover, the hepatic mRNA and protein levels of SOD and GPx were both markedly raised by LEM. The obtained results suggest that oral administration of the extracts of Lentinus edodes mycelia (LEM has the protective effect against CCl4-induced hepatic injury in rats, mainly due to an increase in antioxidant-like action.

Polysaccharides from Tricholoma matsutake and Lentinus edodes enhance 5-fluorouracil-mediated H22 cell growth inhibition.

Science.gov (United States)

Ren, Ming; Ye, Lingyan; Hao, Xiaoshi; Ren, Zhixing; Ren, Shuping; Xu, Kun; Li, Juan

2014-06-01

Few studies have investigated the effects produced by combinations of polysaccharides and chemotherapeutic drugs in cancer treatment. We hypothesized that a combination of polysaccharides (COP) from Lentinus edodes and Tricholoma matsutake would improve the efficacy of 5-fluorouracil (5-FU)-mediated inhibition of H22 cell growth. Mice were injected H22 cells and then treated with either 5-FU, polysaccharides from Tricholoma matsutake (PTM), polysaccharides from Lentinus edodes (PL), PTM+PL, 5-FU+PTM, 5-FU+ PL, or 5-FU + COP. The tumor weight and volume, and splenic CD4 + and CD8 + T cell frequencies, were determined. Additionally, splenic natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activities were assessed and the serum levels of tumor necrosis factor-alpha (TNF-alpha), Interleukin-2 (IL-2), and Interferon-gamma (IFN-gamma) were measured. Compared with mice from the control, 5-FU, PL, PTM, PTM + PL, 5-FU + PL, and 5-FU + PTM groups, mice treated with 5-FU + COP showed: (a) significantly reduced tumor weight and volume (P Lentinus edodes and Tricholoma matsutake could enhance the efficacy of 5-FU-mediated H22 cell growth inhibition.

[The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

Science.gov (United States)

Terekhova, V A; Semenova, T A

2005-01-01

We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

Energy Technology Data Exchange (ETDEWEB)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

Shiitake Flagellate Dermatitis: the First Case Reported in Ireland

LENUS (Irish Health Repository)

Byrne, N

2017-01-01

Shiitake (Lentinula edodes) is the second most commonly consumed mushroom worldwide1. It is used in Asian medicine for its anticarcinogenic, antihypertensive and lipid lowering properties2. Furthermore, extracts of these mushrooms are used in over-the-counter dietary supplements designed to improve the immune system1. The first case of shiitake mushroom induced flagellate dermatitis was described in Japan in 1977 and it is now being reported in the western world3. After literary review and consultation with the Irish National Poisons Information Centre, we believe this is the first reported case of shiitake flagellate dermatitis in Ireland

Medicinal properties of fungi occurring on Betula sp. trees. A review

Directory of Open Access Journals (Sweden)

Smolibowska Joanna

2016-09-01

Full Text Available The article presents the chemical costituents and pharmacological properties of polyporoid fungi found on birch, namely Piptoporus betulinus, Inonotus obliquus, Lenzites betulina, Fomes fomentarius, and Trametes versicolor. The in vitro and in vivo studies on the effect of different extracts from above-mentioned fungi on the human organism shown anti-cancer, anti-inflammatory, antiviral, antibacterial and immunostimulant activity, conditioned by the presence of such compounds as polysaccharides, polyphenols or terpenes. These fungi are commonly found in Poland and may superbly compete with Ganoderma lucidum (Reishi or Lentinula edodes (Shitake used in Asia for medicinal purposes.

Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

2013-03-11

Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

Occurrence of indoor wood decay basidiomycetes in Europe

Czech Academy of Sciences Publication Activity Database

Gabriel, Jiří; Švec, Karel

2017-01-01

Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

In vivo anticancer and immunomodulating activities of mannogalactoglucan-type polysaccharides from Lentinus edodes (Berkeley) Singer.

Science.gov (United States)

Jeff, Iteku Bekomo; Fan, Enxue; Tian, Meihong; Song, Chenyang; Yan, Jingmin; Zhou, Yifa

2016-01-01

There is considerable interest in the potential of mushrooms in modulating the immune system and/or suppressing tumor growth. Among the studied bioactive compounds in mushrooms, polysaccharides are the most important. Nontoxic fungal polysaccharides have a more important role in immunomodulating and antitumor activities which are related to their effects to act of immune effecter cells such as lymphocytes, macrophages, dendritic cells, and natural killer cells involved in the innate and adaptive immunity. Two mannogalactoglucan-type polysaccharides (WPLE-N-2 and WPLE-A0.5-2), purified from the fruiting bodies of Lentinus edodes, were evaluated for their effects on the cellular immune response of Sarcoma 180 (S-180)-bearing mice. Mice were treated with 100 mg/kg body weight of the polysaccharides for 10 days. Significant tumor regressions of the polysaccharide groups' mice were observed compared to the control group. These polysaccharides could induce an increase in nitrite oxide (NO) production in peritoneal macrophages, significantly increase macrophage phagocytosis of tumor-bearing mice and augment concanavalin (ConA) and lipopolysaccharide (LPS)-induced splenocytes proliferation. Our results indicated that immunomodulating activity occurred through host mediation in response to lymphocyte proliferation, macrophage phagocytosis and induction of NO production while the antitumor activity occurred through direct cytotoxicity. Our findings suggest that mannogalactoglucan-type polysaccharides from L. edodes can be explored as novel potential immunostimulants. Our research provides essential data to a better understanding of L. edodes bioactive compounds, especially polysaccharides. Our results also confirm the key role of β-linkages in the antitumor and immunomodulating effects of polysaccharides.

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

Science.gov (United States)

Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

Directory of Open Access Journals (Sweden)

Lehlohonolo Benedict Qhanya

Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

The use of residual geothermal energy in an edible mushroom production plant, Los Humeros geothermal fields (Mexico): Achievements and alternatives; El uso de la energia geotermica residual en la planta productora de hongos comestibles del campo geotermico Los Humeros (Mexico): Logros y alternativas

Energy Technology Data Exchange (ETDEWEB)

Rangel Rangel, Maria Elena [Proteccion ambiental, Puebla (Mexico)

2000-12-01

A plant for raising edible mushrooms with residual geothermal energy is a project of the Comision Federal de Electricidad (CFE). The results reflect important achievements in the development of technology for the productions of wholesome and available food with geothermal heat instead of conventional energy sources. The installations have an enormous technological and commercial potential- demonstrated by the cultivation of oyster mushrooms (Pleurotus ostreatus), which success has awakened the interest of research institutions. The Instituto of Ecologia, A.C., has begun a joint project with CFE cultivating shiitake mushrooms (Lentinula edodes) with geothermal energy. These achievements mark a clear trend toward the integral use of facilities, the establishment of a crop with greater economic advantages, and the diffusion of this project. [Spanish] La planta productora de hongos comestibles es un proyecto de la Comision Federal de Electricidad (CFE) para dar un uso alterno a la energia geotermica residual. Los resultados obtenidos hasta el momento reflejan logros importantes en la generacion de tecnologia propia para la produccion de un alimento sano y accesible, sustituyendo la energia proveniente de combustibles convencionales por calor geotermico. Las instalaciones creadas cuentan con un enorme potencial tecnologico y comercial demostrando con el cultivo de las setas (Pleurotus ostreatus) con un exito tal que ha despertado el interes de instituciones dedicadas a la investigacion. Tal es el caso de Instituto de Ecologia, A.C que acualmente se encuentra involucrado en un proyecto conjunto sobre el cultivo del hongo Lentinula edodes (shiitake) utilizando energia geotermica en su proceso productivo. Con lo anterior, se esta marcando una clara tendencia hacia el aprovechamiento integral de las instalaciones, el establecimiento de un cultivo con mayores ventajas economicas y la difusion de este proyecto.

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

Science.gov (United States)

Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

2014-01-01

Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

Directory of Open Access Journals (Sweden)

Martin Vohník

Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

CSIR Research Space (South Africa)

Wolfaardt, F

2004-10-01

Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

Purification, characterization and anti-aging capacity of mycelia zinc polysaccharide by Lentinus edodes SD-08.

Science.gov (United States)

Wang, Liqin; Wang, Cuiqin; Gao, Xia; Xu, Nuo; Lin, Lin; Zhao, Huajie; Jia, Shouhua; Jia, Le

2015-04-09

In the modern society, aging had been a major problem. People may rely on many medicines to delay it. However, lots of medicines were chemosynthetic, and they would do a bad side-effect on human body. Microbial sources could be used as a potential means of producing natural antioxidants. Lentinus edodes, commercial obtained in daily life, had recently become more attractive in physiological research. Zinc was now considered as a major element in assuring the correct functioning of an organism and essential for maintaining coordination of the major homeostatic networks. To investigate the bioconversion of zinc and the physiological effects of their complex (MZPS), the present studies were processed. Mycelia polysaccharides (MPS) and mycelia zinc polysaccharides (MZPS) of Lentinus edodes SD-08 were extracted by hot water leaching and purified by DEAE-52 cellulose anion-exchange column chromatography separately. The zinc content was determined by flame atomic absorption spectrometry. The evaluation of monosaccharide compositions and proportions used gas chromatogram. The analysis of molecular weight used HPGPC chromatogram. The typical structure of polysaccharide was evaluated by IR spectrum. The antioxidant activities in vitro measured through reducing power, the scavenging effects on hydroxyl radical and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals. The anti-aging activities in vivo measured through the total antioxidant capacity (T-AOC), GSH peroxide (GSH-Px), superoxide dismutase (SOD) and the contents of malondialdehyde (MDA). MPS and MZPS of Lentinus edodes SD-08 were extracted and purified by DEAE-52 cellulose anion-exchange column chromatography separately, and four fractions (MPS-1, MPS-2, MZPS-1 and MZPS-2) were obtained. In addition, MPS composing of rhamnose, arabinose and mannose (molar proportion = 1.75:1.00:3.02) and MZPS containing rhamnose, arabinose, mannose and glucose (molar proportion = 7.19:2.26:1.00:8.39) were investigated by gas chromatography

DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

OpenAIRE

B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

2014-01-01

ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

Characterization of Lentinus edodes β-glucan influencing the in vitro starch digestibility of wheat starch gel.

Science.gov (United States)

Zhuang, Haining; Chen, Zhongqiu; Feng, Tao; Yang, Yan; Zhang, Jingsong; Liu, Guodong; Li, Zhaofeng; Ye, Ran

2017-06-01

Lentinus edodes β-glucan (abbreviated LEBG) was prepared from fruiting bodies of Lentinus edodes. The average molecular weight (Mw) and polydispersity index (Mw/Mn) of LEBG were measured to be 1.868×10 6 g/mol and 1.007, respectively. In addition, the monosaccharide composition of LEBG was composed of arabinose, galactose, glucose, xylose, mannose with a molar ratio of 5:11:18:644:16. After adding LEBG, both G' and G″ of starch gel increased. This is mainly because the connecting points between the molecular chains of LEBG and starch formed so that gel network structures were enhanced. The peak temperature in the heat flow diagram shifted to a higher temperature and the peak area of the endothermic enthalpy increased. Furthermore, LEBG can significantly inhibit starch hydrolysis. The predicted glycemic index (pGI) values were reduced when starch was replaced with LEBG at 20% (w/w). It might indicate that LEBG was suitable to develop low GI noodle or bread. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

Science.gov (United States)

Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

2015-02-01

Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

Directory of Open Access Journals (Sweden)

Hamid Akbarirad

2013-06-01

Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

Science.gov (United States)

Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

2014-01-01

The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

NARCIS (Netherlands)

Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

2015-01-01

Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

Effects of electrical stimulation on fruit of lentinus edodes; Shiitake jinko kindoko ni taisuru denki shigeki ga kojittai hassei kosu ni oyobosu eikyo

Energy Technology Data Exchange (ETDEWEB)

Mitobe, K.; Sato, T.; Yoshimura, N. [Akita Univ. (Japan)] Suzuki, T. [Tohoku Electric Power Co. Ltd., Sendai (Japan)

1997-11-30

So far, the cultivation of Lentinus edodes is cultivated from material wood mainly, however, recently, artificial bed-blocks method has been used widely. The advantage of bed-block cultivation is to a short growing period and be possible to cultivate by a large scale facilities. Hereafter, it is thought that this growing method is used mainly. Before now, based on the experimental fact that abnormal fruiting of Lentinus edodes occurs due to lightening, the study on the effects of electrical stimulation was reported, however, the investigation on the effects of electrical stimulation on the artificial bed-bocks which is thought to come into wide use in future does not carry out until now. The purpose of this study is to investigate an increased yield of the Lentinus fruit-bodies grown on artificial bed-blocks that electrical stimuli were applied. Nineteen artificial bed-blocks were provided for each applied voltage condition; Control, 200V, 400V, 600V, for the AC. As a result of experiment, in the 600V condition, the total number of fruiting of Lentinus edodes was significantly increased as compared with other conditions. Especially, in the artificial bed-blocks that peak current was over 300 mA, the total number of fruiting was increased. 6 refs., 6figs.

EVALUACIÓN DE ACTIVIDADES ENDOGLUCANASA, EXOGLUCANASA, LACASA Y LIGNINA PEROXIDASA EN DIEZ HONGOS DE PUDRICIÓN BLANCA

Directory of Open Access Journals (Sweden)

SANDRA MONTOYA B.

Full Text Available Este trabajo presenta una vía de rastreo de producción de enzimas lignocelulolíticas en diez especies de hongos de pudrición blanca: Lentinula edodes, Schizophyllum commune, Trametes trogii, Coriolus versicolor, Pycnoporus sanguineus, Ganoderma applanatum, Ganoderma lucidum, Grifola frondosa, Pleurotus ostreatus y Auricularia delicata. Estas especies primero fueron rastreadas sobre medios de cultivo sólido que contienen carboximetil celulosa, celulosa cristalina, ABTS (2,2´-azino-bis(3-etilbenzotiazolina-6-sulfonato y azure B, los cuales evidenciaron la producción de las enzimas endoglucanasa, exoglucanasa, lacasa y lignina peroxidasa (LiP. Las actividades celulolíticas fueron detectadas a los cinco días de incubación con el indicador rojo congo, formándose un halo claro-blanco en las zonas donde se degrada la celulosa. Para las ligninasas, este rastreo consistió en el seguimiento a la formación de halos verdes por oxidación del ABTS para lacasa y halos de decoloración sobre el azure B para la LiP durante 14 días de incubación. De este rastreo cualitativo, se seleccionaron cuatro cepas (G. lucidum, L. edodes, C. versicolor y T. Trogii, como las mejores productoras de enzimas celulolíticas y ligninolíticas. Estas cuatro especies fueron inoculadas sobre un sustrato de aserrín de roble, obteniéndose 51,8% de lignina degradada por L. edodes y 22% de celulosa degrada por C. versicolor.

Analysis of basidiomycete pigments in situ by Raman spectroscopy.

Science.gov (United States)

Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

2018-02-07

Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biotic interactions of Lentinus edodeds (Berk. Sing. with fungi which occur the most frequently in its cultures

Directory of Open Access Journals (Sweden)

Łukasz Brodziak

2014-08-01

Full Text Available The interaction of the examined fungi was measured as the degree of encirclement of fungal colonies in two-organism cultures, the width of the inhibition yone and the evaluation single species cultures. Three species strongly limited the growth of Lentinus edodes colonies. In the other cases this fungus dominated due to intensive growth of the mycelium.

Extrinsic and Intrinsic Apoptotic Responses Induced by Shiitake Culinary-Medicinal Mushroom Lentinus edodes (Agaricomycetes) Aqueous Extract against a Larynx Carcinoma Cell Line.

Science.gov (United States)

Finimundy, Tiane C; Scola, Gustavo; Scariot, Fernando J; Dillon, Aldo J P; Moura, Sidnei; Echeverrigaray, Sérgio; Henriques, João Pegas; Roesch-Ely, Mariana

2018-01-01

Cumulative evidence from research studies has shown that the shiitake culinary-medicinal mushroom, Lentinus edodes, is an excellent source of natural antitumor agents and is capable of inhibiting cancer cell growth. However, the cell signaling pathway that leads tumor cells to apoptosis is not well understood because many chemical compounds may be acting. This study investigated the chemopreventive effects of an L. edodes aqueous extract on human HEp-2 epithelial larynx carcinoma cells and normal human MRC-5 lung fibroblasts by identifying proliferative and apoptotic pathways. The chemical characterization of the dry powder was assessed by high-performance liquid chromatography. Antiproliferative and proapoptotic effects induced by the extract were evaluated by assessing proliferative markers, cell sorting through flow cytometry, and expression levels of apoptotic proteins with Western blotting. The results suggest that inhibition of cell proliferation was more prominent in HEp-2 than in MRC-5 cells. Cell death analysis showed the appearance of cell populations in the sub-G1 phase, with late apoptotic signal increased in a dose-dependent manner. In addition, the aqueous extract induced depolarization of mitochondria, activating the generation of intracellular reactive oxygen species in HEp-2 cells. These observations suggest that L. edodes extract may exert a chemopreventive effect, regulating mitotic induction of apoptogenic signals. These findings highlight the mushroom's pharmacological potential in cancer treatment.

Discrimination of wild-growing and cultivated Lentinus edodes by tri-step infrared spectroscopy

Science.gov (United States)

Lin, Haojian; Liu, Gang; Yang, Weimei; An, Ran; Ou, Quanhong

2018-01-01

It's not easy to discriminate dried wild-growing Lentinus edodes (WL) and cultivated Lentinus edodes (CL) by conventional method based on the morphological inspection of fruiting bodies. In this paper, fruiting body samples of WL and CL are discriminated by a tri-step IR spectroscopy method, including Fourier transform infrared (FT-IR) spectroscopy, second derivatives infrared (SD-IR) spectroscopy and two-dimensional correlation infrared (2D-IR) spectroscopy under thermal perturbation. The results show that the FT-IR spectra of WL and CL are similar in holistic spectral profile. More significant differences are exhibited in their SD-IR spectra in the range of 1700 - 900 cm-1. Furthermore, more evident differences have been observed in their synchronous 2D-IR spectra in the range of 2970 - 2900, 1678 - 1390, 1250 -1104 and 1090 - 1030 cm-1. The CL has thirteen auto-peaks at 2958, 2921, 1649, 1563, 1450, 1218, 1192, 1161, 1140, 1110, 1082, 1065 and 1047 cm-1, in which the four strongest auto-peaks are at 2921, 1563, 1192 and 1082 cm-1. The WL shows fifteen auto-peaks at 2960, 2937, 2921, 1650, 1615, 1555, 1458, 1219, 1190, 1138, 1111, 1084, 1068, 1048 and 1033 cm-1, in which the four strongest auto-peaks are at 2921, 1650, 1190 and 1068 cm-1. This study shows the potential of FT-IR spectroscopy and 2D correlation analysis in a simple and quick distinction of wild-growing and cultivated mushrooms.

VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

Directory of Open Access Journals (Sweden)

Veligodska A. K.

2013-12-01

Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

[Oil degradation by basidiomycetes in soil and peat at low temperatures].

Science.gov (United States)

Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

2016-01-01

A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

NARCIS (Netherlands)

Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

2011-01-01

Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

Directory of Open Access Journals (Sweden)

Masahiko Isaka

2016-08-01

Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

Purification and Antithrombotic Potential of a Fibrinolytic Enzyme from Shiitake Culinary- Medicinal Mushroom, Lentinus edodes GNA01 (Agaricomycetes).

Science.gov (United States)

Choi, Jun-Hui; Kim, Kyung-Je; Kim, Seung

2018-01-01

We purified Lentinus edodes GNA01 fibrinolytic enzyme (LEFE) and identified it as a novel metalloprotease. LEFE was purified to homogeneity through a 2-step procedure, with an 8.28-fold increase in specific activity and 5.3% recovery. The molecular mass of LEFE was approximately 38 kDa, based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Its optimal pH, optimal temperature, pH stability, and thermal stability were 5, 30°C, 6-7, and 40°C, respectively. LEFE was inhibited by zinc and magnesium ions, and by EDTA and EGTA, indicating that LEFE is a metalloprotease. The protease exhibited fibrinolytic activity and a degradative effect on clot formation and blood clots. The protease prolonged activated partial thromboplastin time, prothrombin time, and coagulation time as induced by platelet aggregators (collagen and epinephrine). Taken together, our results indicate that L. edodes GNA01 produces a metalloprotease/fibrinolytic enzyme and that this enzyme might be applied as a new thrombolytic and antithrombotic agent for thrombosis-related cardiovascular disorders.

Cultivation of three medicinal mushroom species on olive oil press cakes containing substrates

Directory of Open Access Journals (Sweden)

Andrej GREGORI

2015-12-01

Full Text Available Olive oil press cakes (OOPC represent a waste that has a negative impact on environment. OOPC have little or no use and because of that solutions for their alternative use are sought after. In our experiments we investigated substrate mixtures composed of different proportions of OOPC, wheat bran, crushed corn seeds and beech sawdust for cultivation of Ganoderma lucidum, Lentinula edodes and Grifola frondosa fruiting bodies. The increasing amount of OOPC in fruiting bodies cultivation substrates resulted in decreasing production of fruiting bodies. Results show, that although OOPC in small portion can be successfully used as a medicinal mushroom fruiting bodies cultivating substrate, their use is rational only, if no other substrate composing materials can be found or when OOPC usage solves the problem of its deposition.

Selective Cytotoxic Activity of Se-Methyl-Seleno-L-Cysteine- and Se-Polysaccharide-Containing Extracts from Shiitake Medicinal Mushroom, Lentinus edodes (Agaricomycetes).

Science.gov (United States)

Klimaszewska, Marzenna; Górska, Sandra; Dawidowski, Maciej; Podsadni, Piotr; Szczepanska, Agnieszka; Orzechowska, Emilia; Kurpios-Piec, Dagmara; Grosicka-Maciag, Emilia; Rahden-Staroń, Iwonna; Turło, Jadwiga

2017-01-01

Numerous formulations derived from the shiitake medicinal mushroom, Lentinus edodes, demonstrate anticancer activities. We hypothesized that isolates from selenium (Se)-enriched mycelia of L. edodes would possess stronger cancer-preventive properties than current preparations. The aim of this study was to investigate whether the presence of Se-methyl-seleno-L-cysteine in mycelial extracts of L. edodes affects their cytotoxic activity (makes them stronger) or whether they are as effective as Se-containing polysaccharides. Extracts were prepared from Se-containing mycelia under various conditions and assayed for cytotoxic activity in cancer (PC3 and HeLa) and normal (HMEC-1) cell lines. The chemical composition of the extracts was examined; specifically, the amounts of potentially cytotoxic Se compounds (methylselenocysteine, selenomethionine, and Se-containing polysaccharides) were measured. The relationship between extract composition and biological activity was characterized. Mycelial cultures were cultivated in a 10-L bioreactor in medium enriched with sodium selenite. Mycelial extracts were prepared either at 100°C or at 4°C in acidic solution. Total Se content was determined using the atomic absorption spectrometry method, and methylselenocysteine and selenomethionine contents were measured using reverse-phase high-performance liquid chromatography. Protein, carbohydrate, and polyphenolic contents were determined with spectrophotometric methods, and Se-containing polysaccharides were measured with the use of precipitation. Anticancer activity of mycelial extracts was examined using the MTT cell viability assay. Extracts containing Se-methyl-seleno-L-cysteine or Se-polysaccharides prepared at 4°C and 100°C, respectively, display moderate, time-dependent, specific cytotoxic activity in HeLa and PC3 cell lines. The effect in HeLa cells is more pronounced in the extract prepared at 4°C than at 100°C. The effect is almost equal for the PC3 cell line. However

Simultaneous separation and determination of six arsenic species in Shiitake (Lentinus edodes) mushrooms: Method development and applications.

Science.gov (United States)

Chen, Shuangyang; Yuan, Biao; Xu, Jiajia; Chen, Guitang; Hu, Qiuhui; Zhao, Liyan

2018-10-01

A method for simultaneously separating six arsenic (As) species was established by ultrasound-assisted extraction-anion exchange chromatography coupled with inductively coupled plasma mass spectrometry. Six As species could be well separated within 15 min when 0.3 M acetic acid and 25 mM NH 4 H 2 PO 4 were used as the extraction solvent and mobile phase, respectively. Under optimized conditions, the limits of detection and recovery of As species and the relative standard deviation were in the ranges of 0.31-0.59 μg/L, 94.30-102.75%, and 1.63-3.72%, respectively. Furthermore, the established method was successfully applied to fresh Shiitake (Lentinus edodes) mushrooms and processed products. The inorganic As contents of all samples ranged from 0.204 to 0.500 mg/kg, half of samples (>0.400 mg/kg) were close to the maximum contaminant level allowed by the Chinese (0.5 mg/kg). The health risk index estimation results indicated that no particular risk of As exposure to Chinese consumers existed in L. edodes. Copyright © 2018 Elsevier Ltd. All rights reserved.

The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

International Nuclear Information System (INIS)

Bayles, C.J.; Aist, J.R.; Berns, M.W.

1993-01-01

Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

Science.gov (United States)

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

Science.gov (United States)

Chiaki Hori; Daniel Cullen

2016-01-01

Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

NARCIS (Netherlands)

Kreger-van Rij, N.J.W.; Veenhuis, M.

1971-01-01

The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

The anti-adhesive mode of action of a purified mushroom (Lentinus edodes) extract with anticaries and antigingivitis properties in two oral bacterial phatogens

NARCIS (Netherlands)

Signoretto, C.; Marchi, A.; Bertoncelli, A.; Buralcchini, G.; Papetti, A.; Pruzzo, C.; Zaura, E.; Lingström, P.; Ofek, I.; Pratten, J.; Spratt, D.A.; Wilson, M.; Canepari, P.

2014-01-01

Background In previous works we have shown that a low-molecular-mass (LMM) fraction from mushroom (Lentinus edodes) homogenate interferes with binding of Streptococcus mutans to hydroxyapatite and Prevotella intermedia to gingival cells. Additionally, inhibition of biofilm formation of both odonto-

The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

OpenAIRE

Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

2005-01-01

Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

Science.gov (United States)

Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

2011-01-01

When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

Antioxidant activity of water extracts from fruit body of Lentinus edodes enriched with selenium

Directory of Open Access Journals (Sweden)

Savić Milena D.

2011-01-01

Full Text Available Shiitake (Lentinus edodes belongs to medically important and delicious fungi. It is recognizable for its healing properties, excellent taste and rich aroma. According to the traditional Japanese and Chinese medicine, shiitake mushroom significantly increases the strength and vitality of the body. Shiitake contains immunostimulants, compounds that lower cholesterol, prevents clogging of blood vessels, regulates the pressure, balances blood sugar levels, regulates digestion, and improves the performance of respiratory organs by its antirheumatic and antiallergic activities. Shiitake is recommended to use as food, prevention and cure, usually in a form of a spice (dried and ground or tea. It can be consumed fresh, too. The objective of this study was to test the effect of enrichment in selenium on antioxidant, reducing and free radical scavenging activity of water extracts from fruit body of Lentinus edodes. The fungus was enhanced by adding organic selenium, zinc (II complex with the ligand 2.6-bis diacetylpyridine (selenosemicarbazon and inorganic compounds (Na2SeO3 of selenium in nutritional substrate where the fungus was grown. The total selenium content in fruit body was around 50 ppm for the sample enriched with selenium originating from organic sources, and 80 ppm for the sample enriched with selenium from inorganic sources. Samples were prepared by extraction of fruiting bodies in heated water. The results indicated that water extracts of whole fruit bodies, from both control and mushrooms supplemented with selenium, had quite good antioxidant activity. However, there was no significant difference between the samples supplemented with selenium content and those that were not.

Forest farming of shiitake mushrooms: aspects of forced fruiting.

Science.gov (United States)

Bruhn, J N; Mihail, J D

2009-12-01

Three outdoor shiitake (Lentinula edodes (Berk.) Pegler) cultivation experiments were established during 2002-2004 at the University of Missouri Horticulture and Agroforestry Research Center, in central Missouri. Over three complete years following a year of spawn run, we examined shiitake mushroom production in response to the temperature of forcing water, inoculum strain, substrate host species and physical orientation of the log during fruiting. Forcing compressed the period of most productive fruiting to the two years following spawn run. Further, chilled forcing water, 10-12 degrees C, significantly enhanced yield, particularly when ambient air temperatures were favorable for the selected mushroom strain. The temperature of water available for force-fruiting shiitake logs depends on geographic location (latitude) and source (i.e., farm pond vs. spring or well water). Prospective growers should be aware of this effect when designing their management and business plans.

Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

Energy Technology Data Exchange (ETDEWEB)

Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.

2009-07-01

It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

Bioavailability of Compounds Susceptible to Enzymatic Oxidation Enhances Growth of Shiitake Medicinal Mushroom (Lentinus edodes) in Solid-State Fermentation with Vineyard Prunings.

Science.gov (United States)

Cabrera, Rosina; López-Peña, Damian; Asaff, Ali; Esqueda, Martín; Valenzuela-Soto, Elisa M

2018-01-01

Grapes are widely produced in northwestern Mexico, generating many wood trimmings (vineyard prunings) that have no further local use. This makes vineyard prunings a very attractive alternative for the cultivation of white-rot medicinal mushrooms such as Lentinus edodes. This type of wood can also offer a model for the evaluation of oxidative enzyme production during the fermentation process. We tested the effect of wood from vineyard prunings on the vegetative growth of and production of ligninolytic enzymes in L. edodes in solid-state fermentation and with wheat straw as the control substrate. The specific growth rate of the fungus was 2-fold higher on vineyard pruning culture (μM = 0.95 day-1) than on wheat straw culture (μM = 0.47 day-1). Laccase-specific production was 4 times higher in the vineyard prunings culture than on wheat straw (0.34 and 0.08 mU · mg protein-1 · ppm CO2-1, respectively), and manganese peroxidase production was 3.7 times higher on wheat straw culture than on vineyard prunings (2.21 and 0.60 mU · mg protein-1 · ppm CO2-1, respectively). To explain accurately these differences in growth and ligninolytic enzyme activity, methanol extracts were obtained from each substrate and characterized. Resveratrol and catechins were the main compounds identified in vineyard prunings, whereas epigallocatechin was the only one detected in wheat straw. Compounds susceptible to enzymatic oxidation are more bioavailable in vineyard prunings than in wheat straw, and thus the highest L. edodes growth rate is associated with the presence of these compounds.

Concentrations of 137Cs and 40K in mushrooms consumed in Japan and radiation dose as a result of their dietary intake

International Nuclear Information System (INIS)

Ban-nai, Tadaaki; Muramatsu, Yasuyuki; Yoshida, Satoshi

2004-01-01

Mushrooms are known to accumulate radiocesium. To estimate the intake of radiocesium through the eating of mushrooms, about 30 samples belonging to 4 commonly consumed species (Lentinula edodes, Hypsizigus marmoreus, Grifola frondosa, and Tricholoma matsutake), were analyzed for 137 Cs and 40 K. The concentration ranges were 0.060-29 Bq kg -1 (wet wt) for 137 Cs and 38-300 Bq kg -1 (wet wt) for 40 K. The geometric mean concentration for 137 Cs was 0.56 Bq kg -1 (wet wt), and the mean concentration for 40 K was 92 Bq kg -1 (wet wt). The 137 Cs concentrations in L. edodes cultivated in mushroom beds (sawdust-rice bran media) were lower than those cultivated on bed logs (natural wood with bark). The annual intake of 137 Cs per person through mushrooms was calculated, by using the current analytical results and food consumption data in Japan, to be 3.1 Bq for 137 Cs, which is about 28% of the total dietary intake of this nuclide. The effective dose equivalent of 137 Cs through mushrooms was estimated to be 4.0 x 10 -8 Sv, which is about the half the value obtained in our previous study. The decrease of the 137 Cs intake through mushrooms is probably related to changes in cultivation methods in recent years, from the use of bed logs to mushroom beds. (author)

To Study the Influence of Different Substrate on Shiitake Mushroom Fruiting (the First Production Report in IRAN

Directory of Open Access Journals (Sweden)

L Razeghi yadak

2011-01-01

Full Text Available Abstarct Shiitake mushroom [Lentinula edodes(Berk Singer/Pegler] has the second production class among the most important edible mushrooms. For a long time this mushroom has draw attention due to its unique flavor and taste and also therapeutic properties. ِDue to the importance of this mushroom in the world and also the effect of substrate on the production of this medicinal mushroom, a research were conducted in randomized complete block design with 6 replications on 4 different substrate formulations including: 1 sawdust, wheat bran, millet; 2 sawdust, wheat bran, molasses, chalk, calcium super phosphate; 3sawdust, wheat bran, tea waste; 4sawdust, saccharose, citric acid, chalk and calcium carbonate on L.edodes production for determining the suitable substarte on early fruiting, yield, biological effeciency, average mushroom numbers and weights per block. Results showed that substrate formulation 1 caused earlier fruiting than others (58 days from incubation time, this formulation also had the highest yield (112/3 g/log and biological effeciency (35/09% between the others formula. mashroom number was the most in substrate formulation 1 (16/67 n/log and the highest mushroom wieght was obtained from formulation 4 (14/33 g/per mushroom. there wasn’t any significant differences at (p≤0.05 between substrate formulation 1 and 2. Keywords: Shiitake, Substrate formulation, Yield, Biological effeciency, Mushroom number and weight

Alkali-soluble polysaccharide, isolated from Lentinus edodes, induces apoptosis and G2/M cell cycle arrest in H22 cells through microtubule depolymerization.

Science.gov (United States)

You, Ru-Xu; Liu, Jin-Yu; Li, Shi-Jun; Wang, Liu; Wang, Kai-Ping; Zhang, Yu

2014-12-01

The aim of the study was to evaluate the pro-apoptotic effects of polysaccharides derived from Lentinus edodes and further elucidated the mechanisms of this action. Our results demonstrated that marked morphological changes of apoptosis were observed after treatment of L. edodes polysaccharides [Lentinan (LTN)]. Moreover, LTN-induced cell apoptosis was characterized by a rapid stimulation of reactive oxygen species production, the loss of mitochondrial membrane potential and an increase in intracellular concentration of Ca(2+) . In addition, the results of the haematoxylin and eosin and TUNEL assay further confirmed that LTN-induced apoptosis in vivo. Furthermore, flow cytometry analysis showed that LTN could arrest the cell cycle at G2/M phase, and immunofluorescence showed LTN caused disruption of microtubule. These results suggest that disruption of cellular microtubule network, arrest of the cell cycle at G2/M phase and induction of apoptosis may be one of the possible mechanisms of anti-tumour effect of LTN. Copyright © 2014 John Wiley & Sons, Ltd.

Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

Science.gov (United States)

Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

2010-11-01

Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

A polysaccharide isolated from the liquid culture of Lentinus edodes (shiitake) mushroom mycelia containing black rice bran protects mice against a Salmonella lipopolysaccharide-induced endotoxemia

Science.gov (United States)

Endotoxemia (sepsis, septic shock) is an inflammatory, virulent disease that results mainly from bacterial infection. The present study investigates the inhibitory effect of the bio-processed polysaccharide (BPP) isolated from the edible Lentinus edodes liquid mycelial mushroom culture supplemented...

Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

OpenAIRE

Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

2006-01-01

Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

Degradation of terbuthylazine, difenoconazole and pendimethalin pesticides by selected fungi cultures.

Science.gov (United States)

Pinto, A P; Serrano, C; Pires, T; Mestrinho, E; Dias, L; Teixeira, D Martins; Caldeira, A T

2012-10-01

Contamination of waters by xenobiotic compounds such as pesticides presents a serious environmental problem with substantial levels of pesticides now contaminating European water resources. The aim of this work was to evaluate the ability of the fungi Fusarium oxysporum, Aspergillus oryzae, Lentinula edodes, Penicillium brevicompactum and Lecanicillium saksenae, for the biodegradation of the pesticides terbuthylazine, difenoconazole and pendimethalin in batch liquid cultures. These pesticides are common soil and water contaminants and terbuthylazine is considered the most persistent triazine herbicide in surface environments. P. brevicompactum and L. saksenae were achieved by enrichment, isolation and screening of fungi capable to metabolize the pesticides studied. The isolates were obtained from two pesticide-primed materials (soil and biomixture). Despite the relatively high persistence of terbuthylazine, the results obtained in this work showed that the fungi species studied have a high capability of biotransformation of this xenobiotic, comparatively the results obtained in other similar studies. The highest removal percentage of terbuthylazine from liquid medium was achieved with A. oryzae (~80%), although the major biodegradation has been reached with P. brevicompactum. The higher ability of P. brevicompactum to metabolize terbuthylazine was presumably acquired through chronic exposure to contamination with the herbicide. L. saksenae could remove 99.5% of the available pendimethalin in batch liquid cultures. L. edodes proved to be a fungus with a high potential for biodegradation of pesticides, especially difenoconazole and pendimethalin. Furthermore, the metabolite desethyl-terbuthylazine was detected in L. edodes liquid culture medium, indicating terbuthylazine biodegradation by this fungus. The fungi strains investigated could prove to be valuable as active pesticide-degrading microorganisms, increasing the efficiency of biopurification systems containing

Preparation of the Lentinus edodes-based porous biomass carbon by hydrothermal method for capacitive desalination

Science.gov (United States)

Yan, Junbin; Zhang, Hexuan; Xie, Zhengzheng; Liu, Jianyun

2017-08-01

Biomass carbon materials were prepared by hydrothermal method using Lentinus edodes, followed by activation by ZnCl2 at high carbonization temperature. SEM and contact angle test show that ZnCl2 has a significant effect on the surface morphology and properties of porous carbon materials. Using the porous carbon as electrodes of the capacitor, the specific capacitance of the porous carbon material was found to be 247.6 F/g. The desalination amount of porous carbon material in capacitor cell was 12.9 mg/g, being the 1.9 times of that of the commercial activated carbon.

Oral administration of Lentinus edodes β-glucans ameliorates DSS-induced ulcerative colitis in mice via MAPK-Elk-1 and MAPK-PPARγ pathways.

Science.gov (United States)

Shi, Limin; Lin, Qinlu; Yang, Tao; Nie, Ying; Li, Xinhua; Liu, Bo; Shen, Junjun; Liang, Ying; Tang, Yiping; Luo, Feijun

2016-11-09

To evaluate the anti-inflammatory effect of β-glucans from Lentinus edodes, and its molecular mechanism, the dextran sulfate sodium salt (DSS) induced colitis model of mice and the LPS-stimulated RAW264.7 cell inflammation model were used in this study. 40 ICR male mice were randomly divided into 4 groups: Control, DSS (DSS treated only), DSS + low-βGs (500 mg kg -1 d -1 ) and DSS + high-βGs (1000 mg kg -1 d -1 ). The body weight of the mice with Lentinus edodes β-glucan supplementation increased significantly compared to the DSS group and the disease activity index (DAI) was improved in both βG-treated groups. Compared with the DSS group, histopathological analysis showed that the infiltration of inflammatory cells of both βG-treated groups decreased significantly in colonic tissues. Furthermore, oral administration of β-glucans decreases the concentration of malondialdehyde (MDA) and myeloperoxidase (MPO) and inhibits the expression of iNOS and several inflammatory factors: TNF-α, IL-1β and IL-6 as well as nitric oxide (NO) of the colonic tissues. The mitogen-activated protein kinase (MAPK) pathway is closely related to the expression of pro-inflammatory factors. In the DSS-induced colitis model and the LPS-stimulated RAW264.7 cell model, βGs inhibited the expression of pro-inflammatory factors and blocked the phosphorylation of JNK/ERK1/2 and p38; βGs also suppress the phosphorylation of Elk-1 at Ser84 and the phosphorylation of PPARγ at Ser112. Altogether, these results suggest that Lentinus edodes βGs could inhibit the DSS-induced ulcerative colitis and decrease inflammatory factor expressions. The molecular mechanism may be involved in suppressing MAPK signaling and inactivation of Elk-1 and activation of PPARγ.

Contents of folates in edible mushrooms commercialised in the city of Campinas, São Paulo, Brazil Teor de folatos em cogumelos comestíveis comercializados na cidade de Campinas, São Paulo, Brasil

Directory of Open Access Journals (Sweden)

Regina Prado Zanes Furlani

2007-06-01

Full Text Available In this study, folates were evaluated in the main species of mushroom cultivated in Brazil. The species analysed were Agaricus bisporus (button mushroom, Lentinula edodes (shiitake and Pleorotus ostreatus (shimeji. The five main forms of folate found in foods were determined: tetrahydrofolic acid (THFA, 10-methyl folic acid (10MFA, 5-methyl tetrahydrofolic acid (5MTHFA, 10-formyl folic acid (10FFA and 5-formy tetrahydrofolic acid (5FTHFA. The methodology employed used extraction with phosphate buffer, clean up with trichloroacetic acid and separation of the vitamins by high-performance liquid chromatography, with simultaneous ultraviolet and fluorescence detection. The results obtained for total folate were 551 to 1404 µg.100 g -1 for the button mushroom, 606 to 727 µg.100 g -1 for shiitake and 460 to 1325 µg.100 g-1 for shimeji. The data showed that mushrooms could be considered as sources of folates and that their contribution of these vitamins to the diet was meaningful.O teor de folatos nas principais espécies de cogumelos cultivados no Brasil foi avaliado neste trabalho. As espécies analisadas foram Agaricus bisporus (champignon de Paris, Lentinula edodes (shiitake e Pleorotus ostreatus (shimeji. Foram determinadas as cinco principais formas de folatos presentes em alimentos: tetrahidro ácido fólico (THAF, 10-metil ácido fólico (10MAF, 5-metil tetrahidro ácido fólico (5MTHAF, 10-formil ácido fólico (10FAF e 5formil tetrahidro ácido fólico (5FTHAF. A metodologia empregada utilizou extração com tampão fosfato, limpeza com ácido tricloroacético e separação das vitaminas por cromatografia líquida de alta eficiência, com detecção em série por fluorescência e ultravioleta. Os resultados obtidos para o total de folatos foram 551 a 1404 µg.100 g -1 para o champignon de Paris, 606 a 727 µg.100 g -1 para o shiitake e 460 a 1325 µg.100 g -1 para o shimeji. Os dados mostram que os cogumelos podem ser considerados fontes

Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

Science.gov (United States)

Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

2004-01-01

We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

Antioxidant activities of polysaccharides from Lentinus edodes and their significance for disease prevention.

Science.gov (United States)

Chen, Huoliang; Ju, Ying; Li, Junjie; Yu, Min

2012-01-01

The crude polysaccharide (LEP) was extracted by hot water from the fruiting bodies of Lentinus edodes, and further purified by DEAE-cellulose and Sepharose CL-6B chromatography, giving three polysaccharide fractions coded as LEPA1, LEPB1 and LEPC1. In this study, their chemical and physical characteristics of polysaccharide fractions and antioxidant capacities, including scavenging activity against hydroxyl radicals, superoxide radicals and Fe(2+)-chelating ability, were valuated. The results showed that LEPC1 exhibited significantly antioxidant activity at a concentration-dependent manner. Therefore these results indicated that the water-extractable polysaccharide fraction was a potent antioxidant and could be developed to be new health medicine for fighting against various human diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

Science.gov (United States)

Steffen, K T; Hofrichter, M; Hatakka, A

2000-12-01

Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

Science.gov (United States)

Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

2008-07-01

The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

Directory of Open Access Journals (Sweden)

FELIPE B. VALER

2016-01-01

Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

Science.gov (United States)

Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

2004-01-01

Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

Biodegradation of softwood lignin and guaiacylglycerol-beta-guiacyl ether by extracellular enzyme in shiitake Lentinus edodes (Berk) Sing

Energy Technology Data Exchange (ETDEWEB)

Oki, T.; Senba, Y.; Ishikawa, H.

1982-01-01

In order to explain the biodegradation of softwood lignin by shiitake (Lentinus edodes Berk. Sing.), akamatsu (Pinus densiflora Sekb. and Zucc.) dioxane lignin (NDL) and guaicylglycerol-beta-guaiacyl ether (I) were degraded by extracellular enzyme from the NDL-contained potato and malt extracts cultures of shiitake TMI-563 and 655 at 25 degrees C for a prolonged period. The main results on the basis of a functional group analysis and gel-filtration of NDL before and after the enzymatic degradation showed that the degraded DL had a higher content of phenolic OH groups than sound lignin, whereas the methoxyl or aromatic aldehyde-yielding group content was lower in the degraded lignin. The main degradation products formed from I in a crude enzyme solution were guaiacol, guaiacylglycerol, guaiacylglycol-beta-guaiacyl ether (II), and guaiacoxyacetoguaiacone (III), although the polymer was formed at pH 4.0, which is the optimum pH of peroxidase and laccase. It also was clarified that the oxidative polymerization of NDL and I occurred preferably in a crude enzyme solution at pH 4.0, and that these compounds were degraded to lower molecular fragments at pH 6.8 under the same conditions. From the above results, it is suggested that softwood lignin is more effectively degraded by the other enzyme than polyphenoloxidase, such as laccase and peroxidase, in a crude enzyme solution of L. edodes. (Refs. 9).

ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

Directory of Open Access Journals (Sweden)

N. P.

2016-02-01

Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

Science.gov (United States)

Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

2010-04-09

We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

International Nuclear Information System (INIS)

Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

2010-01-01

We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

Optimization of the Production of Extracellular Polysaccharide from the Shiitake Medicinal Mushroom Lentinus edodes (Agaricomycetes) Using Mutation and a Genetic Algorithm-Coupled Artificial Neural Network (GA-ANN).

Science.gov (United States)

Adeeyo, Adeyemi Ojutalayo; Lateef, Agbaje; Gueguim-Kana, Evariste Bosco

2016-01-01

Exopolysaccharide (EPS) production by a strain of Lentinus edodes was studied via the effects of treatments with ultraviolet (UV) irradiation and acridine orange. Furthermore, optimization of EPS production was studied using a genetic algorithm coupled with an artificial neural network in submerged fermentation. Exposure to irradiation and acridine orange resulted in improved EPS production (2.783 and 5.548 g/L, respectively) when compared with the wild strain (1.044 g/L), whereas optimization led to improved productivity (23.21 g/L). The EPS produced by various strains also demonstrated good DPPH scavenging activities of 45.40-88.90%, and also inhibited the growth of Escherichia coli and Klebsiella pneumoniae. This study shows that multistep optimization schemes involving physical-chemical mutation and media optimization can be an attractive strategy for improving the yield of bioactives from medicinal mushrooms. To the best of our knowledge, this report presents the first reference of a multistep approach to optimizing EPS production in L. edodes.

Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

Science.gov (United States)

Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

2015-10-01

In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

2014-03-14

Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

Forest farming of shiitake mushrooms: an integrated evaluation of management practices.

Science.gov (United States)

Bruhn, J N; Mihail, J D; Pickens, J B

2009-12-01

Two outdoor shiitake (Lentinula edodes) cultivation experiments, established in Missouri USA in 1999 and 2000, produced mushrooms in 2000-2005. We examined shiitake production in response to substrate species, inoculum form, inoculum strain, and inoculation timing, using total mushroom weight per log as the primary response variable with log characteristics as covariates. The significantly greater mushroom weight produced by sugar maple logs compared with white or northern red oak was attributable to the higher proportion of undiscolored wood volume in the maple logs, rather than to bark thickness or log diameter. The "wide temperature range" shiitake strain produced significantly greater yield compared with the "warm" or "cold" weather strains. Both the wide-range and warm-weather strains were stimulated to fruit by significant rain events, while the cold-weather strain was responsive to temperature. Inoculation with sawdust spawn gave significantly greater yield than colonized wooden dowels or pre-packaged "thimble" plug inoculum. The second and third full years following inoculation were the most productive.

Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

International Nuclear Information System (INIS)

Takimoto, K.

1980-01-01

The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

Evaluation of shiitake (Lentinula edodes) strains of the culture collection of Applied Plant Research

NARCIS (Netherlands)

Sonnenberg, A.S.M.; Amsing, J.G.M.

2005-01-01

Applied Plant Research (PPO), Mushroom Research Unit, has a unique collection of fungi that is used for research in edible mushrooms. The collection contains approximately 6600 strains representing more than 100 species. Most of the species are represented by Agaicus bisporus (button mushroom) and

Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

Czech Academy of Sciences Publication Activity Database

Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

2010-01-01

Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

Science.gov (United States)

Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

2012-01-01

Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

Science.gov (United States)

Degenkolb, Thomas; Vilcinskas, Andreas

2016-05-01

In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

A polysaccharide isolated from the liquid culture of Lentinus edodes (shiitake) mushroom mycelia containing black rice bran protects mice against Salmonellosis through up-regulation of the Th1 immune reaction

Science.gov (United States)

The present study investigated the antibacterial effect of a bioprocessed polysaccharide (BPP) isolated from Lentinus edodes liquid mycelial culture supplemented with black rice bran against murine salmonellosis. BPP was not bactericidal in vitro, but did, however stimulate uptake of the bacteria i...

Structure, chain conformation and antitumor activity of a novel polysaccharide from Lentinus edodes.

Science.gov (United States)

Yu, Zhang; Ming, Gu; Kaiping, Wang; Zhixiang, Chen; Liquan, Dai; Jingyu, Liu; Fang, Zeng

2010-12-01

A water-soluble polysaccharide LT1 was isolated from the basidiocarps of Lentinus edodes by hot water extraction and ethanol precipitations, further purified by gel chromatography. The Mw of LT1 was estimated to be 642 kDa by using HPGPC. Chemical and spectroscopic studies illustrated that LT1 has a backbone chain composed of 1 → 4-linked and 1 → 3-linked glucopyranosyl residues and has branches of single glucosyl stubs at C-6 of β-(1 → 4)-linked glucopyranosyl. AFM and Congo-red test revealed that LT1 existed as triple helix chain in 0.10 M NaOH solution or distilled water. Our studies showed that LT1 presented significant antitumor bioactivities on Sarcoma180 solid tumor cell implanted in BALB/c mice, which implies that LT1 could be potentially applied as a natural antitumor drug. Copyright © 2010 Elsevier B.V. All rights reserved.

SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

Directory of Open Access Journals (Sweden)

A. K. Veligodska

2015-11-01

Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

Kajian pendahuluan uji toksisitas ekstrak air miselia dan tubuh buah jamur shitake (Lentinus edodes) dengan metode brine shrimp lethality test (BTS)

OpenAIRE

Noor Erma NS; Tri Sundari; Arie Ika Susanty; Dwi Riani Octavia Palupi; Isnaeni Isnaeni; Sukardiman Sukardiman

2012-01-01

Shiitake mushroom (Lentinus edodes) is one of the wood mushroom types that can be consumed as a food as well as for a medicalpurpose. Lentinan, a polysaccharide contained in shiitake, is well known for its use on cancer medication. Mycelium of Shiitake mushroomcontains lentinan the same as other part of the mushroom like fruity body. Toxicity of the lentinan in mycelium compare to the fruitybody has been first conducted by using Brine Shrimp Lethality Test (BST). Using Potato Dextrose Broth m...

BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

Directory of Open Access Journals (Sweden)

Tiberius BALAEŞ

2015-12-01

Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

UTILIZATION OF AREN (Arenga pinnata Merr. SAWMILLING WASTE FOR EDIBLE MUSHROOM CULTIVATION MEDIA

Directory of Open Access Journals (Sweden)

Djarwanto

2016-04-01

Full Text Available Aren (Arenga pinnata Merr. is a multipurpose tree that can be utilized for palm sugar, alcoholic drinks, beverages and construction wood. The use of aren sawdust has not been studied intensively. This study examines the utilization of aren sawdust as cultivation media for edible mushrooms. Aren sawdust was mixed with rice bran, CaCO3, gypsum, fertilizers and distilled water before sterilization in 30 minutes pressurized autoclave at 1210C and 1.5atm. The mixed media was inoculated with pure cultures containing four mushrooms species (Pleurotus flabellatus, P. ostreatus, P. sajor-caju and Lentinula edodes and incubated for five weeks to allow mycelium growth producing fruit bodies. The fruit bodies were harvested everyday within four months and examined for its gained mushroom-weight and biological conversion efficiency/BE. The core part of aren trunk was cut into smaller pieces of 10 cm (width by 5 cm (thickness, by 120 cm (length. Each core sample was bored from the surface inward, creating holes with a particular distance apart. Each hole was inoculated with pure cultures containing 6 mushroom species (four species above, P. cystidiosus and Auricularia polytricha. The inoculated samples were slanted on bamboo support, and placed in a bamboo hut. Harvesting was carried out everyday after the fruiting body became mature and examined for its gained mushroom weight. Results show that the use of sawdust supplemented with nutritious material is more likely to improve the mushroom yield than that of aren sawn-timber core. In this case, the BE values with aren-sawdust media were 21.97-89.45% (P. flabellatus, 15.36-105.36% (P. ostreatus, 63.88-76.86% (P. sajor-caju, and up to 62.88% (L. edodes. Meanwhile, the yields (gained mushroom weight with aren sawn-timber media were 210g (P. ostreatus, 368g (P. flabellatus, 331g (P. sajor-caju and 48g (A. polytricha; however, P. cystidiosus and L. edodes inoculated on aren stem core failed to grow.

A Bioprocessed Polysaccharide from Lentinus edodes Mycelia Cultures with Turmeric Protects Chicks from a Lethal Challenge of Salmonella Gallinarum.

Science.gov (United States)

Han, Dalmuri; Lee, Hyung Tae; Lee, June Bong; Kim, Yongbaek; Lee, Sang Jong; Yoon, Jang Won

2017-02-01

Our previous studies demonstrated that a bioprocessed polysaccharide (BPP) isolated from Lentinus edodes mushroom mycelia cultures supplemented with black rice bran can protect mice against Salmonella lipopolysaccharide-induced endotoxemia and reduce the mortality from Salmonella Typhimurium infection through upregulated T-helper 1 immunity. Here, we report that a BPP from L. edodes mushroom mycelia liquid cultures supplemented with turmeric (referred to as BPP-turmeric) alters chicken macrophage responses against avian-adapted Salmonella Gallinarum and protects chicks against a lethal challenge from Salmonella Gallinarum. In vitro analyses revealed that the water extract of BPP-turmeric (i) changed the protein expression or secretion profile of Salmonella Gallinarum, although it was not bactericidal, (ii) reduced the phagocytic activity of the chicken-derived macrophage cell line HD-11 when infected with Salmonella Gallinarum, and (iii) significantly activated the transcription expression of interleukin (IL)-1β, IL-10, tumor necrosis factor α, and inducible nitric oxide synthase in response to various Salmonella infections, whereas it repressed that of IL-4, IL-6, interferon-β, and interferon-γ. We also found that BPP-turmeric (0.1 g/kg of feed) as a feed additive provided significant protection to 1-day-old chicks infected with a lethal dose of Salmonella Gallinarum. Collectively, these results imply that BPP-turmeric contains biologically active component(s) that protect chicks against Salmonella Gallinarum infection, possibly by regulating macrophage immune responses. Further studies are needed to evaluate the potential efficacy of BPP-turmeric as a livestock feed additive for the preharvest control of fowl typhoid or foodborne salmonellosis.

Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

Czech Academy of Sciences Publication Activity Database

Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

2012-01-01

Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

Science.gov (United States)

Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

2006-12-14

DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

Directory of Open Access Journals (Sweden)

Andrej Liner

2013-01-01

Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

Directory of Open Access Journals (Sweden)

Marcin Piątek

2014-08-01

Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

DNA quantification of basidiomycetous fungi during storage of logging residues

Directory of Open Access Journals (Sweden)

Isabella Børja

2015-04-01

Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

Effects of irradiation and drying on volatile components of fresh shiitake (Lentinus edodes Sing)

International Nuclear Information System (INIS)

Yang, Ming-Sheng; Chyau, Charng-Cherng; Horng, Deng-Tsen; Yang, Jui-Sen

1998-01-01

Fresh shiitake (Lentinus edodes Sing) was irradiated with doses of 0.5, 1 and 2 kGy using 60 Co. Effects of γ-irradiation and drying on the volatile composition of shiitake were studied by gas chromatography (GC) and GC-mass spectrometry. Irradiation above 1.0 kGy could inhibit the growth and mould decay of fresh shiitakes after harvesting. Irradiation with 2 kGy increased the eight-carbon volatile components of fresh shiitake. Treatment at 1 kGy irradiation of fresh shiitake produced some new volatile compounds in the dry product, such as methylethyl disulphide, sulphinylbis methane, methyl(methylthio)ethyl disulphide and N-(3-methylbutyl) acetamide. The eight-carbon compounds mostly disappeared after drying. The amount of sulphur-containing volatile compounds in dried shiitake became lower during irradiation. Irradiation with doses of 1 or 2 kGy of fresh shiitake did not increase the volatile content of shiitake after drying

Improved Extraction and Quality Characterization of Water-Soluble Polysaccharide from Gamma-Irradiated Lentinus edodes.

Science.gov (United States)

Akram, Kashif; Shahbaz, Hafiz Muhammad; Kim, Gui-Ran; Farooq, Umar; Kwon, Joong-Ho

2017-02-01

Gamma irradiation was applied to the improved extraction of water-soluble polysaccharides (WSPs) from dried Lentinus edodes. Irradiation provided a dose-dependent increase in extraction yield (0 kGy, 2.01%; 7.5 kGy, 4.03%; 15 kGy, 7.17%) and purity (0 kGy, 78.8%; 7.5 kGy, 83.1%; 15 kGy, 85.6%) of the WSPs from hot-water extraction. The effect of irradiation was evident in the degraded microstructures and reduced molecular weights of the WSPs. However, nuclear magnetic resonance, Fourier-transform infrared, and X-ray diffraction spectroscopic analyses provided comparable structures of WSPs from nonirradiated and irradiated samples. UV-visible spectra showed a dose-dependent decline in intensity, but an improvement in thermal properties of the WSPs from the irradiated mushroom samples was observed. © 2017 Institute of Food Technologists®.

Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

Science.gov (United States)

Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

2014-05-10

Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

A comparison study between different molecular weight polysaccharides derived from Lentinus edodes and their antioxidant activities in vivo.

Science.gov (United States)

You, Ruxu; Wang, Kaiping; Liu, Jinyu; Liu, Maochang; Luo, Li; Zhang, Yu

2011-12-01

Polysaccharide purified Lentinus edodes (Berk.) Sing (Tricholomataceae) has been reported to attenuate oxidative stress in vitro. This study investigated whether polysaccharides from L. edodes with different molecular weight have protective effects against oxidative stress induced by D-galactose (D-gal) in vivo, and determined the specific relationship between molecular weight and antioxidant activity. In the present study, we successfully obtained three purified polysaccharides, coded as LT1, LT2, and LT3, and their molecular weights were 25.5, 306.2, and 605.4 kDa, respectively. The D-gal-treated mice received three polysaccharides once daily for 60 days. The activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px), the content of malondialdehyde (MDA), and erythrocyte membrane fluidity were measured to evaluate the changes of the antioxidant ability. It was demonstrated that the administration of LT1, LT2, and LT3 could improve the antioxidant status to different levels. Furthermore, LT2 exhibited the highest antioxidant ability among these samples in vivo. Indeed, LT2 significantly decreased the content of MDA in liver (15.91 ± 0.31 versus 23.79 ± 1.18 nmol/mg protein for the model group, p < 0.05), enhanced the fluidity of erythrocyte membrane (2.458 ± 0.023 versus 2.167 ± 0.024 for the model group, p < 0.05), and increased the activities of SOD (147.19 ± 4.90 versus 82.26 ± 5.55 units/mg protein for the model group, p < 0.05) and GSH-Px (310.91 ± 6.24 versus 243.64 ± 6.77 units/mg protein for the model group, p < 0.05) in liver. The LT2 had a potential to be used as a novel natural antioxidant.

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Science.gov (United States)

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

Phenotypic variation and characterization of mutant matting in shiitake

International Nuclear Information System (INIS)

Ibrahim Mahmood; Azhar Mohamad

2016-01-01

Shiitake (Lentinula edodes) is an edible mushroom that has many uses such as: pharmaceutical, nutraceutical and cosmeceutical industries. In this study, we will induce Shiitake to create the genetic variation via exposing the spores of shiitake to gamma (γ) ray at different doses (0-700 Gy) then make the matting between two different monokaryon mycelium (MM). potato dextrose agar (PDA), this media will be used for spore germination and monokaryon mycelium subculturing during this study. The compatibility of the matting will be observed macroscopically (observing on the plates of PDA) and microscopically (by observing the clamps test under the microscope (Olympus brand)). The finding of this study, there is no significant changing in the growth performance of irradiated monokaryon mycelium in comparing with non-irradiated mycelium. From 108 matting only 15 were compatibles. This study, the physical mutagen will be used followed by mating as a normal stage of life cycle for creating potential strain of shiitake with alteration in phenotypic characterization of dikaryon mycelium (DM) as a compatible mating for two MM. (author)

Antimicrobial activity and mineral composition of shiitake mushrooms cultivated on agricultural waste

Directory of Open Access Journals (Sweden)

Kérley Braga Pereira Bento Casaril

2011-10-01

Full Text Available The antimicrobial activity and mineral composition of shiitake mushrooms were evaluated in four isolates of Lentinula edodes. Mushrooms were cultivated on artificial logs, based on eucalyptus sawdust enriched with 20% rice, wheat, or soybean bran, or combination of 10% of two of these supplements. The substrates were humidified with a 0.1% mate tea extract or water. Logs of Eucalyptus grandis were also used to cultivate the shiitake mushrooms. The antimicrobial activity of an aqueous extract, corresponding to 40 mg of mushroom dry matter, was in some cases, depending on the isolate, able to inhibit both Bacillus subtilis and Escherichia coli K-12, independent of substrate composition or the growth stage of the mushrooms. Nitrogen, phosphorus, potassium, magnesium and calcium concentrations varied according to the substrate on which the mushrooms were cultivated, being, generally, higher with cultivation on artificial rather than natural eucalyptus logs. It could be concluded that, in addition to the fungal isolate, substrate composition and, processing methods must be considered during the production of antimicrobial substance(s as well as in the mushroom nutritional composition.

A comparison of dried shiitake mushroom in log cultivation and mycelial cultivation from different geographical origins using stable carbon and nitrogen isotope analysis

International Nuclear Information System (INIS)

Suzuki, Yaeko; Nakashita, Rumiko; Ishikawa, Noemia Kazue; Tabuchi, Akiko; Sakuno, Emi; Tokimoto, Keisuke

2015-01-01

We determined carbon and nitrogen isotopic compositions (δ 13 C and δ 15 N) of dried shiitake mushroom (Lentinula edodes) samples from Japan, China, South Korea and Brazil in order to discriminate their geographical origins. In log cultivation, the δ 13 C values of Japanese dried shiitake samples were lower than those of Chinese samples, depending on the δ 13 C values of log and their growth conditions. In mycelial cultivation, the δ 13 C and δ 15 N values of Japanese dried shiitake samples were higher than those of Chinese samples. By using the δ 13 C and δ 15 N values, 87.4% of Japanese dried shiitake samples (n = 95) and 87.9% of Chinese dried shiitake samples (n = 66) in log cultivation, 90.0% of the Japanese dried shiitake samples (n = 50) and 93.9% of Chinese dried shiitake samples (n = 114) in mycelial cultivation, were correctly classified according to the production site. These results suggested that the δ 13 C and δ 15 N values will be potentially useful for tracing their geographical origin of dried shiitake samples. (author)

Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments

Directory of Open Access Journals (Sweden)

S.M. Badalyan

2004-04-01

Full Text Available Seventeen wood-decaying mushroom species (Coriolus versicolor, Flammulina velutipes, Ganoderma sp., Hypholoma fasciculare, H. sublateritium, Kühneromyces mutabilis, Lentinula edodes, Lentinus tigrinus, Pholiota alnicola, Ph. aurivella, Ph. destruens, Pleurotus cornucopiae, Pl. ostreatus, Polyporus subarcularius, Po. squamosus, Po. varius and Schizophyllum commune were paired with three Trichoderma species (T. harzianum, T. pseudokoningii, and T. viride and Clonostachys rosea in dual-culture experiments on an agar-based medium. Xylotrophic mushrooms and mycoparasitic fungi in general showed similar competitive ability; deadlock, or mutual inhibition after mycelial contact, was observed in 45.6% of pairings, while stable inhibition at a distance occurred in 4.4% of pairings. Replacement, or overgrowth of xylotrophic mushroom by a mycoparasitic fungus was observed in 29.4% of pairings; the opposite, overgrowth of the xylotrophic mushroom on the mycoparasitic fungus in 20.6%. of pairings. Of the xylotrophic mushrooms, Pl. ostreatus, Ganoderma sp., F. velutipes and H. fasciculare, showed the highest competitive ability against mycoparasitic fungi. Of the mycoparasitic fungi, T. harzianum showed the strongest competitive activity against xylotrophic mushrooms.

Polysaccharide from Lentinus edodes inhibits the immunosuppressive function of myeloid-derived suppressor cells.

Directory of Open Access Journals (Sweden)

Hao Wu

Full Text Available Reversing the function of immune suppressor cells may improve the efficacy of cancer therapy. Here, we have isolated a novel polysaccharide MPSSS (577.2 Kd from Lentinus edodes and examined its effects on differentiation and function of myeloid-derived suppressor cells (MDSCs. MPSSS is composed of glucose (75.0%, galactose (11.7%, mannose (7.8%, and xylose (0.4%. In vivo, it inhibits the growth of McgR32 tumor cells, which is correlated with a reduced percentage of MDSCs in peripheral blood. In vitro, it induces both morphological and biophysical changes in MDSCs. Importantly, MPSSS up-regulates MHC II and F4/80 expression on MDSCs, and reverses their inhibition effect on CD4(+ T cells in a dose-dependent manner. The mechanism study shows that MPSSS may stimulate MDSCs through a MyD88 dependent NF-κB signaling pathway. Together, we demonstrated for the first time that MPSSS stimulates the differentiation of MDSCs and reverses its immunosuppressive functions, shedding new light on developing novel anti-cancer strategies by targeting MDSCs.

ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

Directory of Open Access Journals (Sweden)

А. Бухало

2011-02-01

Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

Science.gov (United States)

Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

2014-01-01

Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

Science.gov (United States)

Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

2014-01-01

Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

Directory of Open Access Journals (Sweden)

Daniil N. Olennikov

2014-03-01

Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

Science.gov (United States)

Laich, Federico; Vaca, Inmaculada; Chávez, Renato

2013-10-01

During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

Potencial do flavedo (epicarpo de Citrus aurantifolia cv. Tahiti no controle do bolor verde e da antracnose em citros

Directory of Open Access Journals (Sweden)

Leonardo Toffano

2012-03-01

Full Text Available O Brasil é considerado o maior produtor de citros e o maior exportador de suco de laranja. Doenças de pós-colheita representam uma grande perda para a citricultura, sendo que para a exportação de frutos são rígidas as exigências com relação a isenção de resíduos químicos nos mesmos. Patógenos de importância em pós-colheita de citros incluem o Penicillium digitatum, agente causal do bolor-verde e o Colletotrichum gloeosporioides, agente causal da antracnose. Dada a importância econômica que representam estas doenças dos frutos cítricos, tanto em termos de comprometimento da qualidade e dificuldade de controle, a busca de alternativas adicionais que possam viabilizar a capacidade produtiva e garantir a obtenção de frutos com excelentes padrões de qualidade torna-se imprescindível. Portanto, estudou-se os efeitos dos extratos aquosos do flavedo de Citrus aurantifolia var. Tahiti, Lentinula edodes, Agaricus subrufescens (syn. Agaricus brasiliensis, albedo de Citrus sinensis var. Valência e do ácido jasmônico no controle póscolheita do bolor verde e da antracnose e na indução de resistência em frutos de laranjeira Valência (Citrus sinensis. Foi possível observar que o extrato aquoso do flavedo (C. aurantifolia apresentou efeito inibitório sobre os patógenos, quando tratados em pós-colheita, em função da redução dos sintomas e esporulação. Porém, os extratos de albedo (C. sinensis, L. edodes, A. subrufescens e o ácido jasmônico não apresentaram efeitos sobre P. digitatum e C. gloeosporioides.

Extraction, purification and anti-proliferative activities of polysaccharides from Lentinus edodes.

Science.gov (United States)

Zhao, Yong-Ming; Wang, Jin; Wu, Zhi-Gang; Yang, Jian-Ming; Li, Wei; Shen, Li-Xia

2016-12-01

In this study, the enzyme-assisted extraction of polysaccharides from Lentinus edodes (LEPs) was optimized by response surface methodology, and a preliminary characterization of the extracted LEPs and their anti-proliferative activities were investigated. An orthogonal assay was constructed to determine the optimal amounts of cellulase, papain and pectinase, which were 15, 20 and 15g/kg, respectively. Then effects of extraction conditions were evaluated and optimized using a Box-Behnken design. The results showed that the highest polysaccharides yield of 15.65% was achieved with an extraction temperature of 54°C, pH 5.0, enzymatic treatment time of 93min and a liquid/material ratio of 29:1mL/g, which correlated well with the predicted yield of 15.58%. Subsequently, the crude LEPs were further purified by DEAE-cellulose and Sephadex-100 chromatography to obtain two fractions, which were designated as LEP-1 and LEP-2 and their monosaccharide compositions were characterized by GC. Fourier-transform infrared spectra demonstrated that LEP-1 and LEP-2 were distinct from each other regarding their chemical structures. In addition, the LEPs exhibited inhibition of cell proliferation on HCT-116 and HeLa cells in vitro. In summary, this study provides an efficient enzyme-assisted extraction for LEPs, which can be used as natural antitumor agents in the pharmaceutical and functional food industries. Copyright © 2016 Elsevier B.V. All rights reserved.

Macro and trace elements in edible mushrooms, Shiitake, Shimeji and Cardoncello from Petrópolis, Rio de Janeiro, Brazil

Directory of Open Access Journals (Sweden)

Jaylei Monteiro Gonçalves

2014-05-01

Full Text Available The concentrations of twenty-five elements (Al, As, Ba, Bi, Ca, Cd, Cr, Cu, Fe, Ga, K, Li, Mg, Mn, Mo, Na, Ni, Pb, Rb , Sb, Se, Sn, Sr, V and Zn were determined in three edible mushrooms, Shiitake (Lentinula edodes, Black Shimeji (Pleurotus ostreatusi and Cardoncello (Pleurotus eryngyii from Petrópolis, Rio de Janeiro, Brazil. Samples were collected along the year 2010 and their preparations were made after drying, milling, an acid pre-digestion and a decomposition procedure in a muffle furnace. The analytical techniques employed for the elements determination were Mass Spectrometry with Inductively Coupled Plasma and Flame Atomic Absorption Spectrometry. Two certified reference materials, Apple Leaves and Mussel Tissue, were used for the evaluation of the analytical procedure and recovery values around 98% were obtained. The results showed that the analyzed mushrooms have high levels of Cu, Fe, K, Mg, Mn and Zn containing more than 30% the recommended daily intake for these nutrients according to Brazilian legislation. These mushrooms presented a very low ratio Na/K. Regarding the levels of some contaminants, the mushrooms had concentrations of Cd, Pb and As below the recommended maximum limits allowed by Brazilian legislation.

Water Extract from Spent Mushroom Substrate of Hericium erinaceus Suppresses Bacterial Wilt Disease of Tomato

Science.gov (United States)

Kwak, A Min; Min, Kyeong Jin; Lee, Sang Yeop

2015-01-01

Culture filtrates of six different edible mushroom species were screened for antimicrobial activity against tomato wilt bacteria Ralstonia solanacearum B3. Hericium erinaceus, Lentinula edodes (Sanjo 701), Grifola frondosa, and Hypsizygus marmoreus showed antibacterial activity against the bacteria. Water, n-butanol, and ethyl acetate extracts of spent mushroom substrate (SMS) of H. erinaceus exhibited high antibacterial activity against different phytopathogenic bacteria: Pectobacterium carotovorum subsp. carotovorum, Agrobacterium tumefaciens, R. solanacearum, Xanthomonas oryzae pv. oryzae, X. campestris pv. campestris, X. axonopodis pv. vesicatoria, X. axonopodis pv. citiri, and X. axonopodis pv. glycine. Quantitative real-time PCR revealed that water extracts of SMS (WESMS) of H. erinaceus induced expressions of plant defense genes encoding β-1,3-glucanase (GluA) and pathogenesis-related protein-1a (PR-1a), associated with systemic acquired resistance. Furthermore, WESMS also suppressed tomato wilt disease caused by R. solanacearum by 85% in seedlings and promoted growth (height, leaf number, and fresh weight of the root and shoot) of tomato plants. These findings suggest the WESMS of H. erinaceus has the potential to suppress bacterial wilt disease of tomato through multiple effects including antibacterial activity, plant growth promotion, and defense gene induction. PMID:26539048

On the reaction of some bacteria and fungi on coal tar creosote. Zur Verhalten einiger Bakterien und Pilze gegenueber Steinkohlenteeroel

Energy Technology Data Exchange (ETDEWEB)

Schmidt, O.; Dittberner, D.; Faix, O. (Universitaet Hamburg, Hamburg (Germany). Ordinariat fuer Holzbiologie)

1991-01-01

To contribute to the waste management of wood preservatives, the biodegradability of coal tar creosote by bacteria and fungi has been investigated. Microorganisms comprised 24 bacterial strains and 31 fungi from different systematic and ecological groups as well as isolates from contaminated soils. Based on countings of viable cells, the experiments with various nutrient media, methods of cultivation, preservative concentrations, and organic solvents yielded some bacteria which could grow in the presence of creosote: {ital Aeromonas hydrophila}, {ital Flavobacterium} sp., {ital Pseudomonas arvilla}, {ital P. fluorescens}, and {ital P. putida}. The white-rot fungi {ital Bjerkandera adusta}, {ital Heterobasidion annosum}, {ital Hirschioporus abietinus}, {ital Lentinula edodes}, {ital Peniophora gigantea}, {ital Pleurotus ostreatus}, {ital Schizophyllum commune}, and {ital Trametes versicolor}, the brown-rot fungus {ital Lentinus lepideus}, the staining fungi {ital Ceratocystis piceae} and {ital Stereum sanguinolentum}, and the moulds {ital Paecilomyces variotii} and {ital Trichoderma viride} also grew with creosote. To prepare samples for IR-measurements, continuous extraction of creosote from the nutrient liquid by percolation with methylene chloride was suitable. However, the IR-spectra of creosote did not show any measurable changes after incubation with 16 bacterial strains and 6 fungi. 42 refs., 2 figs., 4 tabs.

Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

Directory of Open Access Journals (Sweden)

Aza Kobakhidze

2016-09-01

Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

Directory of Open Access Journals (Sweden)

Sônia C. Melo

2015-06-01

Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

Directory of Open Access Journals (Sweden)

R.L. Arakaki

2013-12-01

Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

Science.gov (United States)

Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

2013-12-01

Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

A Lentinus edodes polysaccharide induces mitochondrial-mediated apoptosis in human cervical carcinoma HeLa cells.

Science.gov (United States)

Ya, Guowei

2017-10-01

In this study, a homogeneous polysaccharide (LEP1) with an average molecular weight of 53kDa was successfully purified from the fruiting bodies of Lentinus edodes and its anticancer efficacy on human cervical carcinoma HeLa cells in vitro and associated possible molecular mechanism were also evaluated. MTT assay showed that LEP1 exhibited a dose-dependent inhibitory effect on the proliferation of HeLa cells and caused apoptotic death. Our present findings provided the first evidence that LEP1 induced the apoptosis of HeLa cells via a mitochondria dependent pathway, as indicated by an increase in Bax/Bcl-2 ratio, a loss of mitochondrial membrane potential (Δym), the release of cytochrome c from the mitochondria to the cytosol, activation of caspase-9 and caspase-3, and cleavage of poly (ADP-ribose) polymerase (PARP) in HeLa cells. These combined results unequivocally indicated that the involvement of mitochondria-mediated signaling pathway in LEP1-induced apoptosis and strongly provided experimental evidence for the use of LEP1 as a potential therapeutic agent in the prevention and treatment of human cervical carcinoma. Copyright © 2017 Elsevier B.V. All rights reserved.

Kajian pendahuluan uji toksisitas ekstrak air miselia dan tubuh buah jamur shitake (Lentinus edodes dengan metode brine shrimp lethality test (BTS

Directory of Open Access Journals (Sweden)

Noor Erma NS

2012-02-01

Full Text Available Shiitake mushroom (Lentinus edodes is one of the wood mushroom types that can be consumed as a food as well as for a medicalpurpose. Lentinan, a polysaccharide contained in shiitake, is well known for its use on cancer medication. Mycelium of Shiitake mushroomcontains lentinan the same as other part of the mushroom like fruity body. Toxicity of the lentinan in mycelium compare to the fruitybody has been first conducted by using Brine Shrimp Lethality Test (BST. Using Potato Dextrose Broth media with the growth rate of3.88% did mycelium multiplications. Probit analysis showed that the toxicity of the mushroom’s cap, stem, and mycelium of Shiitakemushrooms is LC50 = 648.76507 mg/ml LC50 = 489.39444 mg/ml, and LC50 = 481.16941 mg/ml respectively.

Uso de residuos lignocelulósicos para optimizar la producción de inóculo y la formación de carpóforos del hongo comestible Lentinula boryana

OpenAIRE

Gaitán-Hernández, Rigoberto; Salmones, Dulce

2015-01-01

Se evaluaron diferentes residuos lignocelulósicos para la producción de inóculo y carpóforos de Lentinula boryana. El crecimiento micelial y biomasa asociada a la actividad metabólica (AM) se estimaron a los 12 y 19 d de incubación, con 12 cepas en tres tipos de inóculo: fórmula 1 (F1), fórmula 2 (F2) y fórmula 3 (F3). El diámetro del micelio en caja Petri a los 12 y 19 d fue mayor en F1, con 61.9 a 74.8 mm y de 71.8 a 90 mm, respectivamente. La mayor AM a los 12 d de incubación se presentó e...

Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

Energy Technology Data Exchange (ETDEWEB)

Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

1995-12-01

It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

Ultrasound assisted extraction of polysaccharides from Lentinus edodes and its anti-hepatitis B activity in vitro.

Science.gov (United States)

Zhao, Yong-Ming; Yang, Jian-Ming; Liu, Ying-Hui; Zhao, Ming; Wang, Jin

2018-02-01

The aim of this study was to optimize the extraction process of polysaccharides from the fruiting bodies of Lentinus edodes and investigate its anti-hepatitis B virus activity. The extracting parameters including ultrasonic power (240-320W), extraction temperature (40-60°C) and extraction time (15-25min) was optimized by using three-variable-three-level Box-Behnken design based on the single-factor experiments. Data analysis results showed that the optimal conditions for extracting LEPs were an extraction temperature of 45°C, extraction time of 21min and ultrasonic power of 290W. Under these optimal conditions, the experimental yield of LEPs was 9.75%, a 1.62-fold increase compared with conventional heat water extraction (HWE). In addition, crude polysaccharides were purified to obtain two fractions (LEP-1 and LEP-2). Chemical analysis showed that these components were rich in glucose, arabinose and mannose. Furthermore, HepG2.2.15 cells were used as in vitro models to evaluate their anti-hepatitis B virus (HBV) activity. The results suggest that LEPs possesses potent anti-HBV activity in vitro. Copyright © 2017 Elsevier B.V. All rights reserved.

Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

Science.gov (United States)

Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

2018-01-01

Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

Directory of Open Access Journals (Sweden)

Veligodska A. K.

2015-12-01

Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

Modification of growth conditions by mm-waves of wood-decaying mushrooms cultures

International Nuclear Information System (INIS)

Avagyan, I.A.

2016-01-01

Basidial macromycetes are not only value food, but can be used as source of such biological active compounds as the genistein, β -glucans, glioxal-oxidase et al. In this work we used different frequencies of extremely high frequency of electromagnetic irradiation (EHF EMI) with the aim of obtaining mushroom cultures with increased fermentative activity by the modulation of its growth conditions during growth on the peptone media. We investigated the influence of the non-thermal extremely high frequency electromagnetic waves in the interval of 45-53 GHz on β-glucosidase activities of two species of wood-decaying mushroom. In this study we examined the most popular edible wood-decaying mushroom Pleurotus ostreatus, which is wide-spread in the forests and commercial mushroom Lentinula edodes, under influence of such an abiotic factor as the extremely high frequency waves in the interval of 45 GHz - 53 GHz during 20 and 40 min on the 7th day of mycelial culture's growth. After the treatment of cultures we continued their growth and on the 3th day we examined the influence of these waves on fermentative activity of mycelial extracts. The some conditions of such treatment led to significant rising of β-glucosidase activities in the extracts of mycelial cultures

Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

Directory of Open Access Journals (Sweden)

Liang Huo

2018-02-01

Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

A Phytase Characterized by Relatively High pH Tolerance and Thermostability from the Shiitake Mushroom Lentinus edodes

Science.gov (United States)

Zhang, Guo-Qing; Wu, Ying-Ying; Ng, Tzi-Bun; Chen, Qing-Jun; Wang, He-Xiang

2013-01-01

A monomeric phytase with a molecular mass of 14 kDa was acquired from fresh fruiting bodies of the shiitake mushroom Lentinus edodes. The isolation procedure involved chromatography on DEAE-cellulose, CM-cellulose, Q-Sepharose, Affi-gel blue gel, and a final fast protein liquid chromatography-gel filtration on Superdex 75. The purified phytase demonstrated the unique N-terminal amino acid sequence DPKRTDQVN, which exhibited no sequence similarity with those of other phytases previously reported. It expressed its maximal activity at pH 5.0 and 37°C. Phytase activity manifested less than 20% change in activity over the pH range of 3.0–9.0, considerable thermostability with more than 60% residual activity at 70°C, and about 40% residual activity at 95°C. It displayed a wide substrate specificity on a variety of phosphorylated compounds with the following ranking: ATP > fructose-6-phosphate > AMP > glucose-6-phosphate > ADP > sodium phytate > β-glycerophosphate. The phytase activity was moderately stimulated by Ca2+, but inhibited by Al3+, Mn2+, Zn2+, and Cu2+ at a tested concentration of 5 mM. PMID:23586045

A Phytase Characterized by Relatively High pH Tolerance and Thermostability from the Shiitake Mushroom Lentinus edodes

Directory of Open Access Journals (Sweden)

Guo-Qing Zhang

2013-01-01

Full Text Available A monomeric phytase with a molecular mass of 14 kDa was acquired from fresh fruiting bodies of the shiitake mushroom Lentinus edodes. The isolation procedure involved chromatography on DEAE-cellulose, CM-cellulose, Q-Sepharose, Affi-gel blue gel, and a final fast protein liquid chromatography-gel filtration on Superdex 75. The purified phytase demonstrated the unique N-terminal amino acid sequence DPKRTDQVN, which exhibited no sequence similarity with those of other phytases previously reported. It expressed its maximal activity at pH 5.0 and 37°C. Phytase activity manifested less than 20% change in activity over the pH range of 3.0–9.0, considerable thermostability with more than 60% residual activity at 70°C, and about 40% residual activity at 95°C. It displayed a wide substrate specificity on a variety of phosphorylated compounds with the following ranking: ATP > fructose-6-phosphate > AMP > glucose-6-phosphate > ADP > sodium phytate > β-glycerophosphate. The phytase activity was moderately stimulated by Ca2+, but inhibited by Al3+, Mn2+, Zn2+, and Cu2+ at a tested concentration of 5 mM.

Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

Directory of Open Access Journals (Sweden)

Marian Petre

2009-11-01

Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts.The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum asthe longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for theirvalorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

Directory of Open Access Journals (Sweden)

Marian Petre

2009-12-01

Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts. The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum as the longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for their valorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and oyster (Pleurotus ostreatus) mushrooms.

Science.gov (United States)

Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E

2009-02-01

Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.

Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

Directory of Open Access Journals (Sweden)

Tony Hadibarata

2011-11-01

Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

Active Hexose Correlated Compound Extends the Lifespan and Increases the Thermotolerance of Nematodes

Directory of Open Access Journals (Sweden)

Tetsuya Okuyama

2013-06-01

Full Text Available ABSTRACTBackground: Active hexose correlated compound (AHCC is the extract from cultured mycelia of Lentinula edodes, a species of Basidiomycetes mushroom. AHCC contains various polysaccharides, including partially acylated -1,4-glucan, which is one of its major constituents. The application of AHCC has been markedly increased in complementary and alternative medicine as a functional food because AHCC improved the prognosis of postoperative hepatocellular carcinoma patients. AHCC has anti-inflammatory and antioxidant effects, such as the suppression of nitric oxide production in hepatocytes. AHCC might affect resistance to environmental stress, which is assumed to play a pivotal role in the longevity of many organisms.Objective: To investigate the effect of AHCC on longevity, we measured the lifespan of the nematode Caenorhabditis elegans, a model animal that is widely used to assess longevity. We also examined the effect of AHCC on resistance to heat stress, i.e., thermotolerance.Methods: The lifespan of C. elegans animals grown on media in the absence or presence of AHCC at 20°C was evaluated. Thermotolerance assays were performed at 35°C, the restrictive temperature of the animals. The effects of AHCC on lifespan and thermotolerance were analyzed with longevity mutants. Expression levels of stress-related genes, including heat shock genes, were measured by strand-specific reverse transcription-polymerase chain reaction after heat shock.Results: Wild-type C. elegans animals exhibited a longer mean lifespan by up to 10% in the presence of AHCC in the growth media than animals in the absence of AHCC. Furthermore, AHCC markedly increased thermotolerance at 35°C. Epistasis analyses showed that lifespan extension by AHCC at least partly required two longevity-promoting transcription factors: DAF-16 (C. elegans homolog of FOXO and HSF-1 (C. elegans homolog of heat shock transcription factor 1. After heat shock, AHCC activated the transcription

Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

International Nuclear Information System (INIS)

Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

1990-01-01

During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

Science.gov (United States)

Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

2015-01-14

Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

“Estudio de los compuestos polifenolicos con énfasis en flavonoides del hongo Lentinula edodes y determinación de la actividad antioxidante” / “Study of the polyphenolic compounds with emphasisoin flavonoids of mushroom Lentinula edodes and determination of the antioxidant activity”

OpenAIRE

Ávila Castañeda, Iris Marcela

2009-01-01

Debido al hecho de que los extractos de algunos macrohongos han exhibido actividad antioxidante y siendo el proceso natural del envejecimiento resultado en gran parte de la acción de los radicales libres generados dentro del metabolismo, esta bioacción de los hongos permite inferir que formando parte de los fungicompuestos deben estar presentes algunos metabolitos secundarios responsables de dicha acción. Dentro de los compuestos llamados a ejercer este efecto se encuentran los polifenoles en...

Optimization of enzymes-microwave-ultrasound assisted extraction of Lentinus edodes polysaccharides and determination of its antioxidant activity.

Science.gov (United States)

Yin, Chaomin; Fan, Xiuzhi; Fan, Zhe; Shi, Defang; Gao, Hong

2018-05-01

Enzymes-microwave-ultrasound assisted extraction (EMUE) method had been used to extract Lentinus edodes polysaccharides (LEPs). The enzymatic temperature, enzymatic pH, microwave power and microwave time were optimized by response surface methodology. The yields, properties and antioxidant activities of LEPs from EMUE and other extraction methods including hot-water extraction, enzymes-assisted extraction, microwave-assisted extraction and ultrasound-assisted extraction were evaluated. The results showed that the highest LEPs yield of 9.38% was achieved with enzymatic temperature of 48°C, enzymatic pH of 5.0, microwave power of 440W and microwave time of 10min, which correlated well with the predicted value of 9.79%. Additionally, LEPs from different extraction methods possessed typical absorption peak of polysaccharides, which meant different extraction methods had no significant effects on type of glycosidic bonds and sugar ring of LEPs. However, SEM images of LEPs from different extraction methods were significantly different. Moreover, the different LEPs all showed antioxidant activities, but LEPs from EMUE showed the highest reducing power when compared to other LEPs. The results indicated LEPs from EMUE can be used as natural antioxidant component in the pharmaceutical and functional food industries. Copyright © 2018 Elsevier B.V. All rights reserved.

Elm Tree (Ulmus parvifolia) Bark Bioprocessed with Mycelia of Shiitake (Lentinus edodes) Mushrooms in Liquid Culture: Composition and Mechanism of Protection against Allergic Asthma in Mice.

Science.gov (United States)

Kim, Sung Phil; Lee, Sang Jong; Nam, Seok Hyun; Friedman, Mendel

2016-02-03

Mushrooms can break down complex plant materials into smaller, more digestible and bioactive compounds. The present study investigated the antiasthma effect of an Ulmus parvifolia bark extract bioprocessed in Lentinus edodes liquid mycelium culture (BPUBE) against allergic asthma in chicken egg ovalbumin (OVA)-sensitized/challenged mice. BPUBE suppressed total IgE release from U266B1 cells in a dose-dependent manner without cytotoxicity. Inhibitory activity of BPUBE against OVA-specific IgE secretion in bronchoalveolar lavage fluid (BALF) was observed in OVA-sensitized/challenged asthmatic mice. BPUBE also inhibited OVA-specific IgG and IgG1 secretion into serum from the allergic mice, suggesting the restoration of a Th2-biased immune reaction to a Th1/Th2-balanced status, as indicated by the Th1/Th2 as well as regulatory T cell (Treg) cytokine profile changes caused by BPUBE in serum or BALF. Inflammatory cell counts in BALF and lung histology showed that leukocytosis and eosinophilia induced by OVA-sensitization/challenge were inhibited by the oral administration of BPUBE. Amelioration of eosinophil infiltration near the trachea was associated with reduced eotaxin and vascular cell adhesion molecule-1 (VCAM-1) levels. Changes in proinflammatory mediator levels in BALF suggest that BPUBE decreased OVA-sensitization-induced elevation of leukotriene C4 (LTC4) and prostaglandin D2 (PGD2). The finding that asthma-associated biomarker levels of OVA-sensitized/challenged mice were much more inhibited with BPUBE treatment than NPUBE (not-bioprocessed Ulmus parvifolia extract) treatment suggested the production of new bioactive compounds by the mushroom mycelia that may be involved in enhancing the observed antiasthmatic properties. The possible relation of the composition determined by proximate analysis and GC/MS to observed bioactivity is discussed. The results suggest that the elm tree (Ulmus parvifolia) bark bioprocessed with mycelia of shiitake (Lentinus edodes

Effects of indoor and outdoor cultivation conditions on 137 Cs concentrations in cultivated mushrooms produced after the Fukushima Daiichi Nuclear Power Plant accident.

Science.gov (United States)

Tagami, Keiko; Uchida, Shigeo; Ishii, Nobuyoshi

2017-01-01

Radiocesium ( 134 Cs and 137 Cs) in mushrooms has been a matter of public concern after the accident at Fukushima Daiichi Nuclear Power Plant. To minimize the internal dose by ingestion of cultivated mushrooms, the Japanese government set a guideline level with respect to the radiocesium concentration in bed-logs and mushroom beds; however, the effects of indoor and outdoor cultivation methods on radiocesium concentrations in cultivated mushrooms were not clear. The effects of indoor and outdoor cultivation on the radiocesium concentrations in mushroom were examined using published food monitoring data. 137 Cs concentration data in Lentinula edodes from the Aizu area in Fukushima Prefecture and seven prefectures outside Fukushima were used for the analysis. No statistically significant 137 Cs concentration differences were found between these two cultivation methods. Using detected 137 Cs data in shiitake, the geometric means from each prefecture were less than one-quarter of the standard limit (100 Bq kg -1 ) for total radiocesium under both cultivation conditions. It was suspected that re-suspended radiocesium might have been taken up by mushrooms or that radiocesium might have been absorbed into the mushrooms from the soil in the outdoor cultures. However, neither effect was significant for cultivated mushrooms in the areas examined. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Identification and Characterization of Trichoderma Species Damaging Shiitake Mushroom Bed-Logs Infested by Camptomyia Pest.

Science.gov (United States)

Kim, Jun Young; Kwon, Hyuk Woo; Yun, Yeo Hong; Kim, Seong Hwan

2016-05-28

The shiitake mushroom industry has suffered from Camptomyia (gall midges) pest, which feeds on the mycelium of shiitake mushroom during its cultivation. It has been postulated that fungal damage of shiitake bed-logs is associated with infestation by the insect pest, but this is not well understood. To understand the fungal damage associated with Camptomyia pest, various Trichoderma species were isolated, identified, and characterized. In addition to two previously known Trichoderma species, T. citrinoviride and T. deliquescens, two other Trichoderma species, T. harzianum and T. atroviride, were newly identified from the pestinfested bed-log samples obtained at three mushroom farms in Cheonan, Korea. Among these four species, T. harzianum was the most evident. The results of a chromogenic media-based assay for extracellular enzymes showed that these four species have the ability to produce amylase, carboxyl-methyl cellulase, avicelase, pectinase, and β-glucosidase, thus indicating that they can degrade wood components. A dual culture assay on PDA indicated that T. harzianum, T. atroviride, and T. citrinoviride were antagonistic against the mycelial growth of a shiitake strain (Lentinula edodes). Inoculation tests on shiitake bed-logs revealed that all four species were able to damage the wood of bed-logs. Our results provide evidence that the four green mold species are the causal agents involved in fungal damage of shiitake bed-logs infested by Camptomyia pest.

Effects of Shiitake Intake on Serum Lipids in Rats Fed Different High-Oil or High-Fat Diets.

Science.gov (United States)

Asada, Norihiko; Kairiku, Rumi; Tobo, Mika; Ono, Akifumi

2018-04-27

Shiitake (Lentinula edodes) extract, eritadenine, has been shown to reduce cholesterol levels, and its hypocholesterolemic actions are involved in the metabolism of methionine. However, the mechanisms by which eritadenine affects cholesterol metabolism in animals fed a high-fat diet containing different sources of lipids have not yet been elucidated in detail. This study was conducted to investigate the effects of shiitake supplementation on serum lipid concentrations in rats fed a diet including a high amount of a plant oil (HO [high oil] and HOS [high oil with shiitake] groups), animal fat (HF [high fat] and HFS [high fat with shiitake] groups), or MCT- (medium-chain triglyceride-) rich plant oil (HM [high MCT] and HMS [high MCT with shiitake] groups). Rats in the HOS, HFS, and HMS groups were fed shiitake. When rats were fed a diet containing shiitake, serum triglyceride, cholesterol levels, and LCAT (lecithin-cholesterol acyltransferase) activities were lower in rats given MCT-rich plant oil than in those that consumed lard. The lipid type in the diet with shiitake also affected serum cholesterol levels and LCAT activities. The diet containing MCT-rich plant oil showed the greatest rates of decrease in all serum lipid profiles and LCAT activities. These results suggest that shiitake and MCT-rich plant oil work together to reduce lipid profiles and LCAT activity in serum.

Mineral Composition of Four Edible Mushrooms

Directory of Open Access Journals (Sweden)

S. E. Mallikarjuna

2013-01-01

Full Text Available Two cultivated mushroom species, namely, Lentinula edodes and Pleurotus florida and two wild growing species Lentinus cladopus and Pleurotus djamor were studied for their mineral contents such as Ca, Mg, Na, K, Fe, Zn, Mn, Cu, Ni, Se, Pb, and Cd by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES and also Atomic Absorption Spectroscopy, (AAS. Phosphorus was estimated by spectrophotometric method. K, Ca, Na, and P were in higher concentrations ranging from 59.3 mg to 3634 mg, 8.27 mg–174.9 mg, 22.2 mg–327.4 mg, and 100.5 mg–769.9 mg/100 g dry weight respectively in the four mushroom species studied. Fe, Zn, Mg and Se were ranging from 6.27 mg to 35.3 mg, 1.58 mg–9.44 mg, 21.1 mg–40.7 mg and 0.048 mg–0.182 mg/100 g dry weight, respectively, amongst the mushroom species analyzed. However, Ni, Cu, and Mn contents showed relatively lower concentrations, whereas Pb and Cd were below detectable level. The mushrooms were safe for consumption, in accordance with the permissible tolerance limits of the estimated toxic metals. Implications of the mineral contents on mushroom nutritional value are highlighted.

Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

Science.gov (United States)

Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

2015-04-01

Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

Science.gov (United States)

Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

2014-01-01

The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

Turmeric Bioprocessed with Mycelia from the Shiitake Culinary-Medicinal Mushroom Lentinus edodes (Agaricomycetes) Protects Mice Against Salmonellosis.

Science.gov (United States)

Kim, Sung Phil; Lee, Sang Jong; Nam, Seok Hyun; Friedman, Mendel

2017-01-01

This study investigated the suppressive mechanisms of an extract from bioprocessed Lentinus edodes mycelial liquid culture supplemented with turmeric (bioprocessed Curcuma longa extract [BPCLE]) against murine salmonellosis. The BPLCE extract from the bioprocessed mycelia of the Salmonella Typhimurium into murine RAW 264.7 macrophage cells, elimination of intracellular bacteria, and elevation of inducible nitric oxide synthase expression. Dietary administration of BPCLE activated leukocytes from the mice infected with Salmonella through the intraperitoneal route. The enzyme-linked immunosorbent assay of the cytokines produced by splenocytes from infected mice showed significant increases in the levels of Th1 cytokines, including interleukin (IL)-1β, IL-2, IL-6, and IL-12. Histology showed that dietary administration of BPCLE protected against necrosis of the liver resulting from a sublethal dose of Salmonella. In addition, the treatment (1) extended the lifespan of lethally infected mice, (2) suppressed the invasion of Salmonella into human Caco-2 colorectal adenocarcinoma cells, (3) increased excretion of the bacterium in the feces, (4) suppressed the translocation of the Salmonella to internal organs, and (5) increased total immunoglobulin A in both serum and intestinal fluids. BPCLE protected the mice against salmonellosis via cooperative effects that include the upregulation of the Th1 immune reaction, prevention of translocation of bacteria across the intestinal epithelial cells, and increased immunoglobulin A production in serum and intestinal fluids.

De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

Energy Technology Data Exchange (ETDEWEB)

Lundquist, K; Kirk, T K

1978-01-01

In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

Energy Technology Data Exchange (ETDEWEB)

D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

1999-12-01

Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

Science.gov (United States)

Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

2015-02-01

Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

KAUST Repository

Ali, Shawkat

2014-09-19

The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

Directory of Open Access Journals (Sweden)

Grażyna Końska

2014-01-01

Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

Directory of Open Access Journals (Sweden)

Olga A. Glazunova

2018-04-01

Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

Protective effect of polysaccharides of lentinus edodes on damage in mice induced by ionizing radiation

International Nuclear Information System (INIS)

Song Xiuling; Wang Hongfang; Qi Yanfei; Wang Xuerui; Chen Tian; Wang Quan; Li Juan; Li Jing

2010-01-01

Objective: To evaluate the protective effect of polysaccharides of lentinus edodes (PLE) on immune and anti-oxidative and hematopoietic function of ionizing irradiated mice, and provide theoretical basis for its clinical application. Methods: Fifty ICR mice were randomly divided into normal control group (NC), irradiating control group (IC), low dose of PLE irradiating group (800 mg · kg -1 ), middle dose of PLE irradiating group (1600 mg · kg -1 ), and high dose of PLE irradiating group (2400 mg · kg -1 ) (n=10). The mice in PLE groups were gaster-poured by PLE for 7 d, the mice in NC group and IC group were gaster-poured by 0.9% sodium chloride solution. The mice in all groups except NC group were irradiated with 2 Gy X-ray on the eighth day. The spleen index, thymus index, the activity of SOD and content of MDA, the number of WBC, the micronucleus rate of bone marrow polychromalic erythrocytes (PCE)were detected at the 24th hour after radiation. Results: Compared with IC group,the spleen index, thymus index and activity of SOD in high dose of PLE irradiating group were increased markedly (P<0.05); the contents of MDA in middle and high dose of PLE irradiating groups were increased significantly (P<0.05). The number of WBC in PLE groups was increased significantly (P<0.05); the micronucleus rates of bone marrow PCE in middle and high dose of PLE irradiating groups were decreased significantly (P<0.05). Conclusion: PLE has an obvious protective effect on damage in X-ray irradiated mice. (authors)

Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

Science.gov (United States)

Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

2018-05-03

Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

Science.gov (United States)

Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

2013-06-01

Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

Science.gov (United States)

Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

2015-01-01

The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

Energy Technology Data Exchange (ETDEWEB)

C.A.Reddy, PI

2005-06-30

and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

Science.gov (United States)

Han, Jianrong

2003-01-15

The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

Antioxidative Effects of Phenolic Compounds of Mushroom Mycelia in Simulated Regions of the Human Colon, In Vitro Study

Directory of Open Access Journals (Sweden)

Vamanu Emanuel

2018-03-01

Full Text Available Many compounds in mushrooms are biologically active; however, the in vivo actions of their metabolites are poorly understood. An in vitro system, GIS1, was used to simulate the fermentation action of microbiota in each colon region. We used MycoPo, a natural product obtained from the lyophilized mycelia of different Pleurotus ostreatus species to determine the biological effects in human-colon regions. Controls (Lentinula edodes mycelia; dried basidia of Agaricus brunnescens were chosen to confirm the biological activity of P. ostreatus mycelia in vitro. We measured total antioxidant capacity and ferric ion-reducing antioxidant power (FRAP in simulated colon regions to identify antioxidant compounds, and undertook in vitro gastrointestinal simulation and microbiological analyses. The highest FRAP was found for the ascending colon, and the antioxidant effect was higher when MycoPo was administered. A. brunnescens consumption resulted in low total antioxidant capacity. Polyphenol content was correlated with the antioxidant status and microbial composition of microbiota. Total polyphenolic content was higher after A. brunnescens consumption, and four types of polyphenols were identified by high-performance liquid chromatography. Major phenolic acids were gentisic acid, homogentisic acid, and small amounts of caffeic acid. The Enterobacteriaceae species populations varied greatly across the three parts of the colon. We noted a significant (p0.85. These data suggest a direct relationship between favorable bacterial strains and availability of bioactive compounds, with specificity for each colon region.

An efficient Agrobacterium-mediated transformation method for the edible mushroom Hypsizygus marmoreus.

Science.gov (United States)

Zhang, Jin jing; Shi, Liang; Chen, Hui; Sun, Yun qi; Zhao, Ming wen; Ren, Ang; Chen, Ming jie; Wang, Hong; Feng, Zhi yong

2014-01-01

Hypsizygus marmoreus is one of the major edible mushrooms in East Asia. As no efficient transformation method, the molecular and genetics studies were hindered. The glyceraldehyde-3-phosphate dehydrogenase (GPD) gene of H. marmoreus was isolated and its promoter was used to drive the hygromycin B phosphotransferase (HPH) and enhanced green fluorescent protein (EGFP) in H. marmoreus. Agrobacterium tumefaciens-mediated transformation (ATMT) was successfully applied in H. marmoreus. The transformation parameters were optimized, and it was found that co-cultivation of bacteria with protoplast at a ratio of 1000:1 at a temperature of 26 °C in medium containing 0.3 mM acetosyringone resulted in the highest transformation efficiency for Agrobacterium strain. Besides, three plasmids, each carrying a different promoter (from H. marmoreus, Ganoderma lucidum and Lentinula edodes) driving the expression of an antibiotic resistance marker, were also tested. The construct carrying the H. marmoreus gpd promoter produced more transformants than other constructs. Our analysis showed that over 85% of the transformants tested remained mitotically stable even after five successive rounds of subculturing. Putative transformants were analyzed for the presence of hph gene by PCR and Southern blot. Meanwhile, the expression of EGFP in H. marmoreus transformants was detected by fluorescence imaging. This ATMT system increases the transformation efficiency of H. marmoreus and may represent a useful tool for molecular genetic studies in this mushroom species. Copyright © 2014 Elsevier GmbH. All rights reserved.

Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

Energy Technology Data Exchange (ETDEWEB)

Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

2003-07-01

Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

Science.gov (United States)

Steffen, K T; Hatakka, A; Hofrichter, M

2002-10-01

Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

Shiitake mushroom (Lentinus edodes: A poorly known allergen in Western countries responsible for severe work-related asthma

Directory of Open Access Journals (Sweden)

Valerio Pravettoni

2014-10-01

Full Text Available Objectives: The aim of this study was to investigate the IgE-mediated pathogenesis of severe asthma presented by a patient only after handling shiitake (Lentinus edodes mushrooms (SM. Material and Methods: Skin tests were performed using in-house extracts from mushrooms that the patient usually handled, i.e., shiitake, porcini, oyster and black fungus mushroom varieties. Specific IgE to champignons and various molds were determined. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE immunoblotting was performed to detect IgE-binding components. Four negative controls were included in the study. Results: Skin prick tests performed with in-house mushroom extracts from varieties other than shiitake were completely negative, in contrast to the positive test obtained for shiitake mushrooms. Serum specific IgE levels for common molds and champignons were all negative. SDS-PAGE revealed many protein bands in the four mushroom extracts. Immunoblotting using the patient’s serum showed allergenic bands at about 15 and 24 kDa exclusively for SM that were not shared with negative controls. Another faint band was detectable at approximately 37 kDa for SM and porcini varieties. Conclusions: Here, we present the first European case of SM-induced occupational asthma, a disease more frequently occurring in Asia. Asthma attacks stopped when the patient avoided contact with shiitake mushrooms. No skin reactions and no IgE-binding proteins by immunoblotting were detectable with the other mushrooms tested. The positive skin test with shiitake mushrooms and IgE-binding components in the shiitake extract confirmed the IgE-mediated etiology of the reaction.

Circumvention of Taxol-Resistance in Human Breast Cancers by Improved Water Soluble Taxanes

Science.gov (United States)

2001-10-01

Basidomycetes were found to have antitumor activity in animal models, including one extract derived from Lentinus edodes which completely inhibited the growth...other naturally occurring polysaccharide preparations from Lentinus edodes , Ganoderma lucidum, and Aloe barbadensis Miller, like CPS, also demonstrated...1969) Inhibition of mouse sarcoma 180 by polysaccharides from Lentinus edodes (Berk.) sing. Nature 222:687- 688 8. Chen WC, Hau DM, Lee SS. (1995

Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

Science.gov (United States)

Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

2010-01-01

During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

Science.gov (United States)

Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

2009-03-01

Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

Science.gov (United States)

Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

2016-01-01

The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

CW EPR and 9 GHz EPR imaging investigation of stable paramagnetic species and their antioxidant activities in dry shiitake mushroom (Lentinus edodes).

Science.gov (United States)

Nakagawa, Kouichi; Hara, Hideyuki

2016-01-01

We investigated the antioxidant activities and locations of stable paramagnetic species in dry (or drying) shiitake mushroom (Lentinus edodes) using continuous wave (CW) electron paramagnetic resonance (EPR) and 9 GHz EPR imaging. CW 9 GHz EPR detected paramagnetic species (peak-to-peak linewidth (ΔHpp) = 0.57 mT) in the mushroom. Two-dimensional imaging of the sharp line using a 9 GHz EPR imager showed that the species were located in the cap and shortened stem portions of the mushroom. No other location of the species was found in the mushroom. However, radical locations and concentrations varied along the cap of the mushroom. The 9 GHz EPR imaging determined the exact location of stable paramagnetic species in the shiitake mushroom. Distilled water extracts of the pigmented cap surface and the inner cap of the mushroom showed similar antioxidant activities that reduced an aqueous solution of 0.1 mM 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl. The present results suggest that the antioxidant activities of the edible mushroom extracts are much weaker than those of ascorbic acid. Thus, CW EPR and EPR imaging revealed the location and distribution of stable paramagnetic species and the antioxidant activities in the shiitake mushroom for the first time.

Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

Directory of Open Access Journals (Sweden)

S. Lupo

2006-04-01

Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal

Directory of Open Access Journals (Sweden)

Prabin Shrestha

2016-01-01

Full Text Available At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate. Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L and copper sulfate (30 μM in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, Km, Vmax, and Kcat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process.

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal.

Science.gov (United States)

Shrestha, Prabin; Joshi, Bishnu; Joshi, Jarina; Malla, Rajani; Sreerama, Lakshmaiah

2016-01-01

At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum -CDBT1 , Ganoderma japonicum, and Lentinula edodes , isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum -CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum -CDBT1. Presence of lignin (5 g/L) and copper sulfate (30  μ M) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum -CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m , V max , and K cat , determined using 2,2'-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110  μ M, 36  μ mol/min/mg, and 246 min -1 , respectively. The isolated thermostable laccase will be used in future experiments for delignification process.

Demonstration-Scale High-Cell-Density Fermentation of Pichia pastoris.

Science.gov (United States)

Liu, Wan-Cang; Zhu, Ping

2018-01-01

Pichia pastoris has been one of the most successful heterologous overexpression systems in generating proteins for large-scale production through high-cell-density fermentation. However, optimizing conditions of the large-scale high-cell-density fermentation for biochemistry and industrialization is usually a laborious and time-consuming process. Furthermore, it is often difficult to produce authentic proteins in large quantities, which is a major obstacle for functional and structural features analysis and industrial application. For these reasons, we have developed a protocol for efficient demonstration-scale high-cell-density fermentation of P. pastoris, which employs a new methanol-feeding strategy-biomass-stat strategy and a strategy of increased air pressure instead of pure oxygen supplement. The protocol included three typical stages of glycerol batch fermentation (initial culture phase), glycerol fed-batch fermentation (biomass accumulation phase), and methanol fed-batch fermentation (induction phase), which allows direct online-monitoring of fermentation conditions, including broth pH, temperature, DO, anti-foam generation, and feeding of glycerol and methanol. Using this protocol, production of the recombinant β-xylosidase of Lentinula edodes origin in 1000-L scale fermentation can be up to ~900 mg/L or 9.4 mg/g cells (dry cell weight, intracellular expression), with the specific production rate and average specific production of 0.1 mg/g/h and 0.081 mg/g/h, respectively. The methodology described in this protocol can be easily transferred to other systems, and eligible to scale up for a large number of proteins used in either the scientific studies or commercial purposes.

Características de Trichoderma harzianum, como agente limitante en el cultivo de hongos comestibles

Directory of Open Access Journals (Sweden)

Omar Romero Arenas

2009-07-01

Full Text Available El incremento dramático de incidencia y severidad de los “mohos verdes” en la producción de hongos comestibles se refleja en la aparición de formas altamente agresivas de éstos patógenos, como es el caso de los biotipos de Trichoderma harzianum (Th1, Th2., Th3 y Th4, que han sido encontrados en Europa y Norte América, donde la importancia de la patogenicidad de dicho “moho” se comprobó en 1995 con las pérdidas del 30-100% en las plantas de hongos comestibles en Chester, Pennsylvania. En México se han identificado diversos “mohos contaminantes”, entre los cuales Trichoderma spp., se encuentra frecuentemente en la producción de hongos comestibles (Agaricus bisporus, Pleurotus ostreatus y Lentinula edodes, en el 2004, un grupo de investigación detectó la presencia de cepas altamente agresivas de T. aggressivum f. aggressivum, identificadas con técnicas clásicas y moleculares, en muestras de substrato (compost contaminado, proporcionado por la principal planta de hongos de México. Actualmente se desconoce la situación sobre la distribución de Trichoderma harzianum y los problemas de contaminación en la producción de hongos comestibles, tanto de zonas rurales, como de zonas industrializadas en México, puede causar serias disminuciones en la producción de hongos comestibles y presentar pérdidas económicas para los productores de la región.

Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

Science.gov (United States)

Han, J R; An, C H; Yuan, J M

2005-01-01

The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

Science.gov (United States)

Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

2015-02-01

A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

Antimicrobial, Cytotoxic, Anti-Inflammatory, and Antioxidant Activity of Culinary Processed Shiitake Medicinal Mushroom (Lentinus edodes, Agaricomycetes) and Its Major Sulfur Sensory-Active Compound-Lenthionine.

Science.gov (United States)

Kupcova, Kristyna; Stefanova, Iveta; Plavcova, Zuzana; Hosek, Jan; Hrouzek, Pavel; Kubec, Roman

2018-01-01

The antimicrobial, cytotoxic, anti-inflammatory, and antioxidant properties of aqueous extracts of raw and culinary processed shiitake mushrooms were evaluated and compared with those of lenthionine (1,2,3,5,6-penta-thiepane), the principal aroma-bearing substance of the shiitake medicinal mushroom (Lentinus edodes). Antimicrobial activity was tested using a panel of 4 strains of bacteria, 2 yeasts, and 2 fungi. Cytotoxic properties were evaluated against 3 cell lines (HepG2, HeLa, PaTu), whereas the anti-inflammatory activity of tested samples was assayed based on their ability to attenuate the secretion of the cytokine tumor necrosis factor-α. Antioxidant activity was measured using in vitro DPPH and ABTS assays. It was found that lenthionine possesses significant antimicrobial properties; it is remarkably effective in inhibiting the growth of yeasts and fungi (minimum inhibitory concentration, 2-8 μg/mL) and thus is comparable to standard antifungal agents. Lenthionine is also able to decrease significantly the production of tumor necrosis factor-a and thus could be at least partly responsible for the observed anti-inflammatory effect of shiitake. On the other hand, lenthionine does not seem to contribute significantly to the well-known anticancer and antioxidant effects of the mushroom.

Productivity, Physicochemical Changes, and Antioxidant Activity of Shiitake Culinary-Medicinal Mushroom Lentinus edodes (Agaricomycetes) Cultivated on Lignocellulosic Residues.

Science.gov (United States)

Gaitán-Hernández, Rigoberto; Zavaleta, Marco Antonio Barradas; Aquino-Bolaños, Elia Nora

2017-01-01

The effects of substrate and strain on productivity, physicochemical characteristics, and compounds with antioxidant activity were evaluated in basidiomes of the shiitake mushroom, Lentinus edodes. Strains IE-245 and IE-256 and the substrates oak wood shavings (OW), sorghum stubble (SS), and sugar cane bagasse (SC) were used. Productivity was evaluated by measuring biological efficiency (BE), production rate (PR), and yield. Total sugars, total soluble solids, pH, titratable acidity, color parameters, total phenolics, flavonoids, ascorbic acid, and antioxidant activity of the basidiomes were measured. BE, PR and yield were higher with the combination IE-256/SS, at 103.71%, 1.32%, and 34.57%, respectively. The largest amount of total sugars (17.61 mg glucose · g-1 dry weight) was found with combination IE-256/SS. Variation was observed in basidiome color; the lowest luminosity (L*) value (darkest color) was found in the IE-256 strain on the OW substrate (L* = 30.45), whereas that of the IE-245 strain on the SC substrate was the lightest in color (L* = 57.00). The largest amounts of total phenolics were recorded in the IE-256 strain on the OW (6.50 mg gallic acid equivalents [GAE] · g-1 dry weight) and the SS substrates (5.85 mg GAE · g-1 dry weight). The best antioxidant activity was obtained with IE-256-0.80, 0.65, and 0.59 μmol Trolox equivalents · g dry weight-1-on the OW, SC, and SS substrates, respectively. Based on the values of BE, PR, and yield, IE-256/SS was the most productive. Substrate and strain, and their interactions, influenced the physicochemical characteristics of the basidiomes and the amounts of compounds with antioxidant activity they contained.

Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

Science.gov (United States)

Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

2017-03-01

A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

Science.gov (United States)

Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

2010-10-01

The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

Caracterização da produção em toros do cogumelo comestível Lentinula edodes (Berk. Pegler na região oeste do Estado de São Paulo = Characterization of log cultivation of the edible mushroom Lentinula edodes (Berk. Pegler in western São Paulo State (Brazil

Directory of Open Access Journals (Sweden)

Cilene Ferreira de Queiroz Neves

2008-10-01

Full Text Available A pesquisa foi realizada nos municípios de Dracena, Junqueirópolis,Mirandópolis, Alianças, Ilha Solteira, Castilho, Araçatuba, Birigui e Guararapes, Estado de São Paulo, aplicando-se um questionário para 17 produtores. As informações sobre as etapas do cultivo de Shiitake em toros, catalogando e caracterizando os produtores e o cultivo,foram tabuladas no software Microsoft Excel for Windows. Os resultados evidenciaram que o cultivo de Shiitake, nesta região, é recente, está em franca expansão e os produtores possuem alto grau de escolaridade. O cultivo está localizado principalmente na zona rural eé realizado tanto por brasileiros descendentes de japoneses como por brasileiros nativos. O eucalipto e a mangueira são as árvores mais utilizadas. A alta ocorrência de contaminação nos toros pode ser por causa do cultivo realizado em ambientes sem controle de temperatura e umidade relativa e à ausência de um manejo adequado. A região contava, em 2004, com 45 mil toros inoculados e uma produtividade média de 200 g cogumelo fresco/toro. Os cogumelos embalados em bandejas de 200 g são vendidos principalmente para o Ceasa em feiras livres.This study was carried out in the towns of Dracena, Junqueirópolis, Mirandópolis, Alianças, Ilha Solteira, Castilho, Araçatuba, Birigui and Guararapes, São Paulo State, by surveying 17 Shiitakegrowers through a questionnaire. Data pertaining to the stages of log-Shiitake growing, recording and characterization of growers and growing systems were entered into Microsoft Excel for Windows. The results showed that Shiitake cultivation is recent and increasing inthis region, and that growers have a high education level. Shiitake cultivation is mainly located in rural areas, with both Brazilians of Japanese descent and native Brazilians growing it. The most commonly used trees are eucalyptus and mango. The high level of log contamination is perhaps due to growing without temperature or moisture control and to the inappropriate growing system. In 2004, there were 45,000 Shiitake-inoculated logs in this region, and the yield stood around 200 g of fresh mushroom/log. The mushrooms arepacked in boxes of 200 g, and are sold mainly to Ceasa in open markets.

Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

Directory of Open Access Journals (Sweden)

Hirotoshi Sato

Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

Science.gov (United States)

Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

2016-09-01

Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

Shiitake dermatitis recorded by French Poison Control Centers - new case series with clinical observations.

Science.gov (United States)

Boels, D; Landreau, A; Bruneau, C; Garnier, R; Pulce, C; Labadie, M; de Haro, L; Harry, P

2014-07-01

Shiitake (Lentinula edodes) is an edible mushroom which was initially grown in Japan and China and is now sold on the European market. Flagellate erythema may arise following shiitake consumption and was first described in Japan in 1974. This paper reports a French shiitake dermatitis case series. The findings of retrospective study of shiitake dermatitis cases, reported to French Poison Control Centres (PCC) from January 2000 to December 2013, are reported. Among 32 exposed patients, 15 presented flagellate urticarial lesions after raw shiitake consumption. The first case of this series was reported in 2006 and the last nine cases were reported as of 2012. After shared meals, no symptoms were reported among guests, who preferred cooked shiitake to the raw mushroom. In this series, rashes appeared 12 h to 5 days (median: 24 h) after raw shiitake ingestion. Linear and itchy urticarial lesions formed on the trunk, arms, and legs within a few hours and persisted for 3-21 days. In four cases, rash and pruritus were either triggered or worsened by sun exposure. Eleven patients received corticosteroids, antihistamines, or both. All patients completely recovered. Due to the rapidly increasing consumption of exotic food in Western countries, it is no surprise that cases of shiitake dermatitis are now appearing in Europe. The mechanism of shiitake dermatitis is thought to be toxic and due to lentinan, a polysaccharide component of the mushroom. There is no specific validated treatment for shiitake dermatitis. Health professionals and the general population should be aware of both the risk associated with raw shiitake consumption and of the good prognosis of this very spectacular and uncomfortable toxic dermatitis.

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal

Science.gov (United States)

Joshi, Jarina; Malla, Rajani

2016-01-01

At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μM) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m, V max, and K cat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process. PMID:27822471

Antioxidant activities of extracts from five edible mushrooms using different extractants

Directory of Open Access Journals (Sweden)

Suphaphit Boonsong

2016-03-01

Full Text Available Extractions were performed of the total phenolic and flavonoid contents and antioxidant properties of five edible mushroom samples—Lentinus edodes, Volvariella volvacea, Pleurotus eous, Pleurotus sajor-caju and Auricularia auricular—using three different extractants. Among the three different extractants, 50% (volume per volume; v/v ethanol was the most suitable for antioxidant extraction from the mushroom samples. The 50% (v/v ethanolic extract of dried L. edodes contained higher total phenolic and flavonoid contents than in the other mushroom extract samples. The antioxidant activities of 50% (v/v ethanolic extract of dried L. edodes showed the strongest 2,2-diphenyl-1-picrylhydrazyl radical-scavenging assay (64.34% compared to butylated hydroxyanisole (BHA and α-tocopherol at 500 μg/mL. The ethanolic extract showed a lower reducing power of 0.10 compared to BHA and α-tocopherol at 500 μg/mL. Moreover, the L. edodes ethanolic extract also had the highest chelating ability (66.28% which was lower than for ethylenediaminetetraacetic acid at 500 μg/mL and showed the strongest superoxide radical-scavenging activity (64.17% compared to BHA and α-tocopherol. Therefore, the 50% (v/v ethanolic extract of L. edodes could be used as a potential natural antioxidative source or as an ingredient in the fish and fishery product industries.

Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

Science.gov (United States)

Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

2017-10-01

Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization and Antiproliferative Effect of Novel Acid Polysaccharides from the Spent Substrate of Shiitake Culinary-Medicinal Mushroom Lentinus edodes (Agaricomycetes) Cultivation.

Science.gov (United States)

Zhang, Yong; Liu, Wei; Xu, Chunping; Huang, Wei; He, Peixin

2017-01-01

In this study, a high yield of crude polysaccharide (16.73 ± 0.756%) was extracted from the spent mushroom substrate of Lentinus edodes using a hot alkali extraction method. Two groups of polysaccharides (designated as LSMS-1 and LSMS-2) were obtained from the crude extract by size exclusion chromatography (SEC), and their molecular characteristics were examined by a multiangle laser-light scattering (MALLS) and refractive index detector system. The weight-average molar masses of LSMS-1 and LSMS-2 were determined to be 6.842 × 106 and 2.154 × 106 g/mol, respectively. The SEC/MALLS analysis revealed that the molecular shapes of LSMS-1 and LSMS-2 were sphere-like forms in aqueous solution. Carbohydrate composition analysis using chromatography--mass spectrometry revealed that they were both acid heteropolysaccharides. LSMS-1 comprised mainly glucose and galacturonic acid, whereas LSMS-2 mainly consisted of xylose and glucuronic acid. Fourier transform infrared spectral analysis of the purified fractions revealed typical characteristic polysaccharide groups. In addition, MTT assays with refined polysaccharide doses of 25, 50, 100, 200, and 400 µg/mL suggested that both of the polysaccharide fractions exhibited antiproliferative activity against 6 tested human tumor cell lines in a concentration-dependent manner, and LSMS-2 had better anticancer capacity in vitro than LSMS-1. The inhibition ratio of LSMS-2 against A549 human lung cancer cells, the SGC7901 gastric cancer cell line, MCF-7 breast cancer cells, the U937 histiocytic lymphoma cell line, and the MG-63 human osteosarcoma cell line reached 43.55%, 29.97%, 19.63%, 18.24%, and 17.93%, respectively, at a concentration of 400 µg/mL.

β-Glucan from Lentinus edodes inhibits nitric oxide and tumor necrosis factor-α production and phosphorylation of mitogen-activated protein kinases in lipopolysaccharide-stimulated murine RAW 264.7 macrophages.

Science.gov (United States)

Xu, Xiaojuan; Yasuda, Michiko; Nakamura-Tsuruta, Sachiko; Mizuno, Masashi; Ashida, Hitoshi

2012-01-06

Lentinan (LNT), a β-glucan from the fruiting bodies of Lentinus edodes, is well known to have immunomodulatory activity. NO and TNF-α are associated with many inflammatory diseases. In this study, we investigated the effects of LNT extracted by sonication (LNT-S) on the NO and TNF-α production in LPS-stimulated murine RAW 264.7 macrophages. The results suggested that treatment with LNT-S not only resulted in the striking inhibition of TNF-α and NO production in LPS-activated macrophage RAW 264.7 cells, but also the protein expression of inducible NOS (iNOS) and the gene expression of iNOS mRNA and TNF-α mRNA. It is surprising that LNT-S enhanced LPS-induced NF-κB p65 nuclear translocation and NF-κB luciferase activity, but severely inhibited the phosphorylation of JNK1/2 and ERK1/2. The neutralizing antibodies of anti-Dectin-1 and anti-TLR2 hardly affected the inhibition of NO production. All of these results suggested that the suppression of LPS-induced NO and TNF-α production was at least partially attributable to the inhibition of JNK1/2 and ERK1/2 activation. This work discovered a promising molecule to control the diseases associated with overproduction of NO and TNF-α.

Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

Science.gov (United States)

Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

1996-01-01

Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

Determination of total cadmium, lead, arsenic, mercury and inorganic arsenic in mushrooms: outcome of IMEP-116 and IMEP-39.

Science.gov (United States)

Cordeiro, F; Llorente-Mirandes, T; López-Sánchez, J F; Rubio, R; Sánchez Agullo, A; Raber, G; Scharf, H; Vélez, D; Devesa, V; Fiamegos, Y; Emteborg, H; Seghers, J; Robouch, P; de la Calle, M B

2015-01-01

The Institute for Reference Materials and Measurements (IRMM) of the Joint Research Centre (JRC), a Directorate General of the European Commission, operates the International Measurement Evaluation Program (IMEP). IMEP organises inter-laboratory comparisons in support of European Union policies. This paper presents the results of two proficiency tests (PTs): IMEP-116 and IMEP-39, organised for the determination of total Cd, Pb, As, Hg and inorganic As (iAs) in mushrooms. Participation in IMEP-116 was restricted to National Reference Laboratories (NRLs) officially appointed by national authorities in European Union member states. IMEP-39 was open to all other laboratories wishing to participate. Thirty-seven participants from 25 countries reported results in IMEP-116, and 62 laboratories from 36 countries reported for the IMEP-39 study. Both PTs were organised in support to Regulation (EC) No. 1881/2006, which sets the maximum levels for certain contaminants in food. The test item used in both PTs was a blend of mushrooms of the variety shiitake (Lentinula edodes). Five laboratories, with demonstrated measurement capability in the field, provided results to establish the assigned values (Xref). The standard uncertainties associated to the assigned values (uref) were calculated by combining the uncertainty of the characterisation (uchar) with a contribution for homogeneity (ubb) and for stability (ust), whilst uchar was calculated following ISO 13528. Laboratory results were rated with z- and zeta (ζ)-scores in accordance with ISO 13528. The standard deviation for proficiency assessment, σp, ranged from 10% to 20% depending on the analyte. The percentage of satisfactory z-scores ranged from 81% (iAs) to 97% (total Cd) in IMEP-116 and from 64% (iAs) to 84% (total Hg) in IMEP-39.

The mitochondrial LSU rRNA group II intron of Ustilago maydis encodes an active homing endonuclease likely involved in intron mobility.

Directory of Open Access Journals (Sweden)

Anja Pfeifer

Full Text Available BACKGROUND: The a2 mating type locus gene lga2 is critical for uniparental mitochondrial DNA inheritance during sexual development of Ustilago maydis. Specifically, the absence of lga2 results in biparental inheritance, along with efficient transfer of intronic regions in the large subunit rRNA gene between parental molecules. However, the underlying role of the predicted LAGLIDADG homing endonuclease gene I-UmaI located within the group II intron LRII1 has remained unresolved. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the enzymatic activity of I-UmaI in vitro based on expression of a tagged full-length and a naturally occurring mutant derivative, which harbors only the N-terminal LAGLIDADG domain. This confirmed Mg²⁺-dependent endonuclease activity and cleavage at the LRII1 insertion site to generate four base pair extensions with 3' overhangs. Specifically, I-UmaI recognizes an asymmetric DNA sequence with a minimum length of 14 base pairs (5'-GACGGGAAGACCCT-3' and tolerates subtle base pair substitutions within the homing site. Enzymatic analysis of the mutant variant indicated a correlation between the activity in vitro and intron homing. Bioinformatic analyses revealed that putatively functional or former functional I-UmaI homologs are confined to a few members within the Ustilaginales and Agaricales, including the phylogenetically distant species Lentinula edodes, and are linked to group II introns inserted into homologous positions in the LSU rDNA. CONCLUSIONS/SIGNIFICANCE: The present data provide strong evidence that intron homing efficiently operates under conditions of biparental inheritance in U. maydis. Conversely, uniparental inheritance may be critical to restrict the transmission of mobile introns. Bioinformatic analyses suggest that I-UmaI-associated introns have been acquired independently in distant taxa and are more widespread than anticipated from available genomic data.

High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

Directory of Open Access Journals (Sweden)

Sujatha eKandhasamy

2016-05-01

Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

A study of the irradiation of sawdust culture medium and the yield of fresh lentinus

International Nuclear Information System (INIS)

Xu Meiyu; Wu Jinshui

1989-01-01

60 Co γ-rays at the doses of 1.0-1.8 Mrad were used to irradiate sawdust material for sterilization, It was found that 60 Co γ-rays could promote the breakdown of cellulose into soluble sugar, and thus promoted the growth of hyphae and increased the yield of L.edode. Determination of regressive analysis and correlation coefficients indicated that there was a high positive correlation between soluble sugar and the growth of hyphae(r = 0.9546**) , which can be expressed as Y = 3.12 + 1.30X; A high positive correlation between soluble sugar and the yield of L.edode(r = 0.9935**) can be expressed as Y = 31.95 + 86.69X; and a high positive correlation between the hyphae growing rate and the yield of L.edode(r = 0.9531**) can be expressed as Y = -145.34 + 60.92X

A polysaccharide isolated from the liquid culture of Lentinus edodes (Shiitake) mushroom mycelia containing black rice bran protects mice against a Salmonella lipopolysaccharide-induced endotoxemia.

Science.gov (United States)

Kim, Sung Phil; Park, Sun Ok; Lee, Sang Jong; Nam, Seok Hyun; Friedman, Mendel

2013-11-20

Endotoxemia (sepsis, septic shock) is an inflammatory, virulent disease that results mainly from bacterial infection. The present study investigates the inhibitory effect of a bioprocessed polysaccharide (BPP) isolated from the edible Lentinus edodes liquid mycelial mushroom culture supplemented with black rice bran against murine endotoxemia induced by the Salmonella lipopolysaccharide and d-galactosamine (LPS/GalN). BPP was obtained after dialysis against water using a cellulose tube with a molecular weight cutoff of 10000. BPP eluted as a single peak on an HPLC chromatogram. Acid hydrolysis of BPP showed the presence of the following sugars: fucose, galactose, galactosamine, glucose, glucosamine, mannose, rhamnose, and xylose. Treatment of BPP with β-glucanase reduced its immunostimulating activity, suggesting that the polysaccharide has a β-glucan structure. Pretreatment of mice with BPP via oral or intraperitoneal (ip) administration for 2 weeks resulted in the suppression of LPS/GalN-induced catalase, superoxide dismutase (SOD), and transaminase (GOT/GPT) liver enzymes, amelioration of necrotic liver lesions, and reduction of tumor necrosis factor α (TNF-α) and nitrite serum levels as well as myeloperoxidase (MPO) activity, an index of necrotic injury. Immunostimulating macrophage activity was up to 5.4-fold greater than that observed with the culture without the rice bran. BPP also extended the lifespan of the toxemic mice. These positive results with inflammation biomarkers and lifespan studies suggest that the BPP can protect mice against LPS/GalN-induced liver, lung, and kidney injuries and inflammation by blocking oxidative stress and TNF-α production, thus increasing the survival of the toxic shock-induced mice. The polysaccharide has the potential to serve as a new functional food.

A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

Science.gov (United States)

Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

2017-07-01

The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

DEFF Research Database (Denmark)

Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

2004-01-01

nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

Directory of Open Access Journals (Sweden)

Sérgio Luiz Moreira Neto

2009-10-01

Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

Utilization of Bagasse Cellulose for Ethanol Production through Simultaneous Saccharification and Fermentation by Xylanase

Directory of Open Access Journals (Sweden)

M Samsuri

2010-10-01

Full Text Available Bagasse is a solid residue from sugar cane process, which is not many use it for some product which have more added value. Bagasse, which is a lignosellulosic material, be able to be use for alternative energy resources like bioethanol or biogas. With renewable energy resources a crisis of energy in Republic of Indonesia could be solved, especially in oil and gas. This research has done the conversion of bagasse to bioethanol with xylanase enzyme. The result show that bagasse contains of 52,7% cellulose, 20% hemicelluloses, and 24,2% lignin. Xylanase enzyme and Saccharomyces cerevisiae was used to hydrolyse and fermentation in SSF process. Variation in this research use pH (4, 4,5, and 5, for increasing ethanol quantity, SSF process was done by added chloride acid (HCl with concentration 0.5% and 1% (v/v and also pre-treatment with white rot fungi such as Lentinus edodes (L.edodes as long 4 weeks. The SSF process was done with 24, 48, 72, and 96 hour's incubation time for fermentation. Variation of pH 4, 4,5, and 5 can produce ethanol with concentrations 2,357 g/L, 2,451 g/L, 2,709 g/L. The added chloride acid (HCl with concentration 0.5% and 1% (v/v and L. edodes can increase ethanol yield, The highest ethanol concentration with added chloride acid (HCl concentration 0.5% and 1% consecutively is 2,967 g/L, 3,249 g/L. The highest ethanol concentration with pre-treatment by L. edodes is 3,202 g/L.

Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.

Directory of Open Access Journals (Sweden)

Javier Ribera

Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.

Bioconversion of rice straw as animal feed ingredient through solid state fermentation

International Nuclear Information System (INIS)

Mohamad Hanif Mohamad Jamil; Sepiah Muid

1998-01-01

Work was conducted to establish procedures and techniques to utilise microorganisms, particularly basidiomycetes, for solid fermentation of rice by-products. The purpose of the study was to determine the potential of biologically processed rice by-products as ingredients of feed formula for selected livestock. Fungal organisms Auriculariapolytrichia, Lentimus connatus, L. edodes, Pleurotus cystidiosus, P. florida, P. sajor-caju and Volvariella volvacea respectively were inoculated on sterilised rice straw and the mycelium produced were cultured for periods of 3-4 weeks by which time the straw was fully enmeshed with mycelia. Proximate analysis of the finished products gave increases of 93-172 % crude protein and reduction of 31-54 % crude fibre on comparison with untreated rice straw. Amino acid analysis showed general increases for solid fermented rice straw (SFRS) which were comparatively close to amino acid values of conventional feed ingredients such as wheat, corn, sorghum and barley. Solid fermented rice straw was also tested as an ingredient in the formulation of rations for broiler chickens. Feeding trials on poultry indicated a maximum substitution of 50% maize with SFRS in feed rations was possible to attain acceptable growth of chickens to an average live final weight of 1.8 - 2.0 kg. per chicken at age 7 weeks. From studies undertaken, it was observed that the cellulolytic straw could be developed as a potential feed material for livestock through solid fermentation with microorganisms. From the research results, the use of solid fermented rice straw as an alternative ingredient in animal feeds may be one way in reducing reliance on feed imports and at the same time controlling environmental pollution. (Author)

Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

Directory of Open Access Journals (Sweden)

Ivana Potočnik

2015-12-01

Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.

Science.gov (United States)

Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

2008-07-01

Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

Higher marine fungi from mangroves (Manglicolous fungi)

Digital Repository Service at National Institute of Oceanography (India)

ChinnaRaj, S.

of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

Obtención in vitro de micelio de hongos comestibles, shiitake (Lentinula edodes) y orellanas (Pleurotus ostreatus y Pleurotus pulmonarius) a partir de aislamientos de cuerpos fructíferos, para la producción de semilla / In vitro micelia isolation of edible mushrooms, shiitake (Lentinula edodes) and oyster mushrooms (Pleurotus ostreatus and Pleurotus pulmonarius) from fruiting bodies, for spawn production

OpenAIRE

Suárez Arango, Carolina

2010-01-01

Los macromicetos han sido parte de la cultura humana desde hace miles de años y han sido reportados como alimento humano en las más importantes civilizaciones de la historia. Se han descrito muchísimas propiedades nutricéuticas de los macromicetos, como lo son sus propiedades anticancerígenas y antitumorales, hipocolesterolémicas, antivirales, antibacterianas, inmunomoduladoras, entre otras. Igualmente, han sido descritas sus propiedades nutricionales, tienen un elevado contenido de proteína,...

Books received by the Rijksherbarium library

NARCIS (Netherlands)

NN,

1982-01-01

A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.

Science.gov (United States)

Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S

2006-06-01

The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

26 - 30 Kutama

African Journals Online (AJOL)

DR. AMINU

wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

Microbiological decomposition of bagasse after radiation pasteurization

International Nuclear Information System (INIS)

Ito, Hitoshi; Ishigaki, Isao

1987-01-01

Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms. (author)

Vitamin D2 Stability During the Refrigerated Storage of Ultraviolet B-Treated Cultivated Culinary-Medicinal Mushrooms.

Science.gov (United States)

Slawinska, Aneta; Fornal, Emilia; Radzki, Wojciech; Jablonska-Rys, Ewa; Parfieniuk, Ewa

2017-01-01

The effects of ultraviolet B (UVB) irradiation on the synthesis of vitamin D2 and its stability during refrigerated storage was determined in fresh cultivated culinary-medicinal mushrooms (Agaricus bisporus, Pleurotus ostreatus, and Lentinus edodes) after harvest. The irradiated mushrooms were stored at 4°C for up to 10 days. The concentrations of vitamin D2 and ergosterol were determined using ultrahigh-performance liquid chromatography/tandem mass spectrometry. The cultivated mushrooms not treated with UVB were devoid of vitamin D2. After UVB irradiation, we obtained mushrooms with a large amount of ergocalciferol. A. bisporus showed the lowest vitamin D2 content (3.55 ± 0.11 μg D2/g dry weight); P. ostreatus contained 58.96 ± 1.15 μg D2/g dry weight, and L. edodes contained 29.46 ± 2.21 μg/g dry weight. During storage at 4°C, the amount of vitamin D2 was gradually decreased in P. ostreatus and L. edodes, whereas in A. bisporus vitamin D2 gradually increased until the sixth day, then decreased. Mushrooms exposed to UVB radiation contain a significant amount of vitamin D2 and are therefore an excellent food source of vitamin D.

Microbiological decomposition of bagasse after radiation pasteurization

Energy Technology Data Exchange (ETDEWEB)

Ito, Hitoshi; Ishigaki, Isao

1987-11-01

Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms.

Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils.

Science.gov (United States)

Gramss, Gerhard; Bergmann, Hans

2007-08-01

Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

Science.gov (United States)

Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

2012-01-01

Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

A Polysaccharide isolated from the liquid culture of Lentinus edodes (Shiitake) mushroom mycelia containing black rice bran protects mice against salmonellosis through upregulation of the Th1 immune reaction.

Science.gov (United States)

Kim, Sung Phil; Park, Sun Ok; Lee, Sang Jong; Nam, Seok Hyun; Friedman, Mendel

2014-03-19

The present study investigated the antibacterial effect of a bioprocessed polysaccharide (BPP) isolated from Lentinus edodes liquid mycelial culture supplemented with black rice bran against murine salmonellosis. BPP was not bactericidal in vitro, it did, however, stimulate uptake of the bacteria into RAW 264.7 murine macrophage cells, as indicated by increased colony-forming unit (CFU) counts of the contents of the lysed macrophages incubated with Salmonella Typhimurium for 30 and 60 min. Two hours postinfection, the bacterial counts drastically increased in the macrophages, but 4 and 8 h postinfection BPP extract-treated cells showed lower bacterial counts than the vehicle (saline phosphate pH 7.4 buffer, PBS)-treated control. BPP elicited altered morphology and markedly elevated inducible nitric oxide (NO) synthase (iNOS) mRNA and protein expression in the infected macrophage cells. BPP also activated leukocytes in S. Typhimurium-infected mice, as determined by spleen lymphocyte proliferation and IFN-γ levels in mice sera. ELISA analysis on cytokine production by Th1 and Th2 immune cells from splenocytes of infected mice showed significant increases in the levels of the following Th1 cytokines: IL-1β, IL-2, IL-6, and IL-12. Histology assays of the livers of mice infected with a sublethal dose (1 × 10(4) CFU) of S. Typhimurium showed that BPP, administered daily through an intraperitoneal (ip) or oral route, protected against necrosis of the liver, a biomarker of in vivo salmonellosis. The lifespan of mice similarly infected with a lethal dose of S. Typhimurium (1 × 10(5) CFU) was significantly extended by ip injection or oral administration of the BPP without side effects. These results suggest that the activity of BPP against bacterial infection in mice occurs mainly through the activation of macrophage-mediated immune response resulting from augmented Th1 immunity. The significance of the results for microbial food safety and human health and further

Güney Kore’de Mantar Yetiştiriciliği

Directory of Open Access Journals (Sweden)

Mustafa Kemal Soylu

2016-03-01

Full Text Available Güney Kore’de son yıllarda mantar üretimi çok hızlı bir şekilde artmaktadır. Güney Kore mantar üretimi 173577 ton olup, bu üretimden yıllık 800 milyon dolar gelir elde edilmektedir. Farklı mantar türlerinin üretimi yapılmakta olup, üretim miktarının %31’ni kış mantarı (Flammulina velutipes, %26’sını kulacık mantarı (Pleurotus eryngii, %26’sını kayın mantarı (Pleurotus ostreatus, %13’ünü beyaz şapkalı kültür mantar (Agaricus bisporus, kalan %4’ünü ise Lentinula edodes, Ganoderma lucidum ve Phellinus vb. mantarlar oluşturmaktadır. 764ha’lık bir alanda mantar üretimi yapılmaktadır. Üretim alanının %31’inde kayın mantarı (Pleurotus ostreatus, %14’ünde kulacık mantarı (Pleurotus eryngii, %6’sında kış mantarı (Flummulina velutipes, %16’sında beyaz şapkalı kültür mantarı (Agaricus bisporus, %3’ünde Phellinus, %3’ünde ölümsüzlük mantarı (Ganoderma lucidum, %27’sı ise diğer mantar türlerinden oluşmaktadır. Kore’de mantar sıkça tüketilen bir gıda olup, kişi başına mantar tüketimi 4.2 kg’dır. Kütüklerde (meşe mantarı, ölümsüzlük mantarı ve Phellinus yetiştiricilik, ranzalarda yetiştiricilik (Agaricus bisporus ve Pleurotus ostreatus ve şişe kültürü (Flummulina velutipes, Pleurotus ostreatus, Pleurotus eryngii yaygın olarak yapılan yetiştirme sistemleridir.

Shiitake mushroom production on small diameter oak logs in Ohio

Science.gov (United States)

S.M. Bratkovich

1991-01-01

Yields of different strains of shiitake mushrooms (Lentinus edodes) were evaluated when produced on small diameter oak logs in Ohio. Logs averaging between 3-4 inches in diameter were inoculated with four spawn strains in 1985.

A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

Directory of Open Access Journals (Sweden)

Azusa Saika

Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

Characterization and cultivation of a wild mushroom species isolated in Brazil
Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil

OpenAIRE

Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki

2002-01-01

Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

Enzyme-assisted extraction enhancing the umami taste amino acids recovery from several cultivated mushrooms

DEFF Research Database (Denmark)

Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo

2017-01-01

In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...

Decolorization of six synthetic dyes by fungi

OpenAIRE

Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.

2016-01-01

To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...

Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

International Nuclear Information System (INIS)

Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

2011-01-01

The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

In vitro effects of plant and mushroom extracts on immunological function of chicken lymphocytes and macrophages

Science.gov (United States)

The present study was conducted to examine the effects of milk thistle (Silybum marianum), turmeric (Curcuma longa), reishi mushroom (Ganoderma lucidum), and shiitake mushroom (Lentinus edodes) on innate immunity and tumor cell viability. In vitro culture of chicken spleen lymphocytes with extracts ...

Effects of mushroom and herb polysaccharides, as alternative for an antibiotic, on the cecal microbial ecosystem in broiler chickens

NARCIS (Netherlands)

Guo, F.; Williams, B.A.; Kwakkel, R.P.; Li, H.S.; Li, X.P.; Luo, J.Y.; Li, W.K.; Verstegen, M.W.A.

2004-01-01

An in vivo experiment was conducted to study the potential prebiotic effects of mushroom and herb polysaccharide extracts, Lentinus edodes extract (LenE), Tremella fuciformis extract, and Astragalus membranaceus Radix extract, on chicken growth and the cecal microbial ecosystem, as compared with the

The anticaries effect of a food extract (shiitake) in a short-term clinical study

NARCIS (Netherlands)

Lingström, P.; Zaura, E.; Hassan, H.; Buijs, M.J.; Hedelin, P.; Pratten, J.; Spratt, D.; Daglia, M.; Karbowiak, A.; Signoretto, C.; Rosema, M.; van der Weijden, F.; Wilson, M.

2012-01-01

The main objective was to investigate whether low-molecular-weight fraction of edible mushroom shiitake extract (Lentinus edodes) possesses caries-preventive properties. The study was designed as a double-blind, three-leg, cross-over, randomized, controlled clinical trial carried out on two series

Enzymatic saccharification of biologically pre-treated wheat straw with white-rot fungi.

Science.gov (United States)

Dias, Albino A; Freitas, Gil S; Marques, Guilhermina S M; Sampaio, Ana; Fraga, Irene S; Rodrigues, Miguel A M; Evtuguin, Dmitry V; Bezerra, Rui M F

2010-08-01

Wheat straw was submitted to a pre-treatment by the basidiomycetous fungi Euc-1 and Irpex lacteus, aiming to improve the accessibility of cellulose towards enzymatic hydrolysis via previous selective bio-delignification. This allowed the increase of substrate saccharification nearly four and three times while applying the basidiomycetes Euc-1 and I. lacteus, respectively. The cellulose/lignin ratio increased from 2.7 in the untreated wheat straw to 5.9 and 4.6 after the bio-treatment by the basidiomycetes Euc-1 and I. lacteus, respectively, thus evidencing the highly selective lignin biodegradation. The enzymatic profile of both fungi upon bio-treatment of wheat straw have been assessed including laccase, manganese-dependent peroxidase, lignin peroxidase, carboxymethylcellulase, xylanase, avicelase and feruloyl esterase activities. The difference in efficiency and selectivity of delignification within the two fungi treatments was interpreted in terms of specific lignolytic enzyme profiles and moderate xylanase and cellulolytic activities. (c) 2010 Elsevier Ltd. All rights reserved.

Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

Science.gov (United States)

Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

2015-10-30

Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

Science.gov (United States)

Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.

2016-05-01

Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

In vitro fermentation characteristics of two mushroom species, an herb, and their polysaccharide fractions, using chicken cecal contents as inoculum

NARCIS (Netherlands)

Guo, F.; Williams, B.A.; Kwakkel, R.P.; Verstegen, M.W.A.

2003-01-01

In vitro fermentabilities of two mushrooms (Lentinus edodes - LenS; Tremella fuciformis - TreS), an herb (Astragalus membranaceus - AstS), and their polysaccharide fractions (LenE, TreE, and AstE) were investigated using microflora from chicken ceca. Polysaccharides were extracted using the hot

Effects of Mushroom and Herb Polysaccharides on Cellular and Humoral Immune Responses of Eimeria tenella-Infected Chickens

NARCIS (Netherlands)

Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Parmentier, H.K.; Li, W.K.; Yang, Z.Q.; Verstegen, M.W.A.

2004-01-01

We investigated the effects of polysaccharide extracts from 2 mushrooms, Lentinus edodes (LenE) and Tremella fuciformis (TreE), and an herb, Astragalus membranaceus (AstE), on cellular and humoral immune responses of Eimeria tenella-infected chickens. A total of 150 broiler chicks were assigned to 5

Coccidiosis Immunization: Effects of Mushroom and Herb Polysaccharides on Immune Responses of Chickens Infected with Eimeria Tenella

NARCIS (Netherlands)

Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Suo, X.; Li, W.K.; Verstegen, M.W.A.

2005-01-01

An experiment was conducted to investigate the effects of polysaccharide extracts (E) of two mushrooms, Lentinus edodes (LenE) and Tremella fuciformis (TreE), and an herb, Astragalus membranaceus (AstE), on the immune responses of chickens infected with Eimeria tenella. A total of 180 broiler

Dietary exposure to shiitake mushroom confers reductions in serum glucose, lipids, leptin and antioxidant capacity in rats

Science.gov (United States)

Previously, we showed that dietary intake of shiitake mushroom (Lentinus edodes) decreased serum levels of polar lipids in rats. This study evaluated the effects of lifelong consumption of shiitake on body composition and serum cholesterol-related- and anti-oxidant indices in rats. Rat dams and th...

Current Overview of Mushroom Production in the World

NARCIS (Netherlands)

Royse, Daniel J.; Baars, J.J.P.; Tan, Qi

2017-01-01

Edible, medicinal, and wild mushrooms are the three major components of the global mushroom industry. World production of cultivated, edible mushrooms has increased more than 30‐fold since 1978. China is the main producer of cultivated, edible mushrooms. Lentinus edodes is now the world's leading

Efeito dos extratos do albedo de Citrus sinensis, Lentinula edodes, Agaricus blazei e dos compostos orgânicos voláteis produzidos por Saccharomyces cerevisiae no controle da mancha preta dos citros

OpenAIRE

Leonardo Toffano

2010-01-01

A mancha preta dos citros é uma doença que limita a exportação de laranja brasileira para os países da Europa. Exceto para Citrus aurantium e seus híbridos, todas as outras variedades são susceptíveis ao patógeno. Com isso existe um grande interesse para que esta doença não ocorra, uma vez que é considerada uma doença quarentenária A1. Problemas associados à aquisição de resistência e a percepção do público em geral sobre o impacto potencial das práticas tradicionais de controle sobre a saúde...

Effects of mushroom and herb polysaccharides, as alternatives for an antibiotic, on growth performance of broilers

NARCIS (Netherlands)

Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Li, W.K.; Li, H.S.; Luo, J.Y.; Li, X.P.; Wei, Y.X.; Yan, Z.T.; Verstegen, M.W.A.

2004-01-01

1. This in vivo trial was conducted to study the effects of polysaccharide extracts of two mushrooms, Lentinus edodes (LenE) and Tremella fuciformis (TreE), and a herb, Astragalus membranaceus (AstE) on growth performance, and the weights of organs and the gastrointestinal tract (GIT) of broiler

Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

Directory of Open Access Journals (Sweden)

Evelyne Coppin

Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

Science.gov (United States)

Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

2012-01-01

Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

Natural Protection of Wood with Antagonism Fungi

Directory of Open Access Journals (Sweden)

Alba ZAREMSKI

2011-03-01

Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.

Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.

Science.gov (United States)

Kozar, F; MacDonald, B R; Weijer, J

1977-01-01

The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

CELLULASES FROM THE BASIDIO - MYCETES CULTURAL LIQUID

Directory of Open Access Journals (Sweden)

К. G. Dreval

2013-04-01

Full Text Available Adsorption of cellulases on substrate taking place during the cultivation process was determined. Adsorbed enzymes can be eluted by buffer solution with high ionic strength, but for determine their activity they should be transferred into the aqueous solution. On the basis of the results a method for obtaining of cellulases preparations from cultural liquids of basidiomycetes was developed. This method is the elution of cellulases from the cultivation substrate of basidiomycetes. It was found that using of the last allows to obtain enzymatic preparations with a high degree of purification in 3 stages (salting out of proteins — dialysis — gelchromatography. Cellulase preparations received original products of basidiomycetes strains К-1, А-Дон-02, Д-1 Irpex lacteus and AnSc-1 Daedaleopsis confragosa f. confragosa were obtained. They contained different proteins, enzymes with specific peaks out of column and their activity. However, common to them was a distinct maximum of outing from the column by endoglucanases or cellobiases, which may indicate that the studied cellulolytic complexes of basidiomycetes do not contain multiple forms of cellulases with different molecular mass. This method allowed to obtain preparations with different degree of purification in comparing with the original culture filtrate 7,3 for endoglucanase and 33,3 for cellobiase of strain А-Дон-02 I. lacteus; 13,1 for endoglucanase and 25,5 for cellobiase of strain Д-1 I. lacteus; 29,9 for endoglucanase and 90,1 for cellobiase of strain К-1 I. lacteus; 2,1 for endoglucanase and 30,6 for cellobiase of strain AnSc-1 D. confragosa f. confragosa.

Antibiotics in the chemical communication of fungi.

Science.gov (United States)

Kettering, Melanie; Sterner, Olov; Anke, Timm

2004-01-01

In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.

Temperature development and sterilization of red pine poles during CCA treatment, elevated temperature fixation and drying

Energy Technology Data Exchange (ETDEWEB)

Cooper, P.; Albright, M.; Srinivasan, U.; Ung, A. [New Brunswick Univ., Fredericton, NB (Canada). Wood Science and Technology Centre

2002-07-01

The application of chromated copper arsenate (CCA) treatment and fixation and drying under the conditions of the study to large red pine poles left for an air seasoning period of 10 months in Quebec, Canada progressively reduced the number of micro-organisms present. A large number of microfungi isolations were effected before the treatment from the sapwood and heartwood of all poles and wood decay fungi on 8 selected poles from the 20 test poles. They originated from the sapwood zone. A reduction of approximately 50 per cent in the number of microfungi isolated from the sapwood was noted after the CCA treatment. In the case of 9 of 30 poles, basidiomycetes were isolated after treatment primarily from the untreated heartwood. There were a few instances where basidiomycetes were isolated from unpenetrated sapwood (wet pockets). Temperatures of 55 to 60 degrees Celsius were achieved under moderate temperature fixation schedules (20 hours) for approximately 5 hours at full sapwood depth. Only by the end of the schedule was a temperature of 55 degrees celsius achieved at the centre of the poles. Most of the microfungi were eliminated by this temperature regime. Trichoderma was eliminated, and only one isolation of basidiomycetes was left from the heartwood of one pole. Temperatures of 55 to 60 degrees Celsius were achieved in the wood core for 9 to 10 days during kiln drying. No basidiomycete isolations remained after this exposure. In several of the poles, there was evidence of Paecilomyces variotii, a thermo-tolerant species and a number of species of Penicillium moulds. It was concluded that there was a negligible probability of decay fungi surviving the sequence of processes as described, given the effectiveness of the fixation exposure and the higher wood temperatures sustained for longer periods. 16 refs., 5 tabs., 2 figs.

Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

Directory of Open Access Journals (Sweden)

D Tagu

2009-12-01

Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.

WILD EDIBLE MUSHROOMS OF MEGHALAYA

Science.gov (United States)

Barua, Paran; Adhikary, R.K; Kalita, Pabitra; Bordoloi, Dalimi; Gogoi, P.; Singh, R.S.; Ghosh, A.C.

1998-01-01

Different flesh mushrooms grow widely in Meghalaya. Altogether fie edible species were collected and identified which were found abundantly in forest and are known to be consumed by local people for time immemorial, The species identified are lentinus edodes (Berk) Sing., Boletus edulis Bull ex Fr., Clavaria cinerea (Fr.) Schroet, Clavaria aurea (F) Quet and cantharellus floccosus Juss. PMID:22556840

Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

Directory of Open Access Journals (Sweden)

Marie Desnos-Ollivier

Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

Directory of Open Access Journals (Sweden)

Cheng-Siang Wong

2013-09-01

Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

782-IJBCS-Article-Rose Masalu

African Journals Online (AJOL)

DR GATSING

Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.

Flagellate dermatitis caused by shiitake mushrooms Dermatite flagelada após a ingestão de fungos shiitake

Directory of Open Access Journals (Sweden)

Lidia Marilia Poppe

2012-06-01

Full Text Available Shiitake (Lentinus edodes is the second most consumed mushroom in the world. It has long been known in Asian medicine for its anticarcinogenic, antihypertensive and serum cholesterol level reduction properties. Nevertheless, the consumption of raw or not well-cooked mushrooms may cause skin eruptions which usually occur 24 to 48 hours after ingestion and are characterized by linearly arranged pruritic erythematous papules and plaques. We present a 36-year-old patient that developed typical symptoms 24 hours after consumption of shiitake mushrooms and summarize therapeutic options and particularities of this disease.Shiitake (Lentinus edodes é o segundo tipo de cogumelo mais consumido no mundo. Suas propriedades terapêuticas antitumorais, anti-hipertensivas e redutoras dos níveis elevados de colesterol são há muito conhecidas pela população asiática. Após ingestão desse cogumelo, cru ou malcozido, podem desenvolver-se lesões eritematosas lineares, pruriginosas, que surgem após 24 ou 48 horas em todo o corpo. Apresentamos um paciente de 36 anos com anamnese e clínica típicos, e comentamos as alternativas terapêuticas e nuances dessa dermatose.

Shiitake dermatitis: the first case reported in Brazil Dermatite flagelada por shiitake, primeiro relato de caso no Brasil

Directory of Open Access Journals (Sweden)

André Ricardo Adriano

2013-06-01

Full Text Available Shiitake Dermatitis is often presented as papules and erythemato-violaceous linear streaks. It can be associated with bleomycin treatment, dermatomyositis and shiitake mushroom (Lentinus edodes. There is not any previous report concerning this rare etiology in our country. Shiitake is the second most consumed mushroom worldwide and it can cause flagellate erythema when ingested raw or half cooked. It has a higher incidence in Oriental countries because of their eating habits, this is the first case reported in Brazil, in a male patient that presented a cutaneous rash after consuming this raw mushroom.A dermatite flagelada é caracterizada por pápulas eritematosas lineares com aspecto de "chicotada". A etiologia pode ser associada ao uso de bleomicina, dermatomiosite e shiitake (Lentinus edodes. Este é o segundo cogumelo mais consumido no mundo e pode ser causa de dermatite flagelada quando ingerido cru ou mal cozido. Não há relatos nas literaturas de quadro de dermatite flagelada por shiitake em nosso país, reportamos o primeiro caso no Brasil de um paciente masculino que desenvolveu o quadro após a ingesta desse cogumelo cru.

Type studies in Basidiomycetes. X

NARCIS (Netherlands)

Singer, R.

1961-01-01

For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The

Flagellate dermatitis following consumption of shiitake mushroom

Directory of Open Access Journals (Sweden)

Hui Voon Loo

2011-10-01

Full Text Available Japanese dermatologists were the first to describe the very characteristic flagellate dermatitis following consumption of under-cooked or raw shiitake mushroom (Lentinus edodes. These similar eruptions were also reported in patients treated with bleomycin, in dermatomyositis and adult onset Still’s disease. We report a case where a 40 year old chinese female developed flagellate dermatitis following ingestion of a bun containing shiitake mushroom.

Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions.

Science.gov (United States)

Tauber, James P; Gallegos-Monterrosa, Ramses; Kovács, Ákos T; Shelest, Ekaterina; Hoffmeister, Dirk

2018-01-01

Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S. lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S. lacrymans significantly reduced pigmentation indicating that enzymatic hyphal damage and/or released peptides, rather than mechanical injury, was the major cause of systemic pigment induction. Conversely, no significant pigmentation by bacteria was observed from P. involutus. We found additional putative transcriptional composite elements of atromentin synthetase genes in P. involutus and other ectomycorrhiza-forming species that were absent from S. lacrymans and other brown-rotters. Variegatic and its precursor xerocomic acid, but not involutin, in return inhibited swarming and colony biofilm spreading of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine global regulators, signalling pathways and associated transcription factors of basidiomycetes.

Checklist of the Mycobiota of Iguazú National Park (Misiones, Argentina Catálogo de los hongos del Parque Nacional Iguazú (Misiones, Argentina

Directory of Open Access Journals (Sweden)

Jorge E. Wright

2005-07-01

Full Text Available A check-list of the fungi recorded from Iguazú National Park, one of the best known preserved areas in South America, has been compiled mainly on the basis of Rolf Singer´s and our own collections and publications. Ten species of Dictyosteliales, 4 of Myxomycetes, 4 of Pezizales, 9 of Hypocreales, 31 of other Ascomycetes, 3 Deuteromycotina and 314 of Basidiomycetes are annotated. This last group is by far the best known, and includes 13 species of jelly-fungi, 6 coral fungi, 84 resupinates, 90 Agaricales s. l., 111 polypores of which 26 are poroid Hymenochaetaceae, and 11 of Gasteromycetes. Furthermore, 8 Ascomycetes, 58 Basidiomycetes and 2 Deuteromycotina were determined to genus. Lichens have been excluded. The microfungi of the Park have hardly been explored, and no phycomycetes are recorded, so the number of species included in this checklist is but a mere sample of the rich mycobiota of the Park.Este catálogo de los hongos registrados para el Parque Nacional Iguazú, una de las áreas preservadas mejor conocidas en América del Sur, ha sido confeccionado principalmente sobre la base de las colecciones y publicaciones de Rolf Singer y las propias. Diez especies de Dictyosteliales, 4 de Myxomycetes, 4 de Pezizales, 9 de Hypocreales, 31 de otros Ascomycetes, 3 Deuteromycotina, y 314 de Basidiomycetes han sido anotadas. Este último grupo es de lejos el mejor conocido, e incluye 13 especies de hongos gelatinosos, 6 de hongos clavarioides, 84 de resupinados, 90 de Agaricales s. l., 111 de políporos, de los cuales 26 son Hymenochaetaceae poroides, y 11 de Gasteromycetes. Además, 8 Ascomycetes, 58 Basidiomycetes y 2 Deuteromycotina fueron solo determinados a nivel de género. Los líquenes han sido excluídos. Los microhongos del Parque apenas han sido explorados, y no se han registrado 'ficomicetes', de modo que el número de especies que se presenta aquí son tan sólo un mero muestreo de la micobiota del Parque.

Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

Digital Repository Service at National Institute of Oceanography (India)

DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

Diversity of edible mushrooms in pakistan

International Nuclear Information System (INIS)

Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

2007-01-01

Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions

DEFF Research Database (Denmark)

Tauber, James P.; Gallegos-Monterrosa, Ramses; Kovács, Ákos T.

2018-01-01

Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S...... of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine....... lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S...

Why Mycophoris is not an orchid seedling, and why Synaptomitus is not a fungal symbiont within this fossil

DEFF Research Database (Denmark)

Selosse, Marc-Andre; Brundrett, Mark; Dearnaley, John

2017-01-01

A recent publication in Botany introduced two new taxa: a fossil orchid seed (Mycophoris) and a fossilized basidiomycete fungus (Synaptomitus) in an alleged relationship with this orchid, encased in 15–20 million year old Dominican amber (Poinar, G. 2017. Two new genera, Mycophoris gen. nov......., (Orchidaceae) and Synaptomitus gen. nov. (Basidiomycota) based on a fossil seed with developing embryo and associated fungus in Dominican amber. Botany, 95: 1–8). From the working knowledge of extant orchid seeds, seedlings, and mycorrhiza shared among us, we cannot support these interpretations. Here we...... analyse: (i) why Mycophoris may not be an orchid seed, (ii) why Mycophoris is not a germinating seed, (iii) why fungal hyphae and a symbiotic fungus are absent in Mycophoris, and (iv) why Synaptomitus is likely not a fossil basidiomycete....

Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

Czech Academy of Sciences Publication Activity Database

Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

2010-01-01

Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

Manglicolous fungi from atolls of Maldives, Indian Ocean

Digital Repository Service at National Institute of Oceanography (India)

Chinnaraj, S.

Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

Bioleaching of copper, aluminum, magnesium and manganese from ...

African Journals Online (AJOL)

Administrator

2011-09-12

Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.

octadecenoic acid in tomato

African Journals Online (AJOL)

User

bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.

Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

DEFF Research Database (Denmark)

Poulsen, M; Cafaro, M; Boomsma, J J

2005-01-01

Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

Genetic transformation of the white-rot fungus Dichomitus squalens using a new commercial protoplasting cocktail.

Science.gov (United States)

Daly, Paul; Slaghek, Gillian G; Casado López, Sara; Wiebenga, Ad; Hilden, Kristiina S; de Vries, Ronald P; Mäkelä, Miia R

2017-12-01

D. squalens, a white-rot fungus that efficiently degrades lignocellulose in nature, can be used in various biotechnological applications and has several strains with sequenced and annotated genomes. Here we present a method for the transformation of this basidiomycete fungus, using a recently introduced commercial ascomycete protoplasting enzyme cocktail, Protoplast F. In protoplasting of D. squalens mycelia, Protoplast F outperformed two other cocktails while releasing similar amounts of protoplasts to a third cocktail. The protoplasts released using Protoplast F had a regeneration rate of 12.5% (±6 SE). Using Protoplast F, the D. squalens monokaryon CBS464.89 was conferred with resistance to the antibiotics hygromycin and G418 via polyethylene glycol mediated protoplast transformation with resistance cassettes expressing the hygromycin phosphotransferase (hph) and neomycin phosphotransferase (nptII) genes, respectively. The hph gene was expressed in D. squalens using heterologous promoters from genes encoding β-tubulin or glyceraldehyde 3-phosphate dehydrogenase. A Southern blot confirmed integration of a resistance cassette into the D. squalens genome. An average of six transformants (±2 SE) were obtained when at least several million protoplasts were used (a transformation efficiency of 0.8 (±0.3 SE) transformants per μg DNA). Transformation of D. squalens demonstrates the suitability of the Protoplast F cocktail for basidiomycete transformation and furthermore can facilitate understanding of basidiomycete gene function and development of improved strains for biotechnological applications. Copyright © 2017 Elsevier B.V. All rights reserved.

12038_2016_9614_Article_print 265..275

Indian Academy of Sciences (India)

2016-05-13

May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.

Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

Digital Repository Service at National Institute of Oceanography (India)

DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...

Carotene-degrading activities from Bjerkandera adusta possess an application in detergent industries.

Science.gov (United States)

Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G

2015-06-01

Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning.

Oxidoreductases from Trametes spp. in Biotechnology: A Wealth of Catalytic Activity

Directory of Open Access Journals (Sweden)

Gibson S. Nyanhongo

2007-01-01

Full Text Available Those oxidoreductases that are part of the ligninolytic complex of basidiomycete and ascomycete fungi have played an increasingly important role in biotechnological applications during the last decade. The stability of these extracellular enzymes, their good solubility, and a multitude of catalyzed reactions contribute to this trend. This review focuses on a single genus of white-rot basidiomycetes, Trametes, to highlight the numerous possibilities for the application of this microorganism as well as three of its enzymes: laccase, cellobiose dehydrogenase, and pyranose 2-oxidase. Whereas laccase is without doubt a major player in biotechnology, the two other enzymes are less well known, but represent emerging biocatalysts with potential. Both cellobiose dehydrogenase and pyranose 2-oxidase are presumed to participate in lignin breakdown and will be used to exemplify the potential of less prominent oxidoreductases from this genus.

Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

Digital Repository Service at National Institute of Oceanography (India)

Raghukumar, C.; Rivonkar, G.

Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

NARCIS (Netherlands)

Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

2010-01-01

The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

Books received by the Rijksherbarium library

NARCIS (Netherlands)

NN,

1993-01-01

Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

NARCIS (Netherlands)

Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

2016-01-01

The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
decaying plant material in forests and grasslands of North America and Europe. It degrades forest
litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

NARCIS (Netherlands)

Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

2016-01-01

The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

Science.gov (United States)

Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen

2012-01-01

Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...

Molecular identification, genetic diversity, population genetics and genomics of Rhizoctonia solani. In:perspective of plant pathology in genomic era

Science.gov (United States)

The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...

Uncovering the abilities of Agaricus bisporus to degrade plant biomass throughout its life cycle

NARCIS (Netherlands)

Patyshakuliyeva, A.; Post, H.; Zhou, M.; Jurak, E.; Heck, A.J.R.; Hilden, K.S.; Kabel, M.A.; Makela, M.R.; Altenaar, M.A.F.; Vries, de R.P.

2015-01-01

The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and con-tributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

NARCIS (Netherlands)

Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.

2013-01-01

Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median

The yeast flora of some decaying mushrooms on trunks of living trees

NARCIS (Netherlands)

Middelhoven, W.J.

2004-01-01

Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

NARCIS (Netherlands)

Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.

2007-01-01

Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species

Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

DEFF Research Database (Denmark)

Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

2013-01-01

Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...

Formation and cell wall regeneration of protoplasts from Schizophyllum commune

NARCIS (Netherlands)

de Vries, Onno Minne Hotze

1974-01-01

Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.

Novel Phialophora species from leaf-cutting ants (tribe Attini)

NARCIS (Netherlands)

Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

2014-01-01

Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

Novel mandibular gland volatiles from Apterostigma ants

DEFF Research Database (Denmark)

Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya

2017-01-01

The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...

On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

NARCIS (Netherlands)

Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.

2013-01-01

Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

Czech Academy of Sciences Publication Activity Database

Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

2015-01-01

Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

DEFF Research Database (Denmark)

Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H

2007-01-01

BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...

Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

African Journals Online (AJOL)

The white-rot, basidiomycete fungus, Phanerochaete chrysosporium, has attracted .... with Congo red (1 mg/ml) solution, incubated at room temperature for 15 min and washed several times with sterile 1 .... white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis and regulation of differential expression.

Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

NARCIS (Netherlands)

Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

2002-01-01

Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada

NARCIS (Netherlands)

Hagen, F; Boekhout, T

2006-01-01

Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a

Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

NARCIS (Netherlands)

Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

2015-01-01

The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation

DEFF Research Database (Denmark)

Sitarz, Anna Katarzyna; Mikkelsen, Jørn Dalgaard; Højrup, Peter

2013-01-01

Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt...

Various Stages of Pink Fungus (Upasia salmonicolor in Java

Directory of Open Access Journals (Sweden)

Ambarwati Harsojo Tjokrosoedarmo

1995-12-01

Full Text Available Pink fungus in Java is classified as Upasia salmonicolor (Basidiomycetes: Corticiaceae and its anamorph is Necator decretus. This fungus is a serious pathogen which attacks many woody plants. The pink fungus in Java exhibits five developmental stages on the surface of the host bark: I. An initial cobweb stage as thin, white, cobweb-like hyphal layer, which creeps over the surface of the bark, during which penetration of the host occurs; II. Pseudonodular stage, as conical white pustules occurring only on lenticels or cracks, and only on shady side of branches; III. Teleomorph, occurs as pink incrustation and pink pustules on shady side of branches; IV. Nodular stages, as globose white pustules occurring chiefly on intact bark, but also on the lenticels or cracks, on exposed side of branches; V. Anamorph, as small orange-red sporodochium, on exposed side of branches. Key words: pink fungus, Corticiaceae, Basidiomycetes, Necator

Fungal Sex: The Basidiomycota.

Science.gov (United States)

Coelho, Marco A; Bakkeren, Guus; Sun, Sheng; Hood, Michael E; Giraud, Tatiana

2017-06-01

Fungi of the Basidiomycota, representing major pathogen lineages and mushroom-forming species, exhibit diverse means to achieve sexual reproduction, with particularly varied mechanisms to determine compatibilities of haploid mating partners. For species that require mating between distinct genotypes, discrimination is usually based on both the reciprocal exchange of diffusible mating pheromones, rather than sexes, and the interactions of homeodomain protein signals after cell fusion. Both compatibility factors must be heterozygous in the product of mating, and genetic linkage relationships of the mating pheromone/receptor and homeodomain genes largely determine the complex patterns of mating-type variation. Independent segregation of the two compatibility factors can create four haploid mating genotypes from meiosis, referred to as tetrapolarity. This condition is thought to be ancestral to the basidiomycetes. Alternatively, cosegregation by linkage of the two mating factors, or in some cases the absence of the pheromone-based discrimination, yields only two mating types from meiosis, referred to as bipolarity. Several species are now known to have large and highly rearranged chromosomal regions linked to mating-type genes. At the population level, polymorphism of the mating-type genes is an exceptional aspect of some basidiomycete fungi, where selection under outcrossing for rare, intercompatible allelic variants is thought to be responsible for numbers of mating types that may reach several thousand. Advances in genome sequencing and assembly are yielding new insights by comparative approaches among and within basidiomycete species, with the promise to resolve the evolutionary origins and dynamics of mating compatibility genetics in this major eukaryotic lineage.

Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

Directory of Open Access Journals (Sweden)

Li Fen

2014-01-01

Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

Content of Chemical Elements in Wood-Destroying Fungi

Directory of Open Access Journals (Sweden)

Strapáč I.

2016-12-01

Full Text Available The aim of this study was to examine the content of chemical elements in the dried fruiting bodies of edible wood decaying fungi such as Honey mushrooms (Armillaria mellea, Shiitakes (Lentinus edodes and Oyster mushrooms (Pleurotus ostreatus. Powdered samples of fungi were mineralized in a microwave digestion. Twenty-one (21 chemical elements were detected in the plasma of the device ICP-MS AGILENT 7500c by accredited methods with the aid of calibration curves. The content of individual elements varied within a considerable range. The highest contents of K, Mn, Cu and Cd were found in the fruiting bodies of Honey mushrooms (Armillaria mellea. Shiitakes (Lentinus edodes had the highest content of B and Mo. Significant differences were found in the content of elements in the Oyster mushrooms (Pleurotus ostreatus from Slovakia, Hungary and China. The highest content of Al was found in the Oyster mushrooms (Pleurotus ostreatus from Hungary. The Chinese oysters had a maximum contents of Ca, Mg, Co, Pb, As and U. The Oyster mushrooms (Pleurotus ostreatus from Lemešany (Slovakia had the highest contents of Na, Zn, Fe, Se, Ag, Hg and Cr. The difference of chemical element content could be influenced by the genotype of the fungus and by the composition of substrate on which mushroom grow up.

Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

DEFF Research Database (Denmark)

Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter

2010-01-01

Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

Temporal Alterations in the Secretome of the Selective Ligninolytic Fungus Ceriporipsis subvermispora during growth on Aspen Wood Reveal this Organism's Strategy for Degrading Lighnocellulose

Science.gov (United States)

Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen

2014-01-01

The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...

HYDROPHOBIN GENES INVOLVED IN FORMATION OF AERIAL HYPHAE AND FRUIT BODIES IN SCHIZOPHYLLUM

NARCIS (Netherlands)

WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SCHUREN, FHJ

Fungi typically grow by apical extension of hyphae that penetrate moist substrates. After establishing a branched feeding mycelium, the hyphae differentiate and grow away from the substrate into the air where they form various structures such as aerial hyphae and mushrooms. In the basidiomycete

THE THN MUTATION OF SCHIZOPHYLLUM-COMMUNE, WHICH SUPPRESSES FORMATION OF AERIAL HYPHAE, AFFECTS EXPRESSION OF THE SC3 HYDROPHOBIN GENE

NARCIS (Netherlands)

WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SPRINGER, J

1991-01-01

The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents

The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin

NARCIS (Netherlands)

Lugones, L G; de Jong, J F; de Vries, O M H; Jalving, R; Dijksterhuis, J; Wösten, H A B

Disruption of the SC3 gene in the basidiomycete Schizophyllum commune affected not only formation of aerial hyphae but also attachment to hydrophobic surfaces. However, these processes were not completely abolished, indicating involvement of other molecules. We here show that the SC15 protein

A rare case of urinary tract infection due to Trichosporonasahii in a ...

African Journals Online (AJOL)

Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...

Fungal Systematics and Evolution: FUSE 2

NARCIS (Netherlands)

Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.

2016-01-01

The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature

Two yeast species Cystobasidium psychroaquaticum f.a. sp. nov. and Cystobasidium rietchieii f.a. sp. nov. isolated from natural environments, and the transfer of Rhodotorula minuta clade members to the genus Cystobasidium

NARCIS (Netherlands)

Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D

Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic

[First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].

Science.gov (United States)

Madrid Lorca, Hugo; Muñoz, Mélica

2006-06-01

Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

Fungal Systematics and Evolution: FUSE 3

NARCIS (Netherlands)

Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying

2017-01-01

The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra

Long-term Maintenance of Fungal Cultures on Perlite in Cryovials – an Alternative for Agar Slants

Czech Academy of Sciences Publication Activity Database

Homolka, Ladislav; Lisá, Ludmila

2008-01-01

Roč. 53, č. 6 (2008), s. 534-536 ISSN 0015-5632 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete * perlite * long-term maintenance Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

Science.gov (United States)

Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia

2015-01-01

Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839

Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina

Czech Academy of Sciences Publication Activity Database

Tomšovský, Michal; Homolka, Ladislav

2004-01-01

Roč. 25, č. 1 (2004), s. 49-55 ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004

Taxonomic studies in Chrysoderma, Corneromyces, Dendrophsellum, Hyphoradulum, and Mycobonia

Science.gov (United States)

Karen K. Nakasone

2015-01-01

Eight poorly known or unusual crustose and pileate basidiomycete species were studied. These included the type specimens of three monotypic genera: Chrysoderma alboluteum from Réunion is conspecific with Cerocorticium molle; Dendrophysellum amurense from the Russian Far East is a species of Vararia; and ...

ASSIGNMENT OF GENES TO PULSE-FIELD SEPARATED CHROMOSOMES OF SCHIZOPHYLLUM-COMMUNE

NARCIS (Netherlands)

ASGEIRSDOTTIR, SA; SCHUREN, FHJ; WESSELS, JGH

Chromosomal DNAs of the basidiomycete Schizophyllum commune were separated by Contour-Clamped Homogeneous Electric Field Electrophoresis (CHEF). The estimated sizes of the chromosomal DNAs ranged from 4.7 Megabase pairs (Mbp) to 1.6 Mbp, totalling 35.6 Mbp. Using sequences from 20 cloned genes we

The genus Actiniceps Berk. & Br

NARCIS (Netherlands)

Boedijn, K.B.

1959-01-01

The genus Actiniceps Berk. & Br. is shown to be a Basidiomycete. Wiesnerina Höhn. and Dimorphocystis Corner are regarded synonymous. The type species A. thwaitesii Berk. & Br. is redescribed with D. capitatus Corner as synonym. The following new combinations are proposed: A. horrida (Höhn.) Boedijn,

Phylogenetic position and physiology of Cerinosterus cyanescens

NARCIS (Netherlands)

Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

2000-01-01

Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

Clonality and α-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia

NARCIS (Netherlands)

Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland

2011-01-01

Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the

Bioconcentration of manganese and iron in Panaeoloideae Sing

NARCIS (Netherlands)

Stijve, T.; Blake, C.

1994-01-01

According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae,

First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia

Science.gov (United States)

Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...

Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

NARCIS (Netherlands)

Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

2008-01-01

Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

Science.gov (United States)

Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

A novel expansin protein from the white-rot fungus Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Omar Eduardo Tovar-Herrera

Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.

Structural Identification of Lentinus edodes Cellulose Derivative that ...

African Journals Online (AJOL)

... aspartic acid, leucine and alanine. Conclusion: CED was identified as a complex of peptide and polysaccharide structures possessing β- (1, 4)-glucan backbones, and it provides a theoretical basis for developing polysaccharide preparations to control aflatoxin contamination with medical and food science applications.

A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao

Science.gov (United States)

The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

Identification and first report of Inonotus (Phellinus) tropicalis as an etiologic agent in a patient with chronic granulomatous disease

Science.gov (United States)

D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul

2005-01-01

Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.

Proteomic and functional analysis of the cellulase system expressed by Postia placenta during brown rot of solid wood

Science.gov (United States)

Jae San Ryu; Semarjit Shary; Carl J. Houtman; Ellen A. Panisko; Premsagar Korripally; Franz J. St. John; Casey Crooks; Matti Siika-aho; Jon K. Magnuson; Kenneth E. Hammel

2011-01-01

Brown rot basidiomycetes have an important ecological role in lignocellulose recycling and are notable for their rapid degradation of wood polymers via oxidative and hydrolytic mechanisms. However, most of these fungi apparently lack processive (exo-acting) cellulases, such as cellobiohydrolases, which are generally required for efficient cellulolysis. The recent...

Comparative transcriptome and secretome analysis of wood decay fungi Postia placenta and Phanerochaete chrysosporium

Science.gov (United States)

Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen

2010-01-01

Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...

INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI

NARCIS (Netherlands)

DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH

Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted

Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

Science.gov (United States)

Chiaki Hori; Takuya Ishida; Kiyohiko Igarashi; Masahiro Samejima; Hitoshi Suzuki; Emma Master; Patricia Ferreira; Francisco J. Ruiz-Duenas; Benjamin Held; Paulo Canessa; Luis F. Larrondo; Monika Schmoll; Irina S. Druzhinina; Christian P. Kubicek; Jill A. Gaskell; Phil Kersten; Franz St. John; Jeremy Glasner; Grzegorz Sabat; Sandra Splinter Bondurant; Khajamohiddin Syed; Jagjit Yadav; Anthony C. Mgbeahuruike; Andriy Kovalchuk; Fred O. Asiegbu; Gerald Lackner; Dirk Hoffmeister; Jorge Recoret; Ana Gutierrez; Hui Sun; Erika Lindquist; Kerrie Barry; Robert Riley; Igor V. Grigoriev; Bernard Henrissat; Ursula Kues; Randy M. Berka; Angel T. Martinez; Sarah F. Covert; Robert A. Blanchette; Daniel Cullen

2014-01-01

Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other...

Author Details

African Journals Online (AJOL)

Goud, MJP. Vol 2, No 3 (2007) - Articles Antibacterial activity and biomolecular composition of certain fresh water micro-algae from River Godavari (India) Abstract PDF · Vol 3, No 1 (2008) - Articles Replica plate screening method for detecting phosphatase activity in basidiomycetes using 1-Napthyl Phosphate as a ...

Growth of higher fungi on wheat straw and their impact on the digestibility of the substrate

Energy Technology Data Exchange (ETDEWEB)

Moyson, E.; Verachtert, H. (Catholic Univ. of Leuven (Belgium). Faculty of Agriculture)

1991-12-01

The influence of the growth of three higher fungi on the composition of wheat straw was investigated. Pleurotus pulmonarius, P. sajor-caju and Lentinus edodes grew very well on lignocellulosic substrates, breaking down a considerable amount of lignin. The initial lignin concentration of straw was halved after 12 weeks of fungal growth, doubling the enzymic digestibility. Together with lignin, the higher fungi consumed half of the amount of hemicellulose (i.e. 15%), leaving cellulose fairly intact, which should remain as an energy source for ruminants. (orig.).

Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura

Directory of Open Access Journals (Sweden)

Carlos da Silva Lacaz

1996-10-01

Full Text Available The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum commune. Lesions of the buccal mucosa, brain abscesses, onychomycosis and endocarditis have been described, with a growing interest in this type of deep mycosis on the part of mycologists and infectologists. The present paper reports descriptions of mycetism as well as infectious processes caused by basidiomycetes, such as Schizophyllum commune, Ustilago maydis (= Ustilago zeae and Coprinus cinereusAs basidiomicoses, infecções fúngicas provocadas por basidiomicetos ou agáricos vêm sendo registradas cada vez com maior frequência na literatura médica, principalmente após o advento da AIDS/SIDA, em 1981. Os basidiosporos desses fungos, espalhados na atmosfera e veiculados através do vento ou de correntes aéreas, atingem por via nasal os seios maxilares, provocando quadros de sinusite crônica, na maioria das vezes. Do escarro também têm sido isolados basidiomicetos, principalmente o Schizophyllum commune. Lesões da mucosa da boca, abscessos cerebrais, onicomicoses e endocardites já foram descritas, aumentando o interesse dos micologistas e infectologistas para este tipo de micose profunda. O presente trabalho assinala, ao lado dos quadros dc micetismo, processos infecciosos provocados por basidiomicetos, a exemplo do Schizophyllum commune, Ustilago maydis (= Ustilago zeae e Coprinus cinereus.

Enzyme activities of fungi associated with Picea abies needles

Czech Academy of Sciences Publication Activity Database

Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr

2011-01-01

Roč. 4, č. 6 (2011), s. 427-436 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

Elevated tropospheric CO2 and O3 may not alter initial wood decomposition rate or wood-decaying fungal community composition of Northern hardwoods

Science.gov (United States)

Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser

2016-01-01

We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...

Humic Acid-Like Material from Sewage Sludge Stimulates Culture Growth of Ectomycorrhizal Fungi in Vitro

Czech Academy of Sciences Publication Activity Database

Hršelová, Hana; Soukupová, Lucie; Gryndler, Milan

2007-01-01

Roč. 52, č. 6 (2007), s. 627-630 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540 Institutional research plan: CEZ:AV0Z50200510 Keywords : ectomycorrhizal basidiomycetes * sewage sludge * humic-acid-like materials Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

Functional foods from mushroom

Science.gov (United States)

Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

Science.gov (United States)

2009-03-01

tolerate 3,000–5000 Gy, but are rendered sterile. As a haploid, the basidiomycete fungus Ustilago maydis carries a single set of chromosomes per...salinarum NRC-1. Environ. Microbiol. 5 Jan 2009 (doi:10.1111/j.1462-2920.2008.01828.x). 21. Chan, H. L. et al. Proteomic analysis of UVC irradiation

Transcriptome and secretome analyses of the wood decay fungus Wolfiporia cocos support alternative mechanisms of lignocellulose conversion

Science.gov (United States)

Jill Gaskell; Robert A. Blanchette; Philip E. Stewart; Sandra Splinter BonDurant; Marie Adams; Grzegorz Sabat; Philip Kersten; Daniel Cullen

2016-01-01

Certain wood decay basidiomycetes, collectively referred to as brown rot fungi, rapidly depolymerize cellulose while leaving behind the bulk of cell wall lignin as a modified residue. The mechanism(s) employed is unclear, but considerable evidence implicates the involvement of diffusible oxidants generated via Fenton-like chemistry. Toward a better understanding of...

Significant alteration of gene expression in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species

Science.gov (United States)

Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen

2011-01-01

Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...

Moniliophthora roreri Genome and Transcriptome

Science.gov (United States)

Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

Draft genome sequence of the white-rot fungus Obba rivulosa 3A-2

Science.gov (United States)

Otto Miettinen; Robert Riley; Kerrie Barry; Daniel Cullen; Ronald P. de Vries; Matthieu Hainaut; Annele Hatakka; Bernard Henrissat; Kristiina Hilden; Rita Kuo; Kurt LaButti; Anna Lipzen; Miia R. Makela; Laura Sandor; Joseph W. Spatafora; Igor V. Grigoriev; David S. Hibbett

2016-01-01

We report here the first genome sequence of the white-rot fungus Obba rivulsa (Polyporales, Basidiomycota), a polypore known for its lignin-decomposing ability. The genome is based on the homokaryon 3A-2 originating in Finland. The genome is typical in size and carbohydrate active enzyme (CAZy) content for wood-decomposing basidiomycetes.

Survey of radiocesium in domestic mushrooms on the market

International Nuclear Information System (INIS)

Kawamura, Yoko; Uchiyama, Sadao; Saito, Yukio

1991-01-01

Domestic mushrooms on the market were tested for concentration of radiocesium; cesium-134 and 137 by γ-ray spectrometer. Cesium-137 was detected in most samples of dried and raw shiitake (Lentinus edodes (Berk.) Sing.). The concentrations were from 6.7 to 73.9 Bq/kg in dried ones and from 1.3 to 6.4 Bq/kg in raw ones. It was not detected in enokitake (Flammulina veltipes (Fr.) Sing.) and shimeji (Lyophyllum aggregatum (Secr.) Kuhner and Pliurotus ostreatus (Fr.) Quel.). Cesium-134 was not found in all samples. (author)

A ribonuclease from the wild mushroom Boletus griseus.

Science.gov (United States)

Wang, Hexiang; Ng, T B

2006-10-01

A ribonuclease (RNase) with a molecular mass of 29 kDa and cospecific for poly A and poly U was isolated from fruiting bodies of the mushroom Boletus griseus. Its N-terminal sequence exhibited some similarity to those of RNases from the mushrooms Irpex lacteus and Lentinus edodes. The RNase was adsorbed on diethylaminoethyl-cellulose, Q-Sepharose, and Affi-gel blue gel and was unadsorbed on CM-cellulose. The enzyme exhibited a temperature optimum between 60 and 70 degrees C and a pH optimum at 3.5.

Survey of radiocesium in domestic mushrooms on the market

Energy Technology Data Exchange (ETDEWEB)

Kawamura, Yoko; Uchiyama, Sadao; Saito, Yukio (National Inst. of Hygienic Sciences, Tokyo (Japan))

1991-01-01

Domestic mushrooms on the market were tested for concentration of radiocesium; cesium-134 and 137 by {gamma}-ray spectrometer. Cesium-137 was detected in most samples of dried and raw shiitake (Lentinus edodes (Berk.) Sing.). The concentrations were from 6.7 to 73.9 Bq/kg in dried ones and from 1.3 to 6.4 Bq/kg in raw ones. It was not detected in enokitake (Flammulina veltipes (Fr.) Sing.) and shimeji (Lyophyllum aggregatum (Secr.) Kuhner and Pliurotus ostreatus (Fr.) Quel.). Cesium-134 was not found in all samples. (author).

Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

Science.gov (United States)

Ngai, Patrick H K; Ng, T B

2003-11-14

From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

Composición y cuantificación por cromatografía de gases acoplada a espectrometría de masas de la fracción esterólica de once hongos colombianos

Directory of Open Access Journals (Sweden)

Augusto Rivera

2010-09-01

Full Text Available La composición de la fracción esterólica de los hongos Ganoderma australe, Ganoderma lucidum, Amanita rubescens, Licoperdon perlatum, Lentinula edades, Coltricia hammata. Lacearía laccata, Suillus luteus, Panus panoides, Macrolepiota colombiana y Agaricus bisporus se estableció mediante la técnica combinada CG-EM. La cuantificación individual de los esteróles presentes en esta fracción se realizó igualmente por CG-EM usando estigmasterol como estándar interno. Los resultados demostraron qyxe. Agaricus bisporus solo contiene ergosterol y por ello, adicionalmente, se esmdio su fracción esterólica a diferentes etapas de desarrollo del hongo.

Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications

Science.gov (United States)

Cathy L. Cripps

2001-01-01

Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...

Purification, molecular cloning, and enzymatic properties of a family 12 endoglucanase (EG-II) from fomitopsis palustris: role of EG-II in larch holocellulose hydrolysis.

Science.gov (United States)

Shimokawa, Tomoko; Shibuya, Hajime; Nojiri, Masanobu; Yoshida, Shigeki; Ishihara, Mitsuro

2008-09-01

A family 12 endoglucanase with a molecular mass of 23,926 Da (EG-II) from the brown-rot basidiomycete Fomitopsis palustris was purified and characterized. One of the roles of EG-II in wood degradation is thought to be to loosen the polysaccharide network in cell walls by disentangling hemicelluloses that are associated with cellulose.

Carbohydrate-active enzymes from the zygomycete fungus Rhizopus oryzae: a highly specialized approach to carbohydrate degradation depicted at genome level

Directory of Open Access Journals (Sweden)

Henrissat Bernard

2011-01-01

Full Text Available Abstract Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs and a high number of glycosyl transferases (GTs and carbohydrate esterases (CEs. A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars, chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota.

Pretreatment of lignocellulosic material with fungi capable of higher lignin degradation and lower carbohydrate degradation improves substrate acid hydrolysis and the eventual conversion to ethanol

Energy Technology Data Exchange (ETDEWEB)

Kuhar, S.; Nair, L.M.; Kuhad, R.C. [Delhi Univ., New Delhi (India). Dept. of Microbiology, Lignocellulose Biotechnology Laboratory

2008-04-15

Lignocellulosic biomass is the most abundant energy resource in the world and is a potential source of carbon substrate for the production of ethanol via fermentation. However, the presence of lignin restricts access to holocellulose. It is necessary to break or remove the lignin in plant residues prior to their hydrolysis. Pretreatment is needed to liberate cellulose and hemicellulose from the lignins. This paper discussed a biological delignification method that avoided the use of toxic and corrosive chemicals. The in situ microbial delignification process used white rot fungi as a basidiomycetes for biological pretreatment. The study examined the capability of 4 basidiomycetes fungi, notably: (1) Phanerochaete chrysosporium; (2) Pycnoporus cinnabarinus; (3) fungal isolate RCK-1; and (4) fungal isolate RCK-3. The fungi were used to delignify wheat straw and improve hydrolysis procedures. Attempts were also made to ferment the acid hydrolysates from fungal-pretreated lignocellulosic materials. Results of the experiment showed that higher yields of ethanol were obtained using selective lignin-degrading fungi as a pretreatment method. 39 refs., 3 tabs., 4 figs.

New data on agaricoid fungi of the Katunsky State Nature Reserve and rare fungi of the Republic of Altai (Russia

Directory of Open Access Journals (Sweden)

Irina A. Gorbunova

2017-08-01

Full Text Available The article presents new data on agaricoid basidiomycetes of the Katunsky State Nature Reserve (Republic of Altai, Russia, including data on rare species. Besides the paper contains characteristics of some rare ascomycetes and basidiomycetes found in the Katunsky Reserve and in the Republic of Altai as well as about species recommended for inclusion in the new edition of the Red Data Book of the Republic of Altai. In total descriptions of 17 species of macromycetes are presented. These are Chroogomphus sibiricus, Cortinarius violaceus, Floccularia luteovirens, Ganoderma lucidum, Grifola frondosa, Lactarius lignyotus, Leucoagaricus nympharum, Leucopholiota lignicola, Gastrosporium simplex, Gyromitra sphaerospora, Laricifomes officinalis, Bovista acuminata, Hydropus atramentosus, Leucopaxillus rhodoleucus, Phallus costatus, Polyozellus multiplex and Polyporus rhizophilus. We present data on species' distribution throughout the Republic of Altai, Russia and the world; some ecological and biological features of species; major threats and their conservation status. Arguments for exclusion of Amanita echinocephala, Hericium coralloides, Cystoderma rugosoreticulatum, Leccinum percandidum, Mutinus caninus from the list of rare species of the region are presented.

Bio-softening of mature coconut husk for facile coir recovery.

Science.gov (United States)

Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

2007-06-01

Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

Global warming and mycoflora in the Baltic Region

Directory of Open Access Journals (Sweden)

Hanns Kreisel

2013-12-01

Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

Enzymology and molecular biology of lignin degradation

Science.gov (United States)

D. Cullen; P.J. Kersten

2004-01-01

This review provides an overview of the physiology and genetics of lignin degradation by white rot basidiomycetes. Emphasis is on recent advances and the reader is referred to earlier comprehensive reviews for historical perspective and background (Kirk and Farrell 1987; Gold and Alic 1993; Higuchi 1993; Cullen and Kersten 1996; Cullen 1997). Recent completion of a...

Fungal bioremediation of the creosote-contaminated soil: Influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study

Czech Academy of Sciences Publication Activity Database

Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr

2008-01-01

Roč. 2008, č. 73 (2008), s. 1518-1523 ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008

SECONDARY METABOLITES FROM MARINE PENICILLIUM BREVICOMPACTUM

OpenAIRE

ROVIROSA, JUANA; DIAZ-MARRERO, ANA; DARIAS, JOSE; PAINEMAL, KARIN; SAN MARTIN, AURELIO

2006-01-01

In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.

EFFECTS OF LIGHT WAVELENGTHS AND COHERENCE ON BASIDIOSPORES GERMINATION

Directory of Open Access Journals (Sweden)

Natalia Poyedinok

2015-02-01

Full Text Available The effects of light wavelengths and coherence on basidiospore germination of Agaricus bisporus, Flammulina velutipes, Ganoderma applanatum, Ganoderma lucidum, Hericium erinaceus, Lentinus edodes and Pleurotus ostreatus have been studied. Short-term low-intensity irradiation by coherent (laser light wavelength 488.0 nm and 632.8 nm at doses 45 and 230 mJ/cm2 has significantly increased the number of germinated basidiospores. It has established that there are differences in the photosensitivity not only between species but also between strains. Spores irradiation by 514.5 nm light has been either neutral or inhibitory. A comparative analysis of basidiospores sensitivity to laser and LED light has also been conducted. To stimulate germination of basidiospores and growth of monokaryons the most suitable solution was to use red coherent and incoherent light of 632.8 nm and 660,0 nm for A. bisporus, G. applanatum and P. ostreatus, red and blue coherent light of 632.8 nm and 488,0 nm for F. velutipes, and both red and blue laser and LED light G. lucidum and H. erinaceus and for L. edodes. No essential difference of a continuous wave mode and intermittent mode light effect at the same doses and wavelength on spore germination were revealed. Light influence has reduced germination time and formation of aerial mycelium on agar medium as compared to the original value and increased the growth rate of monosporous isolates. Characterization of basidiospores photosensitivity and development of environmentally friendly stimulating methods of their germination is important for creating highly effective technologies of mushrooms selection and cultivation.

Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

International Nuclear Information System (INIS)

Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

2009-01-01

The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

2009-07-01

The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Science.gov (United States)

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Environmental Assessment for the Continued Exclusive Use of Department of the Army Land Located at U.S. Army Dugway Proving Ground by Members of the U.S. Air Force

Science.gov (United States)

2012-07-01

canned and prepared foods with gamma rays in an effort to kill micro -organisms, trichina in pork, and food-infesting insects (DPG 2001). The Avery...microcommunity consisting of fungi (Basidiomycetes), lichens, soil algae , and mosses typically occurring in semiarid regions. Cyanobacteria-dominated soil... ponds , playas, and wetlands. Constructed surface water features include wastewater lagoons, evaporation ponds , an excavated pond , a bermed pond , and

Cellobiose dehydrogenase of Chaetomium sp. INBI 2-26(-): structural basis of enhanced activity toward glucose at neutral pH.

Science.gov (United States)

Vasilchenko, Liliya G; Karapetyan, Karen N; Yershevich, Olga P; Ludwig, Roland; Zamocky, Marcel; Peterbauer, Clemens K; Haltrich, Dietmar; Rabinovich, Mikhail L

2011-05-01

Cellobiose dehydrogenase (CDH) is an extracellular fungal flavocytochrome specifically oxidizing cellooligosaccharides and lactose to corresponding (-lactones by a variety of electron acceptors. In contrast to basidiomycetous CDHs, CDHs of ascomycetes also display certain activity toward glucose. The objective of this study was to establish the structural reasons of such an activity of CDH from mesophilic ascomycete Chaetomium sp. INBI 2-26 (ChCDH). The complete amino acid sequence of ChCDH displayed high levels of similarity with the amino acid sequences of CDHs from the thermophilic fungi Thielavia heterotallica and Myriococcum thermophilum. Peptide mass fingerprinting of purified ChCDH provided evidence for the oxidation of methionine residues in the FAD-domain. Comparative homology modeling of the structure of the ChCDH FAD-domain in complex with the transition state analog based on the structure of the same complex of basidiomycetous CDH (1NAA) as template indicated possible structural reasons for the enhanced activity of ascomycetous CDHs toward glucose at neutral pH, which is a prerequisite for application of CDH in a variety of biocompatible biosensors and biofuel cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

NARCIS (Netherlands)

Driel, K.G.A. van

2007-01-01

Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

New records of truffle fungi (Basidiomycetes) from Turkey

Science.gov (United States)

Aziz Turkoglu; Michael Angelo. Castellano

2013-01-01

We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

Science.gov (United States)

Yitzhak Hadar; Daniel Cullen

2013-01-01

Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

Preservation of live cultures of basidiomycetes - Recent methods

Czech Academy of Sciences Publication Activity Database

Homolka, Ladislav

2014-01-01

Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Science.gov (United States)

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Secretome-based Manganese(II) Oxidation by Filamentous Ascomycete Fungi

Science.gov (United States)

Zeiner, C. A.; Purvine, S.; Zink, E.; Paša-Tolić, L.; Chaput, D.; Wu, S.; Santelli, C. M.; Hansel, C. M.

2017-12-01

Manganese (Mn) oxides are among the strongest oxidants in the environment, and Mn(II) oxidation to Mn(III/IV) (hydr)oxides includes both abiotic and microbially-mediated processes. While white-rot Basidiomycete fungi oxidize Mn(II) using laccases and Mn peroxidases in association with lignocellulose degradation, the mechanisms by which filamentous Ascomycete fungi oxidize Mn(II) and a physiological role for Mn(II) oxidation in these organisms remain poorly understood. Through a combination of chemical and in-gel assays, bulk mass spectrometry, and iTRAQ proteomics, we demonstrate enzymatic Mn(II) oxidation in the secretomes of three phylogenetically diverse Ascomycetes that were isolated from Mn-laden sediments. Candidate Mn(II)-oxidizing enzymes were species-specific and included bilirubin oxidase and tyrosinase in Stagonospora sp. SRC1lsM3a, GMC oxidoreductase in Paraconiothyrium sporulosum AP3s5-JAC2a, and FAD-binding oxidoreductases in Pyrenochaeta sp. DS3sAY3a. These findings were supported by full proteomic characterization of the secretomes, which revealed a lack of Mn, lignin, and versatile peroxidases in these Ascomycetes but a substantially higher proportion of LMCOs and GMC oxidoreductases compared to wood-rot Basidiomycetes. We also identified the potential for indirect enzymatic Mn(II) oxidation by hydroxyl radical, as the secretomes were rich in diverse lignocellulose-degrading enzymes that could participate in Fenton chemistry. A link between Mn(II) oxidation and carbon oxidation analogous to white-rot Basidiomycetes remains unknown in these Ascomycetes. Interestingly, growth rates on rich medium were unaffected by the presence of Mn(II), and the production of Mn(II)-oxidizing proteins in the secretome was constitutive and not inducible by Mn(II). Thus, no physiological benefit of Mn(II) oxidation in these Ascomycetes has yet been identified, and Mn(II) oxidation appears to be a side reaction. Future work will explore the lignin-degrading capacity of

Laboratory studies of the degradation of chloropyrifos pesticide in soils supplemented by the fungus Phanerochaete chrysosporium

International Nuclear Information System (INIS)

Lopera Mesa, Margarita Maria; Penuela Mesa, Gustavo Antonio; Dominguez Gual, Maria Carolina; Mejia Zapata, Gloria Maria

2005-01-01

Degradation of the insecticide chloropyrifos was investigated in sterilized soil samples supplemented by the white rot basidiomycetes Phanerochaete chrysosporium. Degradation rates were measured during 21-day incubation at pesticide concentrations of 0,95, 5,3, and 9,41 μ/g. Phanerochaete chrysosporium showed ability to biodegrade the insecticide in values of 96,3%, 82,4% and 62,2%, respectively, followed by rapid degradation at low initial concentration of chloropyrifos

Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations

OpenAIRE

MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan

2007-01-01

Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...

The yeast flora of some decaying mushrooms on trunks of living trees

OpenAIRE

Middelhoven, W.J.

2004-01-01

Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Science.gov (United States)

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...