WorldWideScience

Sample records for basidiomycete coprinus cinereus

  1. Magnetic resonance spectral characterization of the heme active site of Coprinus cinereus peroxidase

    International Nuclear Information System (INIS)

    Lukat, G.S.; Rodgers, K.R.; Jabro, M.N.; Goff, H.M.

    1989-01-01

    Examination of the peroxidase isolated from the inkcap Basidiomycete Coprinus cinereus shows that the 42,000-dalton enzyme contains a protoheme IX prosthetic group. Reactivity assays and the electronic absorption spectra of native Coprinus peroxidase and several of its ligand complexes indicate that this enzyme has characteristics similar to those reported for horseradish peroxidase. In this paper, the authors characterize the H 2 O 2 -oxidized forms of Coprinus peroxidase compounds I, II, and III by electronic absorption and magnetic resonance spectroscopies. Electron paramagnetic resonance (EPR) and nuclear magnetic resonance (NMR) studies of this Coprinus peroxidase indicate the presence of high-spin Fe(III) in the native protein and a number of differences between the heme site of Coprinus peroxidase and horseradish peroxidase. Carbon-13 (of the ferrous CO adduct) and nitrogen-15 (of the cyanide complex) NMR studies together with proton NMR studies of the native and cyanide-complexed Caprinus peroxidase are consistent with coordination of a proximal histidine ligand. The EPR spectrum of the ferrous NO complex is also reported. Protein reconstitution with deuterated hemin has facilitated the assignment of the heme methyl resonances in the proton NMR spectrum

  2. Production and characterization of radiation-sensitive meiotic mutants of Coprinus cinereus

    International Nuclear Information System (INIS)

    Zolan, M.E.; Tremel, C.J.; Pukkila, P.J.

    1988-01-01

    We have isolated four gamma-sensitive mutants of the basidiomycete Coprinus cinereus. When homozygous, two of these (rad 3-1 and rad 9-1) produce fruiting bodies with very few viable basidiospores, the products of meiosis in this organism. A less radiation-sensitive allele of RAD 3, rad 3-2, causes no apparent meiotic defect in homozygous strains. Quantitative measurements of oidial survival of rad 3-1;rad 9-1 double mutants compared to the single mutants indicated that rad 3-1 and rad 9-1 mutants are defective in the same DNA repair pathway. In the pew viable basidiospores that are produced by these two strains, essentially normal levels of meiotic recombination can be detected. None of the mutants exhibits increased sensitivity to UV radiation. Cytological examination of meiotic chromosomes from mutant and wild-type fruiting bodies showed that rad 3-1 homozygous strains fail to condense and pair homologous chromosomes during prophase I. Although rad 9-1 strains are successful at chromosome pairing, meiosis is usually not completed in these mutants

  3. Decolorization of the anthraquinone dye Cibacron Blue 3G-A with immobilized Coprinus cinereus in fluidized bed bioreactor.

    Science.gov (United States)

    Moutaouakkil, A; Blaghen, M

    2011-01-01

    Coprinus cinereus, which was able to decolorize the anthraquinone dye Cibacron Blue 3G-A (CB) enzymatically, was used as a biocatalyst for the decolorization of synthetic solutions containing this reactive dye. Coprinus cinereus was immobilized in both calcium alginate and polyacrylamide gels, and was used for the decolorization of CB from synthetic water by using a fluidized bed bioreactor. The highest specific decolorization rate was obtained when Coprinus cinereus was entrapped in calcium alginate beads, and was of about 3.84 mg g(-1) h(-1) with a 50% conversion time (t1/2) of about 2.60 h. Moreover, immobilized fungal biomass in calcium alginate continuously decolorized CB even after 7 repeated experiments without significant loss of activity, while polyacrylamide-immobilized fungal biomass retained only 67% of its original activity. The effects of some physicochemical parameters such as temperature, pH and dye concentration on decolorization performance of isolated fungal strain were also investigated.

  4. Mapping genes by meiotic and UV-induced mitotic recombination in Coprinus cinereus

    International Nuclear Information System (INIS)

    Amirkhanian, J.D.; Cowan, J.W.

    1985-01-01

    Three morphological mutants in Coprinus cinereus—one spontaneous (den-2) and two chemically induced (zigand sta)—were assigned to linkage groups and utilized in meiotic and mitotic mapping. Mutants den-2 and zig belong to linkage group III, den-2 being close to the centromere and about 20 map units (mu) from zig. The mutant sta in linkage group ‘G’ is at a distance of about 37 mu from ade-3. Mitotic mapping confirmed the gene order in linkage group III and provided evidence that trp-2 in linkage group ‘G’ was between the centromere and ade-3. These morphological mutants are compact in colony growth and therefore suited to high-density plating. The rarity of spontaneously occurring mitotic segregants suggests that diploids of Coprinus cinereus, heterozygous for morphoiogical markers in repuision, could serve as useful test systems for rapid screening of chemical mutagen/carcinogens via mitotic recombination studies

  5. Screening of Coprinus species for the production of extracellular peroxidase and evaluation of its applicability to the treatment of aqueous phenol

    International Nuclear Information System (INIS)

    Ikehata, K.; Buchanan, I.D.

    2002-01-01

    Twenty-nine strains of Coprinus species comprising 16 strains from 12 identified species and 13 unidentified strains as well as one Arthromyces ramosus strain were screened for the production of extracellular peroxidase. Among the fungi examined, three strains of C. cinereus, UAMH 4103, UAMH 7907 and IFO 30116, as well as one Coprinus sp., UAMH 10067, which was isolated from urea treated soil, were shown to produce large amounts of extracellular peroxidase. The performance of crude peroxidase, obtained from liquid culture of C. cinereus, (CIP) on phenol removal from synthetic wastewater was evaluated and compared with that of purified horseradish peroxidase and A. ramosus peroxidase. Although crude CIP performed better than both purified enzymes, its superiority vanished in the presence of poly(ethylene glycol), a known protective agent of peroxidase. This suggests that the residual soluble substances present in crude CIP have protective effects similar to those of poly(ethylene glycol). (author)

  6. Studies in Coprinus V — Coprinus section Coprinus. Revision of subsection Lanatuli Sing

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1999-01-01

    A key is given to the species of subsection Lanatuli known from the Netherlands or to be expected in the Netherlands on account of records from neighbouring countries. For a key to the subsections in Coprinus section Coprinus see Uljé & Noordel., Persoonia 16 (1997) 267. Coprinus bicornis and C.

  7. Studies in Coprinus IV — Coprinus section coprinus. Subdivision and revision of subsection Alachuani

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1997-01-01

    Coprinus section Coprinus is defined and delimited to comprise four subsections: Atramentarii, Coprinus, Lanatuli and Alachuani. A key to the subsections is given as well as a key to the species of subsection Alachuani known from the Netherlands or to be expected in the Netherlands on account of

  8. Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura

    Directory of Open Access Journals (Sweden)

    Carlos da Silva Lacaz

    1996-10-01

    Full Text Available The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum commune. Lesions of the buccal mucosa, brain abscesses, onychomycosis and endocarditis have been described, with a growing interest in this type of deep mycosis on the part of mycologists and infectologists. The present paper reports descriptions of mycetism as well as infectious processes caused by basidiomycetes, such as Schizophyllum commune, Ustilago maydis (= Ustilago zeae and Coprinus cinereusAs basidiomicoses, infecções fúngicas provocadas por basidiomicetos ou agáricos vêm sendo registradas cada vez com maior frequência na literatura médica, principalmente após o advento da AIDS/SIDA, em 1981. Os basidiosporos desses fungos, espalhados na atmosfera e veiculados através do vento ou de correntes aéreas, atingem por via nasal os seios maxilares, provocando quadros de sinusite crônica, na maioria das vezes. Do escarro também têm sido isolados basidiomicetos, principalmente o Schizophyllum commune. Lesões da mucosa da boca, abscessos cerebrais, onicomicoses e endocardites já foram descritas, aumentando o interesse dos micologistas e infectologistas para este tipo de micose profunda. O presente trabalho assinala, ao lado dos quadros dc micetismo, processos infecciosos provocados por basidiomicetos, a exemplo do Schizophyllum commune, Ustilago maydis (= Ustilago zeae e Coprinus cinereus.

  9. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  10. Type studies in Coprinus subsection Lanatuli

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    2001-01-01

    As a prelude to a monograph of the genus Coprinus, types were studied of a number of species said to belong to Coprinus subsection Lanatuli (Coprinus alnivorus. C. alutaceivelatus, C. ammophilae, C. arachnoideus, C. asterophoroides, C. brunneistragulatus, C. bubalinus, C. citrinovelatus, C.

  11. Studies in Coprinus III — Coprinus section Veliformes. Subdivision and revision of subsection Nivei emend

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1993-01-01

    Coprinus section Veliformes is defined and delimited to comprise four subsections: subsection Micacei, subsection Domestici, subsection Nivei, and subsection Narcotici, subsection nov. A key to the subsections is given. Subsection Nivei is emended, including also most taxa of subsection Flocculosi

  12. Isolation and biological activity of triglycerides of the fermented mushroom of Coprinus Comatus

    Directory of Open Access Journals (Sweden)

    Ren Jun

    2012-04-01

    Full Text Available Abstract Background Although many physiological functions of Coprinus comatus have been reported, there has been no report on the antinociceptive activity of Coprinus comatus. Therefore, the objective of the present study is to demonstrate the production, isolation, and biological properties of triglycerides (TFC of the fermented mushroom of Coprinus comatus. Methods The effects of TFC on cytokines levels, total antioxidant activity, antinociceptive effects in vivo, LD50 and tactile hyperalgesia were analyzed respectively. Results TFC treatment decreased the levels of cytokines and total antioxidant status (TAOS and inhibited the acetic acid-induced abdominal constrictions in mice. In addition, TFC reduced CFA-induced tactile hyperalgesia in a dose-dependent manner and the LD50 of TFC was determined to be 400 mg/kg. However, TFC did not significantly inhibit the reaction time to thermal stimuli in the hot-plate test. Conclusions TFC showed anti-inflammatory, antioxidant, peripheral antinociceptive and antihyperalgesic activity in various models of inflammatory pain. The data suggest that TFC may be a viable treatment option for inflammatory pain.

  13. Maxillary sinusitis from Microascus cinereus and Aspergillus repens.

    Science.gov (United States)

    Aznar, C; de Bievre, C; Guiguen, C

    1989-02-01

    Microascus was associated with Aspergillus repens in a left maxillary sinus. Tissue contained septale filaments of two types, conidia, ostiolate perithecia containing ascospores corresponding to Microascus cinereus which was identified by culture. The abundance of sexual fructifications in the tissue indicates that pathogenicity is due to Microascus cinereus.

  14. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

    Science.gov (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

    2014-01-01

    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  15. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  16. Fungicide selective for basidiomycetes.

    Science.gov (United States)

    Edgington, L V; Walton, G S; Miller, P M

    1966-07-15

    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  17. Structural investigation of water-soluble polysaccharides extracted from the fruit bodies of Coprinus comatus

    NARCIS (Netherlands)

    Li, Bo; Dobruchowska, Justyna M.; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

    2013-01-01

    Water-soluble polysaccharide material, extracted from the stipes of the fruit bodies of Coprinus comatus by hot water, was fractionated by sequential weak anion-exchange and size-exclusion chromatography. The relevant fractions were subjected to structural analysis, including (D/L)

  18. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  19. Can the eastern red-backed salamander (Plethodon cinereus) persist in an acidified landscape?

    Science.gov (United States)

    Bondi, Cheryl A; Beier, Colin M.; Ducey, Peter K; Lawrence, Gregory B.; Bailey, Scott W.

    2016-01-01

    Hardwood forests of eastern North America have experienced decades of acidic deposition, leading to soil acidification where base cation supply was insufficient to neutralize acid inputs. Negative impacts of soil acidity on amphibians include disrupted embryonic development, lower growth rates, and habitat loss. However, some amphibians exhibit intraspecific variation in acid tolerance, suggesting the potential for local adaptation in areas where soils are naturally acidic. The eastern red-backed salamander (Plethodon cinereus) is a highly abundant top predator of the northern hardwood forest floor. Early research found that P. cinereus was sensitive to acidic soils, avoiding substrates with pH habitats. However, recent studies have documented P. cinereus populations in lower pH conditions than previously observed, suggesting some populations may persist in acidic conditions. Here, we evaluated relationships between organic horizon soil pH and P. cinereus abundance, adult health (body size and condition), and microhabitat selection, based on surveys of 34 hardwood forests in northeastern United States that encompass a regional soil pH gradient. We found no associations between soil pH and P. cinereus abundance or health, and observed that this salamander used substrates with pH similar to that available, suggesting that pH does not mediate their fine-scale distributions. The strongest negative predictor of P. cinereus abundance was the presence of dusky salamanders (Desmognathus spp.), which were most abundant in the western Adirondacks. Our results indicate that P. cinereus occupies a wider range of soil pH than has been previously thought, which has implications for their functional role in forest food webs and nutrient cycles in acid-impaired ecosystems. Tolerance of P. cinereus for more acidic habitats, including anthropogenically acidified forests, may be due to local adaptation in reproductively isolated populations and/or generalist

  20. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  1. Consumption of Coprinus comatus polysaccharide extract causes recovery of alcoholic liver damage in rats

    NARCIS (Netherlands)

    Ozalp, F.O.; Canbek, M.; Yamac, M.; Kanbak, G.; Griensven, van L.J.L.D.; Uyanoglu, M.; Senturk, H.; Karlkava, K.; Oglakci, A.

    2014-01-01

    Excess use of alcohol is known to be associated with liver diseases such as fatty liver, alcoholic hepatitis, and cirrhosis. Various practices may be applied to prevent or treat the damage caused by chronic alcoholism. Coprinus comatus (O.F. Müll.) Pers. (Agaricaceae) is a macrofungus that has been

  2. Optimization of cultivation conditions of fermented shaggy ink cap culinary-medicinal mushroom, Coprinus comatus (O.Mull.:Fr.) Pers. (higher Basidiomycetes) rich in Vanadium.

    Science.gov (United States)

    Zhang, Chunjing; Qi, Xiaodan; Shi, Yan; Sun, Yan; Li, Shuyan; Gao, Xiulan; Yu, Haitao

    2012-01-01

    The present paper is mainly aimed at optimization of cultivation conditions of fermented mushrooms of Coprinus comatus rich in vanadium (CCRV). Initial screening of effects of carbon source, temperature, pH, and inoculum size were done by using a one-factor-at-a-time method. The results obtained in that study showed that the optimal medium composition was 30 g glucose/Lin YEPG medium, initial pH 6.0, inoculum volume 10%, and incubation time 120 h. Then the medium was subjected to screening of the most significant parameters using the L9 orthogonal array to solve multivariable equations simultaneously. The results obtained in this study showed that the optimal medium composition was 0.4% V and 30 g glucose/Lin YEPG medium, initial pH 5.0, inoculum volume 15%, and incubation time 120 h. At this medium composition, the mycelial biomass and V content were 7.18 ± 0.24 g/L and 3786.0 ± 17 μg/g, respectively. The anti-diabetic potential of CCRV produced with the optimal level was tested in alloxan-induced diabetes. After the mice were administered (i.g.) with CCRV, the level of blood sugar in the CCRV group was very close to that of the control group. These findings suggested that CCRV produced with the optimal level is useful in the control of diabetes mellitus.

  3. Optimal Conditions for the Mycelial Growth of Coprinus comatus Strains

    Science.gov (United States)

    Lee, Yun-Hae; Liu, Jun-Jie; Ju, Young-Cheol

    2009-01-01

    The principal objective of this study was to acquire basic data regarding the mycelial growth characteristics for the artificial cultivation of Coprinus comatus. 12 URP primers were employed to evaluate the genetic relationships of C. comatus, and the results were divided into three groups. Among six kinds of mushroom media, MYP medium was selected as the most favorable culture medium for C. comatus. The optimal temperature and pH ranges for the mycelial growth of C. comatus were 23~26℃ and pH 6~8, respectively. The carbon and nitrogen sources for optimal mycelial growth were sucrose and tryptone, respectively. PMID:23983517

  4. Studies on mushroom flavours 2. Flavour compounds in coprinus comatus.

    Science.gov (United States)

    Dijkstra, F Y; Wikén, T O

    1976-01-01

    In an aqueous extract of fruit bodies of Coprinus comatus 3-octanone, 3-octanol, 1-octen-3-ol, 1-octanol, 2-methyl-2-penten-4-olide, 1-dodecanol and caprylic acid were identified conclusively and n-butyric and isobutyric acids preliminarily. Amino-acids, nucleotides and sugars were also determined. A mixture of 37 compounds found in the extract had a stronger flavour than the natural extract. 3-Octanol, 1-octen-3-ol, 1-octanol and 2-methyl-2-penten-4-olide were the volatiles with the strongest flavour. Mass and IR spectra of 2-methyl-2-penten-4-olide are presented.

  5. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  6. First report of a cross-kingdom pathogenic bacterium, Achromobacter xylosoxidans isolated from stipe-rot Coprinus comatus.

    Science.gov (United States)

    Ye, Luona; Guo, Mengpei; Ren, Pengfei; Wang, Gangzheng; Bian, Yinbing; Xiao, Yang; Zhou, Yan

    2018-03-01

    Coprinus comatus is an edible mushroom widely cultivated in China as a delicious food. Various diseases have occurred on C. comatus with the cultivated area increasing. In this study, the pathogenic bacterium JTG-B1, identified as Achromobacter xylosoxidans by 16S rDNA and nrdA gene sequencing, was isolated from edible mushroom Coprinus comatus with serious rot disease on its stipe. A. xylosoxidans has been confirmed as an important opportunistic human pathogenic bacterium and has been isolated from respiratory samples from cystic fibrosis. It is widely distributed in the environment. Here, we first report that fungi can also serve as a host for A. xylosoxidans. We confirmed that it can cross-kingdom infect between animals (mice) and fungi (C. comatus). The results of pathogenicity tests, physiological, biochemical and genotyping analysis of A. xylosoxidans from different hosts suggested that different strain of A. xylosoxidans may have pathogenicity differentiation. A. xylosoxidans not only is pathogenic to C. comatus but also may threaten human health. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  9. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  10. Determination of some biological activities of Tricholoma terreum and Coprinus micaceus

    OpenAIRE

    Akgül, Hasan; Nur, Aylin Dilara; Sevindik, Mustafa; Doğan, Muhittin

    2016-01-01

    Mantarların gıda olarak kullanımlarının yanı sıra tıbbi açıdan kullanımları gün geçtikçe artmaktadır. Bu çalışmada yenilebilir mantar türlerinden Tricholoma terreum (Schaeff.) P. Kumm. ve Coprinus micaceus (Bull.) Fr. materyal olarak kullanılmıştır. Çalışmada mantarların etanol özütlerinin antioksidan ve DNA koruyucu aktivitelerinin belirlenmesi ve toplam antioksidan ve oksidan seviyeleriyle oksidatif stres indeksleri ve Fe, Mg, Zn, Cu, Na ve Ca içeriklerinin tespiti ve kıyaslanma...

  11. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Avila Arcos, Maria del Carmen; Ishida, Yasuko

    2012-01-01

    The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction...

  12. Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologues, Lim15/Dmc1, but does not stimulate its strand transfer activity

    International Nuclear Information System (INIS)

    Hamada, Fumika N.; Koshiyama, Akiyo; Namekawa, Satoshi H.; Ishii, Satomi; Iwabata, Kazuki; Sugawara, Hiroko; Nara, Takayuki Y.; Sakaguchi, Kengo; Sawado, Tomoyuki

    2007-01-01

    PCNA is a multi-functional protein that is involved in various nuclear events. Here we show that PCNA participates in events occurring during early meiotic prophase. Analysis of protein-protein interactions using surface plasmon resonance indicates that Coprinus cinereus PCNA (CoPCNA) specifically interacts with a meiotic specific RecA-like factor, C. cinereus Lim15/Dmc1 (CoLim15) in vitro. The binding efficiency increases with addition of Mg 2+ ions, while ATP inhibits the interaction. Co-immunoprecipitation experiments indicate that the CoLim15 protein interacts with the CoPCNA protein in vitro and in the cell extracts. Despite the interaction between these two factors, no enhancement of CoLim15-dependent strand transfer activity by CoPCNA was found in vitro. We propose that the interaction between Lim15/Dmc1 and PCNA mediates the recombination-associated DNA synthesis during meiosis

  13. Perfil electroforético de las proteínas de la seta comestible "Coprinus comatus"

    OpenAIRE

    González Rodríguez, Andrea

    2017-01-01

    Este trabajo consiste en un estudio experimental del perfil proteico del hongo comestible Coprinus comatus, muy relevante por su alto valor económico y gastronómico, debido a sus propiedades nutricionales y medicinales. Los hongos son considerados alimentos funcionales, pues además de sus propiedades nutricionales, se han demostrado sus efectos beneficiosos para la salud que pueden ser utilizados en la prevención o tratamiento de enfermedades. Su acción terapéutica es atribuida a los compuest...

  14. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  15. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

    Science.gov (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

    2007-04-01

    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  16. Detection of a novel gammaherpesvirus in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Vaz, P; Whiteley, P L; Wilks, C R; Duignan, P J; Ficorilli, N; Gilkerson, J R; Browning, G F; Devlin, J M

    2011-07-01

    A novel gammaherpesvirus was detected in wild koalas (Phascolarctos cinereus) captured at different locations during 2010. Sequence analysis of the DNA polymerase gene revealed that the virus was genetically distinct from all known gammaherpesviruses. This is the first herpesvirus to be definitively identified in the Vombatiforme suborder (koalas and wombats).

  17. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  18. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  19. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  20. Disseminated coccidoidomycosis in a koala (Phascolarctos cinereus).

    Science.gov (United States)

    Burgdorf-Moisuk, Anne; Stalis, Ilse H; Pye, Geoffrey W

    2012-03-01

    A16-yr-old male koala (Phascolarctos cinereus) presented for nonspecific signs of illness and weight loss. Despite 2 mo of diagnostics and supportive care, the koala's health declined and euthanasia was elected. On histopathologic examination, lesions containing fungal organisms morphologically consistent with coccidioidomycosis were found in the lung, liver, spleen, kidney, lymph node, heart, eye, and bone marrow. Although disseminated infection was present, the koala was IgM and IgG seronegative for Coccidioides spp. 1 mo prior to euthanasia.

  1. Another account of interspecific aggression involving a Hoary Bat (Lasiurus cinereus)

    Science.gov (United States)

    Alyson F Brokaw; Jeff Clerc; Ted Weller

    2016-01-01

    We observed an incident of interspecific aggression between a male Hoary Bat (Lasiurus cinereus) and a male Silver-haired Bat (Lasionycteris noctivagans). The Silver-haired Bat suffered few external injuries, the most conspicuous of which were a missing lower right canine and small...

  2. Accumulation of Methylmercury in Invertebrates and Masked Shrews (Sorex cinereus) at an Upland Forest-Peatland Interface in Northern Minnesota, USA.

    Science.gov (United States)

    Tavshunsky, Ilana; Eggert, Susan L; Mitchell, Carl P J

    2017-12-01

    Mercury (Hg) methylation is often elevated at the terrestrial-peatland interface, but methylmercury (MeHg) production at this "hot spot" has not been linked with in situ biotic accumulation. We examined total Hg and MeHg levels in peat, invertebrates and tissues of the insectivore Sorex cinereus (masked shrew), inhabiting a terrestrial-peatland ecotone in northern Minnesota, USA. Mean MeHg concentrations in S. cinereus (71 ng g -1 ) fell between concentrations measured in spiders (mean 70-140 ng g -1 ), and ground beetles and millipedes (mean 29-42 ng g -1 ). Methylmercury concentrations in S. cinereus increased with age and differed among tissues, with highest concentrations in kidneys and muscle, followed by liver and brain. Nearly all Hg in S. cinereus was in the methylated form. Overall, the high proportional accumulation of MeHg in peat at the site (3.5% total Hg as MeHg) did not lead to particularly elevated concentrations in invertebrates or shrews, which are below values considered a toxicological risk.

  3. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  4. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  5. Physical condition, sex, and age-class of eastern red-backed salamanders (Plethodon cinereus) in forested and open habitats of West Virginia, USA

    Science.gov (United States)

    Breanna L. Riedel; Kevin R. Russell; W. Mark Ford

    2012-01-01

    Nonforested habitats such as open fields and pastures have been considered unsuitable for desiccation-prone woodland salamanders such as the Eastern Red-backed Salamander (Plethodon cinereus). Recent research has suggested that Plethodon cinereus may not only disperse across but also reside within open habitats including fields,...

  6. Microbiological decomposition of bagasse after radiation pasteurization

    International Nuclear Information System (INIS)

    Ito, Hitoshi; Ishigaki, Isao

    1987-01-01

    Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms. (author)

  7. Microbiological decomposition of bagasse after radiation pasteurization

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Hitoshi; Ishigaki, Isao

    1987-11-01

    Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms.

  8. A New Subspecies Identification and Population Study of the Asian Small-Clawed Otter (Aonyx cinereus in Malay Peninsula and Southern Thailand Based on Fecal DNA Method

    Directory of Open Access Journals (Sweden)

    M. K. A. Rosli

    2014-01-01

    Full Text Available Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  9. A new subspecies identification and population study of the Asian small-clawed otter (Aonyx cinereus) in Malay Peninsula and southern Thailand based on fecal DNA method.

    Science.gov (United States)

    Rosli, M K A; Syed-Shabthar, S M F; Abdul-Patah, P; Abdul-Samad, Z; Abdul, S N; Burhanuddin, M N; Zulkifli, N A; Shukor, M N; Budsabong, K; Changtragoon, S; Sekiguchi, T; Sasaki, H; Md-Zain, B M

    2014-01-01

    Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  10. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

    Science.gov (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

    2017-08-25

    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  11. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  12. Determination of some biological activities of Tricholoma terreum and Coprinus micaceus

    Directory of Open Access Journals (Sweden)

    Hasan Akgül

    2016-10-01

    Full Text Available The use of mushrooms as food also as medicine is increasing day by day. In this study, an edible mushrooms - Tricholoma terreum (Schaeff. P. Kumm. and Coprinus micaceus (Bull. Fr. – were used as materials. This study was aimed to determine the antioxidant and DNA protective activity of ethanol extract of mushrooms and determine and compare total antioxidant, oxidative stress index with oxidative levels and Fe, Mg, Zn, Cu, Na and Ca contents. The antioxidant activity of mushrooms were analyzed with using DPPH and total antioxidant and oxidative levels were analyzed with using Rel Assay Diagnostics kits. DNA protective activity was determined by using the supercoiled pBR322 DNA. Furthermore, element contents of the mushrooms were determined with wet decomposition method by using atomic absorption spectrophotometry. As a result of the study, antioxidant and DNA protective activities of ethanol extracts of both mushroom species were not showed any notable effect and total oxidant value was determined very high.

  13. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  14. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)

    OpenAIRE

    Tsangaras, Kyriakos; Ávila-Arcos, María C; Ishida, Yasuko; Helgen, Kristofer M; Roca, Alfred L; Greenwood, Alex D

    2012-01-01

    Abstract Background The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hyp...

  15. Nasal mass removal in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Gorow, April; Pye, Geoffrey W

    2012-12-01

    Nasal masses in the koala (Phascolarctos cinereus) are not uncommon and can be challenging to diagnose and treat. Differential diagnoses for nasal masses in the koala are cryptococcal granulomas, nasal polyps, nasal adenocarcinoma, and osteochondromatosis. This report describes successful surgical approaches for two adult koalas with nasal masses and includes photodocumentation and description of the anatomy of the koala nasal passages from the postmortem transverse sectioning of a normal koala head. Surgical removal of the nasal masses in these koalas resulted in a rapid resolution of clinical signs.

  16. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  17. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  18. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  19. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

    Science.gov (United States)

    Terekhova, V A; Semenova, T A

    2005-01-01

    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  20. Storage properties of irrdiated white pomfret (Stromatus cinereus) in tomato sauce

    International Nuclear Information System (INIS)

    Doke, S.N.; Sherekar, S.V.; Ghadi, S.V.

    1990-01-01

    A process involving radiation and heat treatment combined with effective management of pH using tomato sauce was developed for preservation of white pomfret (Stromatus cinereus). This process enhanced the organoleptic acceptability of the product and also ensured its microbiological safety. The processed product was in good edible condition even after a storage of 6 months at ambient temperature. (M.G.B.). 3 tabs

  1. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  2. Detection of a second novel gammaherpesvirus in a free-ranging koala (Phascolarctos cinereus).

    Science.gov (United States)

    Vaz, Paola; Whiteley, Pam L; Wilks, Colin R; Browning, Glenn F; Gilkerson, James R; Ficorilli, Nino; Devlin, Joanne M

    2012-01-01

    A second novel gammaherpesvirus was detected in a free-ranging koala (Phascolarctos cinereus) shown previously to be infected with phascolarctid herpesvirus 1. Analysis of the DNA polymerase gene showed that the virus was genetically distinct from all known gammaherpesviruses. This is the first reported dual gammaherpesvirus infection in an Australian marsupial.

  3. Mutational synergism between p-fluorophenylalaline and UV in Coprinus lagopus

    International Nuclear Information System (INIS)

    Talmud, P.J.

    1977-01-01

    The amino acid analogue p-fluorophenylalanine (PFP) is mutagenic to Coprinus lagopus due to its incorporation into proteins. Spontaneous mutations, PFP and UV mutagenesis and PFP/UV synergism have been studied in a UV resistant strain and in two complementing UV sensitive mutant strains. By comparison to the UV resistant strain, one UV sensitive strain shows normal spontaneous mutations, 1.4% PFP-induced mutations and 50-fold UV mutagenesis. The second UV sensitive strain has 19-fold spontaneous mutation frequency and slightly elevated UV mutagenesis. In all 3 strains the PFP/UV synergism is comparable (4-5 times the arithmetic expected). The results indicate that PFP mutagenesis is due to the incorporation of PFP into enzymes normally functioning in the organism but which also participate in UV repair mechanisms. A model is proposed for UV repair which is based on a PFP sensitive excision repair system of at least two enzymes, an alternative 'error-proof' pathway which is not susceptible to PFP and an 'error-prone' pathway which is responsible for UV mutagenesis and is susceptible to PFP as shown by the PFP/UV synergism. Because PFP is given before UV treatment, this implies a UV inducible cofactor and a PFP sensitive enzyme which only functions after UV activation

  4. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  5. Chlamydia pecorum Infection in Free-ranging Koalas ( Phascolarctos cinereus ) on French Island, Victoria, Australia.

    Science.gov (United States)

    Legione, Alistair R; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Sansom, Fiona M; Devlin, Joanne M

    2016-04-28

    We detected Chlamydia pecorum in two koalas ( Phascolarctos cinereus ) from a closed island population in Victoria, Australia, previously free of Chlamydia infection. The ompA and multilocus sequence type were most closely related to published isolates of livestock rather than koala origin, suggesting potential cross-species transmission of C. pecorum .

  6. Habitat relationships of eastern red-backed salamanders (Plethodon cinereus) in Appalachian agroforestry and grazing systems

    Science.gov (United States)

    Breanna L. Riedel; Kevin R. Russell; W. Mark Ford; Katherine P. O' Neill; Harry W. Godwin

    2008-01-01

    Woodland salamander responses to either traditional grazing or silvopasture systems are virtually unknown. An information-theoretic modelling approach was used to evaluate responses of red-backed salamanders (Plethodon cinereus) to silvopasture and meadow conversions in southern West Virginia. Searches of area-constrained plots and artificial...

  7. Basin wildrye (Leymus cinereus) pooled tetraploid accessions for U.S. Intermountain rangeland reclamation

    Science.gov (United States)

    Stanford A. Young; Jason Vernon; Nancy Shaw

    2013-01-01

    Basin wildrye (Leymus cinereus [Scribn. & Merr.] A. Love) is an important perennial, hardy, long-lived, cool season C3 native grass of rangeland plant communities throughout much of western United States and Canada. All classes of livestock and wildlife, including large and small birds and mammals, utilise the grass year round for food and protection due to its 2-3...

  8. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  9. Conjunctivitis associated with Chlamydia pecorum in three koalas (Phascolarctos cinereus) in the Mount Lofty Ranges, South Australia.

    Science.gov (United States)

    Funnell, Oliver; Johnson, Lynley; Woolford, Lucy; Boardman, Wayne; Polkinghorne, Adam; McLelland, David

    2013-10-01

    Chlamydiosis is a significant factor contributing to the decline of koala (Phascolarctos cinereus) populations in Australia but has not previously been reported in South Australia. We describe conjunctivitis in three wild koalas from South Australia, with Chlamydia pecorum identified by quantitative PCR.

  10. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  11. Chlamydia pecorum in Joint Tissue and Synovial Fluid of a Koala ( Phascolarctos cinereus) with Arthritis.

    Science.gov (United States)

    Burnard, Delaney; Gillett, Amber; Polkinghorne, Adam

    2018-03-02

    A small number of koalas ( Phascolarctos cinereus) presented to wildlife hospitals in Queensland, Australia, with signs of arthritis in one or more joints. Molecular analysis identified Chlamydia pecorum in the tarsal tissue and synovial fluid of an affected joint of a koala, suggesting that in addition to livestock, C. pecorum has the potential to cause arthritis in the koala.

  12. Production of antibacterial peptide from bee venom via a new strategy for heterologous expression.

    Science.gov (United States)

    Hou, Chunsheng; Guo, Liqiong; Lin, Junfang; You, Linfeng; Wu, Wuhua

    2014-12-01

    Honey bee is important economic insect that not only pollinates fruits and crops but also provides products with various physiological activities. Bee venom is a functional agent that is widely applied in clinical treatment and pharmacy. Secapin is one of these agents that have a significant role in therapy. The functions of secapin from the bee venom have been documented, but little information is known about its heterologous expression under natural condition. Moreover, few scholars verified experimentally the functions of secapin from bee venom in vitro. In this study, we successfully constructed a heterologous expression vector, which is different from conventional expression system. A transgenic approach was established for transformation of secapin gene from the venom of Apis mellifera carnica (Ac-sec) into the edible fungi, Coprinus cinereus. Ac-sec was encoded by a 234 bp nucleotide that contained a signal peptide domain and two potential phosphorylation sites. The sequence exhibited highly homology with various secapins characterized from honey bee and related species. Southern blot data indicated that Ac-sec was present as single or multiple copy loci in the C. cinereus genome. By co-transformation and double-layer active assay, Ac-sec was expressed successfully in C. cinereus and the antibacterial activity of the recombinants was identified, showing notable antibacterial activities on different bacteria. Although Ac-sec is from the venom of Apidae, phylogenetic analysis demonstrated that Ac-sec was more closely related to that of Vespid than to bee species from Apidae. The molecular characteristics of Ac-sec and the potential roles of small peptides in biology were discussed.

  13. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  14. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  15. Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2007-08-01

    Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

  16. Differential resistance to stripe rust (Puccinia striiformis) in collections of basin wild rye (Leymus cinereus)

    Science.gov (United States)

    Frank M. Dugan; Michael J. Cashman; Richard C. Johnson; Meinan Wang; Chen Xianming

    2014-01-01

    Differential resistance to stripe rust (Puccinia striiformis) in a planting of 111 wild collections of Basin wild rye (Leymus cinereus) was noted 2011-2013. In 2011, rust severity was rated on a scale of 1-9. Much lighter infection in 2012 and 2013 was rated as the number of symptomatic leaves per plant divided by plant circumference (to adjust for plant size). Effect...

  17. Toxicological responses of red-backed salamanders (Plethodon cinereus) to subchronic soil exposures of 2,4-dinitrotoluene

    International Nuclear Information System (INIS)

    Johnson, Mark S.; Suski, Jamie; Bazar, Matthew A.

    2007-01-01

    Dinitrotoluenes are used as propellants and in explosives by the military and as such have been found at relatively high concentrations in the soil. To determine whether concentrations of 2,4-dinitrotoluene (2,4-DNT) in soil are toxic to amphibians, 100 red-backed salamanders (Plethodon cinereus) were exposed to either 1500, 800, 200, 75 or 0 mg 2,4-DNT/kg soil for 28 days and evaluated for indicators of toxicity. Concentrations of 2,4-DNT were less than targets and varied with time. Most salamanders exposed to concentrations exceeding 1050 mg/kg died or were moribund within the first week. Salamanders exposed to soil concentrations exceeding 345 mg/kg lost >6% of their body mass though no mortality occurred. Overt effects included a reduction in feed consumption and an increase in bucco-pharyngeal oscillations in salamanders. These results suggest that only high soil concentrations of 2,4-DNT have the potential to cause overtly toxic effects in terrestrial salamanders. - Exposures of 2,4-dinitrotoluene in soil exceeding 345 mg/kg causes toxicity to P. cinereus

  18. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  19. A climate for speciation: rapid spatial diversification within the Sorex cinereus complex of shrews

    Science.gov (United States)

    Hope, Andrew G.; Speer, Kelly A.; Demboski, John R.; Talbot, Sandra L.; Cook, Joseph A.

    2012-01-01

    The cyclic climate regime of the late Quaternary caused dramatic environmental change at high latitudes. Although these events may have been brief in periodicity from an evolutionary standpoint, multiple episodes of allopatry and divergence have been implicated in rapid radiations of a number of organisms. Shrews of the Sorex cinereus complex have long challenged taxonomists due to similar morphology and parapatric geographic ranges. Here, multi-locus phylogenetic and demographic assessments using a coalescent framework were combined to investigate spatiotemporal evolution of 13 nominal species with a widespread distribution throughout North America and across Beringia into Siberia. For these species, we first test a hypothesis of recent differentiation in response to Pleistocene climate versus more ancient divergence that would coincide with pre-Pleistocene perturbations. We then investigate the processes driving diversification over multiple continents. Our genetic analyses highlight novel diversity within these morphologically conserved mammals and clarify relationships between geographic distribution and evolutionary history. Demography within and among species indicates both regional stability and rapid expansion. Ancestral ecological differentiation coincident with early cladogenesis within the complex enabled alternating and repeated episodes of allopatry and expansion where successive glacial and interglacial phases each promoted divergence. The Sorex cinereus complex constitutes a valuable model for future comparative assessments of evolution in response to cyclic environmental change.

  20. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    OpenAIRE

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-01-01

    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  1. Prevalence of Chlamydia pecorum in Juvenile Koalas ( Phascolarctos cinereus) and Evidence for Protection from Infection via Maternal Immunization.

    Science.gov (United States)

    Russell, Isabelle; Timms, Peter; Hanger, Jon; Loader, Jo; Gillett, Amber; Waugh, Courtney

    2018-05-07

    Chlamydia pecorum in koalas ( Phascolarctos cinereus) is considered a sexually transmitted infection. Analysis of samples from koala joeys (<1 yr) suggested that mother-to-young direct transmission was also occurring. Further, evidence suggested that joeys from vaccinated mothers were less likely to contract infections than joeys with unvaccinated mothers.

  2. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  3. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  4. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Radiation preservation of white pomfret (Stromateus cinereus) in tomato sauce

    International Nuclear Information System (INIS)

    Doke, S.N.; Sherekar, S.V.; Ghadi, S.V.

    1991-01-01

    A method for the radiation preservation of white pomfret (Stromateus cinereus) in tomato sauce is described which enables the storage of fish at ambient temperature (28±3 deg C) for a period of six months. The product with low pH could be stabilized with a dose of 5 kGy. A batch of packed cans (consisting of cans of fish with tomato sauce and the control cans) were subjected to a dose in a Cobalt 60 Package Irradiator (Atomic Energy of Canada Ltd.) at a dose rate of 0.045 kGy min -1 . Biochemical and bacteriological evaluation confirmed the storage stability of the product. The process offers a safe and simple method to preserve white pomfret in a 'heat and serve' form. (author) 6 refs.; 5 tabs

  6. Pneumonia due to Chlamydia pecorum in a Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mackie, J T; Gillett, A K; Palmieri, C; Feng, T; Higgins, D P

    2016-11-01

    Chlamydiosis is a common infectious disease of koalas (Phascolarctos cinereus), but Chlamydia spp. have not yet been demonstrated to cause pneumonia in these animals. A juvenile male koala died following an episode of respiratory disease. At necropsy examination, the lung tissue was consolidated. Microscopical lesions in the lung included pyogranulomatous bronchopneumonia, proliferation of bronchiolar and alveolar epithelium and interstitial fibrosis. Hyperplastic bronchiolar epithelial cells contained aggregates of small basophilic punctate organisms, which were confirmed as chlamydiae by transmission electron microscopy and immunohistochemistry. Real-time polymerase chain reaction identified these as Chlamydia pecorum. This report provides the best evidence to date of chlamydial infection causing pneumonia in a koala, and the first evidence that C. pecorum is capable of infecting the bronchiolar epithelium of the koala. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Tongue and taste organ development in the ontogeny of direct-developing salamander Plethodon cinereus (Lissamphibia: Plethodontidae).

    Science.gov (United States)

    Budzik, Karolina A; Żuwała, Krystyna; Kerney, Ryan

    2016-07-01

    The latest research on direct developing caecilian and anuran species indicate presence of only one generation of taste organs during their ontogeny. This is distinct from indirect developing batrachians studied thus far, which possess taste buds in larvae and anatomically distinct taste discs in metamorphs. This study is a description of the tongue and taste organ morphology and development in direct developing salamander Plethodon cinereus (Plethodontidae) using histology and electron microscopy techniques. The results reveal two distinct stages tongue morphology (primary and secondary), similar to metamorphic urodeles, although only one stage of taste organ morphology. Taste disc sensory zones emerge on the surface of the oropharyngeal epithelium by the end of embryonic development, which coincides with maturation of the soft tongue. Taste organs occur in the epithelium of the tongue pad (where they are situated on the dermal papillae), the palate and the inner surface of the mandible and the maxilla. Plethodon cinereus embryos only possess taste disc type taste organs. Similar to the direct developing anuran Eleutherodactylus coqui (Eleutherodactylidae), these salamanders do not recapitulate larval taste bud morphology as an embryo. The lack of taste bud formation is probably a broadly distributed feature characteristic to direct developing batrachians. J. Morphol. 277:906-915, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  9. [Oil degradation by basidiomycetes in soil and peat at low temperatures].

    Science.gov (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

    2016-01-01

    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  10. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  11. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  12. Serum Antibody Response to Koala Retrovirus Antigens Varies in Free-Ranging Koalas ( Phascolarctos cinereus ) in Australia: Implications for Vaccine Design.

    Science.gov (United States)

    Waugh, Courtney; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2016-04-28

    Little is known about the immune response in the koala ( Phascolarctos cinereus ) to its retroviruses. Koala retroviruses (KoRVs) have been linked to neoplasia in wild and captive koalas, but there is no treatment available. We tested the KoRV-specific serum immunoglobulin G antibody response in nonimmunized and immunized koalas.

  13. Preshipment testing success: resolution of a nasal sinus granuloma in a captive koala (Phascolarctos cinereus) caused by Cryptococcus gattii.

    Science.gov (United States)

    Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Pye, Geoffrey W; Meyer, Wieland; Sykes, Jane E

    2012-12-01

    A 3-yr-old female koala (Phascolarctos cinereus) was diagnosed with a nasal sinus granuloma caused by Cryptococcus gattii after a pre-shipment examination revealed a latex cryptococcal agglutination titer of 1:512. Successful medical and surgical treatment of the granuloma was monitored using serial latex cryptococcal agglutination titers, serum levels of antifungal drugs, and advanced imaging.

  14. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  15. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  16. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  17. Inconspicuous echolocation in hoary bats (Lasiurus cinereus).

    Science.gov (United States)

    Corcoran, Aaron J; Weller, Theodore J

    2018-05-16

    Echolocation allows bats to occupy diverse nocturnal niches. Bats almost always use echolocation, even when other sensory stimuli are available to guide navigation. Here, using arrays of calibrated infrared cameras and ultrasonic microphones, we demonstrate that hoary bats ( Lasiurus cinereus ) use previously unknown echolocation behaviours that challenge our current understanding of echolocation. We describe a novel call type ('micro' calls) that has three orders of magnitude less sound energy than other bat calls used in open habitats. We also document bats flying close to microphones (less than 3 m) without producing detectable echolocation calls. Acoustic modelling indicates that bats are not producing calls that exceed 70-75 dB at 0.1 m, a level that would have little or no known use for a bat flying in the open at speeds exceeding 7 m s -1 This indicates that hoary bats sometimes fly without echolocation. We speculate that bats reduce echolocation output to avoid eavesdropping by conspecifics during the mating season. These findings might partly explain why tens of thousands of hoary bats are killed by wind turbines each year. They also challenge the long-standing assumption that bats-model organisms for sensory specialization-are reliant on sonar for nocturnal navigation. © 2018 The Author(s).

  18. Development of 14 microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus) using next generation sequencing technology

    OpenAIRE

    Ruiz-Rodriguez, Christina T.; Ishida, Yasuko; Greenwood, Alex D.; Roca, Alfred L.

    2014-01-01

    We report the development of 14 new microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus). Ten unrelated Queensland koala individuals from the San Diego Zoo, USA, were genotyped. The number of alleles per locus ranged from 2 to 7, with an average of 5.14 alleles per locus. Across all loci, the average observed and expected heterozygosity values were both 0.69. These polymorphic microsatellite loci will be useful for genetic studies relevant to the conservation of the...

  19. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  20. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  1. Multiple intra-abdominal serosal myxosarcomas in two koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Astudillo, V González; Schaffer-White, A; Allavena, R; Palmieri, C

    2015-01-01

    Two adult koalas (Phascolarctos cinereus) were presented for necropsy examination without any clinical history. A diffuse, severe gelatinous effusion was found in the abdominal cavity, while numerous 1-3 mm diameter, round, well-demarcated, multifocal to coalescing, raised, firm nodules containing a clear gelatinous fluid were scattered on the surface of the parietal peritoneum, diaphragm, liver, gastrointestinal tract and mesentery. Microscopically, the nodular lesions consisted of spindle-shaped to stellate neoplastic cells, with scant eosinophilic cytoplasm and moderate anisocytosis and anisokaryosis. The neoplastic cells were admixed with and surrounded by abundant acellular pale eosinophilic material that was stained by Alcian blue and only weakly by the periodic acid-Schiff reaction. Serosal proliferations are described rarely in koalas and to the authors' knowledge this is the first reported case of serosal myxosarcoma. The significance and pathogenesis of this condition in the koala population is unknown. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Peroxide accumulation and cell death in filamentous fungi induced by contact with a contestant.

    Science.gov (United States)

    Silar, Philippe

    2005-02-01

    Podospora anserina and Coprinopsis cinerea (syn. Coprinus cinereus) are endowed with a defence system able to differentiate self vs. non-self and involving the generation of peroxide. Indeed, they produce peroxide when confronted with a filamentous fungus, only in non-self confrontations. Both species are not able to recognize yeasts and show a differential response to bacteria. The accumulation of peroxides in the ascomycete Podospora anserina requires an NADPH oxidase and a MAP kinase cascade, previously shown to be involved in fruit body formation, cell differentiation and cell degeneration. Confrontation is accompanied by the death of the contestant hyphae only in specific combinations of species. As in animals and plants, data suggest that peroxide is likely involved in signalling rather than playing a direct toxic role. Fungi display more complex behaviours than generally acknowledged, i.e. they are able to recognize potential contestants and built up defence reactions involving evolutionary conserved enzymes.

  3. Development of 14 microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus) using next generation sequencing technology.

    Science.gov (United States)

    Ruiz-Rodriguez, Christina T; Ishida, Yasuko; Greenwood, Alex D; Roca, Alfred L

    2014-06-01

    We report the development of 14 new microsatellite markers in the Queensland koala ( Phascolarctos cinereus adustus ). Ten unrelated Queensland koala individuals from the San Diego Zoo, USA, were genotyped. The number of alleles per locus ranged from 2 to 7, with an average of 5.14 alleles per locus. Across all loci, the average observed and expected heterozygosity values were both 0.69. These polymorphic microsatellite loci will be useful for genetic studies relevant to the conservation of the koala, a species listed as vulnerable.

  4. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  5. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

    OpenAIRE

    Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

    2006-01-01

    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  6. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Tsangaras, Kyriakos; Ávila-Arcos, María C; Ishida, Yasuko; Helgen, Kristofer M; Roca, Alfred L; Greenwood, Alex D

    2012-10-24

    The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hypervariable region of mitochondrial DNA (mtDNA) in koala museum specimens collected in the 19th and 20th centuries, hypothesizing that the historical samples would exhibit greater genetic diversity. The mtDNA haplotypes present in historical museum samples were identical to haplotypes found in modern koala populations, and no novel haplotypes were detected. Rarefaction analyses suggested that the mtDNA genetic diversity present in the museum samples was similar to that of modern koalas. Low mtDNA diversity may have been present in koala populations prior to recent population declines. When considering management strategies, low genetic diversity of the mtDNA hypervariable region may not indicate recent inbreeding or founder events but may reflect an older historical pattern for koalas.

  7. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

    Science.gov (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

    2004-01-01

    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  8. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A

    2000-12-01

    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  9. ATYPICAL PRESENTATION OF CRYPTOCOCCUS NEOFORMANS IN A KOALA (PHASCOLARCTOS CINEREUS): A MAGNETIC RESONANCE IMAGING AND COMPUTED TOMOGRAPHY STUDY.

    Science.gov (United States)

    Martínez-Nevado, Eva; Alonso-Alegre, Elisa González; Martínez, M Ángeles Jiménez; Rodríguez-Álvaro, Alfonso; de Merlo, Elena Martínez; García, Juncal García; Real, Isabel García

    2017-03-01

    Cryptococcosis is a worldwide and potentially fatal mycosis documented in wild and captive koalas ( Phascolarctos cinereus ) caused by Cryptococcus neoformans . Though mainly a subclinical disease, when the nasal cavity is affected, epistaxis, mucopurulent nasal discharge, dyspnea, and facial distortion may occur. This report describes a case of cryptococcosis in a koala where unilateral exophthalmos was the only evident clinical sign and magnetic resonance imaging and computed tomography findings are described. Both advanced imaging techniques should be considered as standard and complementary techniques for nasal cavity evaluation in koalas.

  10. Fat-soluble vitamin and mineral comparisons between zoo-based and free-ranging koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Schmidt, Debra A; Pye, Geoffrey W; Hamlin-Andrus, Chris C; Ellis, William A; Bercovitch, Fred B; Ellersieck, Mark R; Chen, Tai C; Holick, Michael F

    2013-12-01

    As part of a health investigation on koalas at San Diego Zoo, serum samples were analyzed from 18 free-ranging and 22 zoo-based koalas, Phascolarctos cinereus. Serum concentrations of calcium, chloride, cobalt, copper, iron, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, sodium, zinc, and vitamins A, E, and 25(OH)D3 were quantified. Calcium, chloride, molybdenum, selenium, and vitamin E concentrations were significantly higher in zoo-based koalas than in free-ranging koalas, whereas magnesium, manganese, phosphorus, and zinc concentrations were significantly higher in the free-ranging koalas. No significant differences were found between genders. The results from this study will help to establish a starting point for determining target circulating nutrient concentrations in koalas.

  11. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

    Science.gov (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

    2008-07-01

    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

  12. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  13. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus) Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP) with Two Different Adjuvants

    OpenAIRE

    Khan, Shahneaz Ali; Desclozeaux, Marion; Waugh, Courtney; Hanger, Jon; Loader, Jo; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2016-01-01

    Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus). In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP) antigen-based vaccine, combined with immune stimulating complex (ISC) adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri...

  14. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  15. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Tsangaras Kyriakos

    2012-10-01

    Full Text Available Abstract Background The koala (Phascolarctos cinereus is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hypervariable region of mitochondrial DNA (mtDNA in koala museum specimens collected in the 19th and 20th centuries, hypothesizing that the historical samples would exhibit greater genetic diversity. Results The mtDNA haplotypes present in historical museum samples were identical to haplotypes found in modern koala populations, and no novel haplotypes were detected. Rarefaction analyses suggested that the mtDNA genetic diversity present in the museum samples was similar to that of modern koalas. Conclusions Low mtDNA diversity may have been present in koala populations prior to recent population declines. When considering management strategies, low genetic diversity of the mtDNA hypervariable region may not indicate recent inbreeding or founder events but may reflect an older historical pattern for koalas.

  16. Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi.

    Science.gov (United States)

    Upadhyay, R C; Hofrichter, M

    1993-01-01

    Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.

  17. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  18. THE PARADOX OF EUTHANIZING KOALAS (PHASCOLARCTOS CINEREUS) TO SAVE POPULATIONS FROM ELIMINATION.

    Science.gov (United States)

    Wilson, David P; Craig, Andrew P; Hanger, Jon; Timms, Peter

    2015-10-01

    Koala (Phascolarctos cinereus) populations in the wild are in sharp decline in Australia due to deforestation, road accidents, dog attacks, and disease from infection with sexually transmitted Chlamydia spp. Severely diseased koalas that are captured are euthanized for humane reasons because antibiotics are not effective. Paradoxically, we propose that euthanizing more koalas could help to increase koala population numbers. We investigated the potential impact of systematically euthanizing diseased koalas. Using data from a well-studied koala population, and an individual-based computer simulation model, we predict that such a program would result in a larger population of koalas after 7 yr than would exist without the program. If terminally diseased and sterile koalas are euthanized and other infected captured koalas are given antibiotics, chlamydial infection could be eliminated and population growth observed after 4 yr. The practical implementation of such a program would be facilitated with further development of tools to diagnose infection and internal disease in the field.

  19. Serum vitamin D levels in free-ranging koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Pye, Geoffrey W; Ellis, William; FitzGibbon, Sean; Opitz, Brian; Keener, Laura; Hollis, Bruce W

    2013-06-01

    Due to climatic conditions in Northern America and Europe, koalas (Phascolarctos cinereus) are often housed indoors. Koala joeys raised in these environments are susceptible to the development of metabolic bone disease due to a lack of exposure to solar ultraviolet radiation to themselves and their dam. As an initial step toward describing vitamin D sufficiency and adequately measuring responses to supplementation, vitamin D values were calculated by using serum collected from 20 free-ranging koalas on St. Bees Island, Queensland, Australia. Vitamin D values ranged from 8.1 to 30.4 pg/ml (18.4 +/- 5.5 pg/ml) for 1, 25-hydroxyvitamin D, and from 1 to 14 nM/L (7.4 +/- 3.0 nM/L) for 25-hydroxyvitamin D. These koala serum vitamin D values are unusually low when compared with eutherian mammals. Although this study was limited in numbers and in the geographically range of the koalas sampled, it does suggest that the koala's requirement for vitamin D is low. Therefore, supplementation to prevent disease may be relatively easy to achieve because low doses will likely meet requirements. Caution should be taken to avoid intoxication if supplementing vitamin D in koalas.

  20. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  1. Treatment of Chlamydia-associated ocular disease via a recombinant protein based vaccine in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Waugh, Courtney; Austin, Ray; Polkinghorne, Adam; Timms, Peter

    2016-11-01

    Koalas (Phascolarctos cinereus) are affected by debilitating chlamydial disease that can lead to blindness, infertility, and death. The causative agent is the intracellular bacterium Chlamydia pecorum. While antibiotics can be used to treat koala chlamydial infection, they are often ineffective or cause severe dysbiosis to the animal's unique gut flora. Recent work has progressed on the development of a protective vaccine for Chlamydia in the koala. This study demonstrates that the use of a vaccine can have a positive effect in koalas already with clinical signs of ocular disease, suggesting a possible therapeutic effect and an alternative to antibiotic therapy. Copyright © 2016 International Alliance for Biological Standardization. All rights reserved.

  2. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  3. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  4. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    Science.gov (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  5. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  6. Preliminary study on isolation and quality analysis of enzymes from fermented oil palm empty fruit bunch

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Tamikazu Kume; Shinpei Matsuhashi

    1998-01-01

    Palm Empty Fruit Bunch (EFB) is a cellulosic waste, consisting of 40 - 60 % cellulose with the remaining components comprised of hemicellulose, lignin and other materials. Cellulase is a complex of enzymes containing chiefly endo and exo glucanase, as well as cellobiase plus others (Mandel et al, 1976). Studies on cellulase production from Trichodermaa viride have been reported. The enzyme system from this fungi is considered to be a complete composition of cellulase; and it was reported to be able to hydrolyse slowly a more resistant or crystalline portion of cellulose. Previous work showed Pleorotus sajor-caju and Coprinus cinereus can be easily grown on EFB. The quality of this enzyme system was characterized based on its degradation activity on filter paper, salicin and xylan into simple sugars. These activity tests would revealed the ability of cellulase enzyme system to break down insoluble cellulose, and hydrolysing salicin such as cellobiose and xylanase for breaking down hemicellulose. In this study, the enzyme system derived from liquid state fermentation by these fungi utilizing EFB as carbon source was investigated

  7. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.

    1980-01-01

    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  8. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  9. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  10. Perceived efficacy of analgesic drug regimens used for koalas (Phascolarctos cinereus) in Australia.

    Science.gov (United States)

    de Kauwe, Tyron; Kimble, Benjamin; Govendir, Merran

    2014-06-01

    Recent publications report that some therapeutic drugs used in koalas (Phascolarctos cinereus) have poor oral absorption and are rapidly eliminated. Therefore, information on both the analgesic drug dosage regimens used to treat koalas in Australia and koala caretakers' perceptions of the efficacy of these drugs to control pain was collected for the purpose of identifying the most popular analgesics to prioritize future analgesic pharmacokinetic studies for this species. A one-page, double-sided questionnaire was distributed both electronically and by mail to Australian koala care facilities such as zoos and wildlife hospitals. Information was received from 13 respondents. Nonsteroidal anti-inflammatory drugs (NSAIDs) were the most frequently used analgesics, followed by full micro- and partial opioid receptor agonists and acetaminophen with or without codeine. The full micro-opioid receptor agonists and acetaminophen with or without codeine were most consistently considered efficacious, with wider variation in perceived efficacy of the NSAIDs. Analgesic drug combinations were generally thought efficacious.

  11. Serum protein electrophoresis values for free-ranging and zoo-based koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Pye, Geoffrey W; Ellis, William; Fitzgibbon, Sean; Opitz, Brian; Keener, Laura; Arheart, Kristopher L; Cray, Carolyn

    2012-03-01

    In a clinical setting, especially with species of special interest, it is important to use all clinical pathology testing options for general health monitoring and diagnosis. Protein electrophoresis (EPH) has previously been shown to be an important adjunct tool in veterinary medicine. Serum samples from 18 free-ranging and 12 zoo-based koalas (Phascolarctos cinereus) were subject to EPH analysis. Significant differences were found between the two groups for the following values: total protein, albumin, beta globulins, and albumin-globulin ratio (P < 0.05). By using the combined data, the minimum-maximum values for the EPH fractions were as follows: total protein 5.0-7.8 g/dl, albumin 2.8-4.7 g/dl, alpha-1 globulins 0.5-1.1 g/dl, alpha-2 globulins 0.3-0.7 g/dl, beta globulins 0.4-1.0 g/dl, gamma globulins 0.2-1.0 g/dl, and albumin-globulin ratio 1.0-2.1.

  12. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  13. Perivertebral B-cell lymphoma in a Queensland koala (Phascolarctos cinereus adustus) with paralytic symptoms in the hind limbs.

    Science.gov (United States)

    Kido, Nobuhide; Edamura, Kazuya; Inoue, Naomi; Shibuya, Hisashi; Sato, Tsuneo; Kondo, Masako; Shindo, Izumi

    2012-08-01

    A male Queensland koala (Phascolarctos cinereus adustus) at Kanazawa Zoological Gardens (Kanagawa, Japan) exhibited paralytic symptoms in the hind limbs. Computed tomography and magnetic resonance imaging revealed a mass on the left ventral side of the 11th to 13th thoracic vertebrae, and the presence of myelitis or edema in the spinal cord. The koala was under anesthesia during the examination and suddenly developed ventricular fibrillation and died. Necropsy revealed a firm flat ovoid hemorrhagic mass on the vertebrae. Following a microscopic examination including immunohistochemistry, the perivertebral mass was diagnosed as B cell lymphoma. Therefore, neoplastic cell infiltration into the spinal cord may cause paralytic symptoms in the hind limbs.

  14. Lymphoma, Koala Retrovirus Infection and Reproductive Chlamydiosis in a Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Fabijan, J; Woolford, L; Lathe, S; Simmons, G; Hemmatzadeh, F; Trott, D J; Speight, N

    Koala retrovirus (KoRV) infection, thought to be associated with lymphoid neoplasia, and Chlamydia pecorum-related ocular and urogenital disease are both highly prevalent in eastern Australian koala (Phascolarctos cinereus) populations. However, in South Australian koalas, little is known about KoRV infection and C. pecorum-associated disease. We report the first South Australian case of lymphoma in a KoRV-A-positive female koala also affected by severe reproductive chlamydiosis. The koala was from the Mount Lofty Ranges population and was presented with hindlimb lameness. Clinical examination identified right stifle crepitus, enlarged superficial lymph nodes and paraovarian cysts. Necropsy examination revealed extensive cartilage degeneration and loss over the medial femoral condyle, solid femoral bone marrow, mesenteric and ovarian tumours, paraovarian cysts and purulent metritis. Histopathology confirmed lymphoma in the bone marrow, mesenteric lymph nodes and ovary, with infiltration and parenchymal effacement in the pancreas, adrenal glands and other tissues. Lymphoma, KoRV and chlamydiosis are being investigated further in this population. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Investigation of the koala (Phascolarctos cinereus) hindgut microbiome via 16S pyrosequencing.

    Science.gov (United States)

    Barker, Christopher J; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2013-12-27

    As a dietary source, the foliage of Eucalyptus spp. is low in available protein and carbohydrate while containing polyphenolic compounds that interfere with enzymatic digestion. To overcome this, the koala (Phascolarctos cinereus) has evolved a range of anatomical and physiological adaptations to assist with digestion and absorption of nutrients from this food source. Microbial fermentation of partially digested eucalyptus leaves is thought to be critical in this process, however, little is known about the composition and diversity of microorganisms that are associated with digestive health in this native species. In this study, we performed 16S rRNA gene pyrosequencing of caecum, colon and faecal pellet samples from two wild, free ranging, Queensland koalas. Our results reveal a highly complex and diverse ecosystem with considerable intra-individual variation. Although samples were dominated by sequences from the Bacteroidetes and Firmicutes phyla there was considerable variation at the genus level. This study is the first non-culture based microbiota analysis, using 454-amplicon pyrosequencing, and provides preliminary data to expand our understanding of the koala hindgut. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  17. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  18. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  19. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner

    2013-01-01

    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  20. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  1. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  2. Supplemental feeding of captive neonatal koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Shibata, Eri; Shindo, Izumi; Miyakawa, Etsuko; Kido, Nobuhide

    2017-01-01

    Koalas (Phascolarctos cinereus) are cautious animals, making supplemental feeding of neonates challenging because of disturbances to the normal routine. However, supplemental feeding is beneficial in improving juvenile nutrition using less formula than required for hand-rearing, and allowing maternal bonding to continue through suckling. In this study, two neonatal koalas, delivered by the same mother in 2 years, exhibited insufficient growth post-emergence from the pouch; supplemental feeding was therefore initiated. The amount of formula fed was determined according to the product instructions, and offspring weight was monitored. Slower than normal growth was not initially noticed in the first offspring. This caused delayed commencement of supplemental feeding. An attempt was made to counteract this by providing more formula for a longer period; however, this meant No. 1 was unable to eat enough eucalyptus when weaning. Supplemental feeding was started earlier for the second offspring than for the first, and was terminated at weaning; this juvenile showed a healthy body weight increase. Furthermore, it was able to eat eucalyptus leaves at an earlier stage than No. 1. Although No. 1 showed delayed growth, both koalas matured and are still living. This study showed that supplemental feeding is useful for koalas, if the mother will accept human intervention. The key factors for successful supplemental feeding of koalas identified by comparing the two feeding systems observed in this study are that: (1) it should be initiated as soon as insufficient growth is identified; and (2) it should be terminated before weaning age. Zoo Biol. 36:62-65, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Cytotoxic protein from the mushroom Coprinus comatus possesses a unique mode for glycan binding and specificity.

    Science.gov (United States)

    Zhang, Peilan; Li, Kunhua; Yang, Guang; Xia, Changqing; Polston, Jane E; Li, Gengnan; Li, Shiwu; Lin, Zhao; Yang, Li-Jun; Bruner, Steven D; Ding, Yousong

    2017-08-22

    Glycans possess significant chemical diversity; glycan binding proteins (GBPs) recognize specific glycans to translate their structures to functions in various physiological and pathological processes. Therefore, the discovery and characterization of novel GBPs and characterization of glycan-GBP interactions are significant to provide potential targets for therapeutic intervention of many diseases. Here, we report the biochemical, functional, and structural characterization of a 130-amino-acid protein, Y3, from the mushroom Coprinus comatus Biochemical studies of recombinant Y3 from a yeast expression system demonstrated the protein is a unique GBP. Additionally, we show that Y3 exhibits selective and potent cytotoxicity toward human T-cell leukemia Jurkat cells compared with a panel of cancer cell lines via inducing caspase-dependent apoptosis. Screening of a glycan array demonstrated GalNAcβ1-4(Fucα1-3)GlcNAc (LDNF) as a specific Y3-binding ligand. To provide a structural basis for function, the crystal structure was solved to a resolution of 1.2 Å, revealing a single-domain αβα-sandwich motif. Two monomers were dimerized to form a large 10-stranded, antiparallel β-sheet flanked by α-helices on each side, representing a unique oligomerization mode among GBPs. A large glycan binding pocket extends into the dimeric interface, and docking of LDNF identified key residues for glycan interactions. Disruption of residues predicted to be involved in LDNF/Y3 interactions resulted in the significant loss of binding to Jurkat T-cells and severely impaired their cytotoxicity. Collectively, these results demonstrate Y3 to be a GBP with selective cytotoxicity toward human T-cell leukemia cells and indicate its potential use in cancer diagnosis and treatment.

  4. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Comparison of antigen detection and quantitative PCR in the detection of chlamydial infection in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Hanger, Jon; Loader, Joanne; Wan, Charles; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-03-01

    The gold standard method for detecting chlamydial infection in domestic and wild animals is PCR, but the technique is not suited to testing animals in the field when a rapid diagnosis is frequently required. The objective of this study was to compare the results of a commercially available enzyme immunoassay test for Chlamydia against a quantitative Chlamydia pecorum-specific PCR performed on swabs collected from the conjunctival sac, nasal cavity and urogenital sinuses of naturally infected koalas (Phascolarctos cinereus). The level of agreement for positive results between the two assays was low (43.2%). The immunoassay detection cut-off was determined as approximately 400 C. pecorum copies, indicating that the test was sufficiently sensitive to be used for the rapid diagnosis of active chlamydial infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  7. Electroretinography in the normal koala (Phascolarctos cinereus).

    Science.gov (United States)

    Liddle, Vicki L

    2015-01-01

    To perform electroretinography on normal anesthetized koalas (Phascolarctos cinereus). Six hospitalized koalas. The koalas were anesthetized using alfaxalone intramuscularly and isoflurane via face mask, then maintained on isoflurane after endotracheal intubation. After 20 min of dark adaptation, electroretinograms were obtained using a handheld electroretinography (ERG) machine using a single flash protocol at three light intensities: 10 mcd s/m(2) , 3000 mcd s/m(2) , and 10,000 mcd s/m(2) . At 10 mcd s/m(2) , the mean b-wave amplitude and implicit time were 49.5 μV (SD ± 33.1 and 95% CI 29.9-69.0) and 87.4 ms (SD ± 6.5 and 95% CI 83.6-91.2). At 3000 mcd s/m(2) , the mean a-wave amplitude and implicit time were 70.5 μV (SD ± 30.7 and 95% CI 52.3-88.7) and 20.6 ms (SD ± 3.1 and 95% CI 18.7-22.4), and the mean b-wave amplitude and implicit time were 122.8 μV (SD ± 49.3 and 95% CI 93.7-151.9) and 63.1 ms (SD ± 13.2 and 95% CI 55.3-71.0). At 10,000 mcd sm(2) , the mean a-wave amplitude and implicit time were 90.8 μV (SD ± 37.2 and 95% CI 68.8-112.8) and 16.1 ms (SD ± 3.1 and 95% CI 14.3-18.0), and the mean b-wave amplitude and implicit time were 148.3 μV (SD ± 54.9 and 95% CI 115.9-180.8) and 67.4 ms (SD ± 8.4 and 95% CI 62.5-72.3). Electroretinography in koalas is practical using a portable ERG system and a DTL thread electrode and allows for rapid assessment of retinal function. © 2013 American College of Veterinary Ophthalmologists.

  8. Scale-up fermentation of oil palm empty fruit bunch to produce ruminant feed by radiation processing

    International Nuclear Information System (INIS)

    Awang, M.R.; Mutaat, H.H.; Deres, R.M.; Kume, Tamikazu.

    1992-01-01

    Scale-up fermentation and irradiation conditions of empty fruit bunch (EFB) of oil palm were examined to produce a large amount of fermented products for animal feeds. The EFB substrates pasteurized by irradiation were inoculated with Coprinus cinereus. After 1 month incubation, the crude fiber contents decreased to 20 - 38% and crude protein contents increased to 9 - 13% in small scale fermentation using conical flask (6 - 20 g EFB). In the case of fermentation using polypropylene bags with 400 g EFB, crude fiber and protein contents were 32 - 34% and 11 - 14%, respectively. A larger plastic container packed with 1.5 kg EFB fiber of 10cm thickness was used for mushroom cultivation. After harvest of mushroom (yields were about 250 g per container), the quality of residual substrates improved further as reflected by its crude fiber content of only 16 - 20%, crude protein content of 6 - 8%. These results show that a large volume of products are available under the good aeration by increasing the number of plastic bags or containers. For the irradiation of a lot of fermentation substrates, the advantage of 60 Co gamma-ray and electron beam irradiator was also discussed. (author)

  9. Cytotoxic protein from the mushroom Coprinus comatus possesses a unique mode for glycan binding and specificity

    Science.gov (United States)

    Zhang, Peilan; Yang, Guang; Xia, Changqing; Polston, Jane E.; Li, Gengnan; Li, Shiwu; Lin, Zhao; Yang, Li-jun; Bruner, Steven D.

    2017-01-01

    Glycans possess significant chemical diversity; glycan binding proteins (GBPs) recognize specific glycans to translate their structures to functions in various physiological and pathological processes. Therefore, the discovery and characterization of novel GBPs and characterization of glycan–GBP interactions are significant to provide potential targets for therapeutic intervention of many diseases. Here, we report the biochemical, functional, and structural characterization of a 130-amino-acid protein, Y3, from the mushroom Coprinus comatus. Biochemical studies of recombinant Y3 from a yeast expression system demonstrated the protein is a unique GBP. Additionally, we show that Y3 exhibits selective and potent cytotoxicity toward human T-cell leukemia Jurkat cells compared with a panel of cancer cell lines via inducing caspase-dependent apoptosis. Screening of a glycan array demonstrated GalNAcβ1–4(Fucα1–3)GlcNAc (LDNF) as a specific Y3-binding ligand. To provide a structural basis for function, the crystal structure was solved to a resolution of 1.2 Å, revealing a single-domain αβα-sandwich motif. Two monomers were dimerized to form a large 10-stranded, antiparallel β-sheet flanked by α-helices on each side, representing a unique oligomerization mode among GBPs. A large glycan binding pocket extends into the dimeric interface, and docking of LDNF identified key residues for glycan interactions. Disruption of residues predicted to be involved in LDNF/Y3 interactions resulted in the significant loss of binding to Jurkat T-cells and severely impaired their cytotoxicity. Collectively, these results demonstrate Y3 to be a GBP with selective cytotoxicity toward human T-cell leukemia cells and indicate its potential use in cancer diagnosis and treatment. PMID:28784797

  10. Food habits of the hoary bat (LASIURUS CINEREUS) during spring migration through new mexico

    Science.gov (United States)

    Valdez, E.W.; Cryan, P.M.

    2009-01-01

    Hoary bats (Lasiums cinernis) exhibit continental patterns of migration that are unique to bats, but details about their behaviors during migration are lacking. We captured 177 hoary bats in spring and early summer 2002 as individuals migrated through the Sandia Mountains of north-central New Mexico. Our results support earlier observations of asynchronous timing of migration between sexes of L. cinernis during spring, with females preceding males by ca. 1 month. We provide the first evidence that hoary bats may travel in dispersed groups, fly below the tree canopy along streams, and feed while migrating during spring. Analysis of guano revealed that diet of L. cinereus consisted mostly of moths, with more than one-half of samples identified as Noctuidae and Geometridae. We observed a late-spring decline in consumption of moths that might be related to seasonal changes in abundance of prey, differential selection of prey by bats, or sampling bias. We suspect that spring migration of L. cinernis through New Mexico temporally coincides with the seasonal abundance of moths.

  11. Dental onlay bridge-like prosthesis in three koalas (Phascolarctos cinereus): the use of Premise trimodal composite to prevent interproximal Eucalyptus spp. retention and infection.

    Science.gov (United States)

    Perry, Sean M; Pye, Geoffrey W; Fagan, David A

    2014-06-01

    Three koalas (Phascolarctos cinereus) presented with moderate to severe interproximal space accumulation with Eucalyptus spp. at the San Diego Zoo. Premise trimodal composite was used to create dental onlay bridge-like prostheses to eliminate open, enlarged interproximal spaces. The prostheses prevented further leaf material accumulation within the interproximal spaces and consequently reduced periodontal disease. Aesthetically, the prosthesis replicates normal tooth coloration and appearance and wears at a similar rate to surrounding teeth. Prosthetic repair or replacement may be required, so periodic examination every 3-6 mo is recommended.

  12. MHC class II diversity of koala (Phascolarctos cinereus) populations across their range.

    Science.gov (United States)

    Lau, Q; Jaratlerdsiri, W; Griffith, J E; Gongora, J; Higgins, D P

    2014-10-01

    Major histocompatibility complex class II (MHCII) genes code for proteins that bind and present antigenic peptides and trigger the adaptive immune response. We present a broad geographical study of MHCII DA β1 (DAB) and DB β1 (DBB) variants of the koala (Phascolarctos cinereus; n=191) from 12 populations across eastern Australia, with a total of 13 DAB and 7 DBB variants found. We identified greater MHCII variation and, possibly, additional gene copies in koala populations in the north (Queensland and New South Wales) relative to the south (Victoria), confirmed by STRUCTURE analyses and genetic differentiation using analysis of molecular variance. The higher MHCII diversity in the north relative to south could potentially be attributed to (i) significant founder effect in Victorian populations linked to historical translocation of bottlenecked koala populations and (ii) increased pathogen-driven balancing selection and/or local genetic drift in the north. Low MHCII genetic diversity in koalas from the south could reduce their potential response to disease, although the three DAB variants found in the south had substantial sequence divergence between variants. This study assessing MHCII diversity in the koala with historical translocations in some populations contributes to understanding the effects of population translocations on functional genetic diversity.

  13. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  14. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  15. Ultrasonographic assessment of the male koala (Phascolarctos cinereus) reproductive tract.

    Science.gov (United States)

    Larkin, Rebecca; Palmieri, Chiara; Oishi, Motoharu; Hulse, Lyndal; Johnston, Stephen D

    2018-04-01

    Studies documenting the application of ultrasonography to depict normal and pathological changes in koalas (Phascolarctos cinereus), especially in the male, are scarce. Sixty-two wild koalas were used in this study to define ultrasonographic protocols and features for the assessment of the male koala reproductive tract. Testis, epididymis and spermatic cord were examined using a hockey stick transducer. The normal koala testis showed a homogeneous echogenicity and an obvious hyper-echoic band corresponding to the tunica albuginea. The cauda epididymis was characterised by hypo- and hyper-echoic regions and was most effectively imaged in sagittal section. The koala prostate was assessed using a micro-curved transducer positioned midline, caudal to the bladder. On transverse section, it showed distinct margins and a well-defined internal structure, although the prostatic urethra was not apparent on most scans. To image the bulbourethral glands (BGs), the hockey stick transducer was placed lateral to the cloaca. BGIII was located just below the skin, while BGII was located deeper than BGIII. BGI was too small and not sufficiently echogenic to be detected. The ultrasonographic appearance of the BGs was similar to that of the testes but with more obvious hypo-echoic stippling. This comprehensive review of the ultrasonographic appearance of normal male koala reproductive tract can be used by veterinarians and others, in zoos or those working with wild koalas, during assessment of the reproductive tract of male koalas in relation to seasonal changes in accessory gland function or for the pathological investigation of reproductive lesions and infertility problems. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  17. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    Science.gov (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  18. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Two distinct forms of Chlamydia psittaci associated with disease and infertility in Phascolarctos cinereus (koala).

    Science.gov (United States)

    Girjes, A A; Hugall, A F; Timms, P; Lavin, M F

    1988-01-01

    While several diseases associated with Chlamydia psittaci infection have been reported in Phascolarctos cinereus (koala), it is still unclear whether one or more chlamydial strains are responsible. In this study, we provide evidence, obtained by restriction enzyme and gene probe analysis, that two quite distinct strains of C. psittaci infect koalas; one strain was isolated from the conjunctivae, and the other was isolated from the urogenital tract and the rectum. A gene probe, pFEN207, containing the coding sequence for an enzyme involved in the biosynthesis of the chlamydial genus-specific lipopolysaccharide antigen, and a separate probe, pCPML-4N, prepared from a DNA fragment of a koala-infecting strain of C. psittaci, were used to determine the patterns of hybridization in the koala-infecting strains; these patterns were found to be quite distinct from those observed with C. psittaci isolates from other animals. We also demonstrated by hybridization analysis with an avian strain plasmid that all three koala urogenital isolates contain a plasmid and that there is no evidence for the presence of a homologous plasmid in any of the ocular isolates. Images PMID:3397180

  20. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze

    2016-09-01

    Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  1. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  2. Foraging range movements of the endangered Hawaiian hoary bat, Lasiurus cinereus semotus (Chiroptera: Vespertilionidae)

    Science.gov (United States)

    Bonaccorso, Frank J.; Todd, Christopher M.; Miles, Adam C.; Gorresen, P. Marcos

    2015-01-01

    We documented nightly movements of Hawaiian hoary bats (Lasiurus cinereus semotus) on the island of Hawai’i. Based on data from 28 radiotagged individuals mean foraging range (FR) was 230.7±72.3 ha, core-use area (CUA) was 25.5±6.9 ha (or 11.1% of mean FR), and the mean long axis (LAX) across the FR was 3,390.8±754.3 m. There was almost no overlap in CUAs among 4 adult males having overlapping foraging areas and tracked simultaneously or within a 90-day window of each other. CUAs of subadults partially overlapped with multiple adult males or with one other subadult. High variance in FRs, cores use areas, and LAX across the FR perhaps reflect localized stochastic variables such as weather, habitat, and food resources. Hawaiian hoary bats use moderately large FRs among insectivorous bats studied with comparable methodologies; however, foraging activity indicated by documentation of acoustic feeding buzzes is concentrated within one or a few disjunct areas cumulatively forming the 50% fixed kernel of CUA. The concentration of feeding activity, low values of individual overlap, and agonistic chasing behavior within CUAs all demonstrate a structured use of individual space by Hawaiian hoary bats.

  3. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  4. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  5. Fecal glucocorticoid metabolite response of captive koalas (Phascolarctos cinereus) to visitor encounters.

    Science.gov (United States)

    Webster, Koa; Narayan, Edward; de Vos, Nicholas

    2017-04-01

    Physiological responses of wildlife species to zoo visitors should be studied to better understand how wildlife perceive human encounters. We conducted an experimental test of the effect of changes in zoo visitor encounter experiences on the glucocorticoid (GC) response of koalas (Phascolarctos cinereus) in a Sydney zoo. Koalas were housed in a multiple-bay enclosure (two to three koalas per bay) for photography sessions with zoo visitors (no touching of koalas permitted by visitors). Following a one-week no-photography baseline period, photography sessions were rotated between three enclosure bays for four weeks (Intensive photography), then between five enclosure bays for an additional four weeks (Standard photography). A sixth enclosure bay was never included in the photography sessions (control bay); koalas in this bay showed no significant change in fecal cortisol metabolites (FCMs) during the course of the study. In the five experimental bays differences were seen between male and female koalas. Males had higher mean FCMs than females, and individual FCM traces showed that two male koalas that were related and of similar age responded strongly to the experimental manipulation. These two males showed a peak in FCMs at the beginning of the Intensive photography period, then a decline when photography sessions returned to the Standard protocol. No systematic pattern in response to photography sessions was observed in females. Our results demonstrate successful application of a non-invasive endocrinology tool for assessing the stress biology and welfare of captive zoo wildlife. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. PREVALENCE AND PATHOLOGIC FEATURES OF CHLAMYDIA PECORUM INFECTIONS IN SOUTH AUSTRALIAN KOALAS (PHASCOLARCTOS CINEREUS).

    Science.gov (United States)

    Speight, K Natasha; Polkinghorne, Adam; Penn, Rachel; Boardman, Wayne; Timms, Peter; Fraser, Tamieka; Johnson, Kathryn; Faull, Rachel; Bate, Sarah; Woolford, Lucy

    2016-04-28

    Chlamydia pecorum infection is highly prevalent in many koala ( Phascolarctos cinereus ) populations in the eastern states of Australia, causing ocular and urogenital tract disease. In contrast, the current prevalence of chlamydiosis in South Australian (SA) koalas is largely unknown, with few reports of clinical cases. We examined 65 SA rescued wild koalas at necropsy and collected ocular and urogenital swabs for the detection of C. pecorum by PCR. We detected C. pecorum in ocular or urogenital swabs from 57 koalas (88%), and 34 koalas were positive at both ocular and urogenital sites. Clinically overt chlamydial disease was present in only 12 (21%) positive koalas. Gross lesions were often externally inapparent as they affected the urogenital tract (n=5), and 24 infected koalas had microscopically evident lesions only. Lesions were predominantly mild and included conjunctivitis, cystitis, and urethritis. Reproductive tract disease was infrequently observed. We detected C. pecorum in 16 (28%) koalas with no evidence of chlamydial disease, suggesting the presence of subclinical carriers in this population. Based on these findings, chlamydiosis has a higher occurrence in SA koala populations than previously thought, but is most often mild and does not always result in overt clinical disease; inapparent and subclinical infections appear common. Further studies of the prevalence in wild-caught SA koalas are needed along with research into the host and bacterial factors that may influence disease outcome in these animals.

  7. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  8. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  9. Phylogeography of the Koala, (Phascolarctos cinereus), and Harmonising Data to Inform Conservation

    Science.gov (United States)

    Neaves, Linda E.; Frankham, Greta J.; Dennison, Siobhan; FitzGibbon, Sean; Flannagan, Cheyne; Gillett, Amber; Hynes, Emily; Handasyde, Kathrine; Helgen, Kristofer M.; Tsangaras, Kyriakos; Greenwood, Alex D.; Eldridge, Mark D. B.; Johnson, Rebecca N.

    2016-01-01

    The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus), one of Australia’s most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA) Control Region (CR) was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study). The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context. PMID:27588685

  10. Phylogeography of the Koala, (Phascolarctos cinereus, and Harmonising Data to Inform Conservation.

    Directory of Open Access Journals (Sweden)

    Linda E Neaves

    Full Text Available The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus, one of Australia's most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA Control Region (CR was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study. The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context.

  11. Phylogeography of the Koala, (Phascolarctos cinereus), and Harmonising Data to Inform Conservation.

    Science.gov (United States)

    Neaves, Linda E; Frankham, Greta J; Dennison, Siobhan; FitzGibbon, Sean; Flannagan, Cheyne; Gillett, Amber; Hynes, Emily; Handasyde, Kathrine; Helgen, Kristofer M; Tsangaras, Kyriakos; Greenwood, Alex D; Eldridge, Mark D B; Johnson, Rebecca N

    2016-01-01

    The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus), one of Australia's most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA) Control Region (CR) was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study). The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context.

  12. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina

    2017-05-01

    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  13. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  14. Insect prey eaten by Hoary Bats (Lasiurus cinereus) prior to fatal collisions with wind turbines

    Science.gov (United States)

    Valdez, Ernest W.; Cryan, Paul M.

    2013-01-01

    Wind turbines are being deployed all across the world to meet the growing demand for energy, and in many areas, these turbines are causing the deaths of insectivorous migratory bats. One of the hypothesized causes of bat susceptibility is that bats are attracted to insects on or near the turbines. We examined insect remains in the stomachs and intestines of hoary bats (Lasiurus cinereus) found dead beneath wind turbines in New York and Texas to evaluate the hypothesis that bats die while feeding at turbines. Most of the bats we examined had full stomachs, indicating that they fed in the minutes to hours leading up to their deaths. However, we did not find prey in the mouths or throats of any bats that would indicate the bats died while capturing prey. Hoary bats fed mostly on moths, but we also detected the regular presence of beetles, true bugs, and crickets. Presence of terrestrial insects in stomachs indicates that bats may have gleaned them from the ground or the turbine surfaces, yet aerial capture of winged insect stages cannot be ruled out. Our findings confirm earlier studies that indicate hoary bats feed during migration and eat mostly moths. Future studies on bat behaviors and insect presence at wind turbines could help determine whether feeding at turbines is a major fatality risk for bats.

  15. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  16. Koalas (Phascolarctos cinereus) From Queensland Are Genetically Distinct From 2 Populations in Victoria.

    Science.gov (United States)

    Ruiz-Rodriguez, Christina T; Ishida, Yasuko; Murray, Neil D; O'Brien, Stephen J; Graves, Jennifer A M; Greenwood, Alex D; Roca, Alfred L

    2016-01-01

    The koala (Phascolarctos cinereus) suffered population declines and local extirpation due to hunting in the early 20th century, especially in southern Australia. Koalas were subsequently reintroduced to the Brisbane Ranges (BR) and Stony Rises (SR) by translocating individuals from a population on French Island descended from a small number of founders. To examine genetic diversity and north-south differentiation, we genotyped 13 microsatellite markers in 46 wild koalas from the BR and SR, and 27 Queensland koalas kept at the US zoos. The Queensland koalas displayed much higher heterozygosity (H O = 0.73) than the 2 southern Australian koala populations examined: H O = 0.49 in the BR, whereas H O = 0.41 in the SR. This is consistent with the historical accounts of bottlenecks and founder events affecting the southern populations and contrasts with reports of high genetic diversity in some southern populations. The 2 southern Australian koala populations were genetically similar (F ST = 0.018, P = 0.052). By contrast, northern and southern Australian koalas were highly differentiated (F ST = 0.27, P < 0.001), thereby suggesting that geographic structuring should be considered in the conservation management of koalas. Sequencing of 648bp of the mtDNA control region in Queensland koalas found 8 distinct haplotypes, one of which had not been previously detected among koalas. Queensland koalas displayed high mitochondrial haplotype diversity (H = 0.753) and nucleotide diversity (π = 0.0072), indicating along with the microsatellite data that North American zoos have maintained high levels of genetic diversity among their Queensland koalas. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. The koala (Phascolarctos cinereus): a case study in the development of reproductive technology in a marsupial.

    Science.gov (United States)

    Johnston, Stephen D; Holt, William V

    2014-01-01

    The successful development and application of an assisted breeding program in any animal relies primarily on a thorough understanding of the fundamental reproductive biology (anatomy, physiology and behaviour) of the species in question. Surely, the ultimate goal and greatest hallmark of such a program is the efficacious establishment of a series of reliable techniques that facilitate the reproductive and genetic management of fragmented populations, both in captivity and in the wild. Such an achievement is all the more challenging when the reproductive biology of that species is essentially rudimentary and without adequate reproductive models to compare to. Using the koala (Phascolarctos cinereus) as a case study, this chapter provides some personal insights into the evolution of a concept that began as a small undergraduate student project but that subsequently evolved into the first-ever successful artificial insemination of a marsupial. Apart from this historical perspective, we also provide a brief review of the current reproductive biology of the koala, discuss technical elements of current assisted breeding technology of this species, its potential application to the wombat, and the future role it might play in helping to conserve wild koala populations. There is little doubt that the unique reproductive biology and tractability of the koala has in this case been a benefit rather than a hindrance to the success of artificial breeding in this species.

  18. Cryptococcosis in the koala (Phascolarctos cinereus): pathogenesis and treatment in the context of two atypical cases.

    Science.gov (United States)

    Schmertmann, Laura J; Stalder, Kathryn; Hudson, Donald; Martin, Patricia; Makara, Mariano; Meyer, Wieland; Malik, Richard; Krockenberger, Mark B

    2018-02-24

    Disseminated cryptococcosis caused by Cryptococcus gattii (molecular type VGI) was diagnosed in an adult free-ranging female koala (Phascolarctos cinereus). Subclinical cryptococcosis was later diagnosed in this koala's joey. In the adult koala, a pathological fracture of the tibia was associated with the bone lysis of marked focal cryptococcal osteomyelitis. Limb-sparing orthopedic intervention, in the setting of disseminated cryptococcosis, was judged to have a poor prognosis, and the adult koala was euthanized. The joey was removed and hand-reared. Serological testing revealed persistent and increasing cryptococcal capsular antigenemia in the absence of clinical signs of disease and it was subsequently treated with oral fluconazole for approximately 16 months, rehabilitated and released into the wild. It was sighted 3 months post-release in a good state of health and again at 18 months post-release but was not recaptured on either occasion. This is the first published report of cryptococcal appendicular osteomyelitis in a koala. It is also the first report of concurrent disease in a dependent juvenile and the successful treatment of subclinical cryptococcosis to full resolution of the cryptococcal antigenemia in a free-ranging koala. This paper provides a discussion of cryptococcal osteomyelitis in animals, host-pathogen-environment interactions and treatment and monitoring protocols for cryptococcosis in koalas. Published reports describing the treatment of cryptococcosis in koalas are also collated and summarised.

  19. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  20. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

    1990-01-01

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  1. Development and characterization of 21 polymorphic microsatellite markers for the barren-ground shrew, Sorex ugyunak (Mammalia: Sorcidae), through next-generation sequencing, and cross-species amplification in the masked shrew, S. cinereus

    Science.gov (United States)

    Sonsthagen, Sarah A.; Sage, G. Kevin; Fowler, Megan C.; Hope, Andrew G.; Cook, J.A.; Talbot, Sandra L.

    2013-01-01

    We used next generation shotgun sequencing to develop 21 novel microsatellite markers for the barren-ground shrew (Sorex ugyunak), which were polymorphic among individuals from northern Alaska. The loci displayed moderate allelic diversity (averaging 6.81 alleles per locus) and heterozygosity (averaging 70 %). Two loci deviated from Hardy–Weinberg equilibrium (HWE) due to heterozygote deficiency. While the population did not deviate from HWE overall, it showed significant linkage disequilibrium suggesting this population is not in mutation-drift equilibrium. Nineteen of 21 loci were polymorphic in masked shrews (S. cinereus) from interior Alaska and exhibited linkage equilibrium and HWE overall. All loci yielded sufficient variability for use in population studies.

  2. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  3. Characterization of the antimicrobial peptide family defensins in the Tasmanian devil (Sarcophilus harrisii), koala (Phascolarctos cinereus), and tammar wallaby (Macropus eugenii).

    Science.gov (United States)

    Jones, Elizabeth A; Cheng, Yuanyuan; O'Meally, Denis; Belov, Katherine

    2017-03-01

    Defensins comprise a family of cysteine-rich antimicrobial peptides with important roles in innate and adaptive immune defense in vertebrates. We characterized alpha and beta defensin genes in three Australian marsupials: the Tasmanian devil (Sarcophilus harrisii), koala (Phascolarctos cinereus), and tammar wallaby (Macropus eugenii) and identified 48, 34, and 39 defensins, respectively. One hundred and twelve have the classical antimicrobial peptides characteristics required for pathogen membrane targeting, including cationic charge (between 1+ and 15+) and a high proportion of hydrophobic residues (>30%). Phylogenetic analysis shows that gene duplication has driven unique and species-specific expansions of devil, koala, and tammar wallaby beta defensins and devil alpha defensins. Defensin genes are arranged in three genomic clusters in marsupials, whereas further duplications and translocations have occurred in eutherians resulting in four and five gene clusters in mice and humans, respectively. Marsupial defensins are generally under purifying selection, particularly residues essential for defensin structural stability. Certain hydrophobic or positively charged sites, predominantly found in the defensin loop, are positively selected, which may have functional significance in defensin-target interaction and membrane insertion.

  4. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.

    1981-01-01

    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  5. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

    Science.gov (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

    2017-04-01

    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  6. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  7. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  8. Characterization of shifts of koala (Phascolarctos cinereus intestinal microbial communities associated with antibiotic treatment

    Directory of Open Access Journals (Sweden)

    Katherine E. Dahlhausen

    2018-03-01

    Full Text Available Koalas (Phascolarctos cinereus are arboreal marsupials native to Australia that eat a specialized diet of almost exclusively eucalyptus leaves. Microbes in koala intestines are known to break down otherwise toxic compounds, such as tannins, in eucalyptus leaves. Infections by Chlamydia, obligate intracellular bacterial pathogens, are highly prevalent in koala populations. If animals with Chlamydia infections are received by wildlife hospitals, a range of antibiotics can be used to treat them. However, previous studies suggested that koalas can suffer adverse side effects during antibiotic treatment. This study aimed to use 16S rRNA gene sequences derived from koala feces to characterize the intestinal microbiome of koalas throughout antibiotic treatment and identify specific taxa associated with koala health after treatment. Although differences in the alpha diversity were observed in the intestinal flora between treated and untreated koalas and between koalas treated with different antibiotics, these differences were not statistically significant. The alpha diversity of microbial communities from koalas that lived through antibiotic treatment versus those who did not was significantly greater, however. Beta diversity analysis largely confirmed the latter observation, revealing that the overall communities were different between koalas on antibiotics that died versus those that survived or never received antibiotics. Using both machine learning and OTU (operational taxonomic unit co-occurrence network analyses, we found that OTUs that are very closely related to Lonepinella koalarum, a known tannin degrader found by culture-based methods to be present in koala intestines, was correlated with a koala’s health status. This is the first study to characterize the time course of effects of antibiotics on koala intestinal microbiomes. Our results suggest it may be useful to pursue alternative treatments for Chlamydia infections without the use of

  9. Epidemiology of chlamydial infection and disease in a free-ranging koala (Phascolarctos cinereus population.

    Directory of Open Access Journals (Sweden)

    Sharon Nyari

    Full Text Available Chlamydial disease continues to be one of the main factors threatening the long-term survival of the koala (Phascolarctos cinereus. Despite this, large epidemiological studies of chlamydial infection and disease in wild koala populations are lacking. A better understanding of the prevalence, transmission and pathogenesis is needed to improve control measures, such as the development of vaccines. We investigated the prevalence of Chlamydia pecorum infection and disease in 160 koalas in a peri-urban wild population in Queensland, Australia and found that 31% of koalas were Chlamydia PCR positive and 28% had clinically detectable chlamydial disease. Most infections were at the urogenital site (27%; both males and females with only 14% at the ocular site. Interestingly, we found that 27% (4/15 of koalas considered to be sexually immature (9-13 months were already infected with C. pecorum, suggesting that a significant percentage of animals are infected directly from their mother. Ocular infection levels were less prevalent with increasing age (8% in koalas older than 4 years, whereas the prevalence of urogenital tract infections remained high into older age (26% in koalas older than 4 years, suggesting that, after mother-to-young transmission, C. pecorum is predominantly a sexually transmitted infection. While 28% of koalas in this population had clinically detectable chlamydial disease (primarily urogenital tract disease, many PCR positive koalas had no detectable disease and importantly, not all diseased animals were PCR positive. We also observed higher chlamydial loads in koalas who were C. pecorum infected without clinical disease than in koalas who were C. pecorum infected with clinical disease. These results shed light on the potential mechanisms of transmission of C. pecorum in koalas and also guide future control measures, such as vaccination.

  10. Epidemiology of chlamydial infection and disease in a free-ranging koala (Phascolarctos cinereus) population.

    Science.gov (United States)

    Nyari, Sharon; Waugh, Courtney A; Dong, Jianbao; Quigley, Bonnie L; Hanger, Jonathan; Loader, Joanne; Polkinghorne, Adam; Timms, Peter

    2017-01-01

    Chlamydial disease continues to be one of the main factors threatening the long-term survival of the koala (Phascolarctos cinereus). Despite this, large epidemiological studies of chlamydial infection and disease in wild koala populations are lacking. A better understanding of the prevalence, transmission and pathogenesis is needed to improve control measures, such as the development of vaccines. We investigated the prevalence of Chlamydia pecorum infection and disease in 160 koalas in a peri-urban wild population in Queensland, Australia and found that 31% of koalas were Chlamydia PCR positive and 28% had clinically detectable chlamydial disease. Most infections were at the urogenital site (27%; both males and females) with only 14% at the ocular site. Interestingly, we found that 27% (4/15) of koalas considered to be sexually immature (9-13 months) were already infected with C. pecorum, suggesting that a significant percentage of animals are infected directly from their mother. Ocular infection levels were less prevalent with increasing age (8% in koalas older than 4 years), whereas the prevalence of urogenital tract infections remained high into older age (26% in koalas older than 4 years), suggesting that, after mother-to-young transmission, C. pecorum is predominantly a sexually transmitted infection. While 28% of koalas in this population had clinically detectable chlamydial disease (primarily urogenital tract disease), many PCR positive koalas had no detectable disease and importantly, not all diseased animals were PCR positive. We also observed higher chlamydial loads in koalas who were C. pecorum infected without clinical disease than in koalas who were C. pecorum infected with clinical disease. These results shed light on the potential mechanisms of transmission of C. pecorum in koalas and also guide future control measures, such as vaccination.

  11. Characterization of shifts of koala (Phascolarctos cinereus) intestinal microbial communities associated with antibiotic treatment.

    Science.gov (United States)

    Dahlhausen, Katherine E; Doroud, Ladan; Firl, Alana J; Polkinghorne, Adam; Eisen, Jonathan A

    2018-01-01

    Koalas ( Phascolarctos cinereus ) are arboreal marsupials native to Australia that eat a specialized diet of almost exclusively eucalyptus leaves. Microbes in koala intestines are known to break down otherwise toxic compounds, such as tannins, in eucalyptus leaves. Infections by Chlamydia , obligate intracellular bacterial pathogens, are highly prevalent in koala populations. If animals with Chlamydia infections are received by wildlife hospitals, a range of antibiotics can be used to treat them. However, previous studies suggested that koalas can suffer adverse side effects during antibiotic treatment. This study aimed to use 16S rRNA gene sequences derived from koala feces to characterize the intestinal microbiome of koalas throughout antibiotic treatment and identify specific taxa associated with koala health after treatment. Although differences in the alpha diversity were observed in the intestinal flora between treated and untreated koalas and between koalas treated with different antibiotics, these differences were not statistically significant. The alpha diversity of microbial communities from koalas that lived through antibiotic treatment versus those who did not was significantly greater, however. Beta diversity analysis largely confirmed the latter observation, revealing that the overall communities were different between koalas on antibiotics that died versus those that survived or never received antibiotics. Using both machine learning and OTU (operational taxonomic unit) co-occurrence network analyses, we found that OTUs that are very closely related to Lonepinella koalarum , a known tannin degrader found by culture-based methods to be present in koala intestines, was correlated with a koala's health status. This is the first study to characterize the time course of effects of antibiotics on koala intestinal microbiomes. Our results suggest it may be useful to pursue alternative treatments for Chlamydia infections without the use of antibiotics or the

  12. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K

    1978-01-01

    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  13. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  14. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  15. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  16. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  17. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  18. Potential 'ecological traps' of restored landscapes: koalas Phascolarctos cinereus re-occupy a rehabilitated mine site.

    Science.gov (United States)

    Cristescu, Romane H; Banks, Peter B; Carrick, Frank N; Frère, Céline

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community should include criteria

  19. Gastrointestinal torsions and intussusception in northern koalas (Phascolarctos cinereus) at San Diego Zoo (1976-2012).

    Science.gov (United States)

    Joyce-Zuniga, Nicole M; Roesler, Jennifer; Andrus, Chris Hamlin; Sutherland-Smith, Meg; Rideout, Bruce A; Pye, Geoffrey W

    2014-03-01

    The recent classification as threatened status of the northern koala (Phascolarctos cinereus) by the Australian Government highlights the importance of the conservation and health management of this iconic Australian marsupial. This case series describes gastrointestinal torsion and intussusception in six northern koalas (three males, three females, 2-11 yr old) at the San Diego Zoo from 1976 to 2012. Two koalas died shortly after presentation. Diagnoses of ileocecal intussusception, resulting from enteritis in one case and cecal torsion in the other, were made at postmortem examination. One koala died 4 days after an exploratory laparotomy, with negative findings, and an acute double colonic intussusception was diagnosed at postmortem examination. Two small intestinal mesenteric torsion and one proximal colon mesenteric torsion cases were successfully corrected surgically. In the case of colonic mesenteric torsion, the koala had recurrent clinical signs 2 wk later, and a second surgery requiring resection and anastomosis of ischemic jejunum was performed, with the koala dying shortly afterward. One koala with small intestinal torsion had a recurrence of torsion 22 mo later and subsequently died. The koala with the second case of small intestinal torsion remains alive 14 mo postsurgical correction. All six koalas presented with signs of colic that included anorexia, lethargy, depression, acute abdominal distension, abdominal stretching, decreased fecal output, open-mouth gasping, or a combination of symptoms. Abdominal radiographs may show stacked gastrointestinal linear gas patterns and contrast stasis. Prevalence of torsion and intussusception is low at this institution (2%), although recurrence in individuals is common (50%) and overall survival is poor (83%), which emphasizes the importance of timely recognition, surgical correction, and postoperative management. While inciting etiologies were unable to be determined in these cases, monitoring generalized

  20. Potential 'ecological traps' of restored landscapes: koalas Phascolarctos cinereus re-occupy a rehabilitated mine site.

    Directory of Open Access Journals (Sweden)

    Romane H Cristescu

    Full Text Available With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community

  1. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

    Science.gov (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

    2018-05-03

    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  2. Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

    Science.gov (United States)

    Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

    2013-06-01

    Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

  3. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  4. Dim ultraviolet light as a means of deterring activity by the Hawaiian hoary bat Lasiurus cinereus semotus

    Science.gov (United States)

    Gorresen, P. Marcos; Cryan, Paul M.; Dalton, David C.; Wolf, Sandy; Johnson, Jessica A.; Todd, Christopher M.; Bonaccorso, Frank J.

    2015-01-01

    Widespread bat fatalities at industrial wind turbines are a conservation issue with the potential to inhibit efficient use of an abundant source of energy. Bat fatalities can be reduced by altering turbine operations, but such curtailment decreases turbine efficiency. If additional ways of reducing bat fatalities at wind turbines were available such tradeoffs might not be needed. Based on the facts that bats perceive distant objects primarily through vision and can see in very dim lighting conditions, and the possibility that bats might interact with turbines after approaching them as they would trees, we propose a novel method of reducing bat activity at wind turbines: illumination of the structure with dim light. As a first step toward assessing this approach, we illuminated trees with dim flickering ultraviolet (UV) light in areas frequented by Hawaiian hoary bats Lasiurus cinereus semotus, an endangered subspecies affected by wind turbines. We used a repeated-measures design to quantify bat activity near trees with acoustic detectors and thermal video cameras in the presence and absence of UV illumination, while concurrently monitoring insect numbers. Results indicate that dim UV reduces bat activity despite an increase in insect numbers. Experimental treatment did not completely inhibit bat activity near trees, nor did all measures of bat activity show statistically significant differences due to high variance in bat activity among sites. However, the observed decreases in bat activity with dim UV illumination justify further testing of this method as a means to reduce bat fatalities at wind turbines.

  5. Identification of unusual Chlamydia pecorum genotypes in Victorian koalas (Phascolarctos cinereus) and clinical variables associated with infection.

    Science.gov (United States)

    Legione, Alistair R; Patterson, Jade L S; Whiteley, Pam L; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Polkinghorne, Adam; Devlin, Joanne M; Sansom, Fiona M

    2016-05-01

    Chlamydia pecorum infection is a threat to the health of free-ranging koalas (Phascolarctos cinereus) in Australia. Utilizing an extensive sample archive we determined the prevalence of C. pecorum in koalas within six regions of Victoria, Australia. The ompA genotypes of the detected C. pecorum were characterized to better understand the epidemiology of this pathogen in Victorian koalas. Despite many studies in northern Australia (i.e. Queensland and New South Wales), prior Chlamydia studies in Victorian koalas are limited. We detected C. pecorum in 125/820 (15 %) urogenital swabs, but in only one ocular swab. Nucleotide sequencing of the molecular marker C. pecorum ompA revealed that the majority (90/114) of C. pecorum samples typed were genotype B. This genotype has not been reported in northern koalas. In general, Chlamydia infection in Victorian koalas is associated with milder clinical signs compared with infection in koalas in northern populations. Although disease pathogenesis is likely to be multifactorial, the high prevalence of genotype B in Victoria may suggest it is less pathogenic. All but three koalas had C. pecorum genotypes unique to southern koala populations (i.e. Victoria and South Australia). These included a novel C. pecorum ompA genotype and two genotypes associated with livestock. Regression analysis determined that significant factors for the presence of C. pecorum infection were sex and geographical location. The presence of 'wet bottom' in males and the presence of reproductive tract pathology in females were significantly associated with C. pecorum infection, suggesting variation in clinical disease manifestations between sexes.

  6. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus) Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP) with Two Different Adjuvants.

    Science.gov (United States)

    Khan, Shahneaz Ali; Desclozeaux, Marion; Waugh, Courtney; Hanger, Jon; Loader, Jo; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2016-01-01

    Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus). In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP) antigen-based vaccine, combined with immune stimulating complex (ISC) adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri-adjuvant formula that comprises polyphosphazine based poly I: C and host defense peptides, with the same antigen. This formulation also produced strong cellular and humoral immune responses in captive koalas. In this current study, we directly compared the host immune responses of two sub-groups of wild Chlamydia negative koalas in one population vaccinated with the rMOMP protein antigen and adjuvanted with either the ISC or tri-adjuvant formula. Overall, both adjuvants produced strong Chlamydia-specific cellular (IFN-γ and IL-17A) responses in circulating PBMCs as well as MOMP-specific and functional, in vitro neutralising antibodies. While the immune responses were similar, there were adjuvant-specific immune differences between the two adjuvants, particularly in relation to the specificity of the MOMP epitope antibody responses.

  7. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP with Two Different Adjuvants.

    Directory of Open Access Journals (Sweden)

    Shahneaz Ali Khan

    Full Text Available Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus. In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP antigen-based vaccine, combined with immune stimulating complex (ISC adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri-adjuvant formula that comprises polyphosphazine based poly I: C and host defense peptides, with the same antigen. This formulation also produced strong cellular and humoral immune responses in captive koalas. In this current study, we directly compared the host immune responses of two sub-groups of wild Chlamydia negative koalas in one population vaccinated with the rMOMP protein antigen and adjuvanted with either the ISC or tri-adjuvant formula. Overall, both adjuvants produced strong Chlamydia-specific cellular (IFN-γ and IL-17A responses in circulating PBMCs as well as MOMP-specific and functional, in vitro neutralising antibodies. While the immune responses were similar, there were adjuvant-specific immune differences between the two adjuvants, particularly in relation to the specificity of the MOMP epitope antibody responses.

  8. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

    Science.gov (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

    2015-01-01

    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  9. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  10. Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, Jianrong

    2003-01-15

    The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

  11. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

    2003-07-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  12. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  13. Is the modern koala ( Phascolarctos cinereus) a derived dwarf of a Pleistocene giant? Implications for testing megafauna extinction hypotheses

    Science.gov (United States)

    Price, Gilbert J.

    2008-12-01

    The modern Australian koala ( Phascolarctos cinereus) is commonly regarded as a dwarf descendent of a Late Pleistocene giant koala ( Ph. stirtoni). The implication of that hypothesis is that the giant koala survived the Late Pleistocene megafaunal extinction "event", albeit as a smaller body-sized form. It is important to be able to constrain rates of Late Pleistocene faunal turnover, an aspect reliant on having accurate taxonomic information of extinct species. The koala dwarfing hypothesis is tested here by using a temporally-constrained biogeographical record of fossil koalas, and a morphological character analysis. The contemporary occurrence of both taxa in pre-Late Pleistocene deposits and significant differences in dental morphologies between those forms suggests that the modern koala is not a derived dwarf of the Pleistocene giant koala. Thus, the giant-form was among a number of other giant mammals, lizards and birds that suffered extinction sometime during the Late Pleistocene. The potential phenomenon of dwarfing of other Late Pleistocene and Recent faunas, such as grey kangaroos, is commonly used as a test for or against various megafaunal extinction hypotheses. However, the results of this study also demonstrate that the dwarfing hypothesis has not been adequately tested for a suite of other taxa. Thus, until the dwarfing hypothesis can be more fully tested, a clear understanding of the fate of Late Pleistocene faunas that apparently survived the extinction "event", and the origins of many extant forms will remain elusive.

  14. Potential ‘Ecological Traps’ of Restored Landscapes: Koalas Phascolarctos cinereus Re-Occupy a Rehabilitated Mine Site

    Science.gov (United States)

    Cristescu, Romane H.; Banks, Peter B.; Carrick, Frank N.; Frère, Céline

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community should include criteria

  15. Potential citric acid exposure and toxicity to Hawaiian hoary bats (Lasiurus cinereus semotus) associated with Eleutherodactylus frog control.

    Science.gov (United States)

    Pitt, William C; Witmer, Gary W; Jojola, Susan M; Sin, Hans

    2014-04-01

    We examined potential exposure of Hawaiian hoary bats (Lasiurus cinereus semotus) to citric acid, a minimum risk pesticide registered for control of invasive Eleutherodactylus frog populations. Hoary bats are nocturnal insectivores that roost solitarily in foliage, federally listed as endangered, and are endemic to Hawaii. Oral ingestion during grooming of contaminated fur appears to be the principal route by which these bats might be exposed to citric acid. We made assessments of oral toxicity, citric acid consumption, retention of material on fur, and grooming using big brown bats (Eptesicus fuscus) as a surrogate species. We evaluated both ground application and aerial application of 16 % solutions of citric acid during frog control operations. Absorbent bat effigies exposed to ground and aerial operational spray applications retained means of 1.54 and 0.02 g, respectively, of dry citric acid, although retention by the effigies was much higher than bat carcasses drenched in citric acid solutions. A high dose delivered orally (2,811 mg/kg) was toxic to the big brown bats and emesis occurred in 1 bat dosed as low as the 759 mg/kg level. No effect was observed with the lower doses examined (≤ 542 mg/kg). Bats sprayed with 5 ml of 16 % (w/w) citric acid solution showed no evidence of intoxication. In field situations, it is unlikely that bats would be sprayed directly or ingest much citric acid retained by fur. Based on our observations, we believe Hawaiian hoary bats to be at very low risk from harmful exposure to a toxic dose of citric acid during frog control operations.

  16. Interleukin 17A is an immune marker for chlamydial disease severity and pathogenesis in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mathew, Marina; Waugh, Courtney; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2014-10-01

    The koala (Phascolarctos cinereus) is an iconic Australian marsupial species that is facing many threats to its survival. Chlamydia pecorum infections are a significant contributor to this ongoing decline. A major limiting factor in our ability to manage and control chlamydial disease in koalas is a limited understanding of the koala's cell-mediated immune response to infections by this bacterial pathogen. To identify immunological markers associated with chlamydial infection and disease in koalas, we used koala-specific Quantitative Real Time PCR (qrtPCR) assays to profile the cytokine responses of Peripheral Blood Mononuclear Cells (PBMCs) collected from 41 koalas with different stages of chlamydial disease. Target cytokines included the principal Th1 (Interferon gamma; IFNγ), Th2 (Interleukin 10; IL10), and pro-inflammatory cytokines (Tumor Necrosis Factor alpha; TNFα). A novel koala-specific IL17A qrtPCR assay was also developed as part of this study to quantitate the gene expression of this Th17 cytokine in koalas. A statistically significant higher IL17A gene expression was observed in animals with current chlamydial disease compared to animals with asymptomatic chlamydial infection. A modest up-regulation of pro-inflammatory cytokines, such as TNFα and IFNγ, was also observed in these animals with signs of current chlamydial disease. IL10 gene expression was not evident in the majority of animals from both groups. Future longitudinal studies are now required to confirm the role played by cytokines in pathology and/or protection against C. pecorum infection in the koala. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Response of Red-Backed Salamanders (Plethodon Cinereus to Changes in Hemlock Forest Soil Driven by Invasive Hemlock Woolly Adelgid (Adelges Tsugae

    Directory of Open Access Journals (Sweden)

    Alison Ochs

    2017-01-01

    Full Text Available Hemlock forests of the northeastern United States are declining due to the invasive hemlock woolly adelgid (HWA (Adelges tsugae. Hardwood species replace these forests, which affects soil properties that may influence other communities, such as red-backed salamanders (red-backs (Plethodon cinereus. This study examined the effects of HWA invasion on soil properties and how this affects red-backs at the Hemlock Removal Experiment at Harvard Forest, which consists of eight 0.8 ha plots treated with girdling to simulate HWA invasion, logging to simulate common management practices, or hemlock- or hardwood-dominated controls. Coverboard surveys were used to determine the relative abundance of red-backs between plots during June and July 2014 and soil cores were collected from which the bulk density, moisture, pH, temperature, leaf litter, and carbon-nitrogen ratio were measured. Ordination provided a soil quality index based on temperature, pH, and carbon-to-nitrogen ratio, which was significantly different between plot treatments (p < 0.05 and showed a significant negative correlation with the red-back relative abundance (p < 0.05. The findings support the hypothesis that red-backs are affected by soil quality, which is affected by plot treatment and thus HWA invasion. Further studies should explore how salamanders react in the long term towards changing environments and consider the use of red-backs as indicator species.

  18. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  19. Histological and immunohistological investigation of alimentary tract lymphoid tissue in the koala (Phascolarctos cinereus), brushtail possum (Trichosurus vulpecula) and ringtail possum (Pseudocheirus peregrinus).

    Science.gov (United States)

    Hemsley, S W; Canfield, P J; Husband, A J

    1996-01-01

    The histological appearance and distribution of T cells, B cells and plasma cells were investigated for oropharyngeal tonsils, small intestinal lymphoid aggregations (Peyer's patches), caecocolic lymphoid patches and mesenteric lymph nodes of koalas (Phascolarctos cinereus), common brushtail possums (Trichosurus vulpecula) and common ringtail possums (Pseudocheirus peregrinus). The histological organisation and distribution of lymphoid cell subpopulations of these tissues were similar to those described in eutherian mammals, although some differences were found in comparison with previous descriptions of American opossum tissues. The main variation among the 3 species was in the structural organisations of the oropharyngeal tonsil and the caecocolic lymphoid patch which were more complex in the koala than in possums. In the koala the extensive crypts of the oropharyngeal tonsils and folding of the mucosa of the caecocolic lymphoid patch increased their surface area and, in addition, both structures had areas of epithelium heavily infiltrated with T and B cells. These features could indicate that these structures are important in immunological surveillance of orally presented antigens in koalas. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 Fig. 13 Fig. 14 Fig. 15 Fig. 16 PMID:8621326

  20. Development and field validation of a regional, management-scale habitat model: A koala Phascolarctos cinereus case study.

    Science.gov (United States)

    Law, Bradley; Caccamo, Gabriele; Roe, Paul; Truskinger, Anthony; Brassil, Traecey; Gonsalves, Leroy; McConville, Anna; Stanton, Matthew

    2017-09-01

    Species distribution models have great potential to efficiently guide management for threatened species, especially for those that are rare or cryptic. We used MaxEnt to develop a regional-scale model for the koala Phascolarctos cinereus at a resolution (250 m) that could be used to guide management. To ensure the model was fit for purpose, we placed emphasis on validating the model using independently-collected field data. We reduced substantial spatial clustering of records in coastal urban areas using a 2-km spatial filter and by modeling separately two subregions separated by the 500-m elevational contour. A bias file was prepared that accounted for variable survey effort. Frequency of wildfire, soil type, floristics and elevation had the highest relative contribution to the model, while a number of other variables made minor contributions. The model was effective in discriminating different habitat suitability classes when compared with koala records not used in modeling. We validated the MaxEnt model at 65 ground-truth sites using independent data on koala occupancy (acoustic sampling) and habitat quality (browse tree availability). Koala bellows ( n  = 276) were analyzed in an occupancy modeling framework, while site habitat quality was indexed based on browse trees. Field validation demonstrated a linear increase in koala occupancy with higher modeled habitat suitability at ground-truth sites. Similarly, a site habitat quality index at ground-truth sites was correlated positively with modeled habitat suitability. The MaxEnt model provided a better fit to estimated koala occupancy than the site-based habitat quality index, probably because many variables were considered simultaneously by the model rather than just browse species. The positive relationship of the model with both site occupancy and habitat quality indicates that the model is fit for application at relevant management scales. Field-validated models of similar resolution would assist in

  1. Surveys on the distribution and abundance of the Hawaiian hoary bat (Lasiurus cinereus semotus) in the vicinity of proposed geothermal project subzones in the District of Puna, Hawaii. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Reynolds, M.; Ritchotte, G.; Dwyer, J.; Viggiano, A.; Nielsen, B.; Jacobi, J.D. [Fish and Wildlife Service, Hawaii National Park, HI (United States). Hawaii Research Station

    1994-08-01

    In 1993 the US Fish and Wildlife Service (USFWS) entered into an interagency agreement with the Department of Energy (DOE) to conduct wildlife surveys relative to identifying potential impacts of geothermal resource development on the native biota of the east rift zone of Kilauea volcano in the Puna district on the island of Hawaii. This report presents data on the endangered Hawaiian hoary bat (Hawaiian bat), or opeapea (Lasiurus cinereus semotus), within the proposed Hawaii geothermal subzones. Potential effects of geothermal development on Hawaiian bat populations are also discussed. Surveys were conducted to determine the distribution and abundance of bats throughout the District of Puna. Baseline information was collected to evaluate the status of bats within the study area and to identify important foraging habitats. Little specific data exists in the published literature on the population status and potential limiting factors affecting the Hawaiian bat. A USFWS recovery plan does not exist for this endangered species.

  2. The prevalence and clinical significance of Chlamydia infection in island and mainland populations of Victorian koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Patterson, Jade L S; Lynch, Michael; Anderson, Garry A; Noormohammadi, Amir H; Legione, Alistair; Gilkerson, James R; Devlin, Joanne M

    2015-04-01

    Chlamydia infection is known to impact the health of koalas (Phascolarctos cinereus) in New South Wales (NSW) and Queensland, but the clinical significance of Chlamydia infections in Victorian koalas is not well described. We examined the prevalence of Chlamydia infection and assessed associated health parameters in two Victorian koala populations known to be Chlamydia positive. The same testing regimen was applied to a third Victorian population in which Chlamydia had not been detected. We examined 288 koalas and collected samples from the urogenital sinus and conjunctival sacs. Detection and differentiation of Chlamydia species utilized real-time PCR and high-resolution melting curve analysis. Chlamydia pecorum was detected in two populations (prevalences: 25% and 41%, respectively) but only from urogenital sinus swabs. Chlamydia was not detected in the third population. Chlamydia pneumoniae was not detected. Chlamydia pecorum infection was positively associated with wet bottom (indicating chronic urinary tract disease) in one Chlamydia-positive population and with abnormal urogenital ultrasound findings in the other Chlamydia-positive population. The prevalence of wet bottom was similar in all populations (including the Chlamydia-free population), suggesting there is another significant cause (or causes) of wet bottom in Victorian koalas. Ocular disease was not observed. This is the largest study of Chlamydia infection in Victorian koalas, and the results suggest the potential for epidemiologic differences related to Chlamydia infections between Victorian koalas and koalas in Queensland and NSW and also between geographically distinct Victorian populations. Further studies to investigate the genotypes of C. pecorum present in Victorian koalas and to identify additional causes of wet bottom in koalas are indicated.

  3. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  4. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  5. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  6. Winter distribution and use of high elevation caves as foraging sites by the endangered Hawaiian hoary bat, Lasiurus cinereus semotus

    Science.gov (United States)

    Bonaccorso, Frank; Montoya-Aiona, Kristina; Pinzari, Corinna A.; Todd, Christopher M.

    2016-01-01

    We examine altitudinal movements involving unusual use of caves by Hawaiian hoary bats, Lasiurus cinereus semotus, during winter and spring in the Mauna Loa Forest Reserve (MLFR), Hawai‘i Island. Acoustic detection of hoary bat vocalizations, were recorded with regularity outside 13 lava tube cave entrances situated between 2,200 to 3,600 m asl from November 2012 to April 2013. Vocalizations were most numerous in November and December with the number of call events and echolocation pulses decreasing through the following months. Bat activity was positively correlated with air temperature and negatively correlated with wind speed. Visual searches found no evidence of hibernacula nor do Hawaiian hoary bats appear to shelter by day in these caves. Nevertheless, bats fly deep into caves as evidenced by numerous carcasses found in cave interiors. The occurrence of feeding buzzes around cave entrances and visual observations of bats flying in acrobatic fashion in cave interiors point to the use of these spaces as foraging sites. Peridroma moth species (Noctuidae), the only abundant nocturnal, flying insect sheltering in large numbers in rock rubble and on cave walls in the MLFR, apparently serve as the principal prey attracting hoary bats during winter to lava tube caves in the upper MLFR. Caves above 3,000 m on Mauna Loa harbor temperatures suitable for Pseudogymnoascus destructansfungi, the causative agent of White-nose Syndrome that is highly lethal to some species of North American cave-dwelling bats. We discuss the potential for White-nose Syndrome to establish and affect Hawaiian hoary bats.

  7. Preliminary characterisation of tumor necrosis factor alpha and interleukin-10 responses to Chlamydia pecorum infection in the koala (Phascolarctos cinereus.

    Directory of Open Access Journals (Sweden)

    Marina Mathew

    Full Text Available Debilitating infectious diseases caused by Chlamydia are major contributors to the decline of Australia's iconic native marsupial species, the koala (Phascolarctos cinereus. An understanding of koala chlamydial disease pathogenesis and the development of effective strategies to control infections continue to be hindered by an almost complete lack of species-specific immunological reagents. The cell-mediated immune response has been shown to play an influential role in the response to chlamydial infection in other hosts. The objective of this study, hence, was to provide preliminary data on the role of two key cytokines, pro-inflammatory tumour necrosis factor alpha (TNFα and anti-inflammatory interleukin 10 (IL10, in the koala Chlamydia pecorum response. Utilising sequence homology between the cytokine sequences obtained from several recently sequenced marsupial genomes, this report describes the first mRNA sequences of any koala cytokine and the development of koala specific TNFα and IL10 real-time PCR assays to measure the expression of these genes from koala samples. In preliminary studies comparing wild koalas with overt chlamydial disease, previous evidence of C. pecorum infection or no signs of C. pecorum infection, we revealed strong but variable expression of TNFα and IL10 in wild koalas with current signs of chlamydiosis. The description of these assays and the preliminary data on the cell-mediated immune response of koalas to chlamydial infection paves the way for future studies characterising the koala immune response to a range of its pathogens while providing reagents to assist with measuring the efficacy of ongoing attempts to develop a koala chlamydial vaccine.

  8. Preliminary characterisation of tumor necrosis factor alpha and interleukin-10 responses to Chlamydia pecorum infection in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mathew, Marina; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-01-01

    Debilitating infectious diseases caused by Chlamydia are major contributors to the decline of Australia's iconic native marsupial species, the koala (Phascolarctos cinereus). An understanding of koala chlamydial disease pathogenesis and the development of effective strategies to control infections continue to be hindered by an almost complete lack of species-specific immunological reagents. The cell-mediated immune response has been shown to play an influential role in the response to chlamydial infection in other hosts. The objective of this study, hence, was to provide preliminary data on the role of two key cytokines, pro-inflammatory tumour necrosis factor alpha (TNFα) and anti-inflammatory interleukin 10 (IL10), in the koala Chlamydia pecorum response. Utilising sequence homology between the cytokine sequences obtained from several recently sequenced marsupial genomes, this report describes the first mRNA sequences of any koala cytokine and the development of koala specific TNFα and IL10 real-time PCR assays to measure the expression of these genes from koala samples. In preliminary studies comparing wild koalas with overt chlamydial disease, previous evidence of C. pecorum infection or no signs of C. pecorum infection, we revealed strong but variable expression of TNFα and IL10 in wild koalas with current signs of chlamydiosis. The description of these assays and the preliminary data on the cell-mediated immune response of koalas to chlamydial infection paves the way for future studies characterising the koala immune response to a range of its pathogens while providing reagents to assist with measuring the efficacy of ongoing attempts to develop a koala chlamydial vaccine.

  9. Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, J R; An, C H; Yuan, J M

    2005-01-01

    The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

  10. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  11. Computed tomography and magnetic resonance for the advanced imaging of the normal nasal cavity and paranasal sinuses of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Alexander, Kate; Gorow, April; Pye, Geoffrey W

    2014-12-01

    The objective of this study is to describe computed tomography (CT) and magnetic resonance (MR) for the cross-sectional imaging of the normal anatomy of the nasal cavity and paranasal sinuses of the koala (Phascolarctos cinereus), to provide reference figures for gross anatomy with corresponding CT and MR images and to compare the features of the nasal cavity and paranasal sinuses of the normal koala with that reported in other domestic species. Advanced imaging can be used to aid in diagnosis, to plan surgical intervention, and to monitor therapeutic responses to diseases of the nasal passages in koalas. One clinically normal koala was anesthetized twice for the separate acquisition of dorsal CT scan images and transverse, dorsal, and sagittal MR images of its nasal cavity and paranasal sinuses. Sagittal and transverse CT planes were reformatted. Three fresh koala skulls were also transected in one of each transverse, sagittal, and dorsal planes and photographed. The CT and MR images obtained were matched with corresponding gross anatomic images and the normal bone, tissues and airway passages were identified. All anatomic structures were readily identifiable on CT, magnetic resonance imaging (MRI), and gross images. CT and MRI are both valuable diagnostic tools for imaging the nasal cavities and paranasal sinuses of koalas. Images obtained from this project can be used as baseline references for future comparison with diseased koalas to help with diagnosis, surgical intervention, and response to therapy.

  12. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  13. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  14. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  15. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  16. A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity.

    Science.gov (United States)

    Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J; Eldridge, Mark D B; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N; Timms, Peter

    2014-09-11

    The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. RNA-Seq data was generated from a range of tissues from one male and one female koala and assembled de novo into transcripts using Velvet-Oases. Transcript abundance in each tissue was estimated. Transcripts were searched for likely protein-coding regions and a non-redundant set of 117,563 putative protein sequences was produced. In similarity searches there were 84,907 (72%) sequences that aligned to at least one sequence in the NCBI nr protein database. The best alignments were to sequences from other marsupials. After applying a reciprocal best hit requirement of koala sequences to those from tammar wallaby, Tasmanian devil and the gray short-tailed opossum, we estimate that our transcriptome dataset represents approximately 15,000 koala genes. The marsupial alignment information was used to look for potential gene duplications and we report evidence for copy number expansion of the alpha amylase gene, and of an aldehyde reductase gene.Koala retrovirus (KoRV) transcripts were detected in the transcriptomes. These were analysed in detail and the structure of the spliced envelope gene transcript was determined. There was appreciable sequence diversity within KoRV, with 233 sites in the KoRV genome showing small insertions/deletions or single nucleotide polymorphisms. Both koalas had sequences from the KoRV-A subtype, but the male koala transcriptome has, in addition, sequences more closely related to the KoRV-B subtype. This is the first report of a KoRV-B-like sequence in a wild population. This transcriptomic

  17. Non-invasive evaluation of physiological stress in an iconic Australian marsupial: the Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Narayan, Edward J; Webster, Koa; Nicolson, Vere; Mucci, Al; Hero, Jean-Marc

    2013-06-15

    Koalas (Phascolarctos cinereus) are the only extant representatives of Australia's unique marsupial family Phascolarctidae and were listed as nationally Vulnerable in 2012. Causes of mortality are diverse, although the disease chlamydiosis, dog attacks, collisions with cars, and loss of habitat represent the principal reasons for the continued species decline. Koala breeding facilities in Queensland and New South Wales, Australia have been established for conservation and tourism. Non-invasive monitoring of physiological stress is important for determining the sub-lethal effects of environmental stressors on the well-being, reproduction and survival of Koalas in Zoos and also in the wild. In this study, we developed a faecal cortisol metabolite (FCM) enzyme-immunoassay (EIA) for monitoring physiological stress in Koalas from two established Zoos in Australia and also within a free-living sub-population from Queensland. Biological validation of the FCM EIA was done using an adrenocorticotropic hormone (ACTH) challenge. We discovered excretory lag-times of FCM of 24 h in females (n=2) and 48 h in male (n=2) Koalas in response to the ACTH challenge. FCM levels showed an episodic and delayed peak response lasting up to 9 days post ACTH challenge. This finding should be taken into consideration when designing future experiments to study the impacts of short-term (acute) and chronic stressors on the Koalas. Laboratory validations were done using parallelism and recovery checks (extraction efficiency) of the cortisol standard against pooled Koala faecal extracts. Greater than 99% recovery of the cortisol standard was obtained as well as a parallel displacement curve against Koala faecal extracts. FCM levels of the captive Koalas (n=10 males and 13 females) significantly differed by sex, reproductive condition (lactating versus non-lactating Koalas) and the handling groups. Handled male Koalas had 200% higher FCM levels than their non-handled counterparts, while females

  18. The distribution of organised lymphoid tissue in the alimentary tracts of koalas (Phascolarctos cinereus) and possums (Trichosurus vulpecula and Pseudocheirus peregrinus).

    Science.gov (United States)

    Hemsley, S W; Canfield, P J; Husband, A J

    1996-01-01

    The anatomical arrangement of organised lymphoid tissues of the alimentary tract for 3 Australian marsupials, the koala (Phascolarctos cinereus), the common brushtail possum (Trichosurus vulpecula and the common ringtail possum (Pseudocheirus peregrinus), was determined by gross dissection and acetic acid treatment. Oropharyngeal tonsils were consistently found in the dorsolateral wall of the caudal oropharynx in all 3 species and additionally in the ventral soft palate of the koala. Aggregated lymphoid nodules (Peyer's patches) were present in the small intestine of koalas, ringtail possums and brushtail possums and were of similar appearance for all 3 species. Bilateral large intestinal lymphoid patches were detected in the caecocolic lateral wall adjacent to the termination of the ileum for all 3 species. Caecocolic patches were more complex in koalas and had mucosal folds and a central recess. In addition, solitary and grouped large intestinal lymphoid nodules were variably present in the proximal colon and caecum of the koala. In contrast, possums had solitary and grouped large intestinal lymphoid nodules present in the proximal colon and rectum but not the caecum. Aggregated lymphoid tissue was not detected in the tongue, oesophagus or stomach for all 3 species. In contrast to a previous report, this study did not find a paucity of lymphoid tissue associated with the gut of the koala. The appearance and distribution of gut-associated lymphoid tissue in koalas and possums was found to be similar to that described in other marsupials and eutherian mammals, although some variations in appearance and anatomical location were observed. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8621325

  19. Spectroscopic evidence for an engineered, catalytically active Trp radical that creates the unique reactivity of lignin peroxidase.

    Science.gov (United States)

    Smith, Andrew T; Doyle, Wendy A; Dorlet, Pierre; Ivancich, Anabella

    2009-09-22

    The surface oxidation site (Trp-171) in lignin peroxidase (LiP) required for the reaction with veratryl alcohol a high-redox-potential (1.4 V) substrate, was engineered into Coprinus cinereus peroxidase (CiP) by introducing a Trp residue into a heme peroxidase that has similar protein fold but lacks this activity. To create the catalytic activity toward veratryl alcohol in CiP, it was necessary to reproduce the Trp site and its negatively charged microenvironment by means of a triple mutation. The resulting D179W+R258E+R272D variant was characterized by multifrequency EPR spectroscopy. The spectra unequivocally showed that a new Trp radical [g values of g(x) = 2.0035(5), g(y) = 2.0027(5), and g(z) = 2.0022(1)] was formed after the [Fe(IV)=O Por(*+)] intermediate, as a result of intramolecular electron transfer between Trp-179 and the porphyrin. Also, the EPR characterization crucially showed that [Fe(IV)=O Trp-179(*)] was the reactive intermediate with veratryl alcohol. Accordingly, our work shows that it is necessary to take into account the physicochemical properties of the radical, fine-tuned by the microenvironment, as well as those of the preceding [Fe(IV)=O Por(*+)] intermediate to engineer a catalytically competent Trp site for a given substrate. Manipulation of the microenvironment of the Trp-171 site in LiP allowed the detection by EPR spectroscopy of the Trp-171(*), for which direct evidence has been missing so far. Our work also highlights the role of Trp residues as tunable redox-active cofactors for enzyme catalysis in the context of peroxidases with a unique reactivity toward recalcitrant substrates that require oxidation potentials not realized at the heme site.

  20. Biogenic porous silica and silicon sourced from Mexican Giant Horsetail (Equisetum myriochaetum) and their application as supports for enzyme immobilization.

    Science.gov (United States)

    Sola-Rabada, Anna; Sahare, Padma; Hickman, Graham J; Vasquez, Marco; Canham, Leigh T; Perry, Carole C; Agarwal, Vivechana

    2018-06-01

    Porous silica-based materials are attractive for biomedical applications due to their biocompatibility and biodegradable character. In addition, inorganic supports such as porous silicon are being developed due to integrated circuit chip compatibility and tunable properties leading to a wide range of multidisciplinary applications. In this contribution, biosilica extracted from a rarely studied plant material (Equisetum Myriochaetum), its conversion to silicon and the potential for both materials to be used as supports for enzyme immobilization are investigated. E. myriochaetum was subject to conventional acid digestion to extract biogenic silica with a% yield remarkably higher (up to 3 times) than for other Equisetum sp. (i.e. E. Arvense). The surface area of the isolated silica was ∼400 m 2 /g, suitable for biotechnological applications. Biogenic silicon was obtained by magnesiothermic reduction. The materials were characterized by SEM-EDX, XRD, FT-IR, ICP-OES, TGA and BET analysis and did not contain significant levels of class 1 heavy elements (such as Pb, Cd, Hg and As). Two commercial peroxidases, horseradish peroxidase (HRP) and Coprinus cinereus peroxidase (CiP) were immobilized onto the biogenic materials using three different functionalization routes: (A) carbodiimide, (B) amine + glutaraldehyde and (C) amine + carbodiimide. Although both biogenic silica and porous silicon could be used as supports differences in behaviour were observed for the two enzymes. For HRP, loading onto biogenic silica via the glutaraldehyde immobilization technique (route B) was most effective. The loading of CiP showed a much higher peroxidase activity onto porous silicon than silica functionalized by the carbodiimide method (route A). From the properties of the extracted materials obtained from Equisetum Myriochaetum and the immobilization results observed, these materials appear to be promising for industrial and biomedical applications. Copyright © 2018 Elsevier

  1. Variation in the microbiome of the urogenital tract of Chlamydia-free female koalas (Phascolarctos cinereus) with and without 'wet bottom'.

    Science.gov (United States)

    Legione, Alistair R; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Sansom, Fiona M; Devlin, Joanne M

    2018-01-01

    Koalas (Phascolarctos cinereus) are iconic Australian marsupials currently threatened by several processes, including infectious diseases and ecological disruption. Infection with Chlamydia pecorum, is considered a key driver of population decline. The clinical sign of 'wet bottom', a staining of the rump associated with urinary incontinence, is often caused by chlamydial urinary tract infections. However, wet bottom has been recorded in koalas free of C. pecorum, suggesting other causative agents in those individuals. We used 16S rRNA diversity profiling to investigate the microbiome of the urogenital tract of ten female koalas in order to identify potential causative agents of wet bottom, other than C. pecorum. Five urogenital samples were processed from koalas presenting with wet bottom and five were clinically normal. All koalas were negative for C. pecorum infection. We detected thirteen phyla across the ten samples, with Firmicutes occurring at the highest relative abundance (77.6%). The order Lactobacillales, within the Firmicutes, comprised 70.3% of the reads from all samples. After normalising reads using DESeq2 and testing for significant differences (P < 0.05), there were 25 operational taxonomic units (OTUs) more commonly found in one group over the other. The families Aerococcaceae and Tissierellaceae both had four significantly differentially abundant OTUs. These four Tissierellaceae OTUs were all significantly more abundant in koalas with wet bottom. This study provides the foundation for future investigations of causes of koala wet bottom, other than C. pecorum infection. This is of clinical relevance as wet bottom is often assumed to be caused by C. pecorum and treated accordingly. Our research highlights that other organisms may be causing wet bottom, and these potential aetiological agents need to be further investigated to fully address the problems this species faces.

  2. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  3. Linking Genetic Variation in Adaptive Plant Traits to Climate in Tetraploid and Octoploid Basin Wildrye [Leymus cinereus (Scribn. & Merr.) A. Love] in the Western U.S.

    Science.gov (United States)

    Johnson, R C; Vance-Borland, Ken

    2016-01-01

    Few studies have assessed how ploidy type within a species affects genetic variation among populations in relation to source climates. Basin wildrye (Leymus cinereus (Scribn. & Merr.) A. Love) is a large bunchgrass common in the intermountain Western U.S. found in both octoploid and tetraploid types. In common gardens at two sites over two years differences in both ploidy type and genetic variation within ploidy were observed in phenology, morphology, and production traits on 57 octoploid and 52 tetraploid basin wildrye from the intermountain Western U.S. (Ptypes. Still, among populations octoploids often had greater genetic variation for traits and occupied more diverse climates than tetraploids. Genetic variation for both ploidy types was linked to source climates in canonical correlation analysis, with the first two variates explaining 70% of the variation. Regression of those canonical variates with seed source climate variables produced models that explained 64% and 38% of the variation, respectively, and were used to map 15 seed zones covering 673,258 km2. Utilization of these seed zones will help ensure restoration with adaptive seed sources for both ploidy types. The link between genetic traits and seed source climates suggests climate driven natural selection and adaptive evolution in basin wildrye. The more diverse climates occupied by octoploids and higher trait variation suggests a higher capacity for ecological differentiation than tetraploids in the intermountain Western U.S.

  4. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

    Science.gov (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

    2017-10-01

    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Climate-mediated competition in a high-elevation salamander community

    Science.gov (United States)

    Dallalio, Eric A.; Brand, Adrianne B,; Grant, Evan H. Campbell

    2017-01-01

    The distribution of the federally endangered Shenandoah Salamander (Plethodon shenandoah) is presumed to be limited by competition with the Red-backed Salamander (Plethodon cinereus). In particular, the current distribution of P. shenandoah is understood to be restricted to warmer and drier habitats because of interspecific interactions. These habitats may be particularly sensitive to climate change, though the influence of competition may also be affected by temperature and relative humidity. We investigated the response of P. shenandoah to competition with P. cinereus under four climate scenarios in 3-dimensional mesocosms. The results suggest that, although climate change may alleviate competitive pressure from P. cinereus, warmer temperatures may also significantly influence the persistence of the species across its known range.

  6. Assessment of intra and interregional genetic variation in the Eastern Red-backed Salamander, Plethodon cinereus, via analysis of novel microsatellite markers.

    Directory of Open Access Journals (Sweden)

    Alexander C Cameron

    Full Text Available The red-backed salamander (Plethodon cinereus has long-served as a model system in ecology, evolution, and behavior, and studies surveying molecular variation in this species have become increasingly common over the past decade. However, difficulties are commonly encountered when extending microsatellite markers to populations that are unstudied from a genetic perspective due to high levels of genetic differentiation across this species' range. To ameliorate this issue, we used 454 pyrosequencing to identify hundreds of microsatellite loci. We then screened 40 of our top candidate loci in populations in Virginia, Pennsylvania, and Ohio-including an isolated island population ~ 4.5 km off the shore of Lake Erie (South Bass Island. We identified 25 loci that are polymorphic in a well-studied region of Virginia and 11 of these loci were polymorphic in populations located in the genetically unstudied regions of Ohio and Pennsylvania. Use of these loci to examine patterns of variation within populations revealed that South Bass Island has low diversity in comparison to other sites. However, neither South Bass Island nor isolated populations around Cleveland are inbred. Assessment of variation between populations revealed three well defined genetic clusters corresponding to Virginia, mainland Ohio/Pennsylvania, and South Bass Island. Comparisons of our results to those of others working in various parts of the range are consistent with the idea that differentiation is lower in regions that were once glaciated. However, these comparisons also suggest that well differentiated isolated populations in the formerly glaciated portion of the range are not uncommon. This work provides novel genetic resources that will facilitate population genetic studies in a part of the red-backed salamander's range that has not previously been studied in this manner. Moreover, this work refines our understanding of how neutral variation is distributed in this ecologically

  7. Variation in the microbiome of the urogenital tract of Chlamydia-free female koalas (Phascolarctos cinereus) with and without ‘wet bottom’

    Science.gov (United States)

    Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R.; Sansom, Fiona M.; Devlin, Joanne M.

    2018-01-01

    Koalas (Phascolarctos cinereus) are iconic Australian marsupials currently threatened by several processes, including infectious diseases and ecological disruption. Infection with Chlamydia pecorum, is considered a key driver of population decline. The clinical sign of ‘wet bottom’, a staining of the rump associated with urinary incontinence, is often caused by chlamydial urinary tract infections. However, wet bottom has been recorded in koalas free of C. pecorum, suggesting other causative agents in those individuals. We used 16S rRNA diversity profiling to investigate the microbiome of the urogenital tract of ten female koalas in order to identify potential causative agents of wet bottom, other than C. pecorum. Five urogenital samples were processed from koalas presenting with wet bottom and five were clinically normal. All koalas were negative for C. pecorum infection. We detected thirteen phyla across the ten samples, with Firmicutes occurring at the highest relative abundance (77.6%). The order Lactobacillales, within the Firmicutes, comprised 70.3% of the reads from all samples. After normalising reads using DESeq2 and testing for significant differences (P < 0.05), there were 25 operational taxonomic units (OTUs) more commonly found in one group over the other. The families Aerococcaceae and Tissierellaceae both had four significantly differentially abundant OTUs. These four Tissierellaceae OTUs were all significantly more abundant in koalas with wet bottom. This study provides the foundation for future investigations of causes of koala wet bottom, other than C. pecorum infection. This is of clinical relevance as wet bottom is often assumed to be caused by C. pecorum and treated accordingly. Our research highlights that other organisms may be causing wet bottom, and these potential aetiological agents need to be further investigated to fully address the problems this species faces. PMID:29579080

  8. The seminiferous epithelial cycle and microanatomy of the koala (Phascolarctos cinereus) and southern hairy-nosed wombat (Lasiorhinus latifrons) testis.

    Science.gov (United States)

    Oishi, Motoharu; Takahashi, Mei; Amasaki, Hajime; Janssen, Tina; Johnston, Stephen D

    2013-03-01

    The koala (Phascolarctos cinereus) and southern hairy-nosed wombat (Lasiorhinus latifrons) are iconic Australian fauna that share a close phylogenetic relationship but there are currently no comparative studies of the seminiferous epithelial cell or testicular microanatomy of either species. Koala and wombat spermatozoa are unusual for marsupials as they possess a curved stream-lined head and lateral neck insertion that superficially is similar to murid spermatozoa; the koala also contains Sertoli cells with crystalloid inclusions that closely resemble the Charcot-Bottcher crystalloids described in human Sertoli cells. Eighteen sexually mature koalas and four sexually mature southern hairy-nosed (SHN) wombats were examined to establish base-line data on quantitative testicular histology. Dynamics of the seminiferous epithelial cycle in the both species consisted of eight stages of cellular association similar to that described in other marsupials. Both species possessed a high proportion of the pre-meiotic (stages VIII, I - III; koala - 62.2 ± 1.7% and SHN wombat - 66.6 ± 2.4%) when compared with post-meiotic stages of the seminiferous cycle. The mean diameters of the seminiferous tubules found in the koalas and the SHN wombats were 227.8 ± 6.1 and 243.5 ± 3.9 μm, respectively. There were differences in testicular histology between the species including the koala possessing (i) a greater proportion of Leydig cells, (ii) larger Sertoli cell nuclei, (iii) crystalloids in the Sertoli cell cytoplasm, (iv) a distinctive acrosomal granule during spermiogenesis and (v) a highly eosinophilic acrosome. An understanding of the seminiferous epithelial cycle and microanatomy of testis is fundamental for documenting normal spermatogenesis and testicular architecture; recent evidence of orchitis and epididymitis associated with natural chlamydial infection in the koala suggest that this species might be useful as an experimental model for understanding Chlamydia

  9. Characterisation of CD4 T cells in healthy and diseased koalas (Phascolarctos cinereus) using cell-type-specific monoclonal antibodies.

    Science.gov (United States)

    Mangar, Chandan; Armitage, Charles W; Timms, Peter; Corcoran, Lynn M; Beagley, Kenneth W

    2016-07-01

    The koala (Phascolarctos cinereus) is an arboreal herbivorous marsupial that is an Australian icon. Koalas in many parts of Australia are under multiple threats including habitat destruction, dog attacks, vehicular accidents, and infectious diseases such as Chlamydia spp. and the koala retrovirus (KoRV), which may contribute to the incidence of lymphoma and leukaemia in this species. Due to a lack of koala-specific immune reagents and assays there is currently no way to adequately analyse the immune response in healthy, diseased or vaccinated animals. This paper reports the production and characterisation of the first anti-koala CD4 monoclonal antibody (mAb). The koala CD4 gene was identified and used to develop recombinant proteins for mAb production. Fluorochrome-conjugated anti-CD4 mAb was used to measure the levels of CD4(+) lymphocytes collected from koala spleens (41.1%, range 20-45.1%) lymph nodes (36.3%, range 19-55.9%) and peripheral blood (23.8%, range 17.3-35%) by flow cytometry. Biotin-conjugated anti-CD4 mAb was used for western blot to determine an approximate size of 52 kDa for the koala CD4 molecule and used in immunohistochemistry to identify CD4(+) cells in the paracortical region and germinal centres of spleen and lymph nodes. Using the anti-CD4 mab we showed that CD4 cells from vaccinated, but not control, koalas proliferated following in vitro stimulation with UV-inactivated Chlamydia pecorum and recombinant chlamydial antigens. Since CD4(+) T cells have been shown to play a pivotal role in clearing chlamydial infection in both human and mouse infections, using this novel antibody will help determine the role CD4(+) T cells play in protection against chlamydial infection in koalas and also enhance our knowledge of how KoRV affects the koala immune system. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. A metagenomics-based approach to the top-down effect on the detritivore food web: a salamanders influence on fungal communities within a deciduous forest.

    Science.gov (United States)

    Walker, Donald M; Lawrence, Brandy R; Esterline, Dakota; Graham, Sean P; Edelbrock, Michael A; Wooten, Jessica A

    2014-11-01

    The flow of energy within an ecosystem can be considered either top-down, where predators influence consumers, or bottom-up, where producers influence consumers. Plethodon cinereus (Red-backed Salamander) is a terrestrial keystone predator who feeds on invertebrates within the ecosystem. We investigated the impact of the removal of P. cinereus on the detritivore food web in an upland deciduous forest in northwest Ohio, U.S.A. A total of eight aluminum enclosures, each containing a single P. cinereus under a small log, were constructed in the deciduous forest. On Day 1 of the experiment, four salamanders were evicted from four of the eight enclosures. Organic matter and soil were collected from the center of each enclosure at Day 1 and Day 21. From each sample, DNA was extracted, fungal-specific amplification performed, and 454 pyrosequencing was used to sequence the nuclear ribosomal internal transcribed spacer (ITS2) region and partial ribosomal large subunit (LSU). Changes in overall fungal community composition or species diversity were not statistically significant between treatments. Statistically significant shifts in the most abundant taxonomic groups of fungi were documented in presence but not absence enclosures. We concluded that P. cinereus does not affect the overall composition or diversity of fungal communities, but does have an impact on specific groups of fungi. This study used a metagenomics-based approach to investigate a missing link among a keystone predator, P. cinereus, invertebrates, and fungal communities, all of which are critical in the detritivore food web.

  11. Genes controlling plant growth habit in Leymus (Triticeae): maize barren stalk1 (ba1), rice lax panicle, and wheat tiller inhibition (tin3) genes as possible candidates

    Science.gov (United States)

    Parminder Kaur; Steven R. Larson; B. Shaun Bushman; Richard R.-C. Wang; Ivan W. Mott; David Hole; Jyothi Thimmapuram; George Gong; Lei Liu

    2008-01-01

    Leymus cinereus and L. triticoides are large caespitose and rhizomatous perennial grasses, respectively. Previous studies detected quantitative trait loci (QTL) controlling rhizome spreading near the viviparous1 (vp1) gene markers on linkage groups LG3a and LG3b in two families, TTC1 and TTC2, derived from Leymus triticoides x Leymus cinereus hybrids. The wheat tiller...

  12. Identification, characterisation and expression analysis of natural killer receptor genes in Chlamydia pecorum infected koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Morris, Katrina M; Mathew, Marina; Waugh, Courtney; Ujvari, Beata; Timms, Peter; Polkinghorne, Adam; Belov, Katherine

    2015-10-15

    Koalas (Phascolarctos cinereus), an iconic Australian marsupial, are being heavily impacted by the spread of Chlamydia pecorum, an obligate intracellular bacterial pathogen. Koalas vary in their response to this pathogen, with some showing no symptoms, while others suffer severe symptoms leading to infertility, blindness or death. Little is known about the pathology of this disease and the immune response against it in this host. Studies have demonstrated that natural killer (NK) cells, key components of the innate immune system, are involved in the immune response to chlamydial infections in humans. These cells can directly lyse cells infected by intracellular pathogens and their ability to recognise these infected cells is mediated through NK receptors on their surface. These are encoded in two regions of the genome, the leukocyte receptor complex (LRC) and the natural killer complex (NKC). These two families evolve rapidly and different repertoires of genes, which have evolved by gene duplication, are seen in different species. In this study we aimed to characterise genes belonging to the NK receptor clusters in the koala by searching available koala transcriptomes using a combination of search methods. We developed a qPCR assay to quantify relative expression of four genes, two encoded within the NK receptor cluster (CLEC1B, CLEC4E) and two known to play a role in NK response to Chalmydia in humans (NCR3, PRF1). We found that the NK receptor repertoire of the koala closely resembles that of the Tasmanian devil, with minimal genes in the NKC, but with lineage specific expansions in the LRC. Additional genes important for NK cell activity, NCR3 and PRF1, were also identified and characterised. In a preliminary study to investigate whether these genes are involved in the koala immune response to infection by its chlamydial pathogen, C. pecorum, we investigated the expression of four genes in koalas with active chlamydia infection, those with past infection and

  13. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  14. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  15. Linking Genetic Variation in Adaptive Plant Traits to Climate in Tetraploid and Octoploid Basin Wildrye [Leymus cinereus (Scribn. & Merr. A. Love] in the Western U.S.

    Directory of Open Access Journals (Sweden)

    R C Johnson

    Full Text Available Few studies have assessed how ploidy type within a species affects genetic variation among populations in relation to source climates. Basin wildrye (Leymus cinereus (Scribn. & Merr. A. Love is a large bunchgrass common in the intermountain Western U.S. found in both octoploid and tetraploid types. In common gardens at two sites over two years differences in both ploidy type and genetic variation within ploidy were observed in phenology, morphology, and production traits on 57 octoploid and 52 tetraploid basin wildrye from the intermountain Western U.S. (P<0.01. Octoploids had larger leaves, longer culms, and greater crown circumference than tetraploids but the numerical ranges of plant traits and their source climates overlapped between ploidy types. Still, among populations octoploids often had greater genetic variation for traits and occupied more diverse climates than tetraploids. Genetic variation for both ploidy types was linked to source climates in canonical correlation analysis, with the first two variates explaining 70% of the variation. Regression of those canonical variates with seed source climate variables produced models that explained 64% and 38% of the variation, respectively, and were used to map 15 seed zones covering 673,258 km2. Utilization of these seed zones will help ensure restoration with adaptive seed sources for both ploidy types. The link between genetic traits and seed source climates suggests climate driven natural selection and adaptive evolution in basin wildrye. The more diverse climates occupied by octoploids and higher trait variation suggests a higher capacity for ecological differentiation than tetraploids in the intermountain Western U.S.

  16. Pro- and antioxidative properties of medicinal mushroom extracts

    NARCIS (Netherlands)

    Song, W.; Griensven, van L.J.L.D.

    2008-01-01

    Hot water extracts of 2 groups of medicinal mushrooms have been tested from the genera Agaricus, Antrodia, Auricularia, Coprinus, Cordyceps, Hericium, Grifola, Ganoderma, Lentinus, Phellinus, and Trametes for ROS-generating activity in human cells and for DPPH-TEAC antioxidant activity. Group 1

  17. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines

    Science.gov (United States)

    Cryan, P.M.; Jameson, J.W.; Baerwald, E.F.; Willis, C.K.R.; Barclay, R.M.R.; Snider, E.A.; Crichton, E.G.

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  18. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Directory of Open Access Journals (Sweden)

    Paul M Cryan

    Full Text Available Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus, eastern red bats (L. borealis, and silver-haired bats (Lasionycteris noctivagans found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  19. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Science.gov (United States)

    Cryan, Paul M; Jameson, Joel W; Baerwald, Erin F; Willis, Craig K R; Barclay, Robert M R; Snider, E Apple; Crichton, Elizabeth G

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  20. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  2. Indigenous knowledge and utilization of edible mushrooms in parts ...

    African Journals Online (AJOL)

    Heim and Coprinus disseminatus (Pers.: Fr.) S. F. Gray. Among the local people, names of edible mushrooms are based on the substrates on which they grow, their association with insects, and unrelated taxa are given collective names. Rural people believe mushrooms have medicinal values and can serve as blood tonic, ...

  3. Conservation genetics of the endangered Shenandoah salamander (Plethodon shenandoah, Plethodontidae)

    Science.gov (United States)

    Carpenter, D.W.; Jung, R.E.; Sites, J.W.

    2001-01-01

    The Shenandoah salamander (Plethodon shenandoah) is restricted to three isolated talus outcrops in Shenandoah National Park, VA, USA and has one of the smallest ranges of any tetrapod vertebrate. This species was listed as endangered under the US Endangered Species Act in 1989 over concern that direct competition with the red-backed salamander (Plethodon cinereus), successional habitat changes, and human impacts may cause its decline and possible extinction. We address two issues herein: (1) whether extensive introgression (through long-term hybridization) is present between the two species and threatens the survival of P. shenandoah, and (2) the level of population structure within P. shenandoah. We provide evidence from mtDNA haplotypes that shows no genetic differentiation among the three isolates of P. shenandoah, suggesting that their fragmentation is a geologically recent event, and/or that the isolates are still connected by occasional gene flow. There is also no evidence for extensive introgression of alleles in either direction between P. cinereus and P. shenandoah, which suggests that P. shenandoah may not be in danger of being genetically swamped out through hybridization with P. cinereus.

  4. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  5. Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.

  6. Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.

    Science.gov (United States)

    Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

    2008-07-01

    Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

  7. Higher marine fungi from mangroves (Manglicolous fungi)

    Digital Repository Service at National Institute of Oceanography (India)

    ChinnaRaj, S.

    of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

  8. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus and their ticks identified using next-generation sequencing (NGS.

    Directory of Open Access Journals (Sweden)

    Amanda D Barbosa

    Full Text Available Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus, particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8% were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%, T. gilletti (25%, 95% CI: 18.7-32.3%, T. copemani (27.4%, 95% CI: 20.8-34.8% and T. vegrandis (10.1%, 95% CI: 6.0-15.7%. Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%, and a novel species (Trypanosoma sp. AB-2017 was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%. Mixed infections with up to five species were present in 27.4% (95% CI: 21-35% of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%. Overall, a considerably higher proportion (79.7% of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights

  9. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus) and their ticks identified using next-generation sequencing (NGS).

    Science.gov (United States)

    Barbosa, Amanda D; Gofton, Alexander W; Paparini, Andrea; Codello, Annachiara; Greay, Telleasha; Gillett, Amber; Warren, Kristin; Irwin, Peter; Ryan, Una

    2017-01-01

    Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus), particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS)-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani) removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8%) were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%), T. gilletti (25%, 95% CI: 18.7-32.3%), T. copemani (27.4%, 95% CI: 20.8-34.8%) and T. vegrandis (10.1%, 95% CI: 6.0-15.7%). Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%), and a novel species (Trypanosoma sp. AB-2017) was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%). Mixed infections with up to five species were present in 27.4% (95% CI: 21-35%) of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%). Overall, a considerably higher proportion (79.7%) of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS) within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights on the

  10. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1982-01-01

    A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

  11. 78 FR 16292 - Endangered Species; Receipt of Applications for Permit

    Science.gov (United States)

    2013-03-14

    ... Lorisidae Rhinocerotidae Tapiridae Gruidae Threskiornithidae Genus: Tragopan Species: Koala (Phascolarctos cinereus) Applicant: Field Museum of Natural History, Chicago, IL; PRT-698170 The applicant requests...

  12. Nueva contribución al conocimiento de los macromicetos de la Reserva Ecológica del Pedregal de San Ángel, D.F., México New contribution to the knowledge of the macromycetes of the Ecological Reserve of the Pedregal of San Ángel, D.F., Mexico

    Directory of Open Access Journals (Sweden)

    Teófilo Herrera

    2006-06-01

    Full Text Available Se citan 8 especies de macromicetos recolectados en el área poniente de la Reserva Ecológica del Pedregal de San Ángel, D.F., México, de las cuales 5 son lignícolas y 3 humícolas, Se desarrollan a la sombra y entre hojarasca de plantas superiores. Entre los agaricales la familia Agaricaceae es la mejor representada. Se citan por primera vez en la micobiota del Pedregal de San Ángel: Gymnopus confluens, Agrocybe pediades, Agaricus arvensis y A. silvaticus, Setchelliogaster rheophyllus y Coprinus truncorumse citan por primera vez para México.Eight species of macromycetes were collected from the Ecological Reserve of the Pedregal de San Angel D.F. Mexico. Five of them are lignicolous, and 3 are humicolous developing under the shade of trees and among the litter of vascular plants. In the Agaricales the family Agaricaceae is the best represented. Gymnopus confluens, Agrocybe pediades, Agaricus arvensis and A. silvaticus, are first records in the mycobiota of the Pedregal de San Ángel. Setchelliogaster rheophyllus and Coprinus truncorum first records for Mexico are presented in this paper.

  13. In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.

    Science.gov (United States)

    Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S

    2006-06-01

    The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

  14. Habitat and food resources of otters (Mustelidae) in Peninsular Malaysia

    Science.gov (United States)

    Abdul-Patah, P.; Nur-Syuhada, N.; Md-Nor, S.; Sasaki, H.; Md-Zain, B. M.

    2014-09-01

    Habitat and food resources of otters were studied in several locations in Peninsular Malaysia. A total of 210 fecal samples were collected from April 2010 to March 2011 believed to be of otter's were analyzed for their diet composition and their habitat preferences. The DNA testing conducted revealed that only 126 samples were identified as Lultrogale perspicillata and Aonyx cinereus with 105 and 21 samples, respectively. Habitat analyses revealed that these two species preferred paddy fields and mangroves as their main habitats but L. perspicillata preferred to hunt near habitat with large water bodies, such as mangroves, rivers, ponds, and lakes. A. cinereus on the other hand, were mainly found near land-based habitat, such as paddy fields, casuarinas forest and oil palms near mangroves. Habitats chosen were influenced by their food preferences where L. perspicillata consumed a variety of fish species with a supplementary diet of prawns, small mammals, and amphibians, compared to A. cinereus which consumed less fish and more non-fish food items, such as insects, crabs, and snails. Since, the most of the otter habitats in this study are not located within the protected areas, conservation effort involving administrations, landowners, private organizations and public are necessary.

  15. Rediscovery of the type series of the Acadian Masked Shrew, Sorex acadicus Gilpin, 1865 (Mammalia: Soricidae), with the designation of a neotype and a reevaluation of its taxonomic status

    Science.gov (United States)

    Woodman, Neal

    2018-01-01

    The name Sorex acadicus Gilpin, 1865 is currently recognized as the valid name for the Nova Scotian subspecies of the masked shrew, S. cinereus Kerr, 1792 (Mammalia: Soricidae), but a holotype for the taxon was never designated, and the location of the type series has been a mystery. The authority for this species, John Bernard Gilpin, was associated with the Nova Scotia Museum, Halifax, NS, but that institution has no Gilpin specimens in its possession, and I could find no record of Gilpin shrews in any other Canadian Museum. I recently discovered a series of Gilpin specimens in the Mammal Collection of the National Museum of Natural History, Washington, DC (USNM), some of which may have been part of the original type series of S. acadicus, and I show that these specimens best represent Gilpin's concept of the taxon. From this series, I designate a neotype for S. acadicus. I also evaluate the distinctiveness of Nova Scotian S. c. acadicus compared with S. c. cinereus from Maine, New Brunswick, and New Hampshire and determine that S. acadicus should be considered a junior synonym of S. c. cinereus.

  16. 26 - 30 Kutama

    African Journals Online (AJOL)

    DR. AMINU

    wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

  17. Diversity of edible mushrooms in pakistan

    International Nuclear Information System (INIS)

    Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

    2007-01-01

    Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

  18. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    Science.gov (United States)

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  19. A study of bat populations at Los Alamos National Laboratory and Bandelier National Monument, Jemez Mountains, New Mexico: FY95--97 report to Los Alamos National Laboratory and Bandelier National Monument

    Energy Technology Data Exchange (ETDEWEB)

    Bogan, M.A.; O`Shea, T.J.; Cryan, P.M.; Ditto, A.M.; Schaedla, W.H.; Valdez, E.W.; Castle, K.T.; Ellison, L. [Univ. of New Mexico, Albuquerque, NM (United States)

    1998-12-31

    In 1995, a three-year study was initiated to assess the current status of bat species of concern, elucidate distribution and relative abundance, and obtain information on roosting sites of bats. The authors captured and released 1532 bats of 15 species (Myotis californicus, M. ciliolabrum, M. evotis, M. thysanodes, M. volans, M. yumanensis, Lasiurus cinereus, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Euderma maculatum, Corynorhinus townsendii, Antrozous pallidus, Tadarida brasiliensis, and Nyctinomops macrotis) and followed 32 bats of eight species (M. evotis, M. thysanodes, M. volans, E. fuscus, E. maculatum, C. townsendii, A. pallidus, and N. macrotis) to 51 active diurnal roosts. The most abundant species were L. noctivagans, E. fuscus, L. cinereus, M. evotis, M. volans, and M. ciliolabrum. Most of these species are typical inhabitants of ponderosa pine-mixed coniferous forests.

  20. Cytochrome P450 CYP3A in marsupials: cloning and characterisation of the second identified CYP3A subfamily member, isoform 3A78 from koala (Phascolarctos cinereus).

    Science.gov (United States)

    El-Merhibi, Adaweyah; Ngo, Suong N T; Crittenden, Tamara A; Marchant, Ceilidh L; Stupans, Ieva; McKinnon, Ross A

    2011-11-01

    Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of xenobiotics and endogenous substrates. Previously, we cloned and characterised the CYP2C, CYP4A, and CYP4B gene subfamilies from marsupials and demonstrated important species-differences in both activity and tissue expression of these CYP enzymes. Recently, we isolated the Eastern grey kangaroo CYP3A70. Here we have cloned and characterised the second identified member of marsupial CYP3A gene subfamily, CYP3A78 from the koala (Phascolarctos cinereus). In addition, we have examined the gender-differences in microsomal erythromycin N-demethylation activity (a CYP3A marker) and CYP3A protein expression across test marsupial species. Significant differences in hepatic erythromycin N-demethylation activity were observed between male and female koalas, with the activity detected in female koalas being 2.5-fold higher compared to that in male koalas (p<0.01). No gender-differences were observed in tammar wallaby or Eastern grey kangaroo. Immunoblot analysis utilising anti-human CYP3A4 antibody detected immunoreactive proteins in liver microsomes from all test male and female marsupials including the koala, tammar wallaby, and Eastern grey kangaroo, with no gender-differences detected across test marsupials. A 1610 bp koala hepatic CYP3A complete cDNA, designated CYP3A78, was cloned by reverse transcription-polymerase chain reaction approaches. It displays 64% nucleotide and 57% amino acid sequence identity to the Eastern grey kangaroo CYP3A70. The CYP3A78 cDNA encodes a protein of 515 amino acids, shares approximately 68% nucleotide and 56% amino acid sequence identity to human CYP3A4, and displays high sequence similarity to other published mammalian CYP3As from human, monkey, cow, pig, dog, rat, rabbit, mouse, hamster, and guinea pig. Collectively, this study provides primary molecular data regarding koala hepatic CYP3A78 gene and enables further functional analyses of CYP

  1. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  2. Characterization and cultivation of a wild mushroom species isolated in Brazil
    Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil

    OpenAIRE

    Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki

    2002-01-01

    Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

  3. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

    Science.gov (United States)

    Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

    2012-10-23

    Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

  4. 78 FR 23286 - Endangered Species; Marine Mammals; Receipt of Applications for Permit

    Science.gov (United States)

    2013-04-18

    ...-horned oryx (Oryx dammah), from the captive herd maintained at their facility, for the purpose of...) African wild dog (Lycaon pictus) Rothschild's starling (Leucopsar rothschildi) Radiated tortoise...) Koala (Phascolarctos cinereus) African wild dog (Lycaon pictus) Andean condor (Vultur gryphus) Harpy...

  5. Mold biomass as a potential source of nutrient proteins

    Energy Technology Data Exchange (ETDEWEB)

    Fuska, J; Kollarova, A

    1977-01-01

    In submerged cultures of Penicillium resticulosum, Mycelium sterilium, Gibberella fuiikuroi, and Coprinus species grown for 72 hours in medium containing 5 to 7% sawdust hydrolyzate, 1.28 to 1.45 g of dry biomass per 100 mL of culture was produced with 28.1 to 35.3% total amino acids and 15 to 18% essential amino acids; 80 to 90% of the cellular protein was digestible. Mannose, glucose and galactose of the hydrolyzate were utilized faster than xylose and arabinose.

  6. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  7. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus) by qRT-PCR.

    Science.gov (United States)

    Maher, Iona E; Griffith, Joanna E; Lau, Quintin; Reeves, Thomas; Higgins, Damien P

    2014-01-01

    Investigation of the immune response of the koala (Phascolarctos cinereus) is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV), which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala's susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1) and Th2 lymphocyte responses are important to an individual's susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala's adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 10 (IL-10) and interferon gamma (IFNγ) along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A). Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not consistently up-regulated by

  8. The fur of mammals in exposed environments; do crypsis and thermal needs necessarily conflict? The polar bear and marsupial koala compared.

    Science.gov (United States)

    Dawson, Terence J; Webster, Koa N; Maloney, Shane K

    2014-02-01

    The furs of mammals have varied and complex functions. Other than for thermoregulation, fur is involved in physical protection, sensory input, waterproofing and colouration, the latter being important for crypsis or camouflage. Some of these diverse functions potentially conflict. We have investigated how variation in cryptic colouration and thermal features may interact in the coats of mammals and influence potential heat inflows from solar radiation, much of which is outside the visible spectral range. The coats of the polar bear (Ursus maritimus) and the marsupial koala (Phascolarctus cinereus) have insulative similarities but, while they feature cryptic colouration, they are of contrasting colour, i.e. whitish and dark grey. The reflectance of solar radiation by coats was measured across the full solar spectrum using a spectroradiometer. The modulation of incident solar radiation and resultant heat flows in these coats were determined at a range of wind speeds by mounting them on a heat flux transducer/temperature-controlled plate apparatus in a wind tunnel. A lamp with a spectral distribution of radiation similar to the solar spectrum was used as a proxy for the sun. Crypsis by colour matching was apparent within the visible spectrum for the two species, U. maritimus being matched against snow and P. cinereus against Eucalyptus forest foliage. While reflectances across the full solar spectrum differed markedly, that of U. maritimus being 66 % as opposed to 10 % for P. cinereus, the heat influxes from solar radiation reaching the skin were similar. For both coats at low wind speed (1 m s(-1)), 19 % of incident solar radiation impacted as heat at the skin surface; at higher wind speed (10 m s(-1)) this decreased to approximately 10 %. Ursus maritimus and P. cinereus have high and comparable levels of fur insulation and although the patterns of reflectance and depths of penetrance of solar radiation differ for the coats, the considerable insulation limited the

  9. Decolorization of six synthetic dyes by fungi

    OpenAIRE

    Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.

    2016-01-01

    To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...

  10. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  11. Enzymatic saccharification of biologically pre-treated wheat straw with white-rot fungi.

    Science.gov (United States)

    Dias, Albino A; Freitas, Gil S; Marques, Guilhermina S M; Sampaio, Ana; Fraga, Irene S; Rodrigues, Miguel A M; Evtuguin, Dmitry V; Bezerra, Rui M F

    2010-08-01

    Wheat straw was submitted to a pre-treatment by the basidiomycetous fungi Euc-1 and Irpex lacteus, aiming to improve the accessibility of cellulose towards enzymatic hydrolysis via previous selective bio-delignification. This allowed the increase of substrate saccharification nearly four and three times while applying the basidiomycetes Euc-1 and I. lacteus, respectively. The cellulose/lignin ratio increased from 2.7 in the untreated wheat straw to 5.9 and 4.6 after the bio-treatment by the basidiomycetes Euc-1 and I. lacteus, respectively, thus evidencing the highly selective lignin biodegradation. The enzymatic profile of both fungi upon bio-treatment of wheat straw have been assessed including laccase, manganese-dependent peroxidase, lignin peroxidase, carboxymethylcellulase, xylanase, avicelase and feruloyl esterase activities. The difference in efficiency and selectivity of delignification within the two fungi treatments was interpreted in terms of specific lignolytic enzyme profiles and moderate xylanase and cellulolytic activities. (c) 2010 Elsevier Ltd. All rights reserved.

  12. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  14. [Characterization of an extracellular glycolipid from Lentinus edodes (Berk.) Sing [Lentinula edodes (Berk.) Pegler

    Science.gov (United States)

    Tsivileva, O M; Nikitina, V E; Makarov, O E

    2008-01-01

    Submerged mycelium of a xylotrophic basidiomycete Lentinus edodes produces an extracellular glycolipid, S3, associated with a lectin. Galactose glycan residue, as well as the lipid pool composition, which includes nonhydroxylated short-chain fatty acids, is uncommon for basidiomycetes. The glycolipid consists of D-galactopyranose (15% of S3 contains galactose sulfate) acylated by octadecanoic and nonadecanoic fatty acid residues (28 and 72%, respectively). The glycolipid structure and composition are confirmed by physicochemical analysis. The glycolipid is assumed to be a regulator of lectin activity.

  15. The effects of meteorological factors on airborne fungal spore concentration in two areas differing in urbanisation level

    Science.gov (United States)

    Oliveira, M.; Ribeiro, H.; Delgado, J. L.; Abreu, I.

    2009-01-01

    Although fungal spores are an ever-present component of the atmosphere throughout the year, their concentration oscillates widely. This work aims to establish correlations between fungal spore concentrations in Porto and Amares and meteorological data. The seasonal distribution of fungal spores was studied continuously (2005-2007) using volumetric spore traps. To determine the effect of meteorological factors (temperature, relative humidity and rainfall) on spore concentration, the Spearman rank correlation test was used. In both locations, the most abundant fungal spores were Cladosporium, Agaricus, Agrocybe, Alternaria and Aspergillus/Penicillium, the highest concentrations being found during summer and autumn. In the present study, with the exception of Coprinus and Pleospora, spore concentrations were higher in the rural area than in the urban location. Among the selected spore types, spring-autumn spores ( Coprinus, Didymella, Leptosphaeria and Pleospora) exhibited negative correlations with temperature and positive correlations both with relative humidity and rainfall level. On the contrary, late spring-early summer (Smuts) and summer spores ( Alternaria, Cladosporium, Epicoccum, Ganoderma, Stemphylium and Ustilago) exhibited positive correlations with temperature and negative correlations both with relative humidity and rainfall level. Rust, a frequent spore type during summer, had a positive correlation with temperature. Aspergillus/Penicillium, showed no correlation with the meteorological factors analysed. This knowledge can be useful for agriculture, allowing more efficient and reliable application of pesticides, and for human health, by improving the diagnosis and treatment of respiratory allergic disease.

  16. 50 CFR 17.84 - Special rules-vertebrates.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 2 2010-10-01 2010-10-01 false Special rules-vertebrates. 17.84 Section 17.84 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR....84 Special rules—vertebrates. (a) Delmarva Peninsula fox squirrel (Sciurus niger cinereus). (1) The...

  17. Utilization of agro-resources by radiation treatment -production of animal feed and mushroom from oil palm wastes

    International Nuclear Information System (INIS)

    Kume, Tamikazu; Matsuhashi, Shinpei; Hashimoto, Shoji

    1993-01-01

    The production of animal feeds and mushrooms from oil palm cellulosic wastes by radiation and fermentation has been investigated in order to utilize the agro-resources and to reduce the smoke pollution. The process is as follows: decontamination of microorganisms in fermentation media of empty fruit bunch of oil palm (EBF) by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 25 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus and P. sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased to 13% and the crude fiber content decreased to 20% after 30 days of incubation with C. cinereus at 30 o C in solid state fermentation. P. sajor-caju was suitable for the mushroom production on EFB with rice bran. (author)

  18. Utilization of agro-resources by radiation treatment -production of animal feed and mushroom from oil palm wastes

    Science.gov (United States)

    Kume, Tamikazu; Matsuhashi, Shinpei; Hashimoto, Shoji; Awang, Mat Rasol; Hamdini, Hassan; Saitoh, Hideharu

    1993-10-01

    The production of animal feeds and mushrooms from oil palm cellulosic wasres by radiation and fermentation has been investigated in order to utilize the agro-resources and to reduce the smoke pollution. The process is as follows: decontamination of microorganisms in fermentation media of empty fruit bunch of oil palm (EFB) by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 25 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus and P. sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased to 13 % and the crude fiber content decreased to 20% after 30 days of incubation with C. cinereus at 30°C in solid state fermentation. P. sajor-caju was suitable for the mushroom production on EFB with rice bran.

  19. Upgrading of oil palm wastes to animal feeds by radiation and fermentation treatment

    International Nuclear Information System (INIS)

    Kume, Tamikazu; Ito, Hitoshi; Hashimoto, Shoji; Mutaat, H.H.; Awang, M.R.

    1992-01-01

    Upgrading of oil palm cellulosic wastes to animal feeds by radiation and fermentation treatment has been investigated in order to recycle the agro-resources and to reduce the smoke pollution. The process is as follows; decontamination of microorganisms in fermentation media using oil palm wastes by irradiation, inoculation of useful microorganisms, and subsequent microbial digestion of cellulosic materials as well as production of proteins. The dose of 25 kGy was required to sterilize the contaminated bacteria whereas the dose of 5 - 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus was selected as the most suitable seed microorganism for the fermentation of EFB (Empty Fruit Bunch of oil palm). The protein content increased to 13 % and the crude fiber content decreased to 20 % after 30 days incubation with C. cinereus at 30degC in solid state fermentation. It is considered that these fermented products can be used for the ruminant animal feeds. (author)

  20. Fatalities at wind turbines may threaten population viability of a migratory bat

    Science.gov (United States)

    W.F. Frick; E.F. Baerwald; J.F. Pollock; R.M.R. Barclay; J.A. Szymanski; Ted Weller; A.L. Russell; Susan Loeb; R.A. Medellin; L.P. McGuire

    2017-01-01

    Large numbers of migratory bats are killed every year at wind energy facilities. However, population-level impacts are unknown as we lack basic demographic information about these species. We investigated whether fatalities at wind turbines could impact population viability of migratory bats, focusing on the hoary bat (Lasiurus cinereus),...

  1. A nondestructive technique to monitor the relative abundance of terrestrial salamanders

    Science.gov (United States)

    Richard M. DeGraaf; Mariko. Yamasaki

    1992-01-01

    Salamanders are abundant vertebrates in many forest ecosystems, and their annual biomass production can be important in forest food webs (Pough et al. 1987). Population densities of eastern redback salamanders (Plethodon cinereus) can exceed 2 individuals/m2 in deciduous forests of the United States (Heatwole 1962, Jaeger 1980...

  2. Effects of edge contrast on redback salamander distribution in even-aged northern hardwoods

    Science.gov (United States)

    Richard M. DeGraaf; Mariko. Yamasaki

    2002-01-01

    Terrestrial salamanders are sensitive to forest disturbance associated with even-aged management. We studied the distribution of redback salamanders (Plethodon cinereus) for 4 yr at edges between even-aged northern hardwood stands along three replicate transects in each of three edge contrast types: regeneration/mature, sapling/mature, and...

  3. Invasive Asian Earthworms Negatively Impact Keystone Terrestrial Salamanders.

    Directory of Open Access Journals (Sweden)

    Julie L Ziemba

    Full Text Available Asian pheretimoid earthworms (e.g. Amynthas and Metaphire spp. are invading North American forests and consuming the vital detrital layer that forest floor biota [including the keystone species Plethodon cinereus (Eastern Red-backed Salamander], rely on for protection, food, and habitat. Plethodon cinereus population declines have been associated with leaf litter loss following the invasion of several exotic earthworm species, but there have been few studies on the specific interactions between pheretimoid earthworms and P. cinereus. Since some species of large and active pheretimoids spatially overlap with salamanders beneath natural cover objects and in detritus, they may distinctively compound the negative consequences of earthworm-mediated resource degradation by physically disturbing important salamander activities (foraging, mating, and egg brooding. We predicted that earthworms would exclude salamanders from high quality microhabitat, reduce foraging efficiency, and negatively affect salamander fitness. In laboratory trials, salamanders used lower quality microhabitat and consumed fewer flies in the presence of earthworms. In a natural field experiment, conducted on salamander populations from "non-invaded" and "pheretimoid invaded" sites in Ohio, salamanders and earthworms shared cover objects ~60% less than expected. Earthworm abundance was negatively associated with juvenile and male salamander abundance, but had no relationship with female salamander abundance. There was no effect of pheretimoid invasion on salamander body condition. Juvenile and non-resident male salamanders do not hold stable territories centered beneath cover objects such as rocks or logs, which results in reduced access to prey, greater risk of desiccation, and dispersal pressure. Habitat degradation and physical exclusion of salamanders from cover objects may hinder juvenile and male salamander performance, ultimately reducing recruitment and salamander abundance

  4. Invasive Asian Earthworms Negatively Impact Keystone Terrestrial Salamanders.

    Science.gov (United States)

    Ziemba, Julie L; Hickerson, Cari-Ann M; Anthony, Carl D

    2016-01-01

    Asian pheretimoid earthworms (e.g. Amynthas and Metaphire spp.) are invading North American forests and consuming the vital detrital layer that forest floor biota [including the keystone species Plethodon cinereus (Eastern Red-backed Salamander)], rely on for protection, food, and habitat. Plethodon cinereus population declines have been associated with leaf litter loss following the invasion of several exotic earthworm species, but there have been few studies on the specific interactions between pheretimoid earthworms and P. cinereus. Since some species of large and active pheretimoids spatially overlap with salamanders beneath natural cover objects and in detritus, they may distinctively compound the negative consequences of earthworm-mediated resource degradation by physically disturbing important salamander activities (foraging, mating, and egg brooding). We predicted that earthworms would exclude salamanders from high quality microhabitat, reduce foraging efficiency, and negatively affect salamander fitness. In laboratory trials, salamanders used lower quality microhabitat and consumed fewer flies in the presence of earthworms. In a natural field experiment, conducted on salamander populations from "non-invaded" and "pheretimoid invaded" sites in Ohio, salamanders and earthworms shared cover objects ~60% less than expected. Earthworm abundance was negatively associated with juvenile and male salamander abundance, but had no relationship with female salamander abundance. There was no effect of pheretimoid invasion on salamander body condition. Juvenile and non-resident male salamanders do not hold stable territories centered beneath cover objects such as rocks or logs, which results in reduced access to prey, greater risk of desiccation, and dispersal pressure. Habitat degradation and physical exclusion of salamanders from cover objects may hinder juvenile and male salamander performance, ultimately reducing recruitment and salamander abundance following Asian

  5. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Directory of Open Access Journals (Sweden)

    Evelyne Coppin

    Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  6. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Science.gov (United States)

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

    2012-01-01

    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  7. Activities of tabanids (Diptera, Tabanidae attacking domestic duck-Cairina moschata (Linnaeus (Aves, Anatidae, introduced in a forest area in the Central Amazon, Manaus, Brazil

    Directory of Open Access Journals (Sweden)

    Ruth L. M. Ferreira

    2004-06-01

    Full Text Available Presented here are the feeding habits, attack behavior, daily and annual activity of adult of Phorcotabanus cinereus (Wiedeman, 1821, Chrysops laetus (Fabricius, 1805 and Phaeotabanus cajennensis (Fabricius, 1787, while biting a domestic duck, Cairina moschata (Linnaeus, 1758. The last two species were recorded for the first time attacking birds. This study comprehended monthly observations of two consecutive days from April/97 to March/98 between 5:30 a.m. and 6:30 p.m. at the Army Instructional Base ((BI-2/CIGS near Manaus. Annual occurrence of P. cinereus was from July to September, with a daily occurrence between 9:00 a.m. and 5:00 p.m. and highest activity at 12:00 a.m. and 2:00 p.m. C. laetus ocurred from June to October; with a daily occurrence between 8:00 a.m. and 3 p.m. and highest activity at 11:00 and 12:00 a.m. Occurrence of P. cajennensis with one specimen only, was in July between 10:00 and 11:00 a.m.Atividades de tabanídeos (Diptera, Tabanidae atacando pato doméstico Cairina moschata Linnaeus (Aves, Anatidae, introduzido em área de floresta na Amazônia Central, Manaus, Brasil. São apresentados o hábito alimentar, comportamento de ataque, atividade diária e anual de adultos de Phorcotabanus cinereus (Wiedemann, 1821, Chrysops laetus (Fabricius, 1805 e Phaeotabanus cajennensis (Fabricius, 1787 atacando pato doméstico - Cairina moschata (Linnaeus, 1758. As últimas duas últimas espécies são registradas pela primeira vez atacando aves. O estudo compreendeu observações mensais durante dois dias consecutivos de Abril/97 a Março/98, entre 5:30 e 18:30 h, na base de instrução 2 do Centro de Instrução de Guerra na Selva (BI-2/CIGS, Manaus. A ocorrência anual de P. cinereus, foi de julho a setembro, com atividade diária entre 9:00 e 17:00 horas, com maior abundância entre 12:00 e 14:00 horas. C. laetus, ocorreu de junho a outubro, com atividade diária entre 8:00 e 15:00 horas, e maior abundância entre 11:00 e 12

  8. Roost characteristics of hoary bats in Arkansas

    Science.gov (United States)

    Roger W. Perry; Ronald E. Thill

    2007-01-01

    We radiotracked nine hoary bats (Lasiurus cinereus) and characterized 12 roosts during late spring and early summer in the Ouachita Mountains of central Arkansas. Hoary bats generally roosted on the easterly sides of tree canopies in the foliage of white oaks (Quercus alba), post oaks (Q. stellata) and shortleaf pines (Pinus...

  9. Natural Protection of Wood with Antagonism Fungi

    Directory of Open Access Journals (Sweden)

    Alba ZAREMSKI

    2011-03-01

    Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.

  10. Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.

    Science.gov (United States)

    Kozar, F; MacDonald, B R; Weijer, J

    1977-01-01

    The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

  11. Wide-scale population sampling identifies three phylogenetic races of basin wildrye and low-level genetic admixture with creeping wildrye

    Science.gov (United States)

    C. Mae Culumber; Steven R. Larson; Thomas A. Jones; Kevin B. Jensen

    2013-01-01

    Basin wildrye [Leymus cinereus (Scribn. & Merr.) Á. Löve] and creeping wildrye [Leymus triticoides (Buckley) Pilg.] are outcrossing perennial grasses native to western North America. These divergent species are generally adapted to different habitats but can form fertile hybrids. Cultivars of both species are used in agriculture and conservation, but little is...

  12. Immunomics of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Abts, Kendra C; Ivy, Jamie A; DeWoody, J Andrew

    2015-06-01

    The study of the koala transcriptome has the potential to advance our understanding of its immunome--immunological reaction of a given host to foreign antigens--and to help combat infectious diseases (e.g., chlamydiosis) that impede ongoing conservation efforts. We used Illumina sequencing of cDNA to characterize genes expressed in two different koala tissues of immunological importance, blood and spleen. We generated nearly 600 million raw sequence reads, and about 285 million of these were subsequently assembled and condensed into ~70,000 subcomponents that represent putative transcripts. We annotated ~16% of these subcomponents and identified those related to infection and the immune response, including Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), major histocompatibility complex (MHC) genes, and koala retrovirus (KoRV). Using phylogenetic analyses, we identified 29 koala genes in these target categories and report their concordance with currently accepted gene groups. By mapping multiple sequencing reads to transcripts, we identified 56 putative SNPs in genes of interest. The distribution of these SNPs indicates that MHC genes (34 SNPs) are more diverse than KoRV (12 SNPs), TLRs (8 SNPs), or RLRs (2 SNPs). Our sequence data also indicate that KoRV sequences are highly expressed in the transcriptome. Our efforts have produced full-length sequences for potentially important immune genes in koala, which should serve as targets for future investigations that aim to conserve koala populations.

  13. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  14. CELLULASES FROM THE BASIDIO - MYCETES CULTURAL LIQUID

    Directory of Open Access Journals (Sweden)

    К. G. Dreval

    2013-04-01

    Full Text Available Adsorption of cellulases on substrate taking place during the cultivation process was determined. Adsorbed enzymes can be eluted by buffer solution with high ionic strength, but for determine their activity they should be transferred into the aqueous solution. On the basis of the results a method for obtaining of cellulases preparations from cultural liquids of basidiomycetes was developed. This method is the elution of cellulases from the cultivation substrate of basidiomycetes. It was found that using of the last allows to obtain enzymatic preparations with a high degree of purification in 3 stages (salting out of proteins — dialysis — gelchromatography. Cellulase preparations received original products of basidiomycetes strains К-1, А-Дон-02, Д-1 Irpex lacteus and AnSc-1 Daedaleopsis confragosa f. confragosa were obtained. They contained different proteins, enzymes with specific peaks out of column and their activity. However, common to them was a distinct maximum of outing from the column by endoglucanases or cellobiases, which may indicate that the studied cellulolytic complexes of basidiomycetes do not contain multiple forms of cellulases with different molecular mass. This method allowed to obtain preparations with different degree of purification in comparing with the original culture filtrate 7,3 for endoglucanase and 33,3 for cellobiase of strain А-Дон-02 I. lacteus; 13,1 for endoglucanase and 25,5 for cellobiase of strain Д-1 I. lacteus; 29,9 for endoglucanase and 90,1 for cellobiase of strain К-1 I. lacteus; 2,1 for endoglucanase and 30,6 for cellobiase of strain AnSc-1 D. confragosa f. confragosa.

  15. Bats of the Colorado oil shale region

    Energy Technology Data Exchange (ETDEWEB)

    Finley, R.B. Jr.; Caire, W.; Wilhelm, D.E.

    1984-10-31

    New records for Myotis californicus, M. evotis, M. leibii, M. lucifugus, M. thysanodes, M. volans, M. yumanensis, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Lasiurus cinereus, Plecotus townsendii, and Antrozous pallidus and their habitat occurrence in northwestern Colorado are reported. Mortality of 27 bats of six species trapped in an oil sludge pit is described. 7 references.

  16. Antibiotics in the chemical communication of fungi.

    Science.gov (United States)

    Kettering, Melanie; Sterner, Olov; Anke, Timm

    2004-01-01

    In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.

  17. Behavior of the Hawaiian Hawaiian Hoary Bat (Lasiurus cinereus semotus) at wind turbines and its distribution across the North Ko'olau Mountains, O'ahu

    Science.gov (United States)

    Gorresen, P.M.; Cryan, Paul M.; Huso, Manuela M.P.; Hein, Cris D.; Schirmacher, Michael; Johnson, Jessica H.; Montoya-Aiona, Kristina; Brinck, Kevin W.; Bonaccorso, Frank

    2015-01-01

    We studied the landscape distribution of endemic Hawaiian hoary bats (Lasiurus cinereus semotus) on the north Ko‘olau Mountains of O‘ahu, Hawai‘i, from May 2013 to May 2014, while simultaneously studying their behavior at wind turbines within the broader landscape. This research aimed to assess the risk that wind turbines pose to bats on the island and integrated a variety of methods, including acoustic monitoring, thermal videography, and fatality searches.Our findings indicate that hoary bats were acoustically cryptic and occurred sparsely in the region. Overall site occupancy rate was 55% during the 1-year period of acoustic monitoring at 23 sites, and there was only an 8% chance of acoustically detecting a bat on a given night if it was present. We detected bats less frequently in windward northern parts of the study area and at windy, lower-elevation sites with rough terrain. Bats were detected more frequently in leeward southern parts of the study area and at wind-sheltered, higher-elevation sites with flat ridgetops. Acoustic detections were consistently low from October through February and increased at most sites to peak in April through August. However, meteorological conditions were not found to be associated with the acoustic prevalence of bats on a night-to-night basis. We observed more than three thousand events involving bats during six months of nightly video surveillance at four wind turbines. Video monitoring revealed several links to weather at the local scale, despite acoustic detections not clearly relating to weather in our broader landscape analysis. Video demonstrated bats occurring near turbines more often on nights with little rain, warmer temperatures, moderate wind speeds, low humidity, and the low but rising barometric pressures indicative of fair weather and improved foraging conditions. Video monitoring also demonstrated that the presence of bats near turbines strongly correlates with insect presence. We detected bats on video

  18. Temperature development and sterilization of red pine poles during CCA treatment, elevated temperature fixation and drying

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, P.; Albright, M.; Srinivasan, U.; Ung, A. [New Brunswick Univ., Fredericton, NB (Canada). Wood Science and Technology Centre

    2002-07-01

    The application of chromated copper arsenate (CCA) treatment and fixation and drying under the conditions of the study to large red pine poles left for an air seasoning period of 10 months in Quebec, Canada progressively reduced the number of micro-organisms present. A large number of microfungi isolations were effected before the treatment from the sapwood and heartwood of all poles and wood decay fungi on 8 selected poles from the 20 test poles. They originated from the sapwood zone. A reduction of approximately 50 per cent in the number of microfungi isolated from the sapwood was noted after the CCA treatment. In the case of 9 of 30 poles, basidiomycetes were isolated after treatment primarily from the untreated heartwood. There were a few instances where basidiomycetes were isolated from unpenetrated sapwood (wet pockets). Temperatures of 55 to 60 degrees Celsius were achieved under moderate temperature fixation schedules (20 hours) for approximately 5 hours at full sapwood depth. Only by the end of the schedule was a temperature of 55 degrees celsius achieved at the centre of the poles. Most of the microfungi were eliminated by this temperature regime. Trichoderma was eliminated, and only one isolation of basidiomycetes was left from the heartwood of one pole. Temperatures of 55 to 60 degrees Celsius were achieved in the wood core for 9 to 10 days during kiln drying. No basidiomycete isolations remained after this exposure. In several of the poles, there was evidence of Paecilomyces variotii, a thermo-tolerant species and a number of species of Penicillium moulds. It was concluded that there was a negligible probability of decay fungi surviving the sequence of processes as described, given the effectiveness of the fixation exposure and the higher wood temperatures sustained for longer periods. 16 refs., 5 tabs., 2 figs.

  19. Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

    Directory of Open Access Journals (Sweden)

    D Tagu

    2009-12-01

    Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.

  20. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  1. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  2. Survey of bat populations from Mexico and Paraguay for rabies.

    Science.gov (United States)

    Sheeler-Gordon, L L; Smith, J S

    2001-07-01

    A mammalian survey was conducted in Mexico (October 1994-January 1996) and in Paraguay (August 1996-March 1997); a complete specimen was collected for each bat in the survey, including primary voucher specimen, ectoparasites, karyotype, and various frozen tissues. The surveys combined provided 937 brain samples (65 bat species) for rabies diagnosis. One male Lasiurus ega, collected in Paraguay, tested positive for the rabies virus (overall prevalence rate of 0.1%). Nucleotide sequence from a 300 bp region of the rabies nucleoprotein gene was compared with sequence obtained from representative rabies virus samples in the repository at the Centers for Disease Control and Prevention (Atlanta, Georgia, USA). Rabies virus extracted from the brain material of L. ega differed by only one nucleotide from a 300 bp consensus sequence (>99% homology) derived from samples for the variant of rabies virus transmitted by Lasiurus cinereus. Lasiurus ego differed by approximately 15% for the variant transmitted by Desmodus rotundus. Phylogenetic analysis found no evidence to suggest L. ego is a reservoir for rabies antigenic variant 6. The most likely explanation for rabies in L. ega was infection following contact with a rabid L. cinereus.

  3. Two tickets to paradise: multiple dispersal events in the founding of hoary bat populations in Hawai'i

    Science.gov (United States)

    Russell, Amy L.; Pinzari, Corinna A.; Vonhof, Maarten J.; Olival, Kevin J.; Bonaccorso, Frank

    2015-01-01

    The Hawaiian islands are an extremely isolated oceanic archipelago, and their fauna has long served as models of dispersal in island biogeography. While molecular data have recently been applied to investigate the timing and origin of dispersal events for several animal groups including birds, insects, and snails, these questions have been largely unaddressed in Hawai'i's only native terrestrial mammal, the Hawaiian hoary bat, Lasiurus cinereus semotus. Here, we use molecular data to test the hypotheses that (1) Hawaiian L. c. semotus originated via dispersal from North American populations of L. c. cinereus rather than from South American L. c. villosissimus, and (2) modern Hawaiian populations were founded from a single dispersal event. Contrary to the latter hypothesis, our mitochondrial data support a biogeographic history of multiple, relatively recent dispersals of hoary bats from North America to the Hawaiian islands. Coalescent demographic analyses of multilocus data suggest that modern populations of Hawaiian hoary bats were founded no more than 10 kya. Our finding of multiple evolutionarily significant units in Hawai'i highlights information that should be useful for re-evaluation of the conservation status of hoary bats in Hawai'i.

  4. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)

    DR GATSING

    Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.

  5. Type studies in Basidiomycetes. X

    NARCIS (Netherlands)

    Singer, R.

    1961-01-01

    For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The

  6. BIODIVERSITAS DAN POTENSI JAMUR BASIDOMYCOTA DI KAWASAN KASEPUHAN CISUNGSANG, KABUPATEN LEBAK, BANTEN

    Directory of Open Access Journals (Sweden)

    Ahmad Ni’matullah Al Ulya

    2017-04-01

    Full Text Available Abstrak Biodiversitas jamur Basidiomycota di kawasan konservasi Taman Nasional Gunung Halimun Salak (TNGHS yang terletak di Kabupaten Lebak, Provinsi Banten, belum pernah diteliti sebelumnya. Kawasan konservasi tersebut dihuni oleh masyarakat adat dari Kasepuhan Cisungsang, yang selama ini memanfaatkan jamur dalam kehidupan sehari-hari. Oleh karena itu, penelitian ini mengeks-plorasi keanekaragaman jamur Basidiomycota dan pemanfaatannya oleh masyarakat adat Kasepuhan Cisungsang. Penelitian dilaksanakan pada bulan Maret-Mei 2016. Sebanyak 34 spesies dari 21 marga, 16 keluarga, dan 5 bangsa dari jamur Basidiomycota berhasil ditemukan di daerah sawah, pekarangan, kebun, talun atau dudukan, dan hutan. Tujuh marga yang ditemukan diketahui dapat dimanfaatkan sebagai sumber makanan, yaitu supa ceuli (Auricularia sp.; supa amis (Marasmiellus sp.; supa beas (Coprinus sp.; supa tiram (Pleurotus sp.; supa jerami (Volvariella sp.; suung tunggal (Termitomyce sp.; dan supa kebo (Boletus sp.. Data ini menunjukkan tingginya biodiversitas jamur Basidiomycota di daerah masyarakat adat wilayah ini dan potensinya sebagai sumber makanan. Abstract Biodiversity of fungi Basidiomycota in the conservation area of Taman Nasional Gunung Halimun (TNNGHS Salak in Lebak, Province Banten, has never been studied. This area is resided by indigenous people from Kasepuhan Cisungsang, which uses the fungi in their life. Therefore, this study was aimed at exploring the biodiversity of mushrooms (Basidiomycota in Kasepuhan Cisungsang. The exploration was conducted from March to May 2016. A total number of 34 species which belong to 21 genera, 16 families, 5 orders were found in the rice field, yard, garden, and forest. About 7 genera are commonly consumed by the community. These include supa ceuli (Auricularia sp.; supa amis (Marasmiellus sp.; supa beas (Coprinus sp.; supa tiram (Pleurotus sp.; supa jerami (Volvariella sp.; suung tunggal (Termitomyce sp.; and supa kebo (Boletus sp

  7. Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions.

    Science.gov (United States)

    Tauber, James P; Gallegos-Monterrosa, Ramses; Kovács, Ákos T; Shelest, Ekaterina; Hoffmeister, Dirk

    2018-01-01

    Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S. lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S. lacrymans significantly reduced pigmentation indicating that enzymatic hyphal damage and/or released peptides, rather than mechanical injury, was the major cause of systemic pigment induction. Conversely, no significant pigmentation by bacteria was observed from P. involutus. We found additional putative transcriptional composite elements of atromentin synthetase genes in P. involutus and other ectomycorrhiza-forming species that were absent from S. lacrymans and other brown-rotters. Variegatic and its precursor xerocomic acid, but not involutin, in return inhibited swarming and colony biofilm spreading of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine global regulators, signalling pathways and associated transcription factors of basidiomycetes.

  8. Comparison of nine antigen detection kits for diagnosis of urogenital infections due to Chlamydia psittaci in koalas.

    OpenAIRE

    Wood, M M; Timms, P

    1992-01-01

    Chlamydia psittaci is the major cause of infectious disease in the koala (Phascolarctos cinereus). It causes four disease syndromes in the koala, namely, conjunctivitis, rhinitis, cystitis, and infertility (females only). Diagnosis of chlamydial infections in koalas relies primarily on isolation of the organism in cell culture. Serology has generally not been useful, and little use has previously been made of the commercially available antigen detection kits. We examined the sensitivity, spec...

  9. Checklist of the Mycobiota of Iguazú National Park (Misiones, Argentina Catálogo de los hongos del Parque Nacional Iguazú (Misiones, Argentina

    Directory of Open Access Journals (Sweden)

    Jorge E. Wright

    2005-07-01

    Full Text Available A check-list of the fungi recorded from Iguazú National Park, one of the best known preserved areas in South America, has been compiled mainly on the basis of Rolf Singer´s and our own collections and publications. Ten species of Dictyosteliales, 4 of Myxomycetes, 4 of Pezizales, 9 of Hypocreales, 31 of other Ascomycetes, 3 Deuteromycotina and 314 of Basidiomycetes are annotated. This last group is by far the best known, and includes 13 species of jelly-fungi, 6 coral fungi, 84 resupinates, 90 Agaricales s. l., 111 polypores of which 26 are poroid Hymenochaetaceae, and 11 of Gasteromycetes. Furthermore, 8 Ascomycetes, 58 Basidiomycetes and 2 Deuteromycotina were determined to genus. Lichens have been excluded. The microfungi of the Park have hardly been explored, and no phycomycetes are recorded, so the number of species included in this checklist is but a mere sample of the rich mycobiota of the Park.Este catálogo de los hongos registrados para el Parque Nacional Iguazú, una de las áreas preservadas mejor conocidas en América del Sur, ha sido confeccionado principalmente sobre la base de las colecciones y publicaciones de Rolf Singer y las propias. Diez especies de Dictyosteliales, 4 de Myxomycetes, 4 de Pezizales, 9 de Hypocreales, 31 de otros Ascomycetes, 3 Deuteromycotina, y 314 de Basidiomycetes han sido anotadas. Este último grupo es de lejos el mejor conocido, e incluye 13 especies de hongos gelatinosos, 6 de hongos clavarioides, 84 de resupinados, 90 de Agaricales s. l., 111 de políporos, de los cuales 26 son Hymenochaetaceae poroides, y 11 de Gasteromycetes. Además, 8 Ascomycetes, 58 Basidiomycetes y 2 Deuteromycotina fueron solo determinados a nivel de género. Los líquenes han sido excluídos. Los microhongos del Parque apenas han sido explorados, y no se han registrado 'ficomicetes', de modo que el número de especies que se presenta aquí son tan sólo un mero muestreo de la micobiota del Parque.

  10. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  11. Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions

    DEFF Research Database (Denmark)

    Tauber, James P.; Gallegos-Monterrosa, Ramses; Kovács, Ákos T.

    2018-01-01

    Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S...... of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine....... lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S...

  12. Why Mycophoris is not an orchid seedling, and why Synaptomitus is not a fungal symbiont within this fossil

    DEFF Research Database (Denmark)

    Selosse, Marc-Andre; Brundrett, Mark; Dearnaley, John

    2017-01-01

    A recent publication in Botany introduced two new taxa: a fossil orchid seed (Mycophoris) and a fossilized basidiomycete fungus (Synaptomitus) in an alleged relationship with this orchid, encased in 15–20 million year old Dominican amber (Poinar, G. 2017. Two new genera, Mycophoris gen. nov......., (Orchidaceae) and Synaptomitus gen. nov. (Basidiomycota) based on a fossil seed with developing embryo and associated fungus in Dominican amber. Botany, 95: 1–8). From the working knowledge of extant orchid seeds, seedlings, and mycorrhiza shared among us, we cannot support these interpretations. Here we...... analyse: (i) why Mycophoris may not be an orchid seed, (ii) why Mycophoris is not a germinating seed, (iii) why fungal hyphae and a symbiotic fungus are absent in Mycophoris, and (iv) why Synaptomitus is likely not a fossil basidiomycete....

  13. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  14. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  15. Interoceanic occurrence of species of Aristocleidus Mueller, 1936 (Monogenoidea: Dactylogyridae) parasitizing the gills of gerreid fishes in the Neotropics.

    Science.gov (United States)

    Mendoza Franco, Edgar F; Violante-González, Juan; Roche, Dominique G

    2009-09-01

    During investigations of fish parasites in the Neotropics (including the state of Veracruz and the Yucatán Peninsula in the Gulf of Mexico, the Chautengo Lagoon on the Pacific coast of the state of Guerrero in Mexico, and Lake Gatun in the Panama Canal), three monogenoidean (Dactylogyridae) species were found parasitizing the gills of gerreids (Gerreidae): Aristocleidus hastatus Mueller, 1936, was recovered from Eugerres plumieri (Cuvier) and Diapterus auratus Ranzani in Veracruz, from D. auratus and Diapterus rhombeus (Cuvier) in Yucatán, from Eugerres brasilianus (Cuvier) in Panama (all new hosts and geographical records), and from D. peruvianus (Cuvier) and Gerres cinereus (Walbaum) in Guerrero; Aristocleidus lamothei Kritsky and Mendoza-Franco, 2008, was recovered from E. plumieri in Veracruz and from D. rhombeus in Yucatan (new hosts and geographical records), and Aristocleidus sp. was recovered from G. cinereus in Guerrero. Results from this study suggest that species of Aristocleidus exhibit wide host specificity within gerreid fishes and that geminate species within this parasite genus may have originated with the formation of the Isthmus of Panama (3.1 to 3.5 ma). Evidence is also presented suggesting the potential role of the Panama Canal as a passageway allowing the interoceanic dispersal of Aristocleidus species across the isthmus.

  16. Bioleaching of copper, aluminum, magnesium and manganese from ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.

  17. Comparison of trace element content in marine organisms collected from the La Maddalena archipelago and other Mediterranean and Pacific ocean sites

    International Nuclear Information System (INIS)

    Boniforti, R.; Moauro, A.

    1982-01-01

    As, Sb, Zn, Hg, Fe, Co and Cs were analysed by instrumental neutron activation analysis in four fish species (Mullus surmuletus, Scorpaena porcus, Crenilabus cinereus, and Serranus scriba) and one gesteropod (Sepia officinalis). The results were compared with those obtained by other authors for fish collected both in the Mediterranean and the Pacific. The difficulty of comparing results obtained by different authors was stressed and some suggestions to overcome this difficulty were given

  18. octadecenoic acid in tomato

    African Journals Online (AJOL)

    User

    bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.

  19. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  20. Genetic transformation of the white-rot fungus Dichomitus squalens using a new commercial protoplasting cocktail.

    Science.gov (United States)

    Daly, Paul; Slaghek, Gillian G; Casado López, Sara; Wiebenga, Ad; Hilden, Kristiina S; de Vries, Ronald P; Mäkelä, Miia R

    2017-12-01

    D. squalens, a white-rot fungus that efficiently degrades lignocellulose in nature, can be used in various biotechnological applications and has several strains with sequenced and annotated genomes. Here we present a method for the transformation of this basidiomycete fungus, using a recently introduced commercial ascomycete protoplasting enzyme cocktail, Protoplast F. In protoplasting of D. squalens mycelia, Protoplast F outperformed two other cocktails while releasing similar amounts of protoplasts to a third cocktail. The protoplasts released using Protoplast F had a regeneration rate of 12.5% (±6 SE). Using Protoplast F, the D. squalens monokaryon CBS464.89 was conferred with resistance to the antibiotics hygromycin and G418 via polyethylene glycol mediated protoplast transformation with resistance cassettes expressing the hygromycin phosphotransferase (hph) and neomycin phosphotransferase (nptII) genes, respectively. The hph gene was expressed in D. squalens using heterologous promoters from genes encoding β-tubulin or glyceraldehyde 3-phosphate dehydrogenase. A Southern blot confirmed integration of a resistance cassette into the D. squalens genome. An average of six transformants (±2 SE) were obtained when at least several million protoplasts were used (a transformation efficiency of 0.8 (±0.3 SE) transformants per μg DNA). Transformation of D. squalens demonstrates the suitability of the Protoplast F cocktail for basidiomycete transformation and furthermore can facilitate understanding of basidiomycete gene function and development of improved strains for biotechnological applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. 12038_2016_9614_Article_print 265..275

    Indian Academy of Sciences (India)

    2016-05-13

    May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.

  2. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

    Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...

  3. Carotene-degrading activities from Bjerkandera adusta possess an application in detergent industries.

    Science.gov (United States)

    Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G

    2015-06-01

    Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning.

  4. Oxidoreductases from Trametes spp. in Biotechnology: A Wealth of Catalytic Activity

    Directory of Open Access Journals (Sweden)

    Gibson S. Nyanhongo

    2007-01-01

    Full Text Available Those oxidoreductases that are part of the ligninolytic complex of basidiomycete and ascomycete fungi have played an increasingly important role in biotechnological applications during the last decade. The stability of these extracellular enzymes, their good solubility, and a multitude of catalyzed reactions contribute to this trend. This review focuses on a single genus of white-rot basidiomycetes, Trametes, to highlight the numerous possibilities for the application of this microorganism as well as three of its enzymes: laccase, cellobiose dehydrogenase, and pyranose 2-oxidase. Whereas laccase is without doubt a major player in biotechnology, the two other enzymes are less well known, but represent emerging biocatalysts with potential. Both cellobiose dehydrogenase and pyranose 2-oxidase are presumed to participate in lignin breakdown and will be used to exemplify the potential of less prominent oxidoreductases from this genus.

  5. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  6. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  7. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1993-01-01

    Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

  8. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  9. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  10. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Science.gov (United States)

    Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen

    2012-01-01

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...

  11. Molecular identification, genetic diversity, population genetics and genomics of Rhizoctonia solani. In:perspective of plant pathology in genomic era

    Science.gov (United States)

    The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...

  12. Uncovering the abilities of Agaricus bisporus to degrade plant biomass throughout its life cycle

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, M.; Jurak, E.; Heck, A.J.R.; Hilden, K.S.; Kabel, M.A.; Makela, M.R.; Altenaar, M.A.F.; Vries, de R.P.

    2015-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and con-tributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  13. The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.

    2013-01-01

    Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median

  14. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  15. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.

    2007-01-01

    Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species

  16. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...

  17. Formation and cell wall regeneration of protoplasts from Schizophyllum commune

    NARCIS (Netherlands)

    de Vries, Onno Minne Hotze

    1974-01-01

    Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.

  18. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

    2014-01-01

    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  19. Novel mandibular gland volatiles from Apterostigma ants

    DEFF Research Database (Denmark)

    Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya

    2017-01-01

    The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...

  20. On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.

    2013-01-01

    Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

  1. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

    2015-01-01

    Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

  2. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    DEFF Research Database (Denmark)

    Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H

    2007-01-01

    BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...

  3. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The white-rot, basidiomycete fungus, Phanerochaete chrysosporium, has attracted .... with Congo red (1 mg/ml) solution, incubated at room temperature for 15 min and washed several times with sterile 1 .... white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis and regulation of differential expression.

  4. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  5. Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada

    NARCIS (Netherlands)

    Hagen, F; Boekhout, T

    2006-01-01

    Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a

  6. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

    2015-01-01

    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  7. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation

    DEFF Research Database (Denmark)

    Sitarz, Anna Katarzyna; Mikkelsen, Jørn Dalgaard; Højrup, Peter

    2013-01-01

    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt...

  8. Various Stages of Pink Fungus (Upasia salmonicolor in Java

    Directory of Open Access Journals (Sweden)

    Ambarwati Harsojo Tjokrosoedarmo

    1995-12-01

    Full Text Available Pink fungus in Java is classified as Upasia salmonicolor (Basidiomycetes: Corticiaceae and its anamorph is Necator decretus. This fungus is a serious pathogen which attacks many woody plants. The pink fungus in Java exhibits five developmental stages on the surface of the host bark: I. An initial cobweb stage as thin, white, cobweb-like hyphal layer, which creeps over the surface of the bark, during which penetration of the host occurs; II. Pseudonodular stage, as conical white pustules occurring only on lenticels or cracks, and only on shady side of branches; III. Teleomorph, occurs as pink incrustation and pink pustules on shady side of branches; IV. Nodular stages, as globose white pustules occurring chiefly on intact bark, but also on the lenticels or cracks, on exposed side of branches; V. Anamorph, as small orange-red sporodochium, on exposed side of branches. Key words: pink fungus, Corticiaceae, Basidiomycetes, Necator

  9. Fungal Sex: The Basidiomycota.

    Science.gov (United States)

    Coelho, Marco A; Bakkeren, Guus; Sun, Sheng; Hood, Michael E; Giraud, Tatiana

    2017-06-01

    Fungi of the Basidiomycota, representing major pathogen lineages and mushroom-forming species, exhibit diverse means to achieve sexual reproduction, with particularly varied mechanisms to determine compatibilities of haploid mating partners. For species that require mating between distinct genotypes, discrimination is usually based on both the reciprocal exchange of diffusible mating pheromones, rather than sexes, and the interactions of homeodomain protein signals after cell fusion. Both compatibility factors must be heterozygous in the product of mating, and genetic linkage relationships of the mating pheromone/receptor and homeodomain genes largely determine the complex patterns of mating-type variation. Independent segregation of the two compatibility factors can create four haploid mating genotypes from meiosis, referred to as tetrapolarity. This condition is thought to be ancestral to the basidiomycetes. Alternatively, cosegregation by linkage of the two mating factors, or in some cases the absence of the pheromone-based discrimination, yields only two mating types from meiosis, referred to as bipolarity. Several species are now known to have large and highly rearranged chromosomal regions linked to mating-type genes. At the population level, polymorphism of the mating-type genes is an exceptional aspect of some basidiomycete fungi, where selection under outcrossing for rare, intercompatible allelic variants is thought to be responsible for numbers of mating types that may reach several thousand. Advances in genome sequencing and assembly are yielding new insights by comparative approaches among and within basidiomycete species, with the promise to resolve the evolutionary origins and dynamics of mating compatibility genetics in this major eukaryotic lineage.

  10. Ecology and Geography of Transmission of Two Bat-Borne Rabies Lineages in Chile

    OpenAIRE

    Escobar, Luis E.; Peterson, A. Townsend; Favi, Myriam; Yung, Ver?nica; Pons, Daniel J.; Medina-Vogel, Gonzalo

    2013-01-01

    Rabies was known to humans as a disease thousands of years ago. In America, insectivorous bats are natural reservoirs of rabies virus. The bat species Tadarida brasiliensis and Lasiurus cinereus, with their respective, host-specific rabies virus variants AgV4 and AgV6, are the principal rabies reservoirs in Chile. However, little is known about the roles of bat species in the ecology and geographic distribution of the virus. This contribution aims to address a series of questions regarding th...

  11. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter

    2010-01-01

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  12. Temporal Alterations in the Secretome of the Selective Ligninolytic Fungus Ceriporipsis subvermispora during growth on Aspen Wood Reveal this Organism's Strategy for Degrading Lighnocellulose

    Science.gov (United States)

    Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen

    2014-01-01

    The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...

  13. HYDROPHOBIN GENES INVOLVED IN FORMATION OF AERIAL HYPHAE AND FRUIT BODIES IN SCHIZOPHYLLUM

    NARCIS (Netherlands)

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SCHUREN, FHJ

    Fungi typically grow by apical extension of hyphae that penetrate moist substrates. After establishing a branched feeding mycelium, the hyphae differentiate and grow away from the substrate into the air where they form various structures such as aerial hyphae and mushrooms. In the basidiomycete

  14. THE THN MUTATION OF SCHIZOPHYLLUM-COMMUNE, WHICH SUPPRESSES FORMATION OF AERIAL HYPHAE, AFFECTS EXPRESSION OF THE SC3 HYDROPHOBIN GENE

    NARCIS (Netherlands)

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SPRINGER, J

    1991-01-01

    The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents

  15. The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin

    NARCIS (Netherlands)

    Lugones, L G; de Jong, J F; de Vries, O M H; Jalving, R; Dijksterhuis, J; Wösten, H A B

    Disruption of the SC3 gene in the basidiomycete Schizophyllum commune affected not only formation of aerial hyphae but also attachment to hydrophobic surfaces. However, these processes were not completely abolished, indicating involvement of other molecules. We here show that the SC15 protein

  16. A rare case of urinary tract infection due to Trichosporonasahii in a ...

    African Journals Online (AJOL)

    Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...

  17. Fungal Systematics and Evolution: FUSE 2

    NARCIS (Netherlands)

    Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.

    2016-01-01

    The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature

  18. Two yeast species Cystobasidium psychroaquaticum f.a. sp. nov. and Cystobasidium rietchieii f.a. sp. nov. isolated from natural environments, and the transfer of Rhodotorula minuta clade members to the genus Cystobasidium

    NARCIS (Netherlands)

    Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D

    Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic

  19. [First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].

    Science.gov (United States)

    Madrid Lorca, Hugo; Muñoz, Mélica

    2006-06-01

    Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

  20. Fungal Systematics and Evolution: FUSE 3

    NARCIS (Netherlands)

    Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying

    2017-01-01

    The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra

  1. Long-term Maintenance of Fungal Cultures on Perlite in Cryovials – an Alternative for Agar Slants

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila

    2008-01-01

    Roč. 53, č. 6 (2008), s. 534-536 ISSN 0015-5632 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete * perlite * long-term maintenance Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  2. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

    Science.gov (United States)

    Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia

    2015-01-01

    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839

  3. Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 25, č. 1 (2004), s. 49-55 ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004

  4. Taxonomic studies in Chrysoderma, Corneromyces, Dendrophsellum, Hyphoradulum, and Mycobonia

    Science.gov (United States)

    Karen K. Nakasone

    2015-01-01

    Eight poorly known or unusual crustose and pileate basidiomycete species were studied. These included the type specimens of three monotypic genera: Chrysoderma alboluteum from Réunion is conspecific with Cerocorticium molle; Dendrophysellum amurense from the Russian Far East is a species of Vararia; and ...

  5. ASSIGNMENT OF GENES TO PULSE-FIELD SEPARATED CHROMOSOMES OF SCHIZOPHYLLUM-COMMUNE

    NARCIS (Netherlands)

    ASGEIRSDOTTIR, SA; SCHUREN, FHJ; WESSELS, JGH

    Chromosomal DNAs of the basidiomycete Schizophyllum commune were separated by Contour-Clamped Homogeneous Electric Field Electrophoresis (CHEF). The estimated sizes of the chromosomal DNAs ranged from 4.7 Megabase pairs (Mbp) to 1.6 Mbp, totalling 35.6 Mbp. Using sequences from 20 cloned genes we

  6. The genus Actiniceps Berk. & Br

    NARCIS (Netherlands)

    Boedijn, K.B.

    1959-01-01

    The genus Actiniceps Berk. & Br. is shown to be a Basidiomycete. Wiesnerina Höhn. and Dimorphocystis Corner are regarded synonymous. The type species A. thwaitesii Berk. & Br. is redescribed with D. capitatus Corner as synonym. The following new combinations are proposed: A. horrida (Höhn.) Boedijn,

  7. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

    2000-01-01

    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  8. Clonality and α-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia

    NARCIS (Netherlands)

    Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland

    2011-01-01

    Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the

  9. Bioconcentration of manganese and iron in Panaeoloideae Sing

    NARCIS (Netherlands)

    Stijve, T.; Blake, C.

    1994-01-01

    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae,

  10. First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia

    Science.gov (United States)

    Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...

  11. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  12. A novel expansin protein from the white-rot fungus Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Omar Eduardo Tovar-Herrera

    Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.

  13. A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao

    Science.gov (United States)

    The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

  14. Identification and first report of Inonotus (Phellinus) tropicalis as an etiologic agent in a patient with chronic granulomatous disease

    Science.gov (United States)

    D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul

    2005-01-01

    Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.

  15. Proteomic and functional analysis of the cellulase system expressed by Postia placenta during brown rot of solid wood

    Science.gov (United States)

    Jae San Ryu; Semarjit Shary; Carl J. Houtman; Ellen A. Panisko; Premsagar Korripally; Franz J. St. John; Casey Crooks; Matti Siika-aho; Jon K. Magnuson; Kenneth E. Hammel

    2011-01-01

    Brown rot basidiomycetes have an important ecological role in lignocellulose recycling and are notable for their rapid degradation of wood polymers via oxidative and hydrolytic mechanisms. However, most of these fungi apparently lack processive (exo-acting) cellulases, such as cellobiohydrolases, which are generally required for efficient cellulolysis. The recent...

  16. Comparative transcriptome and secretome analysis of wood decay fungi Postia placenta and Phanerochaete chrysosporium

    Science.gov (United States)

    Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen

    2010-01-01

    Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...

  17. INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI

    NARCIS (Netherlands)

    DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH

    Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted

  18. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

    Science.gov (United States)

    Chiaki Hori; Takuya Ishida; Kiyohiko Igarashi; Masahiro Samejima; Hitoshi Suzuki; Emma Master; Patricia Ferreira; Francisco J. Ruiz-Duenas; Benjamin Held; Paulo Canessa; Luis F. Larrondo; Monika Schmoll; Irina S. Druzhinina; Christian P. Kubicek; Jill A. Gaskell; Phil Kersten; Franz St. John; Jeremy Glasner; Grzegorz Sabat; Sandra Splinter Bondurant; Khajamohiddin Syed; Jagjit Yadav; Anthony C. Mgbeahuruike; Andriy Kovalchuk; Fred O. Asiegbu; Gerald Lackner; Dirk Hoffmeister; Jorge Recoret; Ana Gutierrez; Hui Sun; Erika Lindquist; Kerrie Barry; Robert Riley; Igor V. Grigoriev; Bernard Henrissat; Ursula Kues; Randy M. Berka; Angel T. Martinez; Sarah F. Covert; Robert A. Blanchette; Daniel Cullen

    2014-01-01

    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other...

  19. Author Details

    African Journals Online (AJOL)

    Goud, MJP. Vol 2, No 3 (2007) - Articles Antibacterial activity and biomolecular composition of certain fresh water micro-algae from River Godavari (India) Abstract PDF · Vol 3, No 1 (2008) - Articles Replica plate screening method for detecting phosphatase activity in basidiomycetes using 1-Napthyl Phosphate as a ...

  20. Acoustic surveys of Hawaiian Hoary Bats in Kahikinui Forest Reserve and Nakula Natural Area Reserve on the Island of Maui

    Science.gov (United States)

    Todd, Christopher M.; Pinzari, Corinna A.; Bonaccorso, Frank

    2016-01-01

    The Kahikinui Forest Reserve and the adjoining Nakula Natural Area Reserve (KFR-NNAR) was established in 2011 as a conservation area on the leeward slope of Haleakalā Volcano on the island of Maui to protect unique natural features and endangered species including the Hawaiian hoary bat, Lasiurus cinereus semotus. We recorded bat vocalizations from July 2012 to November 2014 using automated echolocation detectors at 14 point locations in the KFRNNAR. Our study area included remnants of recovering mesic montane forest with interspersed grasses (1,250‒1,850 m elevation, hereafter called “forest”) and xeric subalpine shrubland plant communities (1,860‒2,800 m, hereafter called “shrubland”). Monthly detections of Hawaiian hoary bats, Lasiurus cinereus semotus, within the KFR-NNAR identified areas of high and low detection probability as well as foraging activity. Sixty per cent of all detector-nights had confirmed bat vocalizations and included detections in every month of the study. Monthly detection probability values were highest from July to November 2012; these values were significantly greater than values measured in any month thereafter. Pooled values of detection probabilities, mean pulses/night, percentage of nights with feeding activity, and acoustic detections all were greater in the recovering forest zone than corresponding values from the shrublands. Our data provide baseline levels of hoary bat echolocation activity that may be compared with future studies in the KFR-NNAR relative to success criteria for Hawaiian hoary bat habitat restoration.

  1. Evaluating within-population variability in behavior and demography for the adaptive potential of a dispersal-limited species to climate change

    Science.gov (United States)

    Muñoz, David J.; Miller Hesed, Kyle; Grant, Evan H. Campbell; Miller, David A.W.

    2016-01-01

    Multiple pathways exist for species to respond to changing climates. However, responses of dispersal-limited species will be more strongly tied to ability to adapt within existing populations as rates of environmental change will likely exceed movement rates. Here, we assess adaptive capacity in Plethodon cinereus, a dispersal-limited woodland salamander. We quantify plasticity in behavior and variation in demography to observed variation in environmental variables over a 5-year period. We found strong evidence that temperature and rainfall influence P. cinereus surface presence, indicating changes in climate are likely to affect seasonal activity patterns. We also found that warmer summer temperatures reduced individual growth rates into the autumn, which is likely to have negative demographic consequences. Reduced growth rates may delay reproductive maturity and lead to reductions in size-specific fecundity, potentially reducing population-level persistence. To better understand within-population variability in responses, we examined differences between two common color morphs. Previous evidence suggests that the color polymorphism may be linked to physiological differences in heat and moisture tolerance. We found only moderate support for morph-specific differences for the relationship between individual growth and temperature. Measuring environmental sensitivity to climatic variability is the first step in predicting species' responses to climate change. Our results suggest phenological shifts and changes in growth rates are likely responses under scenarios where further warming occurs, and we discuss possible adaptive strategies for resulting selective pressures.

  2. Enzyme activities of fungi associated with Picea abies needles

    Czech Academy of Sciences Publication Activity Database

    Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 427-436 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  3. Elevated tropospheric CO2 and O3 may not alter initial wood decomposition rate or wood-decaying fungal community composition of Northern hardwoods

    Science.gov (United States)

    Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser

    2016-01-01

    We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...

  4. Humic Acid-Like Material from Sewage Sludge Stimulates Culture Growth of Ectomycorrhizal Fungi in Vitro

    Czech Academy of Sciences Publication Activity Database

    Hršelová, Hana; Soukupová, Lucie; Gryndler, Milan

    2007-01-01

    Roč. 52, č. 6 (2007), s. 627-630 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540 Institutional research plan: CEZ:AV0Z50200510 Keywords : ectomycorrhizal basidiomycetes * sewage sludge * humic-acid-like materials Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  5. Functional foods from mushroom

    Science.gov (United States)

    Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

  6. First report of Trypanosoma vegrandis in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Barbosa, Amanda; Austen, Jill; Gillett, Amber; Warren, Kristin; Paparini, Andrea; Irwin, Peter; Ryan, Una

    2016-08-01

    The present study describes the first report of Trypanosoma vegrandis in koalas using morphology and sequence analysis of the 18S rRNA gene. The prevalence of T. vegrandis in koalas was 13.6% (6/44). It is likely that the small size of T. vegrandis (<10μm in length), coupled with the difficulties in amplifying DNA of this parasite in mixed infections using trypanosome generic primers, are the reason why this organism has not been identified in koalas until now. This study highlights the importance of further research comprising a larger sample size to determine the prevalence of T. vegrandis in koalas as well as its potential impacts upon this marsupial species' health. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

    Science.gov (United States)

    2009-03-01

    tolerate 3,000–5000 Gy, but are rendered sterile. As a haploid, the basidiomycete fungus Ustilago maydis carries a single set of chromosomes per...salinarum NRC-1. Environ. Microbiol. 5 Jan 2009 (doi:10.1111/j.1462-2920.2008.01828.x). 21. Chan, H. L. et al. Proteomic analysis of UVC irradiation

  8. Transcriptome and secretome analyses of the wood decay fungus Wolfiporia cocos support alternative mechanisms of lignocellulose conversion

    Science.gov (United States)

    Jill Gaskell; Robert A. Blanchette; Philip E. Stewart; Sandra Splinter BonDurant; Marie Adams; Grzegorz Sabat; Philip Kersten; Daniel Cullen

    2016-01-01

    Certain wood decay basidiomycetes, collectively referred to as brown rot fungi, rapidly depolymerize cellulose while leaving behind the bulk of cell wall lignin as a modified residue. The mechanism(s) employed is unclear, but considerable evidence implicates the involvement of diffusible oxidants generated via Fenton-like chemistry. Toward a better understanding of...

  9. Significant alteration of gene expression in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species

    Science.gov (United States)

    Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen

    2011-01-01

    Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...

  10. Moniliophthora roreri Genome and Transcriptome

    Science.gov (United States)

    Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

  11. Draft genome sequence of the white-rot fungus Obba rivulosa 3A-2

    Science.gov (United States)

    Otto Miettinen; Robert Riley; Kerrie Barry; Daniel Cullen; Ronald P. de Vries; Matthieu Hainaut; Annele Hatakka; Bernard Henrissat; Kristiina Hilden; Rita Kuo; Kurt LaButti; Anna Lipzen; Miia R. Makela; Laura Sandor; Joseph W. Spatafora; Igor V. Grigoriev; David S. Hibbett

    2016-01-01

    We report here the first genome sequence of the white-rot fungus Obba rivulsa (Polyporales, Basidiomycota), a polypore known for its lignin-decomposing ability. The genome is based on the homokaryon 3A-2 originating in Finland. The genome is typical in size and carbohydrate active enzyme (CAZy) content for wood-decomposing basidiomycetes.

  12. Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications

    Science.gov (United States)

    Cathy L. Cripps

    2001-01-01

    Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...

  13. Purification, molecular cloning, and enzymatic properties of a family 12 endoglucanase (EG-II) from fomitopsis palustris: role of EG-II in larch holocellulose hydrolysis.

    Science.gov (United States)

    Shimokawa, Tomoko; Shibuya, Hajime; Nojiri, Masanobu; Yoshida, Shigeki; Ishihara, Mitsuro

    2008-09-01

    A family 12 endoglucanase with a molecular mass of 23,926 Da (EG-II) from the brown-rot basidiomycete Fomitopsis palustris was purified and characterized. One of the roles of EG-II in wood degradation is thought to be to loosen the polysaccharide network in cell walls by disentangling hemicelluloses that are associated with cellulose.

  14. Carbohydrate-active enzymes from the zygomycete fungus Rhizopus oryzae: a highly specialized approach to carbohydrate degradation depicted at genome level

    Directory of Open Access Journals (Sweden)

    Henrissat Bernard

    2011-01-01

    Full Text Available Abstract Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs and a high number of glycosyl transferases (GTs and carbohydrate esterases (CEs. A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars, chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota.

  15. Pretreatment of lignocellulosic material with fungi capable of higher lignin degradation and lower carbohydrate degradation improves substrate acid hydrolysis and the eventual conversion to ethanol

    Energy Technology Data Exchange (ETDEWEB)

    Kuhar, S.; Nair, L.M.; Kuhad, R.C. [Delhi Univ., New Delhi (India). Dept. of Microbiology, Lignocellulose Biotechnology Laboratory

    2008-04-15

    Lignocellulosic biomass is the most abundant energy resource in the world and is a potential source of carbon substrate for the production of ethanol via fermentation. However, the presence of lignin restricts access to holocellulose. It is necessary to break or remove the lignin in plant residues prior to their hydrolysis. Pretreatment is needed to liberate cellulose and hemicellulose from the lignins. This paper discussed a biological delignification method that avoided the use of toxic and corrosive chemicals. The in situ microbial delignification process used white rot fungi as a basidiomycetes for biological pretreatment. The study examined the capability of 4 basidiomycetes fungi, notably: (1) Phanerochaete chrysosporium; (2) Pycnoporus cinnabarinus; (3) fungal isolate RCK-1; and (4) fungal isolate RCK-3. The fungi were used to delignify wheat straw and improve hydrolysis procedures. Attempts were also made to ferment the acid hydrolysates from fungal-pretreated lignocellulosic materials. Results of the experiment showed that higher yields of ethanol were obtained using selective lignin-degrading fungi as a pretreatment method. 39 refs., 3 tabs., 4 figs.

  16. New data on agaricoid fungi of the Katunsky State Nature Reserve and rare fungi of the Republic of Altai (Russia

    Directory of Open Access Journals (Sweden)

    Irina A. Gorbunova

    2017-08-01

    Full Text Available The article presents new data on agaricoid basidiomycetes of the Katunsky State Nature Reserve (Republic of Altai, Russia, including data on rare species. Besides the paper contains characteristics of some rare ascomycetes and basidiomycetes found in the Katunsky Reserve and in the Republic of Altai as well as about species recommended for inclusion in the new edition of the Red Data Book of the Republic of Altai. In total descriptions of 17 species of macromycetes are presented. These are Chroogomphus sibiricus, Cortinarius violaceus, Floccularia luteovirens, Ganoderma lucidum, Grifola frondosa, Lactarius lignyotus, Leucoagaricus nympharum, Leucopholiota lignicola, Gastrosporium simplex, Gyromitra sphaerospora, Laricifomes officinalis, Bovista acuminata, Hydropus atramentosus, Leucopaxillus rhodoleucus, Phallus costatus, Polyozellus multiplex and Polyporus rhizophilus. We present data on species' distribution throughout the Republic of Altai, Russia and the world; some ecological and biological features of species; major threats and their conservation status. Arguments for exclusion of Amanita echinocephala, Hericium coralloides, Cystoderma rugosoreticulatum, Leccinum percandidum, Mutinus caninus from the list of rare species of the region are presented.

  17. Bio-softening of mature coconut husk for facile coir recovery.

    Science.gov (United States)

    Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

    2007-06-01

    Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

  18. Global warming and mycoflora in the Baltic Region

    Directory of Open Access Journals (Sweden)

    Hanns Kreisel

    2013-12-01

    Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

  19. Enzymology and molecular biology of lignin degradation

    Science.gov (United States)

    D. Cullen; P.J. Kersten

    2004-01-01

    This review provides an overview of the physiology and genetics of lignin degradation by white rot basidiomycetes. Emphasis is on recent advances and the reader is referred to earlier comprehensive reviews for historical perspective and background (Kirk and Farrell 1987; Gold and Alic 1993; Higuchi 1993; Cullen and Kersten 1996; Cullen 1997). Recent completion of a...

  20. Fungal bioremediation of the creosote-contaminated soil: Influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study

    Czech Academy of Sciences Publication Activity Database

    Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr

    2008-01-01

    Roč. 2008, č. 73 (2008), s. 1518-1523 ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008

  1. SECONDARY METABOLITES FROM MARINE PENICILLIUM BREVICOMPACTUM

    OpenAIRE

    ROVIROSA, JUANA; DIAZ-MARRERO, ANA; DARIAS, JOSE; PAINEMAL, KARIN; SAN MARTIN, AURELIO

    2006-01-01

    In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.

  2. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  3. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  4. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  5. Environmental Assessment for the Continued Exclusive Use of Department of the Army Land Located at U.S. Army Dugway Proving Ground by Members of the U.S. Air Force

    Science.gov (United States)

    2012-07-01

    canned and prepared foods with gamma rays in an effort to kill micro -organisms, trichina in pork, and food-infesting insects (DPG 2001). The Avery...microcommunity consisting of fungi (Basidiomycetes), lichens, soil algae , and mosses typically occurring in semiarid regions. Cyanobacteria-dominated soil... ponds , playas, and wetlands. Constructed surface water features include wastewater lagoons, evaporation ponds , an excavated pond , a bermed pond , and

  6. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

    OpenAIRE

    Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

    2015-01-01

    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  7. Cellobiose dehydrogenase of Chaetomium sp. INBI 2-26(-): structural basis of enhanced activity toward glucose at neutral pH.

    Science.gov (United States)

    Vasilchenko, Liliya G; Karapetyan, Karen N; Yershevich, Olga P; Ludwig, Roland; Zamocky, Marcel; Peterbauer, Clemens K; Haltrich, Dietmar; Rabinovich, Mikhail L

    2011-05-01

    Cellobiose dehydrogenase (CDH) is an extracellular fungal flavocytochrome specifically oxidizing cellooligosaccharides and lactose to corresponding (-lactones by a variety of electron acceptors. In contrast to basidiomycetous CDHs, CDHs of ascomycetes also display certain activity toward glucose. The objective of this study was to establish the structural reasons of such an activity of CDH from mesophilic ascomycete Chaetomium sp. INBI 2-26 (ChCDH). The complete amino acid sequence of ChCDH displayed high levels of similarity with the amino acid sequences of CDHs from the thermophilic fungi Thielavia heterotallica and Myriococcum thermophilum. Peptide mass fingerprinting of purified ChCDH provided evidence for the oxidation of methionine residues in the FAD-domain. Comparative homology modeling of the structure of the ChCDH FAD-domain in complex with the transition state analog based on the structure of the same complex of basidiomycetous CDH (1NAA) as template indicated possible structural reasons for the enhanced activity of ascomycetous CDHs toward glucose at neutral pH, which is a prerequisite for application of CDH in a variety of biocompatible biosensors and biofuel cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Chemical characterization of milk oligosaccharides of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Urashima, Tadasu; Taufik, Epi; Fukuda, Rino; Nakamura, Tadashi; Fukuda, Kenji; Saito, Tadao; Messer, Michael

    2013-11-01

    Previous structural characterizations of marsupial milk oligosaccharides had been performed in only two macropod species, the tammar wallaby and the red kangaroo. To clarify the homology and heterogeneity of milk oligosaccharides among marsupial species, which could provide information on their evolution, the oligosaccharides of the koala milk carbohydrate fraction were characterized in this study. Neutral and acidic oligosaccharides were separated from the carbohydrate fraction of milk of the koala, a non-macropod marsupial, and characterized by (1)H-nuclear magnetic resonance spectroscopy. The structures of the neutral saccharides were found to be Gal(β1-4)Glc (lactose), Gal(β1-3)Gal(β1-4)Glc (3'-galactosyllactose), Gal(β1-3)Gal(β1-3)Gal(β1-4)Glc (3',3″-digalactosyllactose), Gal(β1-3)[Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (lacto-N-novopentaose I) and Gal(β1-3){Gal(β1-4)[Fuc(α1-3)]GlcNAc(β1-6)}Gal(β1-4)Glc (fucosyl lacto-N-novopentaose I), while those of the acidic saccharides were Neu5Ac(α2-3)Gal(β1-4)Glc (3'-SL), Neu5Ac(α2-3)Gal(β1-3)Gal(β1-4)Gal (sialyl 3'-galactosyllactose), Neu5Ac(α2-3)Gal(β1-3)[Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose a), Gal(β1-3)[Neu5Ac(α2-6)Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose b), Gal(β1-3)[Neu5Ac(α2-3)Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose c), and Neu5Ac(α2-3)Gal(β1-3){Gal(β1-4)[Fuc(α1-3)]GlcNAc(β1-6)}Gal(β1-4)Glc (fucosyl sialyl lacto-N-novopentaose a). The neutral oligosaccharides, other than fucosyl lacto-N-novopentaose I, a novel hexasaccharide, had been found in milk of the tammar wallaby, a macropod marsupial, while the acidic oligosaccharides, other than fucosyl sialyl lacto-N-novopentaose a had been identified in milk carbohydrate of the red kangaroo. The presence of fucosyl oligosaccharides is a significant feature of koala milk, in which it differs from milk of the tammar wallaby and the red kangaroo.

  9. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  10. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  11. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

    Science.gov (United States)

    Yitzhak Hadar; Daniel Cullen

    2013-01-01

    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  12. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  13. Delineating hierarchy of selenotranscriptome expression and their response to selenium status in chicken central nervous system.

    Science.gov (United States)

    Jiang, Xiu-Qing; Cao, Chang-Yu; Li, Zhao-Yang; Li, Wei; Zhang, Cong; Lin, Jia; Li, Xue-Nan; Li, Jing-Long

    2017-04-01

    Selenium (Se) incorporated in selenoproteins as selenocysteine and supports various important cellular and organismal functions. We recently reported that chicken brain exhibited high priority for Se supply and retention under conditions of dietary Se deficiency and supernutrition Li et al. (2012) . However, the selenotranscriptome expressions and their response to Se status in chicken central nervous system (CNS) are unclear. To better understand the relationship of Se homeostasis and selenoproteins expression in chicken CNS, 1day-old HyLine White chickens were fed a low Se diet (Se-L, 0.028mg/g) supplemented with 4 levels of dietary Se (0 to 5.0mgSe/kg) as Na 2 SeO 3 for 8weeks. Then chickens were dissected for getting the CNS, which included cerebral cortex, cerebellum, thalamus, bulbus cinereus and marrow. The expressions of selenoproteome which have 24 selenoproteins were detected by the quantitative real-time PCR array. The concept of a selenoprotein hierarchy was developed and the hierarchy of different regions in chicken CNS was existence, especially cerebral cortex and bulbus cinereus. The expression of selenoproteins has a hierarch while changing Se content, and Selenoprotein T (Selt), Selenoprotein K (Selk), Selenoprotein W (Selw), Selenoprotein U (Selu), Glutathione peroxidase 3 (Gpx3), Glutathione peroxidase 4 (Gpx4), Selenoprotein P (Sepp1), Selenoprotein O (Selo), Selenoprotein 15 (Sel15), Selenoprotein N (Seln), Glutathione peroxidase 2 (Gpx2) and Selenoprotein P 2 (Sepp2) take more necessary function in the chicken CNS. Therefore, we hypothesize that hierarchy of regulated the transcriptions of selenoproteome makes an important role of CNS Se metabolism and transport in birds. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Science.gov (United States)

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  15. Secretome-based Manganese(II) Oxidation by Filamentous Ascomycete Fungi

    Science.gov (United States)

    Zeiner, C. A.; Purvine, S.; Zink, E.; Paša-Tolić, L.; Chaput, D.; Wu, S.; Santelli, C. M.; Hansel, C. M.

    2017-12-01

    Manganese (Mn) oxides are among the strongest oxidants in the environment, and Mn(II) oxidation to Mn(III/IV) (hydr)oxides includes both abiotic and microbially-mediated processes. While white-rot Basidiomycete fungi oxidize Mn(II) using laccases and Mn peroxidases in association with lignocellulose degradation, the mechanisms by which filamentous Ascomycete fungi oxidize Mn(II) and a physiological role for Mn(II) oxidation in these organisms remain poorly understood. Through a combination of chemical and in-gel assays, bulk mass spectrometry, and iTRAQ proteomics, we demonstrate enzymatic Mn(II) oxidation in the secretomes of three phylogenetically diverse Ascomycetes that were isolated from Mn-laden sediments. Candidate Mn(II)-oxidizing enzymes were species-specific and included bilirubin oxidase and tyrosinase in Stagonospora sp. SRC1lsM3a, GMC oxidoreductase in Paraconiothyrium sporulosum AP3s5-JAC2a, and FAD-binding oxidoreductases in Pyrenochaeta sp. DS3sAY3a. These findings were supported by full proteomic characterization of the secretomes, which revealed a lack of Mn, lignin, and versatile peroxidases in these Ascomycetes but a substantially higher proportion of LMCOs and GMC oxidoreductases compared to wood-rot Basidiomycetes. We also identified the potential for indirect enzymatic Mn(II) oxidation by hydroxyl radical, as the secretomes were rich in diverse lignocellulose-degrading enzymes that could participate in Fenton chemistry. A link between Mn(II) oxidation and carbon oxidation analogous to white-rot Basidiomycetes remains unknown in these Ascomycetes. Interestingly, growth rates on rich medium were unaffected by the presence of Mn(II), and the production of Mn(II)-oxidizing proteins in the secretome was constitutive and not inducible by Mn(II). Thus, no physiological benefit of Mn(II) oxidation in these Ascomycetes has yet been identified, and Mn(II) oxidation appears to be a side reaction. Future work will explore the lignin-degrading capacity of

  16. CONTROLE ALTERNATIVO SOBRE Meloidogyne incognita EM SOJA

    Directory of Open Access Journals (Sweden)

    Marlon Henrique Hahn

    2015-12-01

    Full Text Available The alternative control is an environmentally safe and ecologically viable option for controlling plant pathogens. Considering the great importance of nematodes in soybean, this study aimed to evaluate the efficacy of nematophagous fungi against the root-knot nematode Meloidogyne incognita in soybean. The experimental design was in randomized blocks, with five treatments and four replicates. The treatments were Pochonia chlamydosporia, Paecilomyces lilacinus, Coprinus comatus, a mixture of P. chlamydosporia and P. lilacinus, and control plants inoculated with M. incognita and without treatment. We evaluated number of eggs and second stage juveniles (J2 in soil and roots, number of galls and reproduction factor (RF. There were no differences among the treatments and the control plants for number of eggs and J2 in soil and roots, number of galls and RF. The P. chlamydosporia treatments caused the reduction of the number of J2 in roots. Thus, was possible to conclude that P. chlamydosporia has potential to control M. incognita in soybean plants.

  17. Daylight saving time can decrease the frequency of wildlife–vehicle collisions

    Science.gov (United States)

    Ellis, William A.; FitzGibbon, Sean I.; Barth, Benjamin J.; Niehaus, Amanda C.; David, Gwendolyn K.; Taylor, Brendan D.; Matsushige, Helena; Melzer, Alistair; Bercovitch, Fred B.; Carrick, Frank; Jones, Darryl N.; Dexter, Cathryn; Gillett, Amber; Predavec, Martin; Lunney, Dan

    2016-01-01

    Daylight saving time (DST) could reduce collisions with wildlife by changing the timing of commuter traffic relative to the behaviour of nocturnal animals. To test this idea, we tracked wild koalas (Phascolarctos cinereus) in southeast Queensland, where koalas have declined by 80% in the last 20 years, and compared their movements with traffic patterns along roads where they are often killed. Using a simple model, we found that DST could decrease collisions with koalas by 8% on weekdays and 11% at weekends, simply by shifting the timing of traffic relative to darkness. Wildlife conservation and road safety should become part of the debate on DST. PMID:27881767

  18. Laboratory studies of the degradation of chloropyrifos pesticide in soils supplemented by the fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Lopera Mesa, Margarita Maria; Penuela Mesa, Gustavo Antonio; Dominguez Gual, Maria Carolina; Mejia Zapata, Gloria Maria

    2005-01-01

    Degradation of the insecticide chloropyrifos was investigated in sterilized soil samples supplemented by the white rot basidiomycetes Phanerochaete chrysosporium. Degradation rates were measured during 21-day incubation at pesticide concentrations of 0,95, 5,3, and 9,41 μ/g. Phanerochaete chrysosporium showed ability to biodegrade the insecticide in values of 96,3%, 82,4% and 62,2%, respectively, followed by rapid degradation at low initial concentration of chloropyrifos

  19. Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations

    OpenAIRE

    MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan

    2007-01-01

    Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...

  20. The yeast flora of some decaying mushrooms on trunks of living trees

    OpenAIRE

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

  1. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Science.gov (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  2. Genetic recombination in auxotrophic strains of Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Krejci, R.

    1987-01-01

    Four auxotrophic strains of ligninolytic basidiomycete Phanerochaete chrysosporium were obtained by UV mutagenesis. The heterokaryotic mycelium formed by complementation of different auxotrophic isolates was able to fruit and produce basidiospores. Prototrophic strains and strains with a recombined set of parental nutritional requirements were isolated from the basidiospore progeny of the heterokaryons. Genetic recombination hence takes place in fruit bodies produced by the heterokaryotic mycelium. (author). 3 tabs., 13 refs

  3. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  4. Microbial community analysis of field-grown soybeans with different nodulation phenotypes.

    Science.gov (United States)

    Ikeda, Seishi; Rallos, Lynn Esther E; Okubo, Takashi; Eda, Shima; Inaba, Shoko; Mitsui, Hisayuki; Minamisawa, Kiwamu

    2008-09-01

    Microorganisms associated with the stems and roots of nonnodulated (Nod(-)), wild-type nodulated (Nod(+)), and hypernodulated (Nod(++)) soybeans [Glycine max (L.) Merril] were analyzed by ribosomal intergenic transcribed spacer analysis (RISA) and automated RISA (ARISA). RISA of stem samples detected no bands specific to the nodulation phenotype, whereas RISA of root samples revealed differential bands for the nodulation phenotypes. Pseudomonas fluorescens was exclusively associated with Nod(+) soybean roots. Fusarium solani was stably associated with nodulated (Nod(+) and Nod(++)) roots and less abundant in Nod(-) soybeans, whereas the abundance of basidiomycetes was just the opposite. The phylogenetic analyses suggested that these basidiomycetous fungi might represent a root-associated group in the Auriculariales. Principal-component analysis of the ARISA results showed that there was no clear relationship between nodulation phenotype and bacterial community structure in the stem. In contrast, both the bacterial and fungal community structures in the roots were related to nodulation phenotype. The principal-component analysis further suggested that bacterial community structure in roots could be classified into three groups according to the nodulation phenotype (Nod(-), Nod(+), or Nod(++)). The analysis of root samples indicated that the microbial community in Nod(-) soybeans was more similar to that in Nod(++) soybeans than to that in Nod(+) soybeans.

  5. Microbial Community Analysis of Field-Grown Soybeans with Different Nodulation Phenotypes▿

    Science.gov (United States)

    Ikeda, Seishi; Rallos, Lynn Esther E.; Okubo, Takashi; Eda, Shima; Inaba, Shoko; Mitsui, Hisayuki; Minamisawa, Kiwamu

    2008-01-01

    Microorganisms associated with the stems and roots of nonnodulated (Nod−), wild-type nodulated (Nod+), and hypernodulated (Nod++) soybeans [Glycine max (L.) Merril] were analyzed by ribosomal intergenic transcribed spacer analysis (RISA) and automated RISA (ARISA). RISA of stem samples detected no bands specific to the nodulation phenotype, whereas RISA of root samples revealed differential bands for the nodulation phenotypes. Pseudomonas fluorescens was exclusively associated with Nod+ soybean roots. Fusarium solani was stably associated with nodulated (Nod+ and Nod++) roots and less abundant in Nod− soybeans, whereas the abundance of basidiomycetes was just the opposite. The phylogenetic analyses suggested that these basidiomycetous fungi might represent a root-associated group in the Auriculariales. Principal-component analysis of the ARISA results showed that there was no clear relationship between nodulation phenotype and bacterial community structure in the stem. In contrast, both the bacterial and fungal community structures in the roots were related to nodulation phenotype. The principal-component analysis further suggested that bacterial community structure in roots could be classified into three groups according to the nodulation phenotype (Nod−, Nod+, or Nod++). The analysis of root samples indicated that the microbial community in Nod− soybeans was more similar to that in Nod++ soybeans than to that in Nod+ soybeans. PMID:18658280

  6. Prevalence and Clinical Significance of Herpesvirus Infection in Populations of Australian Marsupials.

    Directory of Open Access Journals (Sweden)

    Kathryn Stalder

    Full Text Available Herpesviruses have been reported in several marsupial species, but molecular classification has been limited to four herpesviruses in macropodids, a gammaherpesvirus in two antechinus species (Antechinus flavipes and Antechinus agilis, a gammaherpesvirus in a potoroid, the eastern bettong (Bettongia gaimardi and two gammaherpesviruses in koalas (Phascolarctos cinereus. In this study we examined a range of Australian marsupials for the presence of herpesviruses using molecular and serological techniques, and also assessed risk factors associated with herpesvirus infection. Our study population included 99 koalas (Phascolarctos cinereus, 96 eastern grey kangaroos (Macropus giganteus, 50 Tasmanian devils (Sarcophilus harrisii and 33 common wombats (Vombatus ursinius. In total, six novel herpesviruses (one alphaherpesvirus and five gammaherpesviruses were identified in various host species. The overall prevalence of detection of herpesvirus DNA in our study population was 27.2% (95% confidence interval (CI of 22.6-32.2%, but this varied between species and reached as high as 45.4% (95% CI 28.1-63.7% in common wombats. Serum antibodies to two closely related macropodid herpesviruses (macropodid herpesvirus 1 and 2 were detected in 44.3% (95% CI 33.1-55.9% of animals tested. This also varied between species and was as high as 92% (95% CI 74.0-99.0% in eastern grey kangaroos. A number of epidemiological variables were identified as positive predictors for the presence of herpesvirus DNA in the marsupial samples evaluated. The most striking association was observed in koalas, where the presence of Chlamydia pecorum DNA was strongly associated with the presence of herpesvirus DNA (Odds Ratio = 60, 95% CI 12.1-297.8. Our results demonstrate the common presence of herpesviruses in Australian marsupials and provide directions for future research.

  7. Prevalence and Clinical Significance of Herpesvirus Infection in Populations of Australian Marsupials.

    Science.gov (United States)

    Stalder, Kathryn; Vaz, Paola K; Gilkerson, James R; Baker, Rupert; Whiteley, Pam; Ficorilli, Nino; Tatarczuch, Liliana; Portas, Timothy; Skogvold, Kim; Anderson, Garry A; Devlin, Joanne M

    2015-01-01

    Herpesviruses have been reported in several marsupial species, but molecular classification has been limited to four herpesviruses in macropodids, a gammaherpesvirus in two antechinus species (Antechinus flavipes and Antechinus agilis), a gammaherpesvirus in a potoroid, the eastern bettong (Bettongia gaimardi) and two gammaherpesviruses in koalas (Phascolarctos cinereus). In this study we examined a range of Australian marsupials for the presence of herpesviruses using molecular and serological techniques, and also assessed risk factors associated with herpesvirus infection. Our study population included 99 koalas (Phascolarctos cinereus), 96 eastern grey kangaroos (Macropus giganteus), 50 Tasmanian devils (Sarcophilus harrisii) and 33 common wombats (Vombatus ursinius). In total, six novel herpesviruses (one alphaherpesvirus and five gammaherpesviruses) were identified in various host species. The overall prevalence of detection of herpesvirus DNA in our study population was 27.2% (95% confidence interval (CI) of 22.6-32.2%), but this varied between species and reached as high as 45.4% (95% CI 28.1-63.7%) in common wombats. Serum antibodies to two closely related macropodid herpesviruses (macropodid herpesvirus 1 and 2) were detected in 44.3% (95% CI 33.1-55.9%) of animals tested. This also varied between species and was as high as 92% (95% CI 74.0-99.0%) in eastern grey kangaroos. A number of epidemiological variables were identified as positive predictors for the presence of herpesvirus DNA in the marsupial samples evaluated. The most striking association was observed in koalas, where the presence of Chlamydia pecorum DNA was strongly associated with the presence of herpesvirus DNA (Odds Ratio = 60, 95% CI 12.1-297.8). Our results demonstrate the common presence of herpesviruses in Australian marsupials and provide directions for future research.

  8. Prevalence and Clinical Significance of Herpesvirus Infection in Populations of Australian Marsupials

    Science.gov (United States)

    Stalder, Kathryn; Vaz, Paola K.; Gilkerson, James R.; Baker, Rupert; Whiteley, Pam; Ficorilli, Nino; Tatarczuch, Liliana; Portas, Timothy; Skogvold, Kim; Anderson, Garry A.; Devlin, Joanne M.

    2015-01-01

    Herpesviruses have been reported in several marsupial species, but molecular classification has been limited to four herpesviruses in macropodids, a gammaherpesvirus in two antechinus species (Antechinus flavipes and Antechinus agilis), a gammaherpesvirus in a potoroid, the eastern bettong (Bettongia gaimardi) and two gammaherpesviruses in koalas (Phascolarctos cinereus). In this study we examined a range of Australian marsupials for the presence of herpesviruses using molecular and serological techniques, and also assessed risk factors associated with herpesvirus infection. Our study population included 99 koalas (Phascolarctos cinereus), 96 eastern grey kangaroos (Macropus giganteus), 50 Tasmanian devils (Sarcophilus harrisii) and 33 common wombats (Vombatus ursinius). In total, six novel herpesviruses (one alphaherpesvirus and five gammaherpesviruses) were identified in various host species. The overall prevalence of detection of herpesvirus DNA in our study population was 27.2% (95% confidence interval (CI) of 22.6–32.2%), but this varied between species and reached as high as 45.4% (95% CI 28.1–63.7%) in common wombats. Serum antibodies to two closely related macropodid herpesviruses (macropodid herpesvirus 1 and 2) were detected in 44.3% (95% CI 33.1–55.9%) of animals tested. This also varied between species and was as high as 92% (95% CI 74.0–99.0%) in eastern grey kangaroos. A number of epidemiological variables were identified as positive predictors for the presence of herpesvirus DNA in the marsupial samples evaluated. The most striking association was observed in koalas, where the presence of Chlamydia pecorum DNA was strongly associated with the presence of herpesvirus DNA (Odds Ratio = 60, 95% CI 12.1–297.8). Our results demonstrate the common presence of herpesviruses in Australian marsupials and provide directions for future research. PMID:26222660

  9. [Niche and interspecific association of the dominant fish in the south coastal waters of Wenzhou, China].

    Science.gov (United States)

    Dong, Jing Rui; Shui, Bo Nian; Hu, Cheng Ye; Shui, Yu Yue; DU, Xiao; Tian, Kuo

    2017-05-18

    The studies about the niche and interspecific association in China were mainly focused on the plants, birds and marine animals, and seldom on fish. Based on the fishery resources survey in spring (May) and autumn (September) in 2015, the associations among major fish species in south coastal waters of Wenzhou were investigated. The methods including niche breadth, niche overlap, variance ratio (VR), Χ 2 -test, association coefficient (AC), percentage of co-occurrence (PC) and point correlation coefficients (Ф) were used. The results showed that 47 fish species were identified, including 9 orders, 27 families and 41 genera. Four species were dominant species and 9 were important species, which together accounted for 17%. The niche breadth cluster analysis demonstrated two clearly identifiable ecological niches. The first one referred to wide niche that included Harpodon nehereus, Collichthys lucidus, Engraulis japonicas, Pampus echinogaster, Argyrosomus argentatus, Polynemus sextarius, Decapterus maruadsi and Trichiurus haumela, and the second one was narrow niche that included Muraenesox cinereus, Amblychaeturichthys hexanema, Cunoglossus robustus, Pseudosciaena polyactis and Ilisha elongate. The niche overlap value of the main fish was 0-0.90, indicating that there was difference in the resource utilization among the species. The ecological niche widths of C. robustus and M. cinereus were narrow, and the overlap values were high. This indicated that there was competition between these two species. The VR analysis revealed significant positive correlation among the main fish species. In view of the advantages of Ф value, which could reduce the impact of the analysis results of Χ 2 -test, AC and PC to the interspecific association, the Ф value method was selected in this study, and the association of 63 couples were positive. Both the interspecific association and ecological niche had different degrees of correlation with the stability of community structure

  10. The use of secondary metabolite profiling in chemotaxonomy of filamentous fungi

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Andersen, Birgitte; Thrane, Ulf

    2008-01-01

    A secondary metabolite is a chemical compound produced by a limited number of fungal species in a genus, an order, or even phylum. A profile of secondary metabolites consists of all the different compounds a fungus can produce on a given substratum and includes toxins, antibiotics and other outwa......, Xylaria and in few basidiomycete genera, but not in Zygomycota and Chytridiomycota. (C) 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved....

  11. New phenyl-ethanediols from the culture broth of Boletus edulis.

    Science.gov (United States)

    Yang, Wan-Qiu; Qin, Xiang-Dong; Shao, Hong-Jun; Fang, Li-Zhen; Wang, Fei; Ding, Zhi-Hui; Dong, Ze-Jun; Liu, Ji-Kai

    2007-04-01

    A new phenyl-ethanediol, (1S)-(4-acetylphenyl)-1, 2-ethanediol (1), and a new natural product, (1S)-(3-ethenylphenyl)-1, 2-ethanediol (2), were isolated from the culture broth of the basidiomycete Boletus edulis together with three related known compounds, 1-(4-ethylphenyl)-1, 2-ethanediol (3), 1-(3-ethylphenyl)-1, 2-ethanediol (4) and 1-(3-formylphenyl)-ethanone (5). Their structures were elucidated by spectroscopic methods including extensive 2D-NMR techniques.

  12. Two New Cyathane Diterpenoids from Mycelial Cultures of the Medicinal Mushroom Hericium erinaceus and the Rare Species, Hericium flagellum

    OpenAIRE

    Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W.; Stadler, Marc; Wittstein, Kathrin

    2018-01-01

    Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF) or (as established more recently) brain-derived neurotrophic factor (BDNF) in cell-based bioassays. The present study reports on the metabolite profiles of a Li...

  13. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus in Southeast Queensland

    Directory of Open Access Journals (Sweden)

    Emily Burton

    2016-09-01

    Full Text Available Koala populations in southeast Queensland are under threat from many factors, particularly habitat loss, dog attack, vehicle trauma and disease. Animals not killed from these impacts are often rescued and taken into care for rehabilitation, and eventual release back to the wild if deemed to be healthy. This study investigated current rescue, rehabilitation and release data for koalas admitted to the four major wildlife hospitals in southeast Queensland (Australia Zoo Wildlife Hospital (AZWH, Currumbin Wildlife Sanctuary Hospital (CWH, Moggill Koala Hospital (MKH and the Royal Society for the Prevention Against Cruelty to Animals Wildlife Hospital at Wacol (RSPCA, and suggests aspects of the practice that may be changed to improve its contribution to the preservation of the species. It concluded that: (a the main threats to koalas across southeast Queensland were related to urbanization (vehicle collisions, domestic animal attacks and the disease chlamydiosis; (b case outcomes varied amongst hospitals, including time spent in care, euthanasia and release rates; and (c the majority (66.5% of rescued koalas were either euthanized or died in care with only 27% released back to the wild. The results from this study have important implications for further research into koala rescue and rehabilitation to gain a better understanding of its effectiveness as a conservation strategy.

  14. Activity patterns of free-ranging koalas (Phascolarctos cinereus revealed by accelerometry.

    Directory of Open Access Journals (Sweden)

    Michelle A Ryan

    Full Text Available An understanding of koala activity patterns is important for measuring the behavioral response of this species to environmental change, but to date has been limited by the logistical challenges of traditional field methodologies. We addressed this knowledge gap by using tri-axial accelerometer data loggers attached to VHF radio collars to examine activity patterns of adult male and female koalas in a high-density population at Cape Otway, Victoria, Australia. Data were obtained from 27 adult koalas over two 7-d periods during the breeding season: 12 in the early-breeding season in November 2010, and 15 in the late-breeding season in January 2011. Multiple 15 minute observation blocks on each animal were used for validation of activity patterns determined from the accelerometer data loggers. Accelerometry was effective in distinguishing between inactive (sleeping, resting and active (grooming, feeding and moving behaviors. Koalas were more active during the early-breeding season with a higher index of movement (overall dynamic body acceleration [ODBA] for both males and females. Koalas showed a distinct temporal pattern of behavior, with most activity occurring from mid-afternoon to early morning. Accelerometry has potential for examining fine-scale behavior of a wide range of arboreal and terrestrial species.

  15. Multifarious activities of cellulose degrading bacteria from Koala (Phascolarctos cinereus) faeces.

    Science.gov (United States)

    Singh, Surender; Thavamani, Palanisami; Megharaj, Mallavarapu; Naidu, Ravi

    2015-01-01

    Cellulose degrading bacteria from koala faeces were isolated using caboxymethylcellulose-Congo red agar, screened in vitro for different hydrolytic enzyme activities and phylogenetically characterized using molecular tools. Bacillus sp. and Pseudomonas sp. were the most prominent bacteria from koala faeces. The isolates demonstrated good xylanase, amylase, lipase, protease, tannase and lignin peroxidase activities apart from endoglucanase activity. Furthermore many isolates grew in the presence of phenanthrene, indicating their probable application for bioremediation. Potential isolates can be exploited further for industrial enzyme production or in bioremediation of contaminated sites.

  16. Activity patterns of free-ranging koalas (Phascolarctos cinereus) revealed by accelerometry.

    Science.gov (United States)

    Ryan, Michelle A; Whisson, Desley A; Holland, Greg J; Arnould, John P Y

    2013-01-01

    An understanding of koala activity patterns is important for measuring the behavioral response of this species to environmental change, but to date has been limited by the logistical challenges of traditional field methodologies. We addressed this knowledge gap by using tri-axial accelerometer data loggers attached to VHF radio collars to examine activity patterns of adult male and female koalas in a high-density population at Cape Otway, Victoria, Australia. Data were obtained from 27 adult koalas over two 7-d periods during the breeding season: 12 in the early-breeding season in November 2010, and 15 in the late-breeding season in January 2011. Multiple 15 minute observation blocks on each animal were used for validation of activity patterns determined from the accelerometer data loggers. Accelerometry was effective in distinguishing between inactive (sleeping, resting) and active (grooming, feeding and moving) behaviors. Koalas were more active during the early-breeding season with a higher index of movement (overall dynamic body acceleration [ODBA]) for both males and females. Koalas showed a distinct temporal pattern of behavior, with most activity occurring from mid-afternoon to early morning. Accelerometry has potential for examining fine-scale behavior of a wide range of arboreal and terrestrial species.

  17. Orchitis and Epididymitis in Koalas (Phascolarctos cinereus) Infected With Chlamydia pecorum.

    Science.gov (United States)

    Johnston, S D; Deif, H H; McKinnon, A; Theilemann, P; Griffith, J E; Higgins, D P

    2015-11-01

    Although Chlamydia causes disease of the urethra and prostate of male koalas, its impact on the testis and epididymis has not been examined. This study describes chronic-active and granulomatous orchitis and epididymitis with interstitial fibrosis associated with infection by Chlamydia pecorum in 2 of 18 adult male koalas being euthanized at a koala hospital, 8 of which also had chlamydial prostatitis. By immunohistochemistry and transmission electron microscopy, chlamydial inclusions were demonstrated within Sertoli cells directly associated with mild inflammation surrounding intact seminiferous and epididymal tubules, marked pyogranulomatous inflammation around disrupted tubules, replacement of tubules by interstitial fibrosis, and aspermia. The presence of C. pecorum but not Chlamydia pneumoniae was detected by quantitative polymerase chain reaction of formalin-fixed tissues of the left and right testes and right epididymis in 1 animal. This is the first report of orchitis and epididymitis in a koala infected with C. pecorum. © The Author(s) 2015.

  18. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus) in Southeast Queensland.

    Science.gov (United States)

    Burton, Emily; Tribe, Andrew

    2016-09-15

    Koala populations in southeast Queensland are under threat from many factors, particularly habitat loss, dog attack, vehicle trauma and disease. Animals not killed from these impacts are often rescued and taken into care for rehabilitation, and eventual release back to the wild if deemed to be healthy. This study investigated current rescue, rehabilitation and release data for koalas admitted to the four major wildlife hospitals in southeast Queensland (Australia Zoo Wildlife Hospital (AZWH), Currumbin Wildlife Sanctuary Hospital (CWH), Moggill Koala Hospital (MKH) and the Royal Society for the Prevention Against Cruelty to Animals Wildlife Hospital at Wacol (RSPCA)), and suggests aspects of the practice that may be changed to improve its contribution to the preservation of the species. It concluded that: (a) the main threats to koalas across southeast Queensland were related to urbanization (vehicle collisions, domestic animal attacks and the disease chlamydiosis); (b) case outcomes varied amongst hospitals, including time spent in care, euthanasia and release rates; and (c) the majority (66.5%) of rescued koalas were either euthanized or died in care with only 27% released back to the wild. The results from this study have important implications for further research into koala rescue and rehabilitation to gain a better understanding of its effectiveness as a conservation strategy.

  19. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.

    1996-05-01

    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  20. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  1. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.

    2009-01-01

    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  2. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  3. Effects of some added carbohydrates on cellulases and ligninase and decomposition of whole bagasse

    Energy Technology Data Exchange (ETDEWEB)

    Nigam, P; Prabhu, K A

    1986-01-01

    Two basidiomycetes mould isolates were studied for the production of extracellular cellulases and ligninase in submerged shake culture using whole bagasse as substrate. The effects of some added carbohydrates on enzyme production, substrate decomposition and biomass formation were examined. In both cultures the addition of lactose stimulated biomass production and increased the decomposition of total carbohydrate and lignin contents of bagasse. Lactose was the only sugar which stimulated cellulase and ligninase in both cultures. 19 references.

  4. Bioconcentration of manganese and iron in Panaeoloideae Sing

    OpenAIRE

    Stijve, T.; Blake, C.

    1994-01-01

    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae, as demonstrated by the analysis of 44 collections representing 15 taxons. Carpophores generally contain between 250 and 2500 mg/kg on dry weight, and, with the notable exception of Panaeolus semiova...

  5. Test of Lignin and Cellulose Decomposition and Phosphate Solubilization by Soil Fungi of Gunung Halimun

    OpenAIRE

    Suciatmih, Suciatmih

    2001-01-01

    In order to know the capability of lignin and cellulose degradation and phosphate solubilization by soil fungi of Gunung Halimun National Park, a study was carried out to qualitatively analyse its physiological properties. Out of 35 soil fungi tested, 1 species that belonged to Basidiomycetes degraded lignin, 32 species degraded cellulose, and 31 species dissolved inorganic phosphate.The presence of soil fungi that degraded cellulose and dissolved phosphate could be used as a candidate for bi...

  6. On 210Pb and 90Sr migration in terrestrial biogeocenoses

    International Nuclear Information System (INIS)

    Dushanskene-Duzh, R.F.; Urbonas, V.A.

    1978-01-01

    The 90 Sr and 210 Pb accumulation in various types of topsoil and in mushrooms (genera Boletus, Calocybe, Coprinus, Lactarius, Paxillus, Rozites, Russula and others) has been studied in pine forests of Lithuania. The 210 Pb content was found to depend mostly on the composition of topsoil and the abundance of vegetation, the average concentration being 3600 pCi/kg weight of soil. When the vegetation is abundant, the 210 Pb average concentration increases up to 8600 pCi/kg. The 90 Sr average concentration equals 1430 pCi/kg. In soddy-podzol soils with well-developed grass cover this concentration can be as high as 2900 pCi/kg. The 210 Pb average concentration in the mushroom species studied is 35 pCi/kg irrespective of the soil concentration of this isotope. The 90 Sr concentration in the mycothallus of mushrooms, on the contrary, is directly related to the radionuclide concentration in the substrate and averages 60 pCi/kg of the whole weight. The 210 Sr accumulation is shown to be a function of location and mushroom species

  7. Radioactivity levels in mushrooms collected in the area of Karlsruhe during 1987 and 1988

    International Nuclear Information System (INIS)

    Rueckert, G.; Diehl, J.F.; Heilgeist, M.

    1990-01-01

    Radioactive contamination of wild-growing mushrooms collected in the Northern Black Forest and neighbouring Rhine Valley area has been monitored since the Chernobyl reactor accident. Cs-134, Cs-137, Ag-110m and the natural nuclide K-40 were determined by gamma-spectrometry. Pooled data from all species and all locations showed a decrease in the radio-caesium levels from 1986 to 1988, both in mean values and maximum values. Samples of the same species collected at the same location exhibited large differences, although mixed samples rather than individual mushrooms were measured. Accumulation of caesium was observed particularly in Laccaria amethystina, Xerocomus badius, Xerocomus chrysenteron, Cantharellus tubaeformis, Laccaria laccata, and Russula ochroleuca, with maximum values of 3600 (1986), 2000 (1987), and 1200 (1988) Bq/kg of radio-caesium. A large number of species, among them Calocybe gambosa and Coprinus comatus, showed very small accumulations or no caesium. An accumulation of silver was found in Macrolepiota rhacodes and Agaricus arvensis, which contained a maximum of 11 Bq/kg Ag-110m. (orig.) [de

  8. First Collection and Identification of Wild Mushrooms in Western Iraq

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2014-04-01

    Full Text Available Fungi are found everywhere and affect our lives every day from mushroom to industrially important product, plant helpers, plant pathogens and to human diseases. Therefore, we concentrated our attention on fungi that can be grown in our environment, while maintaining an interest in their performance in nature. About fifteen different species were collected and identified from different villages of Heet district, Anbar province, Iraq. Out of the fifteen, two species, naming Armillaria mellea and Coprinus disseminates were identified as species level and others: Pleurotus spp., Agaricus spp., Calvatia sp., Telephora sp., Fomes sp., Lepiota sp. and Morchella sp. as genus level only. This study was aimed to collect and identify wild mushrooms that grow naturally in different orchards and gardens on 2009-2013 in Heet city. A total of 15 species in 9 genera, 9 families and 5 orders belong to woody and fleshy species were identified for the first time in Anbar province. The collected mushrooms were appearing from November to February of each year.

  9. Cultivation of shear stress sensitive microorganisms in disposable bag reactor systems.

    Science.gov (United States)

    Jonczyk, Patrick; Takenberg, Meike; Hartwig, Steffen; Beutel, Sascha; Berger, Ralf G; Scheper, Thomas

    2013-09-20

    Technical scale (≥5l) cultivations of shear stress sensitive microorganisms are often difficult to perform, as common bioreactors are usually designed to maximize the oxygen input into the culture medium. This is achieved by mechanical stirrers, causing high shear stress. Examples for shear stress sensitive microorganisms, for which no specific cultivation systems exist, are many anaerobic bacteria and fungi, such as basidiomycetes. In this work a disposable bag bioreactor developed for cultivation of mammalian cells was investigated to evaluate its potential to cultivate shear stress sensitive anaerobic Eubacterium ramulus and shear stress sensitive basidiomycetes Flammulina velutipes and Pleurotus sapidus. All cultivations were compared with conventional stainless steel stirred tank reactors (STR) cultivations. Good growth of all investigated microorganisms cultivated in the bag reactor was found. E. ramulus showed growth rates of μ=0.56 h⁻¹ (bag) and μ=0.53 h⁻¹ (STR). Differences concerning morphology, enzymatic activities and growth in fungal cultivations were observed. In the bag reactor growth in form of small, independent pellets was observed while STR cultivations showed intense aggregation. F. velutipes reached higher biomass concentrations (21.2 g l⁻¹ DCW vs. 16.8 g l⁻¹ DCW) and up to 2-fold higher peptidolytic activities in comparison to cell cultivation in stirred tank reactors. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  11. In memoriam Rudolf Arnold Maas Geesteranus Den Haag, 20 january 1911-Oegstgeest, 18 may 2003

    OpenAIRE

    NN

    2003-01-01

    On 18 May 2003 Rudolf Maas Geesteranus died peacefully at the age of 92. With him the mycological world has lost a remarkable and versatile personality, who worked on the taxonomy of fungi for almost 60 years producing papers and books on a wide range of topics, including both asco- and basidiomycetes. The bibliographical notes and publication list printed in this journal on his retirement from active service at the Rijksherbarium in 1976, and on his eightieth birthday in 1991 (Bas, Persoonia...

  12. Nunamycin and Nunapeptin: Two novel cyclic peptides are key components of the antimicrobial activity of the Greenlandic isolate Pseudomonas fluorescens In5

    DEFF Research Database (Denmark)

    Hennessy, Rosanna Catherine; Phippen, Christopher; Nielsen, Kristian F.

    Pseudomonas spp. are a rich source of secondary metabolites including bioactive non-ribosomal peptides (NRPs) and polyketides. NRPs are synthesised in large assembly lines by multi-domain modular enzymes known as NRP-synthetases (NRPS). Nunamycin and nunapeptin are two cyclic NRPs synthesised...... by the Greenlandic isolate P. fluorescens In5. Nunamycin shows antifungal activity against the basidiomycete Rhizoctonia solani whereas the only partially structure elucidated nunapeptin appears most active against the ascomycete Fusarium graminearum and the oomycete Pythium aphanidermatum. Originally isolated from...

  13. Overproduction of ligninolytic enzymes

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  14. Pharmacokinetics of posaconazole in koalas (Phascolarctos cinereus) after intravenous and oral administration.

    Science.gov (United States)

    Gharibi, S; Kimble, B; Vogelnest, L; Barnes, J; Stadler, C K; Govendir, M

    2017-12-01

    The pharmacokinetic profile of posaconazole in clinically normal koalas (n = 8) was investigated. Single doses of posaconazole were administered intravenously (i.v.; 3 mg/kg; n = 2) or orally (p.o.; 6 mg/kg; n = 6) with serial plasma samples collected over 24 and 36 hr, respectively. Plasma concentrations of posaconazole were quantified by validated high-performance liquid chromatography. A noncompartmental pharmacokinetic analysis of data was performed. Following i.v. administration, estimates of the median (range) of plasma clearance (CL) and steady-state volume of distribution (V ss ) were 0.15 (0.13-0.18) L hr -1  kg -1 and 1.23 (0.93-1.53) L/kg, respectively. The median (range) elimination half-life (t 1/2 ) after i.v. and p.o. administration was 7.90 (7.62-8.18) and 12.79 (11.22-16.24) hr, respectively. Oral bioavailability varied from 0.43 to 0.99 (median: 0.66). Following oral administration, maximum plasma concentration (C max ; median: 0.72, range: 0.55-0.93 μg/ml) was achieved in 8 (range 6-12) hr. The in vitro plasma protein binding of posaconazole incubated at 37°C was 99.25 ± 0.29%. Consideration of posaconazole pharmacokinetic/pharmacodynamic (PK/PD) targets for some yeasts such as disseminated candidiasis suggests that posaconazole could be an efficacious treatment for cryptococcosis in koalas. © 2017 John Wiley & Sons Ltd.

  15. Pharmacokinetics of fluconazole following intravenous and oral administration to koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Black, L A; Krockenberger, M B; Kimble, B; Govendir, M

    2014-02-01

    Clinically normal koalas (n = 12) received a single dose of 10 mg/kg fluconazole orally (p.o.; n = 6) or intravenously (i.v.; n = 6). Serial plasma samples were collected over 24 h, and fluconazole concentrations were determined using a validated HPLC assay. A noncompartmental pharmacokinetic analysis was performed. Following i.v. administration, median (range) plasma clearance (CL) and steady-state volume of distribution (Vss ) were 0.31 (0.11-0.55) L/h/kg and 0.92 (0.38-1.40) L/kg, respectively. The elimination half-life (t1/2 ) was much shorter than in many species (i.v.: median 2.25, range 0.98-6.51 h; p.o.: 4.69, range 2.47-8.01 h), and oral bioavailability was low and variable (median 0.53, range 0.20-0.97). Absorption rate-limited disposition was evident. Plasma protein binding was 39.5 ± 3.5%. Although fluconazole volume of distribution (Varea ) displayed an allometric relationship with other mammals, CL and t1/2 did not. Allometrically scaled values were approximately sevenfold lower (CL) and sixfold higher (t1/2 ) than observed values, highlighting flaws associated with this technique in physiologically distinct species. On the basis of fAUC/MIC pharmacodynamic targets, fluconazole is predicted to be ineffective against Cryptococcus gattii in the koala as a sole therapeutic agent administered at 10 mg/kg p.o. every 12 h. © 2013 John Wiley & Sons Ltd.

  16. Fungal cellulases as an aid for the saccharification of cassava

    Energy Technology Data Exchange (ETDEWEB)

    De Menezes, T J.B.; Arakaki, T; DeLamo, P R; Sales, A M

    1978-04-01

    Culture broths of cellulolytic fungi were used together with commercial anylases to enhance the saccharification of cassava starch slurry. It was found that the addition of appropriate concentration of the cellulases Trichoderma viride and a soil isolated Basidiomycete, increased both the rate of sugar formation and the degree of solubilization, and decreased the viscosity of the hydrolyzates. Owing to the improvement of the rheological properties of the must, and the additional sugar produced, an increased ethanol yield would be expected from the alcoholic fermentation of this hydrolyzate.

  17. Biology stage of Moniliophthora roreri in Colombia

    OpenAIRE

    Correa Álvarez, Javier; Castro Martínez, Sergio; Coy, Jairo

    2014-01-01

    La moniliasis es una enfermedad fúngica que ataca el cultivo de cacao, causada por el basidiomycete Moniliophthora roreri -- Está presente en la mayoría de los países latinoamericanos y se adapta a diversidad de ambientes -- En Colombia la enfermedad es devastadora y las estrategias de control tradicional han generado resultados colaterales como el fortalecimiento de la resistencia genética de cepas del hongo en algunas regiones -- En esta revisión, se recopilan los aspectos biológicos y agro...

  18. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.

    2009-01-01

    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  19. Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.

    Science.gov (United States)

    Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina

    2011-01-01

    Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

  20. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    of their ability to degrade xenobiotic compounds. Owing to extra- cellular non-specific free-radical-based ligninolytic system of WRF, they can completely eliminate a variety of xenobiotics, including synthetic dyes, giving rise to non-toxic compounds (Kuhad et al... and decolorization and ligninolytic enzymes activity was determined in the cell-free supernatant (CS). 2.5 Decolorization Assays The fungal biomass from each 250-ml Erlenmeyer flask was taken after respective incubation period. It was crushed into a paste...

  1. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  2. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1alpha genes.

    Science.gov (United States)

    Voigt, K; Wöstemeyer, J

    2001-05-30

    True fungi (Eumycota) are heterotrophic eukaryotic microorganisms encompassing ascomycetes, basidiomycetes, chytridiomycetes and zygomycetes. The natural systematics of the latter group, Zygomycota, are very poorly understood due to the lack of distinguishing morphological characters. We have determined sequences for the nuclear-encoded genes actin (act) from 82 zygomycetes representing all 54 currently recognized genera from the two zygomycetous orders Mucorales and Mortierellales. We also determined sequences for translation elongation factor EF-1alpha (tef) from 16 zygomycetes (total of 96,837 bp). Phylogenetic analysis in the context of available sequence data (total 2,062 nucleotide positions per species) revealed that current classification schemes for the mucoralean fungi are highly unnatural at the family and, to a large extent, at the genus level. The data clearly indicate a deep, ancient and distinct dichotomy of the orders Mucorales and Mortierellales, which are recognized only in some zygomycete systems. Yet at the same time the data show that two genera - Umbelopsis and Micromucor - previously placed within the Mortierellales on the basis of their weakly developed columella (a morphological structure of the sporangiophore well-developed within all Mucorales) are in fact members of the Mucorales. Phylogenetic analyses of the encoded amino acid sequences in the context of homologues from eukaryotes and archaebacterial outgroups indicate that the Eumycota studied here are a natural group but provide little or no support for the monophyly of either zygomycetes, ascomycetes or basidiomycetes. The data clearly indicate that a complete revision of zygomycete natural systematics is necessary.

  4. Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

    Science.gov (United States)

    Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

    2016-01-01

    Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Application of Chinese Jun-Cao technique for the production of Brazilian Ganoderma lucidum strains

    Directory of Open Access Journals (Sweden)

    Leonardo do Nascimento Rolim

    2014-06-01

    Full Text Available Ganoderma lucidum is a medicinal mushroom traditionally used in China against a wide range of diseases such as cancer and also for its prevention. In this work, commercial Chinese strains G. lucidum were compared to wild Brazilian strains aiming to determine the cultivation potential through the use of Jun-Cao. Six formulations were tested and the strains presented good response to the applied method. In general, the mixture between the grass and wood was well suited for the basidiomycetes, contributing to the preparation of substrates that generated better results in Jun Cao.

  6. Pre-Cretaceous Agaricomycetes yet to be discovered: Reinvestigation of a putative Triassic bracket fungus from southern Germany

    Directory of Open Access Journals (Sweden)

    A. P. Kiecksee

    2012-08-01

    Full Text Available Agaricomycetes are major components of extant terrestrial ecosystems; however, their fruiting bodies are exceedingly rare as fossils. Reinvestigation of a peculiar fossil from Late Triassic sediments of southern Germany interpreted as a bracket fungus revealed that this fossil in fact represents a wood abnormality, resulting from injury to the cambium and subsequent callus growth in a Baieroxylon -like ginkgoalean wood. As a result, the fossil record of the Agaricomycetes does not yet pre-date the Early Cretaceous, suggesting a late diversification of basidiomycetes possessing large fruiting bodies. doi:10.1002/mmng.201200006

  7. Recent advances in the molecular genetics of the lignin degrading fungus, phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Covert, S.F.

    1991-01-01

    During the past several years, molecular genetics research on phanerochaete chrysosporium, a white-rot basidiomycete, has increased dramatically. It is known that families of highly homologous, clustered genes encode the lignin peroxidases. The same appears to be true with the exocellobiohydrolase genes. Functional domains and active sites have been tentatively identified from the deduced amino acid sequences of these genes. Current investigations focus on elucidating the genomic organization of gene families, the mechanism(s) of gene regulation, and the role and interaction of specific gene products in lignocellulose degradation. (author)

  8. Components of the ligninolytic system of Fusarium oxysporum and Trichoderma atroviride

    Energy Technology Data Exchange (ETDEWEB)

    Moenkemann, H.; Hoelker, U.; Hoefer, M. [Universitaet Bonn, Bonn (Germany). Botanisches Institut

    1997-11-01

    The ligninolytic system in the two deuteromycetous fungi Fusarium oxysporum and Trichoderma atroviride, which are able to solubilize low-rank coal, has been proved to have several components. Analysis of the chromosomal DNA of these fungi revealed distinct bands with probes coding for three ligninase isoenzymes, glyoxal oxidase and arylalcohol dehydrogenase of the basidiomycete Phanerochaete chrysosporium. These data constitute a strong indication for the existence in F. oxysporum and T. atroviride of a ligninolytic system comparable to that in P. chrysosporium that may be involved in the process of coal solubilization. 11 refs., 3 figs.

  9. PRODUCCIÓN DE BIOMASA Y EXOPOLISACÁRIDOS DE Grifóla frondosa BAJO CULTIVO SUMERGIDO UTILIZANDO FUENTES DE CARBONO NO CONVENCIONALES

    OpenAIRE

    Zapata, Paula; Rojas, Diego; Fernández, Carlos; Ramírez, David; Restrepo, Gloria; Orjuela, Viviana; Arroyave, Marcela; Gómez, Tatiana; Atehortüa, Lucía

    2007-01-01

    Grifóla frondosa es un hongo Basidiomycete comestible y medicinal que produce polisacáridos tipo glucanos (β-1,6 y β-1,3) con actividad antitumoral e inmunomoduladora. Para el presente trabajo, el objetivo fue evaluar la incidencia de diferentes fuentes de carbono (FC) en la producción de biomasa y exopolisacári-dos (EPS), bajo condiciones de cultivo sumergido, utilizando un diseño estadístico factorial con dos factores: fuente de carbono (FC(1-7)) y medio (MB y MS). La máxima produ...

  10. Estado de la moniliasis del cacao causada por moniliophthora roreri en colombia

    OpenAIRE

    Correa Alvarez, Javier; Castro Martínez, Sergio; Coy, Jairo

    2014-01-01

    La Moniliasis es una enfermedad fúngica que ataca el cultivo de cacao, causada por el basidiomycete Mo-niliophthora roreri. Está presente en la mayoría de los países latinoamericanos y se adapta a diversidad de ambientes. En Colombia la enfermedad es devastadora y las estrategias de control tradicional han generado resultados colaterales como el fortalecimiento de la resistencia genética de cepas del hongo en algunas regiones. En esta revisión, se recopilan los aspectos biológicos y agronó...

  11. An Apple Fruit Fermentation (AFF) Treatment Improves the Composition of the Rhizosphere Microbial Community and Growth of Strawberry (Fragaria × ananassa Duch ‘Benihoppe’) Seedlings

    Science.gov (United States)

    Bu, Yufen; Shao, Wei; Huang, Weijing; Ji, Qianlong; Yao, Yuncong

    2016-01-01

    Plant growth can be promoted by the application of apple fruit fermentation (AFF), despite unclear of the underlying mechanisms, the effects involved in AFF on rhizosphere microorganisms have been hypothesized. We investigated the consequences of applying AFF alone or in combination with Bacillus licheniformis to strawberry tissue culture seedlings in vitro, the analyses of Denaturing Gradient Gel Electrophoresis (DGGE) and 16S rDNA were performed to determine AFF effects on rhizosphere. Moreover, the growth index and antioxidant enzyme activities were determined 30 days after treatments. We identified five dominant bacteria in AFF: Coprinus atramentarius, Bacillus megaterium, Bacillus licheniformis, Weissella and B. subtilis. The greatest number of bacterial species were observed in the rhizosphere of control matrix (water treated), and the lowest diversity appeared in the rhizosphere soil treated with 108 cfu/mL B. licheniformis alone. Combining AFF plus B. licheniformis in one treatment resulted in the largest leaf area, plant height, root length, plant weight, and the markedly higher activities of antioxidant enzymes. We conclude that a combination of AFF plus B. licheniformis treatment to matrix can increase antioxidant enzymes activities in strawberry seedlings, optimize the status of rhizosphere microbial, and promote plant growth. PMID:27755580

  12. Identification of medicinal and poisonous mushroom from Khorramabad, Iran

    Directory of Open Access Journals (Sweden)

    seyede zahra Hosseini

    2010-03-01

    Full Text Available Mushrooms grow in a very wide range of ecological conditions, however their growth vary in different conditions. Mushrooms are a valuable source for antibiotics and they are known as drugs in traditional medicine. Identification and characterization of mushrooms is the first step of their exploitations in drug industry. There are many poisonous species of mushrooms, so their identification is essential for better health of societies and also a good indication for physicians in identification of mushroom poisonings and their cure. Material and Method: In this research the samples of mushroom were collected in Khorramabad district during spring and fall of 2008 and 2009. The macroscopic and microscopic characters of collected mushrooms were observed in field and laboratory and these criteria aligned to the species characters in scientific resources. Results: eight mushroom species namely Collybia maculate coprinus atramentarius three species of Boletus (B. luridus, B. felleus and B. satanas two species of Lactarius (L. piperatus and L. vellereus and Hypholoma capnoides were identified . Discussions: Based on the results of biodiversity of mushrooms in khorramabad district found in the present research, it is concluded that there are valuable resources of mushrooms for medicinal purposes in this area.

  13. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Quintin Lau

    2014-06-01

    Full Text Available Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60 are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII alleles or genotypes, and higher c-hsp 60 antibody levels or chlamydia-associated disease and infertility. In this study, we characterised partial MHCII DAB and DBB genes in female koalas (n = 94 from a single geographic population, and investigated associations among antibody responses to c-hsp60 quantified by ELISA, susceptibility to chlamydial infection, or age. The identification of three candidate MHCII variants provides additional support for the functional role of MHCII in the koala, and will inform more focused future studies. This is the first study to investigate an association between MHC genes with chlamydial pathogenesis in a non-model, free-ranging species.

  14. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus)

    Science.gov (United States)

    2011-01-01

    Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58), we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP) were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine-detailed molecular marker for epidemiological analysis appears justified, the tarP and ORF663 genes also appear to be valuable markers of phylogenetic or biogeographic divisions at the C. pecorum intra-species level. This research has significant implications for future typing studies to understand the phylogeny, genetic diversity, and epidemiology of C. pecorum infections in the koala and other animal species. PMID:21496349

  15. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus)

    OpenAIRE

    Lau, Quintin; Griffith, Joanna E.; Higgins, Damien P.

    2014-01-01

    Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60) are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII) alleles or genotypes, and higher c-hsp 60 antibody levels or c...

  16. Assessment of florfenicol as a possible treatment for chlamydiosis in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Budd, C; Flanagan, C; Gillett, A; Hanger, J; Loader, J J; Govendir, M

    2017-09-01

    Because of limited availability of chloramphenicol to veterinary suppliers, a preliminary study was performed to predict whether an analogue, florfenicol, is an efficacious treatment for chlamydiosis in koalas. Florfenicol was administered to koalas with naturally occurring chlamydiosis at 20 mg/kg SC (n = 3) and at 5 mg/kg (n = 3) and 10 mg/kg (n = 3) IV. The estimated areas under the plasma concentration versus time curves (AUC) were compared with the minimum inhibitory concentration to inhibit Chlamydia pecorum. Clinical data were also examined from field trials conducted on koalas (n = 19) with naturally occurring chlamydiosis and treated with florfenicol at a range of dosages (5-20 mg/kg SC and 6-15 mg/kg IV). Florfenicol binding to proteins in plasma was also determined. Florfenicol was not detectable in plasma 24 h post-administration at 20 mg/kg SC. The estimated AUC 0-24 h following administration at 10 mg/kg IV suggests florfenicol might be effective against Chlamydia spp. via this route. Florfenicol binding to plasma proteins was 13.0% (± 0.30 SEM). After treatment with florfenicol in field trials, 5 of 19 koalas (26%) were released without further treatment, 4 with no long-term follow-up; 6 (32%) required additional treatment with chloramphenicol to resolve chlamydiosis; 7 (36%) failed to clinically improve, of which 3 had clinical signs and/or necropsy findings suggestive of antibiotic-related gastrointestinal dysbiosis; another koala died within minutes of florfenicol administered IV at 7 mg/kg. When administered at dosages tolerable in the field, florfenicol is a problematic treatment for chlamydiosis based on equivocal outcomes and plasma concentrations below those that inhibit the pathogen. © 2017 Australian Veterinary Association.

  17. Pharmacokinetics of meloxicam in koalas (Phascolarctos cinereus) after intravenous, subcutaneous and oral administration.

    Science.gov (United States)

    Kimble, B; Black, L A; Li, K M; Valtchev, P; Gilchrist, S; Gillett, A; Higgins, D P; Krockenberger, M B; Govendir, M

    2013-10-01

    The pharmacokinetic profile of meloxicam in clinically healthy koalas (n = 15) was investigated. Single doses of meloxicam were administered intravenously (i.v.) (0.4 mg/kg; n = 5), subcutaneously (s.c.) (0.2 mg/kg; n = 1) or orally (0.2 mg/kg; n = 3), and multiple doses were administered to two groups of koalas via the oral or s.c. routes (n = 3 for both routes) with a loading dose of 0.2 mg/kg for day 1 followed by 0.1 mg/kg s.i.d for a further 3 days. Plasma meloxicam concentrations were quantified by high-performance liquid chromatography. Following i.v. administration, meloxicam exhibited a rapid clearance (CL) of 0.44 ± 0.20 (SD) L/h/kg, a volume of distribution at terminal phase (Vz ) of 0.72 ± 0.22 L/kg and a volume of distribution at steady state (Vss ) of 0.22 ± 0.12 L/kg. Median plasma terminal half-life (t(1/2)) was 1.19 h (range 0.71-1.62 h). Following oral administration either from single or repeated doses, only maximum peak plasma concentration (C(max) 0.013 ± 0.001 and 0.014 ± 0.001 μg/mL, respectively) was measurable [limit of quantitation (LOQ) >0.01 μg/mL] between 4-8 h. Oral bioavailability was negligible in koalas. Plasma protein binding of meloxicam was ~98%. Three meloxicam metabolites were detected in plasma with one identified as the 5-hydroxy methyl derivative. This study demonstrated that koalas exhibited rapid CL and extremely poor oral bioavailability compared with other eutherian species. Accordingly, the currently recommended dose regimen of meloxicam for this species appears inadequate. © 2013 John Wiley & Sons Ltd.

  18. A Survey of Pesticide Accumulation in a Specialist Feeder, the Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Marschner, Caroline; Higgins, Damien P; Krockenberger, Mark B

    2017-09-01

    To maintain profitability in Australia's agricultural and urban landscapes pesticides are used throughout the range of koala habitats. The koala is a specialist feeder, reliant on metabolic enzyme capacities to utilise a toxic diet of eucalypt leaves and is potentially prone to adverse effects when xenobiotic interactions between dietary and anthropogenic xenobiotics occur. The aim of this study was to investigate accumulation of frequently used pesticides in wild koalas in 4 areas of New South Wales and Queensland. Liver samples of 57 deceased koalas were collected from care facilities and analysed using a modified QuEChERS extraction method followed by GCMSMS, HRLCMS and LCMSMS. No accumulation of any of the 166 investigated pesticides was found. Data indicate hepatic accumulation of pesticides in this species is uncommon even with close interactions with intensive land use. Despite the lack of hepatic bioaccumulation, this study cannot exclude a direct effect on hepatocellular metabolic pathways.

  19. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Timms Peter

    2011-04-01

    Full Text Available Abstract Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58, we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine-detailed molecular marker for epidemiological analysis appears justified, the tarP and ORF663 genes also appear to be valuable markers of phylogenetic or biogeographic divisions at the C. pecorum intra-species level. This research has significant implications for future typing studies to understand the phylogeny, genetic diversity, and epidemiology of C. pecorum infections in the koala and other animal species.

  20. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Lau, Quintin; Griffith, Joanna E; Higgins, Damien P

    2014-01-01

    Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60) are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII) alleles or genotypes, and higher c-hsp 60 antibody levels or chlamydia-associated disease and infertility. In this study, we characterised partial MHCII DAB and DBB genes in female koalas (n = 94) from a single geographic population, and investigated associations among antibody responses to c-hsp60 quantified by ELISA, susceptibility to chlamydial infection, or age. The identification of three candidate MHCII variants provides additional support for the functional role of MHCII in the koala, and will inform more focused future studies. This is the first study to investigate an association between MHC genes with chlamydial pathogenesis in a non-model, free-ranging species.