WorldWideScience

Sample records for basidiomycete coprinus cinereus

  1. Magnetic resonance spectral characterization of the heme active site of Coprinus cinereus peroxidase

    International Nuclear Information System (INIS)

    Lukat, G.S.; Rodgers, K.R.; Jabro, M.N.; Goff, H.M.

    1989-01-01

    Examination of the peroxidase isolated from the inkcap Basidiomycete Coprinus cinereus shows that the 42,000-dalton enzyme contains a protoheme IX prosthetic group. Reactivity assays and the electronic absorption spectra of native Coprinus peroxidase and several of its ligand complexes indicate that this enzyme has characteristics similar to those reported for horseradish peroxidase. In this paper, the authors characterize the H 2 O 2 -oxidized forms of Coprinus peroxidase compounds I, II, and III by electronic absorption and magnetic resonance spectroscopies. Electron paramagnetic resonance (EPR) and nuclear magnetic resonance (NMR) studies of this Coprinus peroxidase indicate the presence of high-spin Fe(III) in the native protein and a number of differences between the heme site of Coprinus peroxidase and horseradish peroxidase. Carbon-13 (of the ferrous CO adduct) and nitrogen-15 (of the cyanide complex) NMR studies together with proton NMR studies of the native and cyanide-complexed Caprinus peroxidase are consistent with coordination of a proximal histidine ligand. The EPR spectrum of the ferrous NO complex is also reported. Protein reconstitution with deuterated hemin has facilitated the assignment of the heme methyl resonances in the proton NMR spectrum

  2. Production and characterization of radiation-sensitive meiotic mutants of Coprinus cinereus

    International Nuclear Information System (INIS)

    Zolan, M.E.; Tremel, C.J.; Pukkila, P.J.

    1988-01-01

    We have isolated four gamma-sensitive mutants of the basidiomycete Coprinus cinereus. When homozygous, two of these (rad 3-1 and rad 9-1) produce fruiting bodies with very few viable basidiospores, the products of meiosis in this organism. A less radiation-sensitive allele of RAD 3, rad 3-2, causes no apparent meiotic defect in homozygous strains. Quantitative measurements of oidial survival of rad 3-1;rad 9-1 double mutants compared to the single mutants indicated that rad 3-1 and rad 9-1 mutants are defective in the same DNA repair pathway. In the pew viable basidiospores that are produced by these two strains, essentially normal levels of meiotic recombination can be detected. None of the mutants exhibits increased sensitivity to UV radiation. Cytological examination of meiotic chromosomes from mutant and wild-type fruiting bodies showed that rad 3-1 homozygous strains fail to condense and pair homologous chromosomes during prophase I. Although rad 9-1 strains are successful at chromosome pairing, meiosis is usually not completed in these mutants

  3. Decolorization of the anthraquinone dye Cibacron Blue 3G-A with immobilized Coprinus cinereus in fluidized bed bioreactor.

    Science.gov (United States)

    Moutaouakkil, A; Blaghen, M

    2011-01-01

    Coprinus cinereus, which was able to decolorize the anthraquinone dye Cibacron Blue 3G-A (CB) enzymatically, was used as a biocatalyst for the decolorization of synthetic solutions containing this reactive dye. Coprinus cinereus was immobilized in both calcium alginate and polyacrylamide gels, and was used for the decolorization of CB from synthetic water by using a fluidized bed bioreactor. The highest specific decolorization rate was obtained when Coprinus cinereus was entrapped in calcium alginate beads, and was of about 3.84 mg g(-1) h(-1) with a 50% conversion time (t1/2) of about 2.60 h. Moreover, immobilized fungal biomass in calcium alginate continuously decolorized CB even after 7 repeated experiments without significant loss of activity, while polyacrylamide-immobilized fungal biomass retained only 67% of its original activity. The effects of some physicochemical parameters such as temperature, pH and dye concentration on decolorization performance of isolated fungal strain were also investigated.

  4. Mapping genes by meiotic and UV-induced mitotic recombination in Coprinus cinereus

    International Nuclear Information System (INIS)

    Amirkhanian, J.D.; Cowan, J.W.

    1985-01-01

    Three morphological mutants in Coprinus cinereus—one spontaneous (den-2) and two chemically induced (zigand sta)—were assigned to linkage groups and utilized in meiotic and mitotic mapping. Mutants den-2 and zig belong to linkage group III, den-2 being close to the centromere and about 20 map units (mu) from zig. The mutant sta in linkage group ‘G’ is at a distance of about 37 mu from ade-3. Mitotic mapping confirmed the gene order in linkage group III and provided evidence that trp-2 in linkage group ‘G’ was between the centromere and ade-3. These morphological mutants are compact in colony growth and therefore suited to high-density plating. The rarity of spontaneously occurring mitotic segregants suggests that diploids of Coprinus cinereus, heterozygous for morphoiogical markers in repuision, could serve as useful test systems for rapid screening of chemical mutagen/carcinogens via mitotic recombination studies

  5. Optimization of cultivation conditions of fermented shaggy ink cap culinary-medicinal mushroom, Coprinus comatus (O.Mull.:Fr.) Pers. (higher Basidiomycetes) rich in Vanadium.

    Science.gov (United States)

    Zhang, Chunjing; Qi, Xiaodan; Shi, Yan; Sun, Yan; Li, Shuyan; Gao, Xiulan; Yu, Haitao

    2012-01-01

    The present paper is mainly aimed at optimization of cultivation conditions of fermented mushrooms of Coprinus comatus rich in vanadium (CCRV). Initial screening of effects of carbon source, temperature, pH, and inoculum size were done by using a one-factor-at-a-time method. The results obtained in that study showed that the optimal medium composition was 30 g glucose/Lin YEPG medium, initial pH 6.0, inoculum volume 10%, and incubation time 120 h. Then the medium was subjected to screening of the most significant parameters using the L9 orthogonal array to solve multivariable equations simultaneously. The results obtained in this study showed that the optimal medium composition was 0.4% V and 30 g glucose/Lin YEPG medium, initial pH 5.0, inoculum volume 15%, and incubation time 120 h. At this medium composition, the mycelial biomass and V content were 7.18 ± 0.24 g/L and 3786.0 ± 17 μg/g, respectively. The anti-diabetic potential of CCRV produced with the optimal level was tested in alloxan-induced diabetes. After the mice were administered (i.g.) with CCRV, the level of blood sugar in the CCRV group was very close to that of the control group. These findings suggested that CCRV produced with the optimal level is useful in the control of diabetes mellitus.

  6. Studies in Coprinus V — Coprinus section Coprinus. Revision of subsection Lanatuli Sing

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1999-01-01

    A key is given to the species of subsection Lanatuli known from the Netherlands or to be expected in the Netherlands on account of records from neighbouring countries. For a key to the subsections in Coprinus section Coprinus see Uljé & Noordel., Persoonia 16 (1997) 267. Coprinus bicornis and C.

  7. Studies in Coprinus IV — Coprinus section coprinus. Subdivision and revision of subsection Alachuani

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1997-01-01

    Coprinus section Coprinus is defined and delimited to comprise four subsections: Atramentarii, Coprinus, Lanatuli and Alachuani. A key to the subsections is given as well as a key to the species of subsection Alachuani known from the Netherlands or to be expected in the Netherlands on account of

  8. Type studies in Coprinus subsection Lanatuli

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    2001-01-01

    As a prelude to a monograph of the genus Coprinus, types were studied of a number of species said to belong to Coprinus subsection Lanatuli (Coprinus alnivorus. C. alutaceivelatus, C. ammophilae, C. arachnoideus, C. asterophoroides, C. brunneistragulatus, C. bubalinus, C. citrinovelatus, C.

  9. Screening of Coprinus species for the production of extracellular peroxidase and evaluation of its applicability to the treatment of aqueous phenol

    International Nuclear Information System (INIS)

    Ikehata, K.; Buchanan, I.D.

    2002-01-01

    Twenty-nine strains of Coprinus species comprising 16 strains from 12 identified species and 13 unidentified strains as well as one Arthromyces ramosus strain were screened for the production of extracellular peroxidase. Among the fungi examined, three strains of C. cinereus, UAMH 4103, UAMH 7907 and IFO 30116, as well as one Coprinus sp., UAMH 10067, which was isolated from urea treated soil, were shown to produce large amounts of extracellular peroxidase. The performance of crude peroxidase, obtained from liquid culture of C. cinereus, (CIP) on phenol removal from synthetic wastewater was evaluated and compared with that of purified horseradish peroxidase and A. ramosus peroxidase. Although crude CIP performed better than both purified enzymes, its superiority vanished in the presence of poly(ethylene glycol), a known protective agent of peroxidase. This suggests that the residual soluble substances present in crude CIP have protective effects similar to those of poly(ethylene glycol). (author)

  10. Studies in Coprinus III — Coprinus section Veliformes. Subdivision and revision of subsection Nivei emend

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1993-01-01

    Coprinus section Veliformes is defined and delimited to comprise four subsections: subsection Micacei, subsection Domestici, subsection Nivei, and subsection Narcotici, subsection nov. A key to the subsections is given. Subsection Nivei is emended, including also most taxa of subsection Flocculosi

  11. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  12. Fungicide selective for basidiomycetes.

    Science.gov (United States)

    Edgington, L V; Walton, G S; Miller, P M

    1966-07-15

    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  13. Optimal Conditions for the Mycelial Growth of Coprinus comatus Strains

    Science.gov (United States)

    Lee, Yun-Hae; Liu, Jun-Jie; Ju, Young-Cheol

    2009-01-01

    The principal objective of this study was to acquire basic data regarding the mycelial growth characteristics for the artificial cultivation of Coprinus comatus. 12 URP primers were employed to evaluate the genetic relationships of C. comatus, and the results were divided into three groups. Among six kinds of mushroom media, MYP medium was selected as the most favorable culture medium for C. comatus. The optimal temperature and pH ranges for the mycelial growth of C. comatus were 23~26℃ and pH 6~8, respectively. The carbon and nitrogen sources for optimal mycelial growth were sucrose and tryptone, respectively. PMID:23983517

  14. Studies on mushroom flavours 2. Flavour compounds in coprinus comatus.

    Science.gov (United States)

    Dijkstra, F Y; Wikén, T O

    1976-01-01

    In an aqueous extract of fruit bodies of Coprinus comatus 3-octanone, 3-octanol, 1-octen-3-ol, 1-octanol, 2-methyl-2-penten-4-olide, 1-dodecanol and caprylic acid were identified conclusively and n-butyric and isobutyric acids preliminarily. Amino-acids, nucleotides and sugars were also determined. A mixture of 37 compounds found in the extract had a stronger flavour than the natural extract. 3-Octanol, 1-octen-3-ol, 1-octanol and 2-methyl-2-penten-4-olide were the volatiles with the strongest flavour. Mass and IR spectra of 2-methyl-2-penten-4-olide are presented.

  15. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  16. Structural investigation of water-soluble polysaccharides extracted from the fruit bodies of Coprinus comatus

    NARCIS (Netherlands)

    Li, Bo; Dobruchowska, Justyna M.; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

    2013-01-01

    Water-soluble polysaccharide material, extracted from the stipes of the fruit bodies of Coprinus comatus by hot water, was fractionated by sequential weak anion-exchange and size-exclusion chromatography. The relevant fractions were subjected to structural analysis, including (D/L)

  17. Consumption of Coprinus comatus polysaccharide extract causes recovery of alcoholic liver damage in rats

    NARCIS (Netherlands)

    Ozalp, F.O.; Canbek, M.; Yamac, M.; Kanbak, G.; Griensven, van L.J.L.D.; Uyanoglu, M.; Senturk, H.; Karlkava, K.; Oglakci, A.

    2014-01-01

    Excess use of alcohol is known to be associated with liver diseases such as fatty liver, alcoholic hepatitis, and cirrhosis. Various practices may be applied to prevent or treat the damage caused by chronic alcoholism. Coprinus comatus (O.F. Müll.) Pers. (Agaricaceae) is a macrofungus that has been

  18. Maxillary sinusitis from Microascus cinereus and Aspergillus repens.

    Science.gov (United States)

    Aznar, C; de Bievre, C; Guiguen, C

    1989-02-01

    Microascus was associated with Aspergillus repens in a left maxillary sinus. Tissue contained septale filaments of two types, conidia, ostiolate perithecia containing ascospores corresponding to Microascus cinereus which was identified by culture. The abundance of sexual fructifications in the tissue indicates that pathogenicity is due to Microascus cinereus.

  19. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  20. Disseminated coccidoidomycosis in a koala (Phascolarctos cinereus).

    Science.gov (United States)

    Burgdorf-Moisuk, Anne; Stalis, Ilse H; Pye, Geoffrey W

    2012-03-01

    A16-yr-old male koala (Phascolarctos cinereus) presented for nonspecific signs of illness and weight loss. Despite 2 mo of diagnostics and supportive care, the koala's health declined and euthanasia was elected. On histopathologic examination, lesions containing fungal organisms morphologically consistent with coccidioidomycosis were found in the lung, liver, spleen, kidney, lymph node, heart, eye, and bone marrow. Although disseminated infection was present, the koala was IgM and IgG seronegative for Coccidioides spp. 1 mo prior to euthanasia.

  1. Isolation and biological activity of triglycerides of the fermented mushroom of Coprinus Comatus

    Directory of Open Access Journals (Sweden)

    Ren Jun

    2012-04-01

    Full Text Available Abstract Background Although many physiological functions of Coprinus comatus have been reported, there has been no report on the antinociceptive activity of Coprinus comatus. Therefore, the objective of the present study is to demonstrate the production, isolation, and biological properties of triglycerides (TFC of the fermented mushroom of Coprinus comatus. Methods The effects of TFC on cytokines levels, total antioxidant activity, antinociceptive effects in vivo, LD50 and tactile hyperalgesia were analyzed respectively. Results TFC treatment decreased the levels of cytokines and total antioxidant status (TAOS and inhibited the acetic acid-induced abdominal constrictions in mice. In addition, TFC reduced CFA-induced tactile hyperalgesia in a dose-dependent manner and the LD50 of TFC was determined to be 400 mg/kg. However, TFC did not significantly inhibit the reaction time to thermal stimuli in the hot-plate test. Conclusions TFC showed anti-inflammatory, antioxidant, peripheral antinociceptive and antihyperalgesic activity in various models of inflammatory pain. The data suggest that TFC may be a viable treatment option for inflammatory pain.

  2. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

    Science.gov (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

    2014-01-01

    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  3. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  4. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  5. Inconspicuous echolocation in hoary bats (Lasiurus cinereus).

    Science.gov (United States)

    Corcoran, Aaron J; Weller, Theodore J

    2018-05-16

    Echolocation allows bats to occupy diverse nocturnal niches. Bats almost always use echolocation, even when other sensory stimuli are available to guide navigation. Here, using arrays of calibrated infrared cameras and ultrasonic microphones, we demonstrate that hoary bats ( Lasiurus cinereus ) use previously unknown echolocation behaviours that challenge our current understanding of echolocation. We describe a novel call type ('micro' calls) that has three orders of magnitude less sound energy than other bat calls used in open habitats. We also document bats flying close to microphones (less than 3 m) without producing detectable echolocation calls. Acoustic modelling indicates that bats are not producing calls that exceed 70-75 dB at 0.1 m, a level that would have little or no known use for a bat flying in the open at speeds exceeding 7 m s -1 This indicates that hoary bats sometimes fly without echolocation. We speculate that bats reduce echolocation output to avoid eavesdropping by conspecifics during the mating season. These findings might partly explain why tens of thousands of hoary bats are killed by wind turbines each year. They also challenge the long-standing assumption that bats-model organisms for sensory specialization-are reliant on sonar for nocturnal navigation. © 2018 The Author(s).

  6. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  7. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Avila Arcos, Maria del Carmen; Ishida, Yasuko

    2012-01-01

    The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction...

  8. Detection of a novel gammaherpesvirus in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Vaz, P; Whiteley, P L; Wilks, C R; Duignan, P J; Ficorilli, N; Gilkerson, J R; Browning, G F; Devlin, J M

    2011-07-01

    A novel gammaherpesvirus was detected in wild koalas (Phascolarctos cinereus) captured at different locations during 2010. Sequence analysis of the DNA polymerase gene revealed that the virus was genetically distinct from all known gammaherpesviruses. This is the first herpesvirus to be definitively identified in the Vombatiforme suborder (koalas and wombats).

  9. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  10. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  11. Determination of some biological activities of Tricholoma terreum and Coprinus micaceus

    Directory of Open Access Journals (Sweden)

    Hasan Akgül

    2016-10-01

    Full Text Available The use of mushrooms as food also as medicine is increasing day by day. In this study, an edible mushrooms - Tricholoma terreum (Schaeff. P. Kumm. and Coprinus micaceus (Bull. Fr. – were used as materials. This study was aimed to determine the antioxidant and DNA protective activity of ethanol extract of mushrooms and determine and compare total antioxidant, oxidative stress index with oxidative levels and Fe, Mg, Zn, Cu, Na and Ca contents. The antioxidant activity of mushrooms were analyzed with using DPPH and total antioxidant and oxidative levels were analyzed with using Rel Assay Diagnostics kits. DNA protective activity was determined by using the supercoiled pBR322 DNA. Furthermore, element contents of the mushrooms were determined with wet decomposition method by using atomic absorption spectrophotometry. As a result of the study, antioxidant and DNA protective activities of ethanol extracts of both mushroom species were not showed any notable effect and total oxidant value was determined very high.

  12. Determination of some biological activities of Tricholoma terreum and Coprinus micaceus

    OpenAIRE

    Akgül, Hasan; Nur, Aylin Dilara; Sevindik, Mustafa; Doğan, Muhittin

    2016-01-01

    Mantarların gıda olarak kullanımlarının yanı sıra tıbbi açıdan kullanımları gün geçtikçe artmaktadır. Bu çalışmada yenilebilir mantar türlerinden Tricholoma terreum (Schaeff.) P. Kumm. ve Coprinus micaceus (Bull.) Fr. materyal olarak kullanılmıştır. Çalışmada mantarların etanol özütlerinin antioksidan ve DNA koruyucu aktivitelerinin belirlenmesi ve toplam antioksidan ve oksidan seviyeleriyle oksidatif stres indeksleri ve Fe, Mg, Zn, Cu, Na ve Ca içeriklerinin tespiti ve kıyaslanma...

  13. Electroretinography in the normal koala (Phascolarctos cinereus).

    Science.gov (United States)

    Liddle, Vicki L

    2015-01-01

    To perform electroretinography on normal anesthetized koalas (Phascolarctos cinereus). Six hospitalized koalas. The koalas were anesthetized using alfaxalone intramuscularly and isoflurane via face mask, then maintained on isoflurane after endotracheal intubation. After 20 min of dark adaptation, electroretinograms were obtained using a handheld electroretinography (ERG) machine using a single flash protocol at three light intensities: 10 mcd s/m(2) , 3000 mcd s/m(2) , and 10,000 mcd s/m(2) . At 10 mcd s/m(2) , the mean b-wave amplitude and implicit time were 49.5 μV (SD ± 33.1 and 95% CI 29.9-69.0) and 87.4 ms (SD ± 6.5 and 95% CI 83.6-91.2). At 3000 mcd s/m(2) , the mean a-wave amplitude and implicit time were 70.5 μV (SD ± 30.7 and 95% CI 52.3-88.7) and 20.6 ms (SD ± 3.1 and 95% CI 18.7-22.4), and the mean b-wave amplitude and implicit time were 122.8 μV (SD ± 49.3 and 95% CI 93.7-151.9) and 63.1 ms (SD ± 13.2 and 95% CI 55.3-71.0). At 10,000 mcd sm(2) , the mean a-wave amplitude and implicit time were 90.8 μV (SD ± 37.2 and 95% CI 68.8-112.8) and 16.1 ms (SD ± 3.1 and 95% CI 14.3-18.0), and the mean b-wave amplitude and implicit time were 148.3 μV (SD ± 54.9 and 95% CI 115.9-180.8) and 67.4 ms (SD ± 8.4 and 95% CI 62.5-72.3). Electroretinography in koalas is practical using a portable ERG system and a DTL thread electrode and allows for rapid assessment of retinal function. © 2013 American College of Veterinary Ophthalmologists.

  14. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)

    OpenAIRE

    Tsangaras, Kyriakos; Ávila-Arcos, María C; Ishida, Yasuko; Helgen, Kristofer M; Roca, Alfred L; Greenwood, Alex D

    2012-01-01

    Abstract Background The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hyp...

  15. Mutational synergism between p-fluorophenylalaline and UV in Coprinus lagopus

    International Nuclear Information System (INIS)

    Talmud, P.J.

    1977-01-01

    The amino acid analogue p-fluorophenylalanine (PFP) is mutagenic to Coprinus lagopus due to its incorporation into proteins. Spontaneous mutations, PFP and UV mutagenesis and PFP/UV synergism have been studied in a UV resistant strain and in two complementing UV sensitive mutant strains. By comparison to the UV resistant strain, one UV sensitive strain shows normal spontaneous mutations, 1.4% PFP-induced mutations and 50-fold UV mutagenesis. The second UV sensitive strain has 19-fold spontaneous mutation frequency and slightly elevated UV mutagenesis. In all 3 strains the PFP/UV synergism is comparable (4-5 times the arithmetic expected). The results indicate that PFP mutagenesis is due to the incorporation of PFP into enzymes normally functioning in the organism but which also participate in UV repair mechanisms. A model is proposed for UV repair which is based on a PFP sensitive excision repair system of at least two enzymes, an alternative 'error-proof' pathway which is not susceptible to PFP and an 'error-prone' pathway which is responsible for UV mutagenesis and is susceptible to PFP as shown by the PFP/UV synergism. Because PFP is given before UV treatment, this implies a UV inducible cofactor and a PFP sensitive enzyme which only functions after UV activation

  16. Nasal mass removal in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Gorow, April; Pye, Geoffrey W

    2012-12-01

    Nasal masses in the koala (Phascolarctos cinereus) are not uncommon and can be challenging to diagnose and treat. Differential diagnoses for nasal masses in the koala are cryptococcal granulomas, nasal polyps, nasal adenocarcinoma, and osteochondromatosis. This report describes successful surgical approaches for two adult koalas with nasal masses and includes photodocumentation and description of the anatomy of the koala nasal passages from the postmortem transverse sectioning of a normal koala head. Surgical removal of the nasal masses in these koalas resulted in a rapid resolution of clinical signs.

  17. Perfil electroforético de las proteínas de la seta comestible "Coprinus comatus"

    OpenAIRE

    González Rodríguez, Andrea

    2017-01-01

    Este trabajo consiste en un estudio experimental del perfil proteico del hongo comestible Coprinus comatus, muy relevante por su alto valor económico y gastronómico, debido a sus propiedades nutricionales y medicinales. Los hongos son considerados alimentos funcionales, pues además de sus propiedades nutricionales, se han demostrado sus efectos beneficiosos para la salud que pueden ser utilizados en la prevención o tratamiento de enfermedades. Su acción terapéutica es atribuida a los compuest...

  18. Cytotoxic protein from the mushroom Coprinus comatus possesses a unique mode for glycan binding and specificity

    Science.gov (United States)

    Zhang, Peilan; Yang, Guang; Xia, Changqing; Polston, Jane E.; Li, Gengnan; Li, Shiwu; Lin, Zhao; Yang, Li-jun; Bruner, Steven D.

    2017-01-01

    Glycans possess significant chemical diversity; glycan binding proteins (GBPs) recognize specific glycans to translate their structures to functions in various physiological and pathological processes. Therefore, the discovery and characterization of novel GBPs and characterization of glycan–GBP interactions are significant to provide potential targets for therapeutic intervention of many diseases. Here, we report the biochemical, functional, and structural characterization of a 130-amino-acid protein, Y3, from the mushroom Coprinus comatus. Biochemical studies of recombinant Y3 from a yeast expression system demonstrated the protein is a unique GBP. Additionally, we show that Y3 exhibits selective and potent cytotoxicity toward human T-cell leukemia Jurkat cells compared with a panel of cancer cell lines via inducing caspase-dependent apoptosis. Screening of a glycan array demonstrated GalNAcβ1–4(Fucα1–3)GlcNAc (LDNF) as a specific Y3-binding ligand. To provide a structural basis for function, the crystal structure was solved to a resolution of 1.2 Å, revealing a single-domain αβα-sandwich motif. Two monomers were dimerized to form a large 10-stranded, antiparallel β-sheet flanked by α-helices on each side, representing a unique oligomerization mode among GBPs. A large glycan binding pocket extends into the dimeric interface, and docking of LDNF identified key residues for glycan interactions. Disruption of residues predicted to be involved in LDNF/Y3 interactions resulted in the significant loss of binding to Jurkat T-cells and severely impaired their cytotoxicity. Collectively, these results demonstrate Y3 to be a GBP with selective cytotoxicity toward human T-cell leukemia cells and indicate its potential use in cancer diagnosis and treatment. PMID:28784797

  19. Cytotoxic protein from the mushroom Coprinus comatus possesses a unique mode for glycan binding and specificity.

    Science.gov (United States)

    Zhang, Peilan; Li, Kunhua; Yang, Guang; Xia, Changqing; Polston, Jane E; Li, Gengnan; Li, Shiwu; Lin, Zhao; Yang, Li-Jun; Bruner, Steven D; Ding, Yousong

    2017-08-22

    Glycans possess significant chemical diversity; glycan binding proteins (GBPs) recognize specific glycans to translate their structures to functions in various physiological and pathological processes. Therefore, the discovery and characterization of novel GBPs and characterization of glycan-GBP interactions are significant to provide potential targets for therapeutic intervention of many diseases. Here, we report the biochemical, functional, and structural characterization of a 130-amino-acid protein, Y3, from the mushroom Coprinus comatus Biochemical studies of recombinant Y3 from a yeast expression system demonstrated the protein is a unique GBP. Additionally, we show that Y3 exhibits selective and potent cytotoxicity toward human T-cell leukemia Jurkat cells compared with a panel of cancer cell lines via inducing caspase-dependent apoptosis. Screening of a glycan array demonstrated GalNAcβ1-4(Fucα1-3)GlcNAc (LDNF) as a specific Y3-binding ligand. To provide a structural basis for function, the crystal structure was solved to a resolution of 1.2 Å, revealing a single-domain αβα-sandwich motif. Two monomers were dimerized to form a large 10-stranded, antiparallel β-sheet flanked by α-helices on each side, representing a unique oligomerization mode among GBPs. A large glycan binding pocket extends into the dimeric interface, and docking of LDNF identified key residues for glycan interactions. Disruption of residues predicted to be involved in LDNF/Y3 interactions resulted in the significant loss of binding to Jurkat T-cells and severely impaired their cytotoxicity. Collectively, these results demonstrate Y3 to be a GBP with selective cytotoxicity toward human T-cell leukemia cells and indicate its potential use in cancer diagnosis and treatment.

  20. First report of a cross-kingdom pathogenic bacterium, Achromobacter xylosoxidans isolated from stipe-rot Coprinus comatus.

    Science.gov (United States)

    Ye, Luona; Guo, Mengpei; Ren, Pengfei; Wang, Gangzheng; Bian, Yinbing; Xiao, Yang; Zhou, Yan

    2018-03-01

    Coprinus comatus is an edible mushroom widely cultivated in China as a delicious food. Various diseases have occurred on C. comatus with the cultivated area increasing. In this study, the pathogenic bacterium JTG-B1, identified as Achromobacter xylosoxidans by 16S rDNA and nrdA gene sequencing, was isolated from edible mushroom Coprinus comatus with serious rot disease on its stipe. A. xylosoxidans has been confirmed as an important opportunistic human pathogenic bacterium and has been isolated from respiratory samples from cystic fibrosis. It is widely distributed in the environment. Here, we first report that fungi can also serve as a host for A. xylosoxidans. We confirmed that it can cross-kingdom infect between animals (mice) and fungi (C. comatus). The results of pathogenicity tests, physiological, biochemical and genotyping analysis of A. xylosoxidans from different hosts suggested that different strain of A. xylosoxidans may have pathogenicity differentiation. A. xylosoxidans not only is pathogenic to C. comatus but also may threaten human health. Copyright © 2017 Elsevier GmbH. All rights reserved.

  1. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  2. Radiation preservation of white pomfret (Stromateus cinereus) in tomato sauce

    International Nuclear Information System (INIS)

    Doke, S.N.; Sherekar, S.V.; Ghadi, S.V.

    1991-01-01

    A method for the radiation preservation of white pomfret (Stromateus cinereus) in tomato sauce is described which enables the storage of fish at ambient temperature (28±3 deg C) for a period of six months. The product with low pH could be stabilized with a dose of 5 kGy. A batch of packed cans (consisting of cans of fish with tomato sauce and the control cans) were subjected to a dose in a Cobalt 60 Package Irradiator (Atomic Energy of Canada Ltd.) at a dose rate of 0.045 kGy min -1 . Biochemical and bacteriological evaluation confirmed the storage stability of the product. The process offers a safe and simple method to preserve white pomfret in a 'heat and serve' form. (author) 6 refs.; 5 tabs

  3. Pneumonia due to Chlamydia pecorum in a Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mackie, J T; Gillett, A K; Palmieri, C; Feng, T; Higgins, D P

    2016-11-01

    Chlamydiosis is a common infectious disease of koalas (Phascolarctos cinereus), but Chlamydia spp. have not yet been demonstrated to cause pneumonia in these animals. A juvenile male koala died following an episode of respiratory disease. At necropsy examination, the lung tissue was consolidated. Microscopical lesions in the lung included pyogranulomatous bronchopneumonia, proliferation of bronchiolar and alveolar epithelium and interstitial fibrosis. Hyperplastic bronchiolar epithelial cells contained aggregates of small basophilic punctate organisms, which were confirmed as chlamydiae by transmission electron microscopy and immunohistochemistry. Real-time polymerase chain reaction identified these as Chlamydia pecorum. This report provides the best evidence to date of chlamydial infection causing pneumonia in a koala, and the first evidence that C. pecorum is capable of infecting the bronchiolar epithelium of the koala. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  6. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  7. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  8. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Tsangaras Kyriakos

    2012-10-01

    Full Text Available Abstract Background The koala (Phascolarctos cinereus is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hypervariable region of mitochondrial DNA (mtDNA in koala museum specimens collected in the 19th and 20th centuries, hypothesizing that the historical samples would exhibit greater genetic diversity. Results The mtDNA haplotypes present in historical museum samples were identical to haplotypes found in modern koala populations, and no novel haplotypes were detected. Rarefaction analyses suggested that the mtDNA genetic diversity present in the museum samples was similar to that of modern koalas. Conclusions Low mtDNA diversity may have been present in koala populations prior to recent population declines. When considering management strategies, low genetic diversity of the mtDNA hypervariable region may not indicate recent inbreeding or founder events but may reflect an older historical pattern for koalas.

  9. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Tsangaras, Kyriakos; Ávila-Arcos, María C; Ishida, Yasuko; Helgen, Kristofer M; Roca, Alfred L; Greenwood, Alex D

    2012-10-24

    The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hypervariable region of mitochondrial DNA (mtDNA) in koala museum specimens collected in the 19th and 20th centuries, hypothesizing that the historical samples would exhibit greater genetic diversity. The mtDNA haplotypes present in historical museum samples were identical to haplotypes found in modern koala populations, and no novel haplotypes were detected. Rarefaction analyses suggested that the mtDNA genetic diversity present in the museum samples was similar to that of modern koalas. Low mtDNA diversity may have been present in koala populations prior to recent population declines. When considering management strategies, low genetic diversity of the mtDNA hypervariable region may not indicate recent inbreeding or founder events but may reflect an older historical pattern for koalas.

  10. Can the eastern red-backed salamander (Plethodon cinereus) persist in an acidified landscape?

    Science.gov (United States)

    Bondi, Cheryl A; Beier, Colin M.; Ducey, Peter K; Lawrence, Gregory B.; Bailey, Scott W.

    2016-01-01

    Hardwood forests of eastern North America have experienced decades of acidic deposition, leading to soil acidification where base cation supply was insufficient to neutralize acid inputs. Negative impacts of soil acidity on amphibians include disrupted embryonic development, lower growth rates, and habitat loss. However, some amphibians exhibit intraspecific variation in acid tolerance, suggesting the potential for local adaptation in areas where soils are naturally acidic. The eastern red-backed salamander (Plethodon cinereus) is a highly abundant top predator of the northern hardwood forest floor. Early research found that P. cinereus was sensitive to acidic soils, avoiding substrates with pH habitats. However, recent studies have documented P. cinereus populations in lower pH conditions than previously observed, suggesting some populations may persist in acidic conditions. Here, we evaluated relationships between organic horizon soil pH and P. cinereus abundance, adult health (body size and condition), and microhabitat selection, based on surveys of 34 hardwood forests in northeastern United States that encompass a regional soil pH gradient. We found no associations between soil pH and P. cinereus abundance or health, and observed that this salamander used substrates with pH similar to that available, suggesting that pH does not mediate their fine-scale distributions. The strongest negative predictor of P. cinereus abundance was the presence of dusky salamanders (Desmognathus spp.), which were most abundant in the western Adirondacks. Our results indicate that P. cinereus occupies a wider range of soil pH than has been previously thought, which has implications for their functional role in forest food webs and nutrient cycles in acid-impaired ecosystems. Tolerance of P. cinereus for more acidic habitats, including anthropogenically acidified forests, may be due to local adaptation in reproductively isolated populations and/or generalist

  11. Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2007-08-01

    Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

  12. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  13. Ultrasonographic assessment of the male koala (Phascolarctos cinereus) reproductive tract.

    Science.gov (United States)

    Larkin, Rebecca; Palmieri, Chiara; Oishi, Motoharu; Hulse, Lyndal; Johnston, Stephen D

    2018-04-01

    Studies documenting the application of ultrasonography to depict normal and pathological changes in koalas (Phascolarctos cinereus), especially in the male, are scarce. Sixty-two wild koalas were used in this study to define ultrasonographic protocols and features for the assessment of the male koala reproductive tract. Testis, epididymis and spermatic cord were examined using a hockey stick transducer. The normal koala testis showed a homogeneous echogenicity and an obvious hyper-echoic band corresponding to the tunica albuginea. The cauda epididymis was characterised by hypo- and hyper-echoic regions and was most effectively imaged in sagittal section. The koala prostate was assessed using a micro-curved transducer positioned midline, caudal to the bladder. On transverse section, it showed distinct margins and a well-defined internal structure, although the prostatic urethra was not apparent on most scans. To image the bulbourethral glands (BGs), the hockey stick transducer was placed lateral to the cloaca. BGIII was located just below the skin, while BGII was located deeper than BGIII. BGI was too small and not sufficiently echogenic to be detected. The ultrasonographic appearance of the BGs was similar to that of the testes but with more obvious hypo-echoic stippling. This comprehensive review of the ultrasonographic appearance of normal male koala reproductive tract can be used by veterinarians and others, in zoos or those working with wild koalas, during assessment of the reproductive tract of male koalas in relation to seasonal changes in accessory gland function or for the pathological investigation of reproductive lesions and infertility problems. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Supplemental feeding of captive neonatal koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Shibata, Eri; Shindo, Izumi; Miyakawa, Etsuko; Kido, Nobuhide

    2017-01-01

    Koalas (Phascolarctos cinereus) are cautious animals, making supplemental feeding of neonates challenging because of disturbances to the normal routine. However, supplemental feeding is beneficial in improving juvenile nutrition using less formula than required for hand-rearing, and allowing maternal bonding to continue through suckling. In this study, two neonatal koalas, delivered by the same mother in 2 years, exhibited insufficient growth post-emergence from the pouch; supplemental feeding was therefore initiated. The amount of formula fed was determined according to the product instructions, and offspring weight was monitored. Slower than normal growth was not initially noticed in the first offspring. This caused delayed commencement of supplemental feeding. An attempt was made to counteract this by providing more formula for a longer period; however, this meant No. 1 was unable to eat enough eucalyptus when weaning. Supplemental feeding was started earlier for the second offspring than for the first, and was terminated at weaning; this juvenile showed a healthy body weight increase. Furthermore, it was able to eat eucalyptus leaves at an earlier stage than No. 1. Although No. 1 showed delayed growth, both koalas matured and are still living. This study showed that supplemental feeding is useful for koalas, if the mother will accept human intervention. The key factors for successful supplemental feeding of koalas identified by comparing the two feeding systems observed in this study are that: (1) it should be initiated as soon as insufficient growth is identified; and (2) it should be terminated before weaning age. Zoo Biol. 36:62-65, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Basin wildrye (Leymus cinereus) pooled tetraploid accessions for U.S. Intermountain rangeland reclamation

    Science.gov (United States)

    Stanford A. Young; Jason Vernon; Nancy Shaw

    2013-01-01

    Basin wildrye (Leymus cinereus [Scribn. & Merr.] A. Love) is an important perennial, hardy, long-lived, cool season C3 native grass of rangeland plant communities throughout much of western United States and Canada. All classes of livestock and wildlife, including large and small birds and mammals, utilise the grass year round for food and protection due to its 2-3...

  16. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  17. Habitat relationships of eastern red-backed salamanders (Plethodon cinereus) in Appalachian agroforestry and grazing systems

    Science.gov (United States)

    Breanna L. Riedel; Kevin R. Russell; W. Mark Ford; Katherine P. O' Neill; Harry W. Godwin

    2008-01-01

    Woodland salamander responses to either traditional grazing or silvopasture systems are virtually unknown. An information-theoretic modelling approach was used to evaluate responses of red-backed salamanders (Plethodon cinereus) to silvopasture and meadow conversions in southern West Virginia. Searches of area-constrained plots and artificial...

  18. Another account of interspecific aggression involving a Hoary Bat (Lasiurus cinereus)

    Science.gov (United States)

    Alyson F Brokaw; Jeff Clerc; Ted Weller

    2016-01-01

    We observed an incident of interspecific aggression between a male Hoary Bat (Lasiurus cinereus) and a male Silver-haired Bat (Lasionycteris noctivagans). The Silver-haired Bat suffered few external injuries, the most conspicuous of which were a missing lower right canine and small...

  19. Chlamydia pecorum in Joint Tissue and Synovial Fluid of a Koala ( Phascolarctos cinereus) with Arthritis.

    Science.gov (United States)

    Burnard, Delaney; Gillett, Amber; Polkinghorne, Adam

    2018-03-02

    A small number of koalas ( Phascolarctos cinereus) presented to wildlife hospitals in Queensland, Australia, with signs of arthritis in one or more joints. Molecular analysis identified Chlamydia pecorum in the tarsal tissue and synovial fluid of an affected joint of a koala, suggesting that in addition to livestock, C. pecorum has the potential to cause arthritis in the koala.

  20. Detection of a second novel gammaherpesvirus in a free-ranging koala (Phascolarctos cinereus).

    Science.gov (United States)

    Vaz, Paola; Whiteley, Pam L; Wilks, Colin R; Browning, Glenn F; Gilkerson, James R; Ficorilli, Nino; Devlin, Joanne M

    2012-01-01

    A second novel gammaherpesvirus was detected in a free-ranging koala (Phascolarctos cinereus) shown previously to be infected with phascolarctid herpesvirus 1. Analysis of the DNA polymerase gene showed that the virus was genetically distinct from all known gammaherpesviruses. This is the first reported dual gammaherpesvirus infection in an Australian marsupial.

  1. Chlamydia pecorum Infection in Free-ranging Koalas ( Phascolarctos cinereus ) on French Island, Victoria, Australia.

    Science.gov (United States)

    Legione, Alistair R; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Sansom, Fiona M; Devlin, Joanne M

    2016-04-28

    We detected Chlamydia pecorum in two koalas ( Phascolarctos cinereus ) from a closed island population in Victoria, Australia, previously free of Chlamydia infection. The ompA and multilocus sequence type were most closely related to published isolates of livestock rather than koala origin, suggesting potential cross-species transmission of C. pecorum .

  2. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  3. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    OpenAIRE

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-01-01

    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  4. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

    Science.gov (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

    2007-04-01

    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  5. Storage properties of irrdiated white pomfret (Stromatus cinereus) in tomato sauce

    International Nuclear Information System (INIS)

    Doke, S.N.; Sherekar, S.V.; Ghadi, S.V.

    1990-01-01

    A process involving radiation and heat treatment combined with effective management of pH using tomato sauce was developed for preservation of white pomfret (Stromatus cinereus). This process enhanced the organoleptic acceptability of the product and also ensured its microbiological safety. The processed product was in good edible condition even after a storage of 6 months at ambient temperature. (M.G.B.). 3 tabs

  6. Differential resistance to stripe rust (Puccinia striiformis) in collections of basin wild rye (Leymus cinereus)

    Science.gov (United States)

    Frank M. Dugan; Michael J. Cashman; Richard C. Johnson; Meinan Wang; Chen Xianming

    2014-01-01

    Differential resistance to stripe rust (Puccinia striiformis) in a planting of 111 wild collections of Basin wild rye (Leymus cinereus) was noted 2011-2013. In 2011, rust severity was rated on a scale of 1-9. Much lighter infection in 2012 and 2013 was rated as the number of symptomatic leaves per plant divided by plant circumference (to adjust for plant size). Effect...

  7. Physical condition, sex, and age-class of eastern red-backed salamanders (Plethodon cinereus) in forested and open habitats of West Virginia, USA

    Science.gov (United States)

    Breanna L. Riedel; Kevin R. Russell; W. Mark Ford

    2012-01-01

    Nonforested habitats such as open fields and pastures have been considered unsuitable for desiccation-prone woodland salamanders such as the Eastern Red-backed Salamander (Plethodon cinereus). Recent research has suggested that Plethodon cinereus may not only disperse across but also reside within open habitats including fields,...

  8. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura

    Directory of Open Access Journals (Sweden)

    Carlos da Silva Lacaz

    1996-10-01

    Full Text Available The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum commune. Lesions of the buccal mucosa, brain abscesses, onychomycosis and endocarditis have been described, with a growing interest in this type of deep mycosis on the part of mycologists and infectologists. The present paper reports descriptions of mycetism as well as infectious processes caused by basidiomycetes, such as Schizophyllum commune, Ustilago maydis (= Ustilago zeae and Coprinus cinereusAs basidiomicoses, infecções fúngicas provocadas por basidiomicetos ou agáricos vêm sendo registradas cada vez com maior frequência na literatura médica, principalmente após o advento da AIDS/SIDA, em 1981. Os basidiosporos desses fungos, espalhados na atmosfera e veiculados através do vento ou de correntes aéreas, atingem por via nasal os seios maxilares, provocando quadros de sinusite crônica, na maioria das vezes. Do escarro também têm sido isolados basidiomicetos, principalmente o Schizophyllum commune. Lesões da mucosa da boca, abscessos cerebrais, onicomicoses e endocardites já foram descritas, aumentando o interesse dos micologistas e infectologistas para este tipo de micose profunda. O presente trabalho assinala, ao lado dos quadros dc micetismo, processos infecciosos provocados por basidiomicetos, a exemplo do Schizophyllum commune, Ustilago maydis (= Ustilago zeae e Coprinus cinereus.

  10. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

    Science.gov (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

    2008-07-01

    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

  11. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  12. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  13. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  14. Conjunctivitis associated with Chlamydia pecorum in three koalas (Phascolarctos cinereus) in the Mount Lofty Ranges, South Australia.

    Science.gov (United States)

    Funnell, Oliver; Johnson, Lynley; Woolford, Lucy; Boardman, Wayne; Polkinghorne, Adam; McLelland, David

    2013-10-01

    Chlamydiosis is a significant factor contributing to the decline of koala (Phascolarctos cinereus) populations in Australia but has not previously been reported in South Australia. We describe conjunctivitis in three wild koalas from South Australia, with Chlamydia pecorum identified by quantitative PCR.

  15. Preshipment testing success: resolution of a nasal sinus granuloma in a captive koala (Phascolarctos cinereus) caused by Cryptococcus gattii.

    Science.gov (United States)

    Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Pye, Geoffrey W; Meyer, Wieland; Sykes, Jane E

    2012-12-01

    A 3-yr-old female koala (Phascolarctos cinereus) was diagnosed with a nasal sinus granuloma caused by Cryptococcus gattii after a pre-shipment examination revealed a latex cryptococcal agglutination titer of 1:512. Successful medical and surgical treatment of the granuloma was monitored using serial latex cryptococcal agglutination titers, serum levels of antifungal drugs, and advanced imaging.

  16. Prevalence of Chlamydia pecorum in Juvenile Koalas ( Phascolarctos cinereus) and Evidence for Protection from Infection via Maternal Immunization.

    Science.gov (United States)

    Russell, Isabelle; Timms, Peter; Hanger, Jon; Loader, Jo; Gillett, Amber; Waugh, Courtney

    2018-05-07

    Chlamydia pecorum in koalas ( Phascolarctos cinereus) is considered a sexually transmitted infection. Analysis of samples from koala joeys (<1 yr) suggested that mother-to-young direct transmission was also occurring. Further, evidence suggested that joeys from vaccinated mothers were less likely to contract infections than joeys with unvaccinated mothers.

  17. A climate for speciation: rapid spatial diversification within the Sorex cinereus complex of shrews

    Science.gov (United States)

    Hope, Andrew G.; Speer, Kelly A.; Demboski, John R.; Talbot, Sandra L.; Cook, Joseph A.

    2012-01-01

    The cyclic climate regime of the late Quaternary caused dramatic environmental change at high latitudes. Although these events may have been brief in periodicity from an evolutionary standpoint, multiple episodes of allopatry and divergence have been implicated in rapid radiations of a number of organisms. Shrews of the Sorex cinereus complex have long challenged taxonomists due to similar morphology and parapatric geographic ranges. Here, multi-locus phylogenetic and demographic assessments using a coalescent framework were combined to investigate spatiotemporal evolution of 13 nominal species with a widespread distribution throughout North America and across Beringia into Siberia. For these species, we first test a hypothesis of recent differentiation in response to Pleistocene climate versus more ancient divergence that would coincide with pre-Pleistocene perturbations. We then investigate the processes driving diversification over multiple continents. Our genetic analyses highlight novel diversity within these morphologically conserved mammals and clarify relationships between geographic distribution and evolutionary history. Demography within and among species indicates both regional stability and rapid expansion. Ancestral ecological differentiation coincident with early cladogenesis within the complex enabled alternating and repeated episodes of allopatry and expansion where successive glacial and interglacial phases each promoted divergence. The Sorex cinereus complex constitutes a valuable model for future comparative assessments of evolution in response to cyclic environmental change.

  18. A New Subspecies Identification and Population Study of the Asian Small-Clawed Otter (Aonyx cinereus in Malay Peninsula and Southern Thailand Based on Fecal DNA Method

    Directory of Open Access Journals (Sweden)

    M. K. A. Rosli

    2014-01-01

    Full Text Available Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  19. A new subspecies identification and population study of the Asian small-clawed otter (Aonyx cinereus) in Malay Peninsula and southern Thailand based on fecal DNA method.

    Science.gov (United States)

    Rosli, M K A; Syed-Shabthar, S M F; Abdul-Patah, P; Abdul-Samad, Z; Abdul, S N; Burhanuddin, M N; Zulkifli, N A; Shukor, M N; Budsabong, K; Changtragoon, S; Sekiguchi, T; Sasaki, H; Md-Zain, B M

    2014-01-01

    Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  20. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  1. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

    Science.gov (United States)

    Terekhova, V A; Semenova, T A

    2005-01-01

    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  2. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  3. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  4. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  5. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  6. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  7. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Multiple intra-abdominal serosal myxosarcomas in two koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Astudillo, V González; Schaffer-White, A; Allavena, R; Palmieri, C

    2015-01-01

    Two adult koalas (Phascolarctos cinereus) were presented for necropsy examination without any clinical history. A diffuse, severe gelatinous effusion was found in the abdominal cavity, while numerous 1-3 mm diameter, round, well-demarcated, multifocal to coalescing, raised, firm nodules containing a clear gelatinous fluid were scattered on the surface of the parietal peritoneum, diaphragm, liver, gastrointestinal tract and mesentery. Microscopically, the nodular lesions consisted of spindle-shaped to stellate neoplastic cells, with scant eosinophilic cytoplasm and moderate anisocytosis and anisokaryosis. The neoplastic cells were admixed with and surrounded by abundant acellular pale eosinophilic material that was stained by Alcian blue and only weakly by the periodic acid-Schiff reaction. Serosal proliferations are described rarely in koalas and to the authors' knowledge this is the first reported case of serosal myxosarcoma. The significance and pathogenesis of this condition in the koala population is unknown. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. THE PARADOX OF EUTHANIZING KOALAS (PHASCOLARCTOS CINEREUS) TO SAVE POPULATIONS FROM ELIMINATION.

    Science.gov (United States)

    Wilson, David P; Craig, Andrew P; Hanger, Jon; Timms, Peter

    2015-10-01

    Koala (Phascolarctos cinereus) populations in the wild are in sharp decline in Australia due to deforestation, road accidents, dog attacks, and disease from infection with sexually transmitted Chlamydia spp. Severely diseased koalas that are captured are euthanized for humane reasons because antibiotics are not effective. Paradoxically, we propose that euthanizing more koalas could help to increase koala population numbers. We investigated the potential impact of systematically euthanizing diseased koalas. Using data from a well-studied koala population, and an individual-based computer simulation model, we predict that such a program would result in a larger population of koalas after 7 yr than would exist without the program. If terminally diseased and sterile koalas are euthanized and other infected captured koalas are given antibiotics, chlamydial infection could be eliminated and population growth observed after 4 yr. The practical implementation of such a program would be facilitated with further development of tools to diagnose infection and internal disease in the field.

  10. Perceived efficacy of analgesic drug regimens used for koalas (Phascolarctos cinereus) in Australia.

    Science.gov (United States)

    de Kauwe, Tyron; Kimble, Benjamin; Govendir, Merran

    2014-06-01

    Recent publications report that some therapeutic drugs used in koalas (Phascolarctos cinereus) have poor oral absorption and are rapidly eliminated. Therefore, information on both the analgesic drug dosage regimens used to treat koalas in Australia and koala caretakers' perceptions of the efficacy of these drugs to control pain was collected for the purpose of identifying the most popular analgesics to prioritize future analgesic pharmacokinetic studies for this species. A one-page, double-sided questionnaire was distributed both electronically and by mail to Australian koala care facilities such as zoos and wildlife hospitals. Information was received from 13 respondents. Nonsteroidal anti-inflammatory drugs (NSAIDs) were the most frequently used analgesics, followed by full micro- and partial opioid receptor agonists and acetaminophen with or without codeine. The full micro-opioid receptor agonists and acetaminophen with or without codeine were most consistently considered efficacious, with wider variation in perceived efficacy of the NSAIDs. Analgesic drug combinations were generally thought efficacious.

  11. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  12. Development of 14 microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus) using next generation sequencing technology

    OpenAIRE

    Ruiz-Rodriguez, Christina T.; Ishida, Yasuko; Greenwood, Alex D.; Roca, Alfred L.

    2014-01-01

    We report the development of 14 new microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus). Ten unrelated Queensland koala individuals from the San Diego Zoo, USA, were genotyped. The number of alleles per locus ranged from 2 to 7, with an average of 5.14 alleles per locus. Across all loci, the average observed and expected heterozygosity values were both 0.69. These polymorphic microsatellite loci will be useful for genetic studies relevant to the conservation of the...

  13. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  14. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  15. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  16. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  17. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  18. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  19. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  20. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  1. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

    Science.gov (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

    2004-01-01

    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  2. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  3. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  4. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  5. Food habits of the hoary bat (LASIURUS CINEREUS) during spring migration through new mexico

    Science.gov (United States)

    Valdez, E.W.; Cryan, P.M.

    2009-01-01

    Hoary bats (Lasiums cinernis) exhibit continental patterns of migration that are unique to bats, but details about their behaviors during migration are lacking. We captured 177 hoary bats in spring and early summer 2002 as individuals migrated through the Sandia Mountains of north-central New Mexico. Our results support earlier observations of asynchronous timing of migration between sexes of L. cinernis during spring, with females preceding males by ca. 1 month. We provide the first evidence that hoary bats may travel in dispersed groups, fly below the tree canopy along streams, and feed while migrating during spring. Analysis of guano revealed that diet of L. cinereus consisted mostly of moths, with more than one-half of samples identified as Noctuidae and Geometridae. We observed a late-spring decline in consumption of moths that might be related to seasonal changes in abundance of prey, differential selection of prey by bats, or sampling bias. We suspect that spring migration of L. cinernis through New Mexico temporally coincides with the seasonal abundance of moths.

  6. Foraging range movements of the endangered Hawaiian hoary bat, Lasiurus cinereus semotus (Chiroptera: Vespertilionidae)

    Science.gov (United States)

    Bonaccorso, Frank J.; Todd, Christopher M.; Miles, Adam C.; Gorresen, P. Marcos

    2015-01-01

    We documented nightly movements of Hawaiian hoary bats (Lasiurus cinereus semotus) on the island of Hawai’i. Based on data from 28 radiotagged individuals mean foraging range (FR) was 230.7±72.3 ha, core-use area (CUA) was 25.5±6.9 ha (or 11.1% of mean FR), and the mean long axis (LAX) across the FR was 3,390.8±754.3 m. There was almost no overlap in CUAs among 4 adult males having overlapping foraging areas and tracked simultaneously or within a 90-day window of each other. CUAs of subadults partially overlapped with multiple adult males or with one other subadult. High variance in FRs, cores use areas, and LAX across the FR perhaps reflect localized stochastic variables such as weather, habitat, and food resources. Hawaiian hoary bats use moderately large FRs among insectivorous bats studied with comparable methodologies; however, foraging activity indicated by documentation of acoustic feeding buzzes is concentrated within one or a few disjunct areas cumulatively forming the 50% fixed kernel of CUA. The concentration of feeding activity, low values of individual overlap, and agonistic chasing behavior within CUAs all demonstrate a structured use of individual space by Hawaiian hoary bats.

  7. Insect prey eaten by Hoary Bats (Lasiurus cinereus) prior to fatal collisions with wind turbines

    Science.gov (United States)

    Valdez, Ernest W.; Cryan, Paul M.

    2013-01-01

    Wind turbines are being deployed all across the world to meet the growing demand for energy, and in many areas, these turbines are causing the deaths of insectivorous migratory bats. One of the hypothesized causes of bat susceptibility is that bats are attracted to insects on or near the turbines. We examined insect remains in the stomachs and intestines of hoary bats (Lasiurus cinereus) found dead beneath wind turbines in New York and Texas to evaluate the hypothesis that bats die while feeding at turbines. Most of the bats we examined had full stomachs, indicating that they fed in the minutes to hours leading up to their deaths. However, we did not find prey in the mouths or throats of any bats that would indicate the bats died while capturing prey. Hoary bats fed mostly on moths, but we also detected the regular presence of beetles, true bugs, and crickets. Presence of terrestrial insects in stomachs indicates that bats may have gleaned them from the ground or the turbine surfaces, yet aerial capture of winged insect stages cannot be ruled out. Our findings confirm earlier studies that indicate hoary bats feed during migration and eat mostly moths. Future studies on bat behaviors and insect presence at wind turbines could help determine whether feeding at turbines is a major fatality risk for bats.

  8. Fecal glucocorticoid metabolite response of captive koalas (Phascolarctos cinereus) to visitor encounters.

    Science.gov (United States)

    Webster, Koa; Narayan, Edward; de Vos, Nicholas

    2017-04-01

    Physiological responses of wildlife species to zoo visitors should be studied to better understand how wildlife perceive human encounters. We conducted an experimental test of the effect of changes in zoo visitor encounter experiences on the glucocorticoid (GC) response of koalas (Phascolarctos cinereus) in a Sydney zoo. Koalas were housed in a multiple-bay enclosure (two to three koalas per bay) for photography sessions with zoo visitors (no touching of koalas permitted by visitors). Following a one-week no-photography baseline period, photography sessions were rotated between three enclosure bays for four weeks (Intensive photography), then between five enclosure bays for an additional four weeks (Standard photography). A sixth enclosure bay was never included in the photography sessions (control bay); koalas in this bay showed no significant change in fecal cortisol metabolites (FCMs) during the course of the study. In the five experimental bays differences were seen between male and female koalas. Males had higher mean FCMs than females, and individual FCM traces showed that two male koalas that were related and of similar age responded strongly to the experimental manipulation. These two males showed a peak in FCMs at the beginning of the Intensive photography period, then a decline when photography sessions returned to the Standard protocol. No systematic pattern in response to photography sessions was observed in females. Our results demonstrate successful application of a non-invasive endocrinology tool for assessing the stress biology and welfare of captive zoo wildlife. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. The koala (Phascolarctos cinereus): a case study in the development of reproductive technology in a marsupial.

    Science.gov (United States)

    Johnston, Stephen D; Holt, William V

    2014-01-01

    The successful development and application of an assisted breeding program in any animal relies primarily on a thorough understanding of the fundamental reproductive biology (anatomy, physiology and behaviour) of the species in question. Surely, the ultimate goal and greatest hallmark of such a program is the efficacious establishment of a series of reliable techniques that facilitate the reproductive and genetic management of fragmented populations, both in captivity and in the wild. Such an achievement is all the more challenging when the reproductive biology of that species is essentially rudimentary and without adequate reproductive models to compare to. Using the koala (Phascolarctos cinereus) as a case study, this chapter provides some personal insights into the evolution of a concept that began as a small undergraduate student project but that subsequently evolved into the first-ever successful artificial insemination of a marsupial. Apart from this historical perspective, we also provide a brief review of the current reproductive biology of the koala, discuss technical elements of current assisted breeding technology of this species, its potential application to the wombat, and the future role it might play in helping to conserve wild koala populations. There is little doubt that the unique reproductive biology and tractability of the koala has in this case been a benefit rather than a hindrance to the success of artificial breeding in this species.

  10. Lymphoma, Koala Retrovirus Infection and Reproductive Chlamydiosis in a Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Fabijan, J; Woolford, L; Lathe, S; Simmons, G; Hemmatzadeh, F; Trott, D J; Speight, N

    Koala retrovirus (KoRV) infection, thought to be associated with lymphoid neoplasia, and Chlamydia pecorum-related ocular and urogenital disease are both highly prevalent in eastern Australian koala (Phascolarctos cinereus) populations. However, in South Australian koalas, little is known about KoRV infection and C. pecorum-associated disease. We report the first South Australian case of lymphoma in a KoRV-A-positive female koala also affected by severe reproductive chlamydiosis. The koala was from the Mount Lofty Ranges population and was presented with hindlimb lameness. Clinical examination identified right stifle crepitus, enlarged superficial lymph nodes and paraovarian cysts. Necropsy examination revealed extensive cartilage degeneration and loss over the medial femoral condyle, solid femoral bone marrow, mesenteric and ovarian tumours, paraovarian cysts and purulent metritis. Histopathology confirmed lymphoma in the bone marrow, mesenteric lymph nodes and ovary, with infiltration and parenchymal effacement in the pancreas, adrenal glands and other tissues. Lymphoma, KoRV and chlamydiosis are being investigated further in this population. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Serum vitamin D levels in free-ranging koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Pye, Geoffrey W; Ellis, William; FitzGibbon, Sean; Opitz, Brian; Keener, Laura; Hollis, Bruce W

    2013-06-01

    Due to climatic conditions in Northern America and Europe, koalas (Phascolarctos cinereus) are often housed indoors. Koala joeys raised in these environments are susceptible to the development of metabolic bone disease due to a lack of exposure to solar ultraviolet radiation to themselves and their dam. As an initial step toward describing vitamin D sufficiency and adequately measuring responses to supplementation, vitamin D values were calculated by using serum collected from 20 free-ranging koalas on St. Bees Island, Queensland, Australia. Vitamin D values ranged from 8.1 to 30.4 pg/ml (18.4 +/- 5.5 pg/ml) for 1, 25-hydroxyvitamin D, and from 1 to 14 nM/L (7.4 +/- 3.0 nM/L) for 25-hydroxyvitamin D. These koala serum vitamin D values are unusually low when compared with eutherian mammals. Although this study was limited in numbers and in the geographically range of the koalas sampled, it does suggest that the koala's requirement for vitamin D is low. Therefore, supplementation to prevent disease may be relatively easy to achieve because low doses will likely meet requirements. Caution should be taken to avoid intoxication if supplementing vitamin D in koalas.

  12. Investigation of the koala (Phascolarctos cinereus) hindgut microbiome via 16S pyrosequencing.

    Science.gov (United States)

    Barker, Christopher J; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2013-12-27

    As a dietary source, the foliage of Eucalyptus spp. is low in available protein and carbohydrate while containing polyphenolic compounds that interfere with enzymatic digestion. To overcome this, the koala (Phascolarctos cinereus) has evolved a range of anatomical and physiological adaptations to assist with digestion and absorption of nutrients from this food source. Microbial fermentation of partially digested eucalyptus leaves is thought to be critical in this process, however, little is known about the composition and diversity of microorganisms that are associated with digestive health in this native species. In this study, we performed 16S rRNA gene pyrosequencing of caecum, colon and faecal pellet samples from two wild, free ranging, Queensland koalas. Our results reveal a highly complex and diverse ecosystem with considerable intra-individual variation. Although samples were dominated by sequences from the Bacteroidetes and Firmicutes phyla there was considerable variation at the genus level. This study is the first non-culture based microbiota analysis, using 454-amplicon pyrosequencing, and provides preliminary data to expand our understanding of the koala hindgut. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. MHC class II diversity of koala (Phascolarctos cinereus) populations across their range.

    Science.gov (United States)

    Lau, Q; Jaratlerdsiri, W; Griffith, J E; Gongora, J; Higgins, D P

    2014-10-01

    Major histocompatibility complex class II (MHCII) genes code for proteins that bind and present antigenic peptides and trigger the adaptive immune response. We present a broad geographical study of MHCII DA β1 (DAB) and DB β1 (DBB) variants of the koala (Phascolarctos cinereus; n=191) from 12 populations across eastern Australia, with a total of 13 DAB and 7 DBB variants found. We identified greater MHCII variation and, possibly, additional gene copies in koala populations in the north (Queensland and New South Wales) relative to the south (Victoria), confirmed by STRUCTURE analyses and genetic differentiation using analysis of molecular variance. The higher MHCII diversity in the north relative to south could potentially be attributed to (i) significant founder effect in Victorian populations linked to historical translocation of bottlenecked koala populations and (ii) increased pathogen-driven balancing selection and/or local genetic drift in the north. Low MHCII genetic diversity in koalas from the south could reduce their potential response to disease, although the three DAB variants found in the south had substantial sequence divergence between variants. This study assessing MHCII diversity in the koala with historical translocations in some populations contributes to understanding the effects of population translocations on functional genetic diversity.

  14. Cryptococcosis in the koala (Phascolarctos cinereus): pathogenesis and treatment in the context of two atypical cases.

    Science.gov (United States)

    Schmertmann, Laura J; Stalder, Kathryn; Hudson, Donald; Martin, Patricia; Makara, Mariano; Meyer, Wieland; Malik, Richard; Krockenberger, Mark B

    2018-02-24

    Disseminated cryptococcosis caused by Cryptococcus gattii (molecular type VGI) was diagnosed in an adult free-ranging female koala (Phascolarctos cinereus). Subclinical cryptococcosis was later diagnosed in this koala's joey. In the adult koala, a pathological fracture of the tibia was associated with the bone lysis of marked focal cryptococcal osteomyelitis. Limb-sparing orthopedic intervention, in the setting of disseminated cryptococcosis, was judged to have a poor prognosis, and the adult koala was euthanized. The joey was removed and hand-reared. Serological testing revealed persistent and increasing cryptococcal capsular antigenemia in the absence of clinical signs of disease and it was subsequently treated with oral fluconazole for approximately 16 months, rehabilitated and released into the wild. It was sighted 3 months post-release in a good state of health and again at 18 months post-release but was not recaptured on either occasion. This is the first published report of cryptococcal appendicular osteomyelitis in a koala. It is also the first report of concurrent disease in a dependent juvenile and the successful treatment of subclinical cryptococcosis to full resolution of the cryptococcal antigenemia in a free-ranging koala. This paper provides a discussion of cryptococcal osteomyelitis in animals, host-pathogen-environment interactions and treatment and monitoring protocols for cryptococcosis in koalas. Published reports describing the treatment of cryptococcosis in koalas are also collated and summarised.

  15. Two distinct forms of Chlamydia psittaci associated with disease and infertility in Phascolarctos cinereus (koala).

    Science.gov (United States)

    Girjes, A A; Hugall, A F; Timms, P; Lavin, M F

    1988-01-01

    While several diseases associated with Chlamydia psittaci infection have been reported in Phascolarctos cinereus (koala), it is still unclear whether one or more chlamydial strains are responsible. In this study, we provide evidence, obtained by restriction enzyme and gene probe analysis, that two quite distinct strains of C. psittaci infect koalas; one strain was isolated from the conjunctivae, and the other was isolated from the urogenital tract and the rectum. A gene probe, pFEN207, containing the coding sequence for an enzyme involved in the biosynthesis of the chlamydial genus-specific lipopolysaccharide antigen, and a separate probe, pCPML-4N, prepared from a DNA fragment of a koala-infecting strain of C. psittaci, were used to determine the patterns of hybridization in the koala-infecting strains; these patterns were found to be quite distinct from those observed with C. psittaci isolates from other animals. We also demonstrated by hybridization analysis with an avian strain plasmid that all three koala urogenital isolates contain a plasmid and that there is no evidence for the presence of a homologous plasmid in any of the ocular isolates. Images PMID:3397180

  16. Serum protein electrophoresis values for free-ranging and zoo-based koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Pye, Geoffrey W; Ellis, William; Fitzgibbon, Sean; Opitz, Brian; Keener, Laura; Arheart, Kristopher L; Cray, Carolyn

    2012-03-01

    In a clinical setting, especially with species of special interest, it is important to use all clinical pathology testing options for general health monitoring and diagnosis. Protein electrophoresis (EPH) has previously been shown to be an important adjunct tool in veterinary medicine. Serum samples from 18 free-ranging and 12 zoo-based koalas (Phascolarctos cinereus) were subject to EPH analysis. Significant differences were found between the two groups for the following values: total protein, albumin, beta globulins, and albumin-globulin ratio (P < 0.05). By using the combined data, the minimum-maximum values for the EPH fractions were as follows: total protein 5.0-7.8 g/dl, albumin 2.8-4.7 g/dl, alpha-1 globulins 0.5-1.1 g/dl, alpha-2 globulins 0.3-0.7 g/dl, beta globulins 0.4-1.0 g/dl, gamma globulins 0.2-1.0 g/dl, and albumin-globulin ratio 1.0-2.1.

  17. PREVALENCE AND PATHOLOGIC FEATURES OF CHLAMYDIA PECORUM INFECTIONS IN SOUTH AUSTRALIAN KOALAS (PHASCOLARCTOS CINEREUS).

    Science.gov (United States)

    Speight, K Natasha; Polkinghorne, Adam; Penn, Rachel; Boardman, Wayne; Timms, Peter; Fraser, Tamieka; Johnson, Kathryn; Faull, Rachel; Bate, Sarah; Woolford, Lucy

    2016-04-28

    Chlamydia pecorum infection is highly prevalent in many koala ( Phascolarctos cinereus ) populations in the eastern states of Australia, causing ocular and urogenital tract disease. In contrast, the current prevalence of chlamydiosis in South Australian (SA) koalas is largely unknown, with few reports of clinical cases. We examined 65 SA rescued wild koalas at necropsy and collected ocular and urogenital swabs for the detection of C. pecorum by PCR. We detected C. pecorum in ocular or urogenital swabs from 57 koalas (88%), and 34 koalas were positive at both ocular and urogenital sites. Clinically overt chlamydial disease was present in only 12 (21%) positive koalas. Gross lesions were often externally inapparent as they affected the urogenital tract (n=5), and 24 infected koalas had microscopically evident lesions only. Lesions were predominantly mild and included conjunctivitis, cystitis, and urethritis. Reproductive tract disease was infrequently observed. We detected C. pecorum in 16 (28%) koalas with no evidence of chlamydial disease, suggesting the presence of subclinical carriers in this population. Based on these findings, chlamydiosis has a higher occurrence in SA koala populations than previously thought, but is most often mild and does not always result in overt clinical disease; inapparent and subclinical infections appear common. Further studies of the prevalence in wild-caught SA koalas are needed along with research into the host and bacterial factors that may influence disease outcome in these animals.

  18. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

    Science.gov (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

    2017-08-25

    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  19. Treatment of Chlamydia-associated ocular disease via a recombinant protein based vaccine in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Waugh, Courtney; Austin, Ray; Polkinghorne, Adam; Timms, Peter

    2016-11-01

    Koalas (Phascolarctos cinereus) are affected by debilitating chlamydial disease that can lead to blindness, infertility, and death. The causative agent is the intracellular bacterium Chlamydia pecorum. While antibiotics can be used to treat koala chlamydial infection, they are often ineffective or cause severe dysbiosis to the animal's unique gut flora. Recent work has progressed on the development of a protective vaccine for Chlamydia in the koala. This study demonstrates that the use of a vaccine can have a positive effect in koalas already with clinical signs of ocular disease, suggesting a possible therapeutic effect and an alternative to antibiotic therapy. Copyright © 2016 International Alliance for Biological Standardization. All rights reserved.

  20. ATYPICAL PRESENTATION OF CRYPTOCOCCUS NEOFORMANS IN A KOALA (PHASCOLARCTOS CINEREUS): A MAGNETIC RESONANCE IMAGING AND COMPUTED TOMOGRAPHY STUDY.

    Science.gov (United States)

    Martínez-Nevado, Eva; Alonso-Alegre, Elisa González; Martínez, M Ángeles Jiménez; Rodríguez-Álvaro, Alfonso; de Merlo, Elena Martínez; García, Juncal García; Real, Isabel García

    2017-03-01

    Cryptococcosis is a worldwide and potentially fatal mycosis documented in wild and captive koalas ( Phascolarctos cinereus ) caused by Cryptococcus neoformans . Though mainly a subclinical disease, when the nasal cavity is affected, epistaxis, mucopurulent nasal discharge, dyspnea, and facial distortion may occur. This report describes a case of cryptococcosis in a koala where unilateral exophthalmos was the only evident clinical sign and magnetic resonance imaging and computed tomography findings are described. Both advanced imaging techniques should be considered as standard and complementary techniques for nasal cavity evaluation in koalas.

  1. Perivertebral B-cell lymphoma in a Queensland koala (Phascolarctos cinereus adustus) with paralytic symptoms in the hind limbs.

    Science.gov (United States)

    Kido, Nobuhide; Edamura, Kazuya; Inoue, Naomi; Shibuya, Hisashi; Sato, Tsuneo; Kondo, Masako; Shindo, Izumi

    2012-08-01

    A male Queensland koala (Phascolarctos cinereus adustus) at Kanazawa Zoological Gardens (Kanagawa, Japan) exhibited paralytic symptoms in the hind limbs. Computed tomography and magnetic resonance imaging revealed a mass on the left ventral side of the 11th to 13th thoracic vertebrae, and the presence of myelitis or edema in the spinal cord. The koala was under anesthesia during the examination and suddenly developed ventricular fibrillation and died. Necropsy revealed a firm flat ovoid hemorrhagic mass on the vertebrae. Following a microscopic examination including immunohistochemistry, the perivertebral mass was diagnosed as B cell lymphoma. Therefore, neoplastic cell infiltration into the spinal cord may cause paralytic symptoms in the hind limbs.

  2. Development of 14 microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus) using next generation sequencing technology.

    Science.gov (United States)

    Ruiz-Rodriguez, Christina T; Ishida, Yasuko; Greenwood, Alex D; Roca, Alfred L

    2014-06-01

    We report the development of 14 new microsatellite markers in the Queensland koala ( Phascolarctos cinereus adustus ). Ten unrelated Queensland koala individuals from the San Diego Zoo, USA, were genotyped. The number of alleles per locus ranged from 2 to 7, with an average of 5.14 alleles per locus. Across all loci, the average observed and expected heterozygosity values were both 0.69. These polymorphic microsatellite loci will be useful for genetic studies relevant to the conservation of the koala, a species listed as vulnerable.

  3. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  4. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.

    1980-01-01

    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  5. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

    OpenAIRE

    Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

    2006-01-01

    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  6. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  7. Phylogeography of the Koala, (Phascolarctos cinereus), and Harmonising Data to Inform Conservation

    Science.gov (United States)

    Neaves, Linda E.; Frankham, Greta J.; Dennison, Siobhan; FitzGibbon, Sean; Flannagan, Cheyne; Gillett, Amber; Hynes, Emily; Handasyde, Kathrine; Helgen, Kristofer M.; Tsangaras, Kyriakos; Greenwood, Alex D.; Eldridge, Mark D. B.; Johnson, Rebecca N.

    2016-01-01

    The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus), one of Australia’s most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA) Control Region (CR) was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study). The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context. PMID:27588685

  8. Characterization of shifts of koala (Phascolarctos cinereus intestinal microbial communities associated with antibiotic treatment

    Directory of Open Access Journals (Sweden)

    Katherine E. Dahlhausen

    2018-03-01

    Full Text Available Koalas (Phascolarctos cinereus are arboreal marsupials native to Australia that eat a specialized diet of almost exclusively eucalyptus leaves. Microbes in koala intestines are known to break down otherwise toxic compounds, such as tannins, in eucalyptus leaves. Infections by Chlamydia, obligate intracellular bacterial pathogens, are highly prevalent in koala populations. If animals with Chlamydia infections are received by wildlife hospitals, a range of antibiotics can be used to treat them. However, previous studies suggested that koalas can suffer adverse side effects during antibiotic treatment. This study aimed to use 16S rRNA gene sequences derived from koala feces to characterize the intestinal microbiome of koalas throughout antibiotic treatment and identify specific taxa associated with koala health after treatment. Although differences in the alpha diversity were observed in the intestinal flora between treated and untreated koalas and between koalas treated with different antibiotics, these differences were not statistically significant. The alpha diversity of microbial communities from koalas that lived through antibiotic treatment versus those who did not was significantly greater, however. Beta diversity analysis largely confirmed the latter observation, revealing that the overall communities were different between koalas on antibiotics that died versus those that survived or never received antibiotics. Using both machine learning and OTU (operational taxonomic unit co-occurrence network analyses, we found that OTUs that are very closely related to Lonepinella koalarum, a known tannin degrader found by culture-based methods to be present in koala intestines, was correlated with a koala’s health status. This is the first study to characterize the time course of effects of antibiotics on koala intestinal microbiomes. Our results suggest it may be useful to pursue alternative treatments for Chlamydia infections without the use of

  9. Epidemiology of chlamydial infection and disease in a free-ranging koala (Phascolarctos cinereus population.

    Directory of Open Access Journals (Sweden)

    Sharon Nyari

    Full Text Available Chlamydial disease continues to be one of the main factors threatening the long-term survival of the koala (Phascolarctos cinereus. Despite this, large epidemiological studies of chlamydial infection and disease in wild koala populations are lacking. A better understanding of the prevalence, transmission and pathogenesis is needed to improve control measures, such as the development of vaccines. We investigated the prevalence of Chlamydia pecorum infection and disease in 160 koalas in a peri-urban wild population in Queensland, Australia and found that 31% of koalas were Chlamydia PCR positive and 28% had clinically detectable chlamydial disease. Most infections were at the urogenital site (27%; both males and females with only 14% at the ocular site. Interestingly, we found that 27% (4/15 of koalas considered to be sexually immature (9-13 months were already infected with C. pecorum, suggesting that a significant percentage of animals are infected directly from their mother. Ocular infection levels were less prevalent with increasing age (8% in koalas older than 4 years, whereas the prevalence of urogenital tract infections remained high into older age (26% in koalas older than 4 years, suggesting that, after mother-to-young transmission, C. pecorum is predominantly a sexually transmitted infection. While 28% of koalas in this population had clinically detectable chlamydial disease (primarily urogenital tract disease, many PCR positive koalas had no detectable disease and importantly, not all diseased animals were PCR positive. We also observed higher chlamydial loads in koalas who were C. pecorum infected without clinical disease than in koalas who were C. pecorum infected with clinical disease. These results shed light on the potential mechanisms of transmission of C. pecorum in koalas and also guide future control measures, such as vaccination.

  10. Epidemiology of chlamydial infection and disease in a free-ranging koala (Phascolarctos cinereus) population.

    Science.gov (United States)

    Nyari, Sharon; Waugh, Courtney A; Dong, Jianbao; Quigley, Bonnie L; Hanger, Jonathan; Loader, Joanne; Polkinghorne, Adam; Timms, Peter

    2017-01-01

    Chlamydial disease continues to be one of the main factors threatening the long-term survival of the koala (Phascolarctos cinereus). Despite this, large epidemiological studies of chlamydial infection and disease in wild koala populations are lacking. A better understanding of the prevalence, transmission and pathogenesis is needed to improve control measures, such as the development of vaccines. We investigated the prevalence of Chlamydia pecorum infection and disease in 160 koalas in a peri-urban wild population in Queensland, Australia and found that 31% of koalas were Chlamydia PCR positive and 28% had clinically detectable chlamydial disease. Most infections were at the urogenital site (27%; both males and females) with only 14% at the ocular site. Interestingly, we found that 27% (4/15) of koalas considered to be sexually immature (9-13 months) were already infected with C. pecorum, suggesting that a significant percentage of animals are infected directly from their mother. Ocular infection levels were less prevalent with increasing age (8% in koalas older than 4 years), whereas the prevalence of urogenital tract infections remained high into older age (26% in koalas older than 4 years), suggesting that, after mother-to-young transmission, C. pecorum is predominantly a sexually transmitted infection. While 28% of koalas in this population had clinically detectable chlamydial disease (primarily urogenital tract disease), many PCR positive koalas had no detectable disease and importantly, not all diseased animals were PCR positive. We also observed higher chlamydial loads in koalas who were C. pecorum infected without clinical disease than in koalas who were C. pecorum infected with clinical disease. These results shed light on the potential mechanisms of transmission of C. pecorum in koalas and also guide future control measures, such as vaccination.

  11. Koalas (Phascolarctos cinereus) From Queensland Are Genetically Distinct From 2 Populations in Victoria.

    Science.gov (United States)

    Ruiz-Rodriguez, Christina T; Ishida, Yasuko; Murray, Neil D; O'Brien, Stephen J; Graves, Jennifer A M; Greenwood, Alex D; Roca, Alfred L

    2016-01-01

    The koala (Phascolarctos cinereus) suffered population declines and local extirpation due to hunting in the early 20th century, especially in southern Australia. Koalas were subsequently reintroduced to the Brisbane Ranges (BR) and Stony Rises (SR) by translocating individuals from a population on French Island descended from a small number of founders. To examine genetic diversity and north-south differentiation, we genotyped 13 microsatellite markers in 46 wild koalas from the BR and SR, and 27 Queensland koalas kept at the US zoos. The Queensland koalas displayed much higher heterozygosity (H O = 0.73) than the 2 southern Australian koala populations examined: H O = 0.49 in the BR, whereas H O = 0.41 in the SR. This is consistent with the historical accounts of bottlenecks and founder events affecting the southern populations and contrasts with reports of high genetic diversity in some southern populations. The 2 southern Australian koala populations were genetically similar (F ST = 0.018, P = 0.052). By contrast, northern and southern Australian koalas were highly differentiated (F ST = 0.27, P < 0.001), thereby suggesting that geographic structuring should be considered in the conservation management of koalas. Sequencing of 648bp of the mtDNA control region in Queensland koalas found 8 distinct haplotypes, one of which had not been previously detected among koalas. Queensland koalas displayed high mitochondrial haplotype diversity (H = 0.753) and nucleotide diversity (π = 0.0072), indicating along with the microsatellite data that North American zoos have maintained high levels of genetic diversity among their Queensland koalas. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Characterization of shifts of koala (Phascolarctos cinereus) intestinal microbial communities associated with antibiotic treatment.

    Science.gov (United States)

    Dahlhausen, Katherine E; Doroud, Ladan; Firl, Alana J; Polkinghorne, Adam; Eisen, Jonathan A

    2018-01-01

    Koalas ( Phascolarctos cinereus ) are arboreal marsupials native to Australia that eat a specialized diet of almost exclusively eucalyptus leaves. Microbes in koala intestines are known to break down otherwise toxic compounds, such as tannins, in eucalyptus leaves. Infections by Chlamydia , obligate intracellular bacterial pathogens, are highly prevalent in koala populations. If animals with Chlamydia infections are received by wildlife hospitals, a range of antibiotics can be used to treat them. However, previous studies suggested that koalas can suffer adverse side effects during antibiotic treatment. This study aimed to use 16S rRNA gene sequences derived from koala feces to characterize the intestinal microbiome of koalas throughout antibiotic treatment and identify specific taxa associated with koala health after treatment. Although differences in the alpha diversity were observed in the intestinal flora between treated and untreated koalas and between koalas treated with different antibiotics, these differences were not statistically significant. The alpha diversity of microbial communities from koalas that lived through antibiotic treatment versus those who did not was significantly greater, however. Beta diversity analysis largely confirmed the latter observation, revealing that the overall communities were different between koalas on antibiotics that died versus those that survived or never received antibiotics. Using both machine learning and OTU (operational taxonomic unit) co-occurrence network analyses, we found that OTUs that are very closely related to Lonepinella koalarum , a known tannin degrader found by culture-based methods to be present in koala intestines, was correlated with a koala's health status. This is the first study to characterize the time course of effects of antibiotics on koala intestinal microbiomes. Our results suggest it may be useful to pursue alternative treatments for Chlamydia infections without the use of antibiotics or the

  13. Potential 'ecological traps' of restored landscapes: koalas Phascolarctos cinereus re-occupy a rehabilitated mine site.

    Science.gov (United States)

    Cristescu, Romane H; Banks, Peter B; Carrick, Frank N; Frère, Céline

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community should include criteria

  14. Gastrointestinal torsions and intussusception in northern koalas (Phascolarctos cinereus) at San Diego Zoo (1976-2012).

    Science.gov (United States)

    Joyce-Zuniga, Nicole M; Roesler, Jennifer; Andrus, Chris Hamlin; Sutherland-Smith, Meg; Rideout, Bruce A; Pye, Geoffrey W

    2014-03-01

    The recent classification as threatened status of the northern koala (Phascolarctos cinereus) by the Australian Government highlights the importance of the conservation and health management of this iconic Australian marsupial. This case series describes gastrointestinal torsion and intussusception in six northern koalas (three males, three females, 2-11 yr old) at the San Diego Zoo from 1976 to 2012. Two koalas died shortly after presentation. Diagnoses of ileocecal intussusception, resulting from enteritis in one case and cecal torsion in the other, were made at postmortem examination. One koala died 4 days after an exploratory laparotomy, with negative findings, and an acute double colonic intussusception was diagnosed at postmortem examination. Two small intestinal mesenteric torsion and one proximal colon mesenteric torsion cases were successfully corrected surgically. In the case of colonic mesenteric torsion, the koala had recurrent clinical signs 2 wk later, and a second surgery requiring resection and anastomosis of ischemic jejunum was performed, with the koala dying shortly afterward. One koala with small intestinal torsion had a recurrence of torsion 22 mo later and subsequently died. The koala with the second case of small intestinal torsion remains alive 14 mo postsurgical correction. All six koalas presented with signs of colic that included anorexia, lethargy, depression, acute abdominal distension, abdominal stretching, decreased fecal output, open-mouth gasping, or a combination of symptoms. Abdominal radiographs may show stacked gastrointestinal linear gas patterns and contrast stasis. Prevalence of torsion and intussusception is low at this institution (2%), although recurrence in individuals is common (50%) and overall survival is poor (83%), which emphasizes the importance of timely recognition, surgical correction, and postoperative management. While inciting etiologies were unable to be determined in these cases, monitoring generalized

  15. Phylogeography of the Koala, (Phascolarctos cinereus, and Harmonising Data to Inform Conservation.

    Directory of Open Access Journals (Sweden)

    Linda E Neaves

    Full Text Available The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus, one of Australia's most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA Control Region (CR was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study. The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context.

  16. Phylogeography of the Koala, (Phascolarctos cinereus), and Harmonising Data to Inform Conservation.

    Science.gov (United States)

    Neaves, Linda E; Frankham, Greta J; Dennison, Siobhan; FitzGibbon, Sean; Flannagan, Cheyne; Gillett, Amber; Hynes, Emily; Handasyde, Kathrine; Helgen, Kristofer M; Tsangaras, Kyriakos; Greenwood, Alex D; Eldridge, Mark D B; Johnson, Rebecca N

    2016-01-01

    The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus), one of Australia's most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA) Control Region (CR) was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study). The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context.

  17. Potential 'ecological traps' of restored landscapes: koalas Phascolarctos cinereus re-occupy a rehabilitated mine site.

    Directory of Open Access Journals (Sweden)

    Romane H Cristescu

    Full Text Available With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community

  18. Accumulation of Methylmercury in Invertebrates and Masked Shrews (Sorex cinereus) at an Upland Forest-Peatland Interface in Northern Minnesota, USA.

    Science.gov (United States)

    Tavshunsky, Ilana; Eggert, Susan L; Mitchell, Carl P J

    2017-12-01

    Mercury (Hg) methylation is often elevated at the terrestrial-peatland interface, but methylmercury (MeHg) production at this "hot spot" has not been linked with in situ biotic accumulation. We examined total Hg and MeHg levels in peat, invertebrates and tissues of the insectivore Sorex cinereus (masked shrew), inhabiting a terrestrial-peatland ecotone in northern Minnesota, USA. Mean MeHg concentrations in S. cinereus (71 ng g -1 ) fell between concentrations measured in spiders (mean 70-140 ng g -1 ), and ground beetles and millipedes (mean 29-42 ng g -1 ). Methylmercury concentrations in S. cinereus increased with age and differed among tissues, with highest concentrations in kidneys and muscle, followed by liver and brain. Nearly all Hg in S. cinereus was in the methylated form. Overall, the high proportional accumulation of MeHg in peat at the site (3.5% total Hg as MeHg) did not lead to particularly elevated concentrations in invertebrates or shrews, which are below values considered a toxicological risk.

  19. Serum Antibody Response to Koala Retrovirus Antigens Varies in Free-Ranging Koalas ( Phascolarctos cinereus ) in Australia: Implications for Vaccine Design.

    Science.gov (United States)

    Waugh, Courtney; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2016-04-28

    Little is known about the immune response in the koala ( Phascolarctos cinereus ) to its retroviruses. Koala retroviruses (KoRVs) have been linked to neoplasia in wild and captive koalas, but there is no treatment available. We tested the KoRV-specific serum immunoglobulin G antibody response in nonimmunized and immunized koalas.

  20. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  1. Toxicological responses of red-backed salamanders (Plethodon cinereus) to subchronic soil exposures of 2,4-dinitrotoluene

    International Nuclear Information System (INIS)

    Johnson, Mark S.; Suski, Jamie; Bazar, Matthew A.

    2007-01-01

    Dinitrotoluenes are used as propellants and in explosives by the military and as such have been found at relatively high concentrations in the soil. To determine whether concentrations of 2,4-dinitrotoluene (2,4-DNT) in soil are toxic to amphibians, 100 red-backed salamanders (Plethodon cinereus) were exposed to either 1500, 800, 200, 75 or 0 mg 2,4-DNT/kg soil for 28 days and evaluated for indicators of toxicity. Concentrations of 2,4-DNT were less than targets and varied with time. Most salamanders exposed to concentrations exceeding 1050 mg/kg died or were moribund within the first week. Salamanders exposed to soil concentrations exceeding 345 mg/kg lost >6% of their body mass though no mortality occurred. Overt effects included a reduction in feed consumption and an increase in bucco-pharyngeal oscillations in salamanders. These results suggest that only high soil concentrations of 2,4-DNT have the potential to cause overtly toxic effects in terrestrial salamanders. - Exposures of 2,4-dinitrotoluene in soil exceeding 345 mg/kg causes toxicity to P. cinereus

  2. Tongue and taste organ development in the ontogeny of direct-developing salamander Plethodon cinereus (Lissamphibia: Plethodontidae).

    Science.gov (United States)

    Budzik, Karolina A; Żuwała, Krystyna; Kerney, Ryan

    2016-07-01

    The latest research on direct developing caecilian and anuran species indicate presence of only one generation of taste organs during their ontogeny. This is distinct from indirect developing batrachians studied thus far, which possess taste buds in larvae and anatomically distinct taste discs in metamorphs. This study is a description of the tongue and taste organ morphology and development in direct developing salamander Plethodon cinereus (Plethodontidae) using histology and electron microscopy techniques. The results reveal two distinct stages tongue morphology (primary and secondary), similar to metamorphic urodeles, although only one stage of taste organ morphology. Taste disc sensory zones emerge on the surface of the oropharyngeal epithelium by the end of embryonic development, which coincides with maturation of the soft tongue. Taste organs occur in the epithelium of the tongue pad (where they are situated on the dermal papillae), the palate and the inner surface of the mandible and the maxilla. Plethodon cinereus embryos only possess taste disc type taste organs. Similar to the direct developing anuran Eleutherodactylus coqui (Eleutherodactylidae), these salamanders do not recapitulate larval taste bud morphology as an embryo. The lack of taste bud formation is probably a broadly distributed feature characteristic to direct developing batrachians. J. Morphol. 277:906-915, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity.

    Science.gov (United States)

    Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J; Eldridge, Mark D B; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N; Timms, Peter

    2014-09-11

    The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. RNA-Seq data was generated from a range of tissues from one male and one female koala and assembled de novo into transcripts using Velvet-Oases. Transcript abundance in each tissue was estimated. Transcripts were searched for likely protein-coding regions and a non-redundant set of 117,563 putative protein sequences was produced. In similarity searches there were 84,907 (72%) sequences that aligned to at least one sequence in the NCBI nr protein database. The best alignments were to sequences from other marsupials. After applying a reciprocal best hit requirement of koala sequences to those from tammar wallaby, Tasmanian devil and the gray short-tailed opossum, we estimate that our transcriptome dataset represents approximately 15,000 koala genes. The marsupial alignment information was used to look for potential gene duplications and we report evidence for copy number expansion of the alpha amylase gene, and of an aldehyde reductase gene.Koala retrovirus (KoRV) transcripts were detected in the transcriptomes. These were analysed in detail and the structure of the spliced envelope gene transcript was determined. There was appreciable sequence diversity within KoRV, with 233 sites in the KoRV genome showing small insertions/deletions or single nucleotide polymorphisms. Both koalas had sequences from the KoRV-A subtype, but the male koala transcriptome has, in addition, sequences more closely related to the KoRV-B subtype. This is the first report of a KoRV-B-like sequence in a wild population. This transcriptomic

  4. Non-invasive evaluation of physiological stress in an iconic Australian marsupial: the Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Narayan, Edward J; Webster, Koa; Nicolson, Vere; Mucci, Al; Hero, Jean-Marc

    2013-06-15

    Koalas (Phascolarctos cinereus) are the only extant representatives of Australia's unique marsupial family Phascolarctidae and were listed as nationally Vulnerable in 2012. Causes of mortality are diverse, although the disease chlamydiosis, dog attacks, collisions with cars, and loss of habitat represent the principal reasons for the continued species decline. Koala breeding facilities in Queensland and New South Wales, Australia have been established for conservation and tourism. Non-invasive monitoring of physiological stress is important for determining the sub-lethal effects of environmental stressors on the well-being, reproduction and survival of Koalas in Zoos and also in the wild. In this study, we developed a faecal cortisol metabolite (FCM) enzyme-immunoassay (EIA) for monitoring physiological stress in Koalas from two established Zoos in Australia and also within a free-living sub-population from Queensland. Biological validation of the FCM EIA was done using an adrenocorticotropic hormone (ACTH) challenge. We discovered excretory lag-times of FCM of 24 h in females (n=2) and 48 h in male (n=2) Koalas in response to the ACTH challenge. FCM levels showed an episodic and delayed peak response lasting up to 9 days post ACTH challenge. This finding should be taken into consideration when designing future experiments to study the impacts of short-term (acute) and chronic stressors on the Koalas. Laboratory validations were done using parallelism and recovery checks (extraction efficiency) of the cortisol standard against pooled Koala faecal extracts. Greater than 99% recovery of the cortisol standard was obtained as well as a parallel displacement curve against Koala faecal extracts. FCM levels of the captive Koalas (n=10 males and 13 females) significantly differed by sex, reproductive condition (lactating versus non-lactating Koalas) and the handling groups. Handled male Koalas had 200% higher FCM levels than their non-handled counterparts, while females

  5. Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi.

    Science.gov (United States)

    Upadhyay, R C; Hofrichter, M

    1993-01-01

    Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.

  6. Comparison of antigen detection and quantitative PCR in the detection of chlamydial infection in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Hanger, Jon; Loader, Joanne; Wan, Charles; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-03-01

    The gold standard method for detecting chlamydial infection in domestic and wild animals is PCR, but the technique is not suited to testing animals in the field when a rapid diagnosis is frequently required. The objective of this study was to compare the results of a commercially available enzyme immunoassay test for Chlamydia against a quantitative Chlamydia pecorum-specific PCR performed on swabs collected from the conjunctival sac, nasal cavity and urogenital sinuses of naturally infected koalas (Phascolarctos cinereus). The level of agreement for positive results between the two assays was low (43.2%). The immunoassay detection cut-off was determined as approximately 400 C. pecorum copies, indicating that the test was sufficiently sensitive to be used for the rapid diagnosis of active chlamydial infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Fat-soluble vitamin and mineral comparisons between zoo-based and free-ranging koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Schmidt, Debra A; Pye, Geoffrey W; Hamlin-Andrus, Chris C; Ellis, William A; Bercovitch, Fred B; Ellersieck, Mark R; Chen, Tai C; Holick, Michael F

    2013-12-01

    As part of a health investigation on koalas at San Diego Zoo, serum samples were analyzed from 18 free-ranging and 22 zoo-based koalas, Phascolarctos cinereus. Serum concentrations of calcium, chloride, cobalt, copper, iron, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, sodium, zinc, and vitamins A, E, and 25(OH)D3 were quantified. Calcium, chloride, molybdenum, selenium, and vitamin E concentrations were significantly higher in zoo-based koalas than in free-ranging koalas, whereas magnesium, manganese, phosphorus, and zinc concentrations were significantly higher in the free-ranging koalas. No significant differences were found between genders. The results from this study will help to establish a starting point for determining target circulating nutrient concentrations in koalas.

  8. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  9. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus) Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP) with Two Different Adjuvants

    OpenAIRE

    Khan, Shahneaz Ali; Desclozeaux, Marion; Waugh, Courtney; Hanger, Jon; Loader, Jo; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2016-01-01

    Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus). In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP) antigen-based vaccine, combined with immune stimulating complex (ISC) adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri...

  10. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  11. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  12. [Oil degradation by basidiomycetes in soil and peat at low temperatures].

    Science.gov (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

    2016-01-01

    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  13. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  14. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  15. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  16. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  17. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  18. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  19. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    Science.gov (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  20. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze

    2016-09-01

    Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  2. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  3. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  4. Dim ultraviolet light as a means of deterring activity by the Hawaiian hoary bat Lasiurus cinereus semotus

    Science.gov (United States)

    Gorresen, P. Marcos; Cryan, Paul M.; Dalton, David C.; Wolf, Sandy; Johnson, Jessica A.; Todd, Christopher M.; Bonaccorso, Frank J.

    2015-01-01

    Widespread bat fatalities at industrial wind turbines are a conservation issue with the potential to inhibit efficient use of an abundant source of energy. Bat fatalities can be reduced by altering turbine operations, but such curtailment decreases turbine efficiency. If additional ways of reducing bat fatalities at wind turbines were available such tradeoffs might not be needed. Based on the facts that bats perceive distant objects primarily through vision and can see in very dim lighting conditions, and the possibility that bats might interact with turbines after approaching them as they would trees, we propose a novel method of reducing bat activity at wind turbines: illumination of the structure with dim light. As a first step toward assessing this approach, we illuminated trees with dim flickering ultraviolet (UV) light in areas frequented by Hawaiian hoary bats Lasiurus cinereus semotus, an endangered subspecies affected by wind turbines. We used a repeated-measures design to quantify bat activity near trees with acoustic detectors and thermal video cameras in the presence and absence of UV illumination, while concurrently monitoring insect numbers. Results indicate that dim UV reduces bat activity despite an increase in insect numbers. Experimental treatment did not completely inhibit bat activity near trees, nor did all measures of bat activity show statistically significant differences due to high variance in bat activity among sites. However, the observed decreases in bat activity with dim UV illumination justify further testing of this method as a means to reduce bat fatalities at wind turbines.

  5. Is the modern koala ( Phascolarctos cinereus) a derived dwarf of a Pleistocene giant? Implications for testing megafauna extinction hypotheses

    Science.gov (United States)

    Price, Gilbert J.

    2008-12-01

    The modern Australian koala ( Phascolarctos cinereus) is commonly regarded as a dwarf descendent of a Late Pleistocene giant koala ( Ph. stirtoni). The implication of that hypothesis is that the giant koala survived the Late Pleistocene megafaunal extinction "event", albeit as a smaller body-sized form. It is important to be able to constrain rates of Late Pleistocene faunal turnover, an aspect reliant on having accurate taxonomic information of extinct species. The koala dwarfing hypothesis is tested here by using a temporally-constrained biogeographical record of fossil koalas, and a morphological character analysis. The contemporary occurrence of both taxa in pre-Late Pleistocene deposits and significant differences in dental morphologies between those forms suggests that the modern koala is not a derived dwarf of the Pleistocene giant koala. Thus, the giant-form was among a number of other giant mammals, lizards and birds that suffered extinction sometime during the Late Pleistocene. The potential phenomenon of dwarfing of other Late Pleistocene and Recent faunas, such as grey kangaroos, is commonly used as a test for or against various megafaunal extinction hypotheses. However, the results of this study also demonstrate that the dwarfing hypothesis has not been adequately tested for a suite of other taxa. Thus, until the dwarfing hypothesis can be more fully tested, a clear understanding of the fate of Late Pleistocene faunas that apparently survived the extinction "event", and the origins of many extant forms will remain elusive.

  6. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  7. Dental onlay bridge-like prosthesis in three koalas (Phascolarctos cinereus): the use of Premise trimodal composite to prevent interproximal Eucalyptus spp. retention and infection.

    Science.gov (United States)

    Perry, Sean M; Pye, Geoffrey W; Fagan, David A

    2014-06-01

    Three koalas (Phascolarctos cinereus) presented with moderate to severe interproximal space accumulation with Eucalyptus spp. at the San Diego Zoo. Premise trimodal composite was used to create dental onlay bridge-like prostheses to eliminate open, enlarged interproximal spaces. The prostheses prevented further leaf material accumulation within the interproximal spaces and consequently reduced periodontal disease. Aesthetically, the prosthesis replicates normal tooth coloration and appearance and wears at a similar rate to surrounding teeth. Prosthetic repair or replacement may be required, so periodic examination every 3-6 mo is recommended.

  8. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  9. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  10. Potential citric acid exposure and toxicity to Hawaiian hoary bats (Lasiurus cinereus semotus) associated with Eleutherodactylus frog control.

    Science.gov (United States)

    Pitt, William C; Witmer, Gary W; Jojola, Susan M; Sin, Hans

    2014-04-01

    We examined potential exposure of Hawaiian hoary bats (Lasiurus cinereus semotus) to citric acid, a minimum risk pesticide registered for control of invasive Eleutherodactylus frog populations. Hoary bats are nocturnal insectivores that roost solitarily in foliage, federally listed as endangered, and are endemic to Hawaii. Oral ingestion during grooming of contaminated fur appears to be the principal route by which these bats might be exposed to citric acid. We made assessments of oral toxicity, citric acid consumption, retention of material on fur, and grooming using big brown bats (Eptesicus fuscus) as a surrogate species. We evaluated both ground application and aerial application of 16 % solutions of citric acid during frog control operations. Absorbent bat effigies exposed to ground and aerial operational spray applications retained means of 1.54 and 0.02 g, respectively, of dry citric acid, although retention by the effigies was much higher than bat carcasses drenched in citric acid solutions. A high dose delivered orally (2,811 mg/kg) was toxic to the big brown bats and emesis occurred in 1 bat dosed as low as the 759 mg/kg level. No effect was observed with the lower doses examined (≤ 542 mg/kg). Bats sprayed with 5 ml of 16 % (w/w) citric acid solution showed no evidence of intoxication. In field situations, it is unlikely that bats would be sprayed directly or ingest much citric acid retained by fur. Based on our observations, we believe Hawaiian hoary bats to be at very low risk from harmful exposure to a toxic dose of citric acid during frog control operations.

  11. Winter distribution and use of high elevation caves as foraging sites by the endangered Hawaiian hoary bat, Lasiurus cinereus semotus

    Science.gov (United States)

    Bonaccorso, Frank; Montoya-Aiona, Kristina; Pinzari, Corinna A.; Todd, Christopher M.

    2016-01-01

    We examine altitudinal movements involving unusual use of caves by Hawaiian hoary bats, Lasiurus cinereus semotus, during winter and spring in the Mauna Loa Forest Reserve (MLFR), Hawai‘i Island. Acoustic detection of hoary bat vocalizations, were recorded with regularity outside 13 lava tube cave entrances situated between 2,200 to 3,600 m asl from November 2012 to April 2013. Vocalizations were most numerous in November and December with the number of call events and echolocation pulses decreasing through the following months. Bat activity was positively correlated with air temperature and negatively correlated with wind speed. Visual searches found no evidence of hibernacula nor do Hawaiian hoary bats appear to shelter by day in these caves. Nevertheless, bats fly deep into caves as evidenced by numerous carcasses found in cave interiors. The occurrence of feeding buzzes around cave entrances and visual observations of bats flying in acrobatic fashion in cave interiors point to the use of these spaces as foraging sites. Peridroma moth species (Noctuidae), the only abundant nocturnal, flying insect sheltering in large numbers in rock rubble and on cave walls in the MLFR, apparently serve as the principal prey attracting hoary bats during winter to lava tube caves in the upper MLFR. Caves above 3,000 m on Mauna Loa harbor temperatures suitable for Pseudogymnoascus destructansfungi, the causative agent of White-nose Syndrome that is highly lethal to some species of North American cave-dwelling bats. We discuss the potential for White-nose Syndrome to establish and affect Hawaiian hoary bats.

  12. Interleukin 17A is an immune marker for chlamydial disease severity and pathogenesis in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mathew, Marina; Waugh, Courtney; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2014-10-01

    The koala (Phascolarctos cinereus) is an iconic Australian marsupial species that is facing many threats to its survival. Chlamydia pecorum infections are a significant contributor to this ongoing decline. A major limiting factor in our ability to manage and control chlamydial disease in koalas is a limited understanding of the koala's cell-mediated immune response to infections by this bacterial pathogen. To identify immunological markers associated with chlamydial infection and disease in koalas, we used koala-specific Quantitative Real Time PCR (qrtPCR) assays to profile the cytokine responses of Peripheral Blood Mononuclear Cells (PBMCs) collected from 41 koalas with different stages of chlamydial disease. Target cytokines included the principal Th1 (Interferon gamma; IFNγ), Th2 (Interleukin 10; IL10), and pro-inflammatory cytokines (Tumor Necrosis Factor alpha; TNFα). A novel koala-specific IL17A qrtPCR assay was also developed as part of this study to quantitate the gene expression of this Th17 cytokine in koalas. A statistically significant higher IL17A gene expression was observed in animals with current chlamydial disease compared to animals with asymptomatic chlamydial infection. A modest up-regulation of pro-inflammatory cytokines, such as TNFα and IFNγ, was also observed in these animals with signs of current chlamydial disease. IL10 gene expression was not evident in the majority of animals from both groups. Future longitudinal studies are now required to confirm the role played by cytokines in pathology and/or protection against C. pecorum infection in the koala. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Preliminary characterisation of tumor necrosis factor alpha and interleukin-10 responses to Chlamydia pecorum infection in the koala (Phascolarctos cinereus.

    Directory of Open Access Journals (Sweden)

    Marina Mathew

    Full Text Available Debilitating infectious diseases caused by Chlamydia are major contributors to the decline of Australia's iconic native marsupial species, the koala (Phascolarctos cinereus. An understanding of koala chlamydial disease pathogenesis and the development of effective strategies to control infections continue to be hindered by an almost complete lack of species-specific immunological reagents. The cell-mediated immune response has been shown to play an influential role in the response to chlamydial infection in other hosts. The objective of this study, hence, was to provide preliminary data on the role of two key cytokines, pro-inflammatory tumour necrosis factor alpha (TNFα and anti-inflammatory interleukin 10 (IL10, in the koala Chlamydia pecorum response. Utilising sequence homology between the cytokine sequences obtained from several recently sequenced marsupial genomes, this report describes the first mRNA sequences of any koala cytokine and the development of koala specific TNFα and IL10 real-time PCR assays to measure the expression of these genes from koala samples. In preliminary studies comparing wild koalas with overt chlamydial disease, previous evidence of C. pecorum infection or no signs of C. pecorum infection, we revealed strong but variable expression of TNFα and IL10 in wild koalas with current signs of chlamydiosis. The description of these assays and the preliminary data on the cell-mediated immune response of koalas to chlamydial infection paves the way for future studies characterising the koala immune response to a range of its pathogens while providing reagents to assist with measuring the efficacy of ongoing attempts to develop a koala chlamydial vaccine.

  14. Potential ‘Ecological Traps’ of Restored Landscapes: Koalas Phascolarctos cinereus Re-Occupy a Rehabilitated Mine Site

    Science.gov (United States)

    Cristescu, Romane H.; Banks, Peter B.; Carrick, Frank N.; Frère, Céline

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community should include criteria

  15. The prevalence and clinical significance of Chlamydia infection in island and mainland populations of Victorian koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Patterson, Jade L S; Lynch, Michael; Anderson, Garry A; Noormohammadi, Amir H; Legione, Alistair; Gilkerson, James R; Devlin, Joanne M

    2015-04-01

    Chlamydia infection is known to impact the health of koalas (Phascolarctos cinereus) in New South Wales (NSW) and Queensland, but the clinical significance of Chlamydia infections in Victorian koalas is not well described. We examined the prevalence of Chlamydia infection and assessed associated health parameters in two Victorian koala populations known to be Chlamydia positive. The same testing regimen was applied to a third Victorian population in which Chlamydia had not been detected. We examined 288 koalas and collected samples from the urogenital sinus and conjunctival sacs. Detection and differentiation of Chlamydia species utilized real-time PCR and high-resolution melting curve analysis. Chlamydia pecorum was detected in two populations (prevalences: 25% and 41%, respectively) but only from urogenital sinus swabs. Chlamydia was not detected in the third population. Chlamydia pneumoniae was not detected. Chlamydia pecorum infection was positively associated with wet bottom (indicating chronic urinary tract disease) in one Chlamydia-positive population and with abnormal urogenital ultrasound findings in the other Chlamydia-positive population. The prevalence of wet bottom was similar in all populations (including the Chlamydia-free population), suggesting there is another significant cause (or causes) of wet bottom in Victorian koalas. Ocular disease was not observed. This is the largest study of Chlamydia infection in Victorian koalas, and the results suggest the potential for epidemiologic differences related to Chlamydia infections between Victorian koalas and koalas in Queensland and NSW and also between geographically distinct Victorian populations. Further studies to investigate the genotypes of C. pecorum present in Victorian koalas and to identify additional causes of wet bottom in koalas are indicated.

  16. Identification of unusual Chlamydia pecorum genotypes in Victorian koalas (Phascolarctos cinereus) and clinical variables associated with infection.

    Science.gov (United States)

    Legione, Alistair R; Patterson, Jade L S; Whiteley, Pam L; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Polkinghorne, Adam; Devlin, Joanne M; Sansom, Fiona M

    2016-05-01

    Chlamydia pecorum infection is a threat to the health of free-ranging koalas (Phascolarctos cinereus) in Australia. Utilizing an extensive sample archive we determined the prevalence of C. pecorum in koalas within six regions of Victoria, Australia. The ompA genotypes of the detected C. pecorum were characterized to better understand the epidemiology of this pathogen in Victorian koalas. Despite many studies in northern Australia (i.e. Queensland and New South Wales), prior Chlamydia studies in Victorian koalas are limited. We detected C. pecorum in 125/820 (15 %) urogenital swabs, but in only one ocular swab. Nucleotide sequencing of the molecular marker C. pecorum ompA revealed that the majority (90/114) of C. pecorum samples typed were genotype B. This genotype has not been reported in northern koalas. In general, Chlamydia infection in Victorian koalas is associated with milder clinical signs compared with infection in koalas in northern populations. Although disease pathogenesis is likely to be multifactorial, the high prevalence of genotype B in Victoria may suggest it is less pathogenic. All but three koalas had C. pecorum genotypes unique to southern koala populations (i.e. Victoria and South Australia). These included a novel C. pecorum ompA genotype and two genotypes associated with livestock. Regression analysis determined that significant factors for the presence of C. pecorum infection were sex and geographical location. The presence of 'wet bottom' in males and the presence of reproductive tract pathology in females were significantly associated with C. pecorum infection, suggesting variation in clinical disease manifestations between sexes.

  17. Development and field validation of a regional, management-scale habitat model: A koala Phascolarctos cinereus case study.

    Science.gov (United States)

    Law, Bradley; Caccamo, Gabriele; Roe, Paul; Truskinger, Anthony; Brassil, Traecey; Gonsalves, Leroy; McConville, Anna; Stanton, Matthew

    2017-09-01

    Species distribution models have great potential to efficiently guide management for threatened species, especially for those that are rare or cryptic. We used MaxEnt to develop a regional-scale model for the koala Phascolarctos cinereus at a resolution (250 m) that could be used to guide management. To ensure the model was fit for purpose, we placed emphasis on validating the model using independently-collected field data. We reduced substantial spatial clustering of records in coastal urban areas using a 2-km spatial filter and by modeling separately two subregions separated by the 500-m elevational contour. A bias file was prepared that accounted for variable survey effort. Frequency of wildfire, soil type, floristics and elevation had the highest relative contribution to the model, while a number of other variables made minor contributions. The model was effective in discriminating different habitat suitability classes when compared with koala records not used in modeling. We validated the MaxEnt model at 65 ground-truth sites using independent data on koala occupancy (acoustic sampling) and habitat quality (browse tree availability). Koala bellows ( n  = 276) were analyzed in an occupancy modeling framework, while site habitat quality was indexed based on browse trees. Field validation demonstrated a linear increase in koala occupancy with higher modeled habitat suitability at ground-truth sites. Similarly, a site habitat quality index at ground-truth sites was correlated positively with modeled habitat suitability. The MaxEnt model provided a better fit to estimated koala occupancy than the site-based habitat quality index, probably because many variables were considered simultaneously by the model rather than just browse species. The positive relationship of the model with both site occupancy and habitat quality indicates that the model is fit for application at relevant management scales. Field-validated models of similar resolution would assist in

  18. Preliminary characterisation of tumor necrosis factor alpha and interleukin-10 responses to Chlamydia pecorum infection in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mathew, Marina; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-01-01

    Debilitating infectious diseases caused by Chlamydia are major contributors to the decline of Australia's iconic native marsupial species, the koala (Phascolarctos cinereus). An understanding of koala chlamydial disease pathogenesis and the development of effective strategies to control infections continue to be hindered by an almost complete lack of species-specific immunological reagents. The cell-mediated immune response has been shown to play an influential role in the response to chlamydial infection in other hosts. The objective of this study, hence, was to provide preliminary data on the role of two key cytokines, pro-inflammatory tumour necrosis factor alpha (TNFα) and anti-inflammatory interleukin 10 (IL10), in the koala Chlamydia pecorum response. Utilising sequence homology between the cytokine sequences obtained from several recently sequenced marsupial genomes, this report describes the first mRNA sequences of any koala cytokine and the development of koala specific TNFα and IL10 real-time PCR assays to measure the expression of these genes from koala samples. In preliminary studies comparing wild koalas with overt chlamydial disease, previous evidence of C. pecorum infection or no signs of C. pecorum infection, we revealed strong but variable expression of TNFα and IL10 in wild koalas with current signs of chlamydiosis. The description of these assays and the preliminary data on the cell-mediated immune response of koalas to chlamydial infection paves the way for future studies characterising the koala immune response to a range of its pathogens while providing reagents to assist with measuring the efficacy of ongoing attempts to develop a koala chlamydial vaccine.

  19. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  20. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

    Science.gov (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

    2018-05-03

    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  1. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K

    1978-01-01

    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  2. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  3. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  4. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  5. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  6. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.

    1981-01-01

    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  7. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  8. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  9. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    Science.gov (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  10. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  11. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  12. The seminiferous epithelial cycle and microanatomy of the koala (Phascolarctos cinereus) and southern hairy-nosed wombat (Lasiorhinus latifrons) testis.

    Science.gov (United States)

    Oishi, Motoharu; Takahashi, Mei; Amasaki, Hajime; Janssen, Tina; Johnston, Stephen D

    2013-03-01

    The koala (Phascolarctos cinereus) and southern hairy-nosed wombat (Lasiorhinus latifrons) are iconic Australian fauna that share a close phylogenetic relationship but there are currently no comparative studies of the seminiferous epithelial cell or testicular microanatomy of either species. Koala and wombat spermatozoa are unusual for marsupials as they possess a curved stream-lined head and lateral neck insertion that superficially is similar to murid spermatozoa; the koala also contains Sertoli cells with crystalloid inclusions that closely resemble the Charcot-Bottcher crystalloids described in human Sertoli cells. Eighteen sexually mature koalas and four sexually mature southern hairy-nosed (SHN) wombats were examined to establish base-line data on quantitative testicular histology. Dynamics of the seminiferous epithelial cycle in the both species consisted of eight stages of cellular association similar to that described in other marsupials. Both species possessed a high proportion of the pre-meiotic (stages VIII, I - III; koala - 62.2 ± 1.7% and SHN wombat - 66.6 ± 2.4%) when compared with post-meiotic stages of the seminiferous cycle. The mean diameters of the seminiferous tubules found in the koalas and the SHN wombats were 227.8 ± 6.1 and 243.5 ± 3.9 μm, respectively. There were differences in testicular histology between the species including the koala possessing (i) a greater proportion of Leydig cells, (ii) larger Sertoli cell nuclei, (iii) crystalloids in the Sertoli cell cytoplasm, (iv) a distinctive acrosomal granule during spermiogenesis and (v) a highly eosinophilic acrosome. An understanding of the seminiferous epithelial cycle and microanatomy of testis is fundamental for documenting normal spermatogenesis and testicular architecture; recent evidence of orchitis and epididymitis associated with natural chlamydial infection in the koala suggest that this species might be useful as an experimental model for understanding Chlamydia

  13. Characterisation of CD4 T cells in healthy and diseased koalas (Phascolarctos cinereus) using cell-type-specific monoclonal antibodies.

    Science.gov (United States)

    Mangar, Chandan; Armitage, Charles W; Timms, Peter; Corcoran, Lynn M; Beagley, Kenneth W

    2016-07-01

    The koala (Phascolarctos cinereus) is an arboreal herbivorous marsupial that is an Australian icon. Koalas in many parts of Australia are under multiple threats including habitat destruction, dog attacks, vehicular accidents, and infectious diseases such as Chlamydia spp. and the koala retrovirus (KoRV), which may contribute to the incidence of lymphoma and leukaemia in this species. Due to a lack of koala-specific immune reagents and assays there is currently no way to adequately analyse the immune response in healthy, diseased or vaccinated animals. This paper reports the production and characterisation of the first anti-koala CD4 monoclonal antibody (mAb). The koala CD4 gene was identified and used to develop recombinant proteins for mAb production. Fluorochrome-conjugated anti-CD4 mAb was used to measure the levels of CD4(+) lymphocytes collected from koala spleens (41.1%, range 20-45.1%) lymph nodes (36.3%, range 19-55.9%) and peripheral blood (23.8%, range 17.3-35%) by flow cytometry. Biotin-conjugated anti-CD4 mAb was used for western blot to determine an approximate size of 52 kDa for the koala CD4 molecule and used in immunohistochemistry to identify CD4(+) cells in the paracortical region and germinal centres of spleen and lymph nodes. Using the anti-CD4 mab we showed that CD4 cells from vaccinated, but not control, koalas proliferated following in vitro stimulation with UV-inactivated Chlamydia pecorum and recombinant chlamydial antigens. Since CD4(+) T cells have been shown to play a pivotal role in clearing chlamydial infection in both human and mouse infections, using this novel antibody will help determine the role CD4(+) T cells play in protection against chlamydial infection in koalas and also enhance our knowledge of how KoRV affects the koala immune system. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Identification, characterisation and expression analysis of natural killer receptor genes in Chlamydia pecorum infected koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Morris, Katrina M; Mathew, Marina; Waugh, Courtney; Ujvari, Beata; Timms, Peter; Polkinghorne, Adam; Belov, Katherine

    2015-10-15

    Koalas (Phascolarctos cinereus), an iconic Australian marsupial, are being heavily impacted by the spread of Chlamydia pecorum, an obligate intracellular bacterial pathogen. Koalas vary in their response to this pathogen, with some showing no symptoms, while others suffer severe symptoms leading to infertility, blindness or death. Little is known about the pathology of this disease and the immune response against it in this host. Studies have demonstrated that natural killer (NK) cells, key components of the innate immune system, are involved in the immune response to chlamydial infections in humans. These cells can directly lyse cells infected by intracellular pathogens and their ability to recognise these infected cells is mediated through NK receptors on their surface. These are encoded in two regions of the genome, the leukocyte receptor complex (LRC) and the natural killer complex (NKC). These two families evolve rapidly and different repertoires of genes, which have evolved by gene duplication, are seen in different species. In this study we aimed to characterise genes belonging to the NK receptor clusters in the koala by searching available koala transcriptomes using a combination of search methods. We developed a qPCR assay to quantify relative expression of four genes, two encoded within the NK receptor cluster (CLEC1B, CLEC4E) and two known to play a role in NK response to Chalmydia in humans (NCR3, PRF1). We found that the NK receptor repertoire of the koala closely resembles that of the Tasmanian devil, with minimal genes in the NKC, but with lineage specific expansions in the LRC. Additional genes important for NK cell activity, NCR3 and PRF1, were also identified and characterised. In a preliminary study to investigate whether these genes are involved in the koala immune response to infection by its chlamydial pathogen, C. pecorum, we investigated the expression of four genes in koalas with active chlamydia infection, those with past infection and

  15. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

    Science.gov (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

    2015-01-01

    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  16. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  17. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  18. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

    2003-07-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  19. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  20. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  1. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  2. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  3. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  4. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A

    2000-12-01

    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  5. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner

    2013-01-01

    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  6. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  7. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  8. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  9. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  10. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

    1990-01-01

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  11. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  12. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  13. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina

    2017-05-01

    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  14. Characterization of the antimicrobial peptide family defensins in the Tasmanian devil (Sarcophilus harrisii), koala (Phascolarctos cinereus), and tammar wallaby (Macropus eugenii).

    Science.gov (United States)

    Jones, Elizabeth A; Cheng, Yuanyuan; O'Meally, Denis; Belov, Katherine

    2017-03-01

    Defensins comprise a family of cysteine-rich antimicrobial peptides with important roles in innate and adaptive immune defense in vertebrates. We characterized alpha and beta defensin genes in three Australian marsupials: the Tasmanian devil (Sarcophilus harrisii), koala (Phascolarctos cinereus), and tammar wallaby (Macropus eugenii) and identified 48, 34, and 39 defensins, respectively. One hundred and twelve have the classical antimicrobial peptides characteristics required for pathogen membrane targeting, including cationic charge (between 1+ and 15+) and a high proportion of hydrophobic residues (>30%). Phylogenetic analysis shows that gene duplication has driven unique and species-specific expansions of devil, koala, and tammar wallaby beta defensins and devil alpha defensins. Defensin genes are arranged in three genomic clusters in marsupials, whereas further duplications and translocations have occurred in eutherians resulting in four and five gene clusters in mice and humans, respectively. Marsupial defensins are generally under purifying selection, particularly residues essential for defensin structural stability. Certain hydrophobic or positively charged sites, predominantly found in the defensin loop, are positively selected, which may have functional significance in defensin-target interaction and membrane insertion.

  15. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus) Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP) with Two Different Adjuvants.

    Science.gov (United States)

    Khan, Shahneaz Ali; Desclozeaux, Marion; Waugh, Courtney; Hanger, Jon; Loader, Jo; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2016-01-01

    Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus). In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP) antigen-based vaccine, combined with immune stimulating complex (ISC) adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri-adjuvant formula that comprises polyphosphazine based poly I: C and host defense peptides, with the same antigen. This formulation also produced strong cellular and humoral immune responses in captive koalas. In this current study, we directly compared the host immune responses of two sub-groups of wild Chlamydia negative koalas in one population vaccinated with the rMOMP protein antigen and adjuvanted with either the ISC or tri-adjuvant formula. Overall, both adjuvants produced strong Chlamydia-specific cellular (IFN-γ and IL-17A) responses in circulating PBMCs as well as MOMP-specific and functional, in vitro neutralising antibodies. While the immune responses were similar, there were adjuvant-specific immune differences between the two adjuvants, particularly in relation to the specificity of the MOMP epitope antibody responses.

  16. Histological and immunohistological investigation of alimentary tract lymphoid tissue in the koala (Phascolarctos cinereus), brushtail possum (Trichosurus vulpecula) and ringtail possum (Pseudocheirus peregrinus).

    Science.gov (United States)

    Hemsley, S W; Canfield, P J; Husband, A J

    1996-01-01

    The histological appearance and distribution of T cells, B cells and plasma cells were investigated for oropharyngeal tonsils, small intestinal lymphoid aggregations (Peyer's patches), caecocolic lymphoid patches and mesenteric lymph nodes of koalas (Phascolarctos cinereus), common brushtail possums (Trichosurus vulpecula) and common ringtail possums (Pseudocheirus peregrinus). The histological organisation and distribution of lymphoid cell subpopulations of these tissues were similar to those described in eutherian mammals, although some differences were found in comparison with previous descriptions of American opossum tissues. The main variation among the 3 species was in the structural organisations of the oropharyngeal tonsil and the caecocolic lymphoid patch which were more complex in the koala than in possums. In the koala the extensive crypts of the oropharyngeal tonsils and folding of the mucosa of the caecocolic lymphoid patch increased their surface area and, in addition, both structures had areas of epithelium heavily infiltrated with T and B cells. These features could indicate that these structures are important in immunological surveillance of orally presented antigens in koalas. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 Fig. 13 Fig. 14 Fig. 15 Fig. 16 PMID:8621326

  17. Computed tomography and magnetic resonance for the advanced imaging of the normal nasal cavity and paranasal sinuses of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Alexander, Kate; Gorow, April; Pye, Geoffrey W

    2014-12-01

    The objective of this study is to describe computed tomography (CT) and magnetic resonance (MR) for the cross-sectional imaging of the normal anatomy of the nasal cavity and paranasal sinuses of the koala (Phascolarctos cinereus), to provide reference figures for gross anatomy with corresponding CT and MR images and to compare the features of the nasal cavity and paranasal sinuses of the normal koala with that reported in other domestic species. Advanced imaging can be used to aid in diagnosis, to plan surgical intervention, and to monitor therapeutic responses to diseases of the nasal passages in koalas. One clinically normal koala was anesthetized twice for the separate acquisition of dorsal CT scan images and transverse, dorsal, and sagittal MR images of its nasal cavity and paranasal sinuses. Sagittal and transverse CT planes were reformatted. Three fresh koala skulls were also transected in one of each transverse, sagittal, and dorsal planes and photographed. The CT and MR images obtained were matched with corresponding gross anatomic images and the normal bone, tissues and airway passages were identified. All anatomic structures were readily identifiable on CT, magnetic resonance imaging (MRI), and gross images. CT and MRI are both valuable diagnostic tools for imaging the nasal cavities and paranasal sinuses of koalas. Images obtained from this project can be used as baseline references for future comparison with diseased koalas to help with diagnosis, surgical intervention, and response to therapy.

  18. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP with Two Different Adjuvants.

    Directory of Open Access Journals (Sweden)

    Shahneaz Ali Khan

    Full Text Available Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus. In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP antigen-based vaccine, combined with immune stimulating complex (ISC adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri-adjuvant formula that comprises polyphosphazine based poly I: C and host defense peptides, with the same antigen. This formulation also produced strong cellular and humoral immune responses in captive koalas. In this current study, we directly compared the host immune responses of two sub-groups of wild Chlamydia negative koalas in one population vaccinated with the rMOMP protein antigen and adjuvanted with either the ISC or tri-adjuvant formula. Overall, both adjuvants produced strong Chlamydia-specific cellular (IFN-γ and IL-17A responses in circulating PBMCs as well as MOMP-specific and functional, in vitro neutralising antibodies. While the immune responses were similar, there were adjuvant-specific immune differences between the two adjuvants, particularly in relation to the specificity of the MOMP epitope antibody responses.

  19. Linking Genetic Variation in Adaptive Plant Traits to Climate in Tetraploid and Octoploid Basin Wildrye [Leymus cinereus (Scribn. & Merr.) A. Love] in the Western U.S.

    Science.gov (United States)

    Johnson, R C; Vance-Borland, Ken

    2016-01-01

    Few studies have assessed how ploidy type within a species affects genetic variation among populations in relation to source climates. Basin wildrye (Leymus cinereus (Scribn. & Merr.) A. Love) is a large bunchgrass common in the intermountain Western U.S. found in both octoploid and tetraploid types. In common gardens at two sites over two years differences in both ploidy type and genetic variation within ploidy were observed in phenology, morphology, and production traits on 57 octoploid and 52 tetraploid basin wildrye from the intermountain Western U.S. (Ptypes. Still, among populations octoploids often had greater genetic variation for traits and occupied more diverse climates than tetraploids. Genetic variation for both ploidy types was linked to source climates in canonical correlation analysis, with the first two variates explaining 70% of the variation. Regression of those canonical variates with seed source climate variables produced models that explained 64% and 38% of the variation, respectively, and were used to map 15 seed zones covering 673,258 km2. Utilization of these seed zones will help ensure restoration with adaptive seed sources for both ploidy types. The link between genetic traits and seed source climates suggests climate driven natural selection and adaptive evolution in basin wildrye. The more diverse climates occupied by octoploids and higher trait variation suggests a higher capacity for ecological differentiation than tetraploids in the intermountain Western U.S.

  20. Response of Red-Backed Salamanders (Plethodon Cinereus to Changes in Hemlock Forest Soil Driven by Invasive Hemlock Woolly Adelgid (Adelges Tsugae

    Directory of Open Access Journals (Sweden)

    Alison Ochs

    2017-01-01

    Full Text Available Hemlock forests of the northeastern United States are declining due to the invasive hemlock woolly adelgid (HWA (Adelges tsugae. Hardwood species replace these forests, which affects soil properties that may influence other communities, such as red-backed salamanders (red-backs (Plethodon cinereus. This study examined the effects of HWA invasion on soil properties and how this affects red-backs at the Hemlock Removal Experiment at Harvard Forest, which consists of eight 0.8 ha plots treated with girdling to simulate HWA invasion, logging to simulate common management practices, or hemlock- or hardwood-dominated controls. Coverboard surveys were used to determine the relative abundance of red-backs between plots during June and July 2014 and soil cores were collected from which the bulk density, moisture, pH, temperature, leaf litter, and carbon-nitrogen ratio were measured. Ordination provided a soil quality index based on temperature, pH, and carbon-to-nitrogen ratio, which was significantly different between plot treatments (p < 0.05 and showed a significant negative correlation with the red-back relative abundance (p < 0.05. The findings support the hypothesis that red-backs are affected by soil quality, which is affected by plot treatment and thus HWA invasion. Further studies should explore how salamanders react in the long term towards changing environments and consider the use of red-backs as indicator species.

  1. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  2. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  3. Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, J R; An, C H; Yuan, J M

    2005-01-01

    The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

  4. Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, Jianrong

    2003-01-15

    The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

  5. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  6. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  7. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  8. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  9. Assessment of intra and interregional genetic variation in the Eastern Red-backed Salamander, Plethodon cinereus, via analysis of novel microsatellite markers.

    Directory of Open Access Journals (Sweden)

    Alexander C Cameron

    Full Text Available The red-backed salamander (Plethodon cinereus has long-served as a model system in ecology, evolution, and behavior, and studies surveying molecular variation in this species have become increasingly common over the past decade. However, difficulties are commonly encountered when extending microsatellite markers to populations that are unstudied from a genetic perspective due to high levels of genetic differentiation across this species' range. To ameliorate this issue, we used 454 pyrosequencing to identify hundreds of microsatellite loci. We then screened 40 of our top candidate loci in populations in Virginia, Pennsylvania, and Ohio-including an isolated island population ~ 4.5 km off the shore of Lake Erie (South Bass Island. We identified 25 loci that are polymorphic in a well-studied region of Virginia and 11 of these loci were polymorphic in populations located in the genetically unstudied regions of Ohio and Pennsylvania. Use of these loci to examine patterns of variation within populations revealed that South Bass Island has low diversity in comparison to other sites. However, neither South Bass Island nor isolated populations around Cleveland are inbred. Assessment of variation between populations revealed three well defined genetic clusters corresponding to Virginia, mainland Ohio/Pennsylvania, and South Bass Island. Comparisons of our results to those of others working in various parts of the range are consistent with the idea that differentiation is lower in regions that were once glaciated. However, these comparisons also suggest that well differentiated isolated populations in the formerly glaciated portion of the range are not uncommon. This work provides novel genetic resources that will facilitate population genetic studies in a part of the red-backed salamander's range that has not previously been studied in this manner. Moreover, this work refines our understanding of how neutral variation is distributed in this ecologically

  10. Linking Genetic Variation in Adaptive Plant Traits to Climate in Tetraploid and Octoploid Basin Wildrye [Leymus cinereus (Scribn. & Merr. A. Love] in the Western U.S.

    Directory of Open Access Journals (Sweden)

    R C Johnson

    Full Text Available Few studies have assessed how ploidy type within a species affects genetic variation among populations in relation to source climates. Basin wildrye (Leymus cinereus (Scribn. & Merr. A. Love is a large bunchgrass common in the intermountain Western U.S. found in both octoploid and tetraploid types. In common gardens at two sites over two years differences in both ploidy type and genetic variation within ploidy were observed in phenology, morphology, and production traits on 57 octoploid and 52 tetraploid basin wildrye from the intermountain Western U.S. (P<0.01. Octoploids had larger leaves, longer culms, and greater crown circumference than tetraploids but the numerical ranges of plant traits and their source climates overlapped between ploidy types. Still, among populations octoploids often had greater genetic variation for traits and occupied more diverse climates than tetraploids. Genetic variation for both ploidy types was linked to source climates in canonical correlation analysis, with the first two variates explaining 70% of the variation. Regression of those canonical variates with seed source climate variables produced models that explained 64% and 38% of the variation, respectively, and were used to map 15 seed zones covering 673,258 km2. Utilization of these seed zones will help ensure restoration with adaptive seed sources for both ploidy types. The link between genetic traits and seed source climates suggests climate driven natural selection and adaptive evolution in basin wildrye. The more diverse climates occupied by octoploids and higher trait variation suggests a higher capacity for ecological differentiation than tetraploids in the intermountain Western U.S.

  11. Variation in the microbiome of the urogenital tract of Chlamydia-free female koalas (Phascolarctos cinereus) with and without 'wet bottom'.

    Science.gov (United States)

    Legione, Alistair R; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Sansom, Fiona M; Devlin, Joanne M

    2018-01-01

    Koalas (Phascolarctos cinereus) are iconic Australian marsupials currently threatened by several processes, including infectious diseases and ecological disruption. Infection with Chlamydia pecorum, is considered a key driver of population decline. The clinical sign of 'wet bottom', a staining of the rump associated with urinary incontinence, is often caused by chlamydial urinary tract infections. However, wet bottom has been recorded in koalas free of C. pecorum, suggesting other causative agents in those individuals. We used 16S rRNA diversity profiling to investigate the microbiome of the urogenital tract of ten female koalas in order to identify potential causative agents of wet bottom, other than C. pecorum. Five urogenital samples were processed from koalas presenting with wet bottom and five were clinically normal. All koalas were negative for C. pecorum infection. We detected thirteen phyla across the ten samples, with Firmicutes occurring at the highest relative abundance (77.6%). The order Lactobacillales, within the Firmicutes, comprised 70.3% of the reads from all samples. After normalising reads using DESeq2 and testing for significant differences (P < 0.05), there were 25 operational taxonomic units (OTUs) more commonly found in one group over the other. The families Aerococcaceae and Tissierellaceae both had four significantly differentially abundant OTUs. These four Tissierellaceae OTUs were all significantly more abundant in koalas with wet bottom. This study provides the foundation for future investigations of causes of koala wet bottom, other than C. pecorum infection. This is of clinical relevance as wet bottom is often assumed to be caused by C. pecorum and treated accordingly. Our research highlights that other organisms may be causing wet bottom, and these potential aetiological agents need to be further investigated to fully address the problems this species faces.

  12. The distribution of organised lymphoid tissue in the alimentary tracts of koalas (Phascolarctos cinereus) and possums (Trichosurus vulpecula and Pseudocheirus peregrinus).

    Science.gov (United States)

    Hemsley, S W; Canfield, P J; Husband, A J

    1996-01-01

    The anatomical arrangement of organised lymphoid tissues of the alimentary tract for 3 Australian marsupials, the koala (Phascolarctos cinereus), the common brushtail possum (Trichosurus vulpecula and the common ringtail possum (Pseudocheirus peregrinus), was determined by gross dissection and acetic acid treatment. Oropharyngeal tonsils were consistently found in the dorsolateral wall of the caudal oropharynx in all 3 species and additionally in the ventral soft palate of the koala. Aggregated lymphoid nodules (Peyer's patches) were present in the small intestine of koalas, ringtail possums and brushtail possums and were of similar appearance for all 3 species. Bilateral large intestinal lymphoid patches were detected in the caecocolic lateral wall adjacent to the termination of the ileum for all 3 species. Caecocolic patches were more complex in koalas and had mucosal folds and a central recess. In addition, solitary and grouped large intestinal lymphoid nodules were variably present in the proximal colon and caecum of the koala. In contrast, possums had solitary and grouped large intestinal lymphoid nodules present in the proximal colon and rectum but not the caecum. Aggregated lymphoid tissue was not detected in the tongue, oesophagus or stomach for all 3 species. In contrast to a previous report, this study did not find a paucity of lymphoid tissue associated with the gut of the koala. The appearance and distribution of gut-associated lymphoid tissue in koalas and possums was found to be similar to that described in other marsupials and eutherian mammals, although some variations in appearance and anatomical location were observed. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8621325

  13. Variation in the microbiome of the urogenital tract of Chlamydia-free female koalas (Phascolarctos cinereus) with and without ‘wet bottom’

    Science.gov (United States)

    Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R.; Sansom, Fiona M.; Devlin, Joanne M.

    2018-01-01

    Koalas (Phascolarctos cinereus) are iconic Australian marsupials currently threatened by several processes, including infectious diseases and ecological disruption. Infection with Chlamydia pecorum, is considered a key driver of population decline. The clinical sign of ‘wet bottom’, a staining of the rump associated with urinary incontinence, is often caused by chlamydial urinary tract infections. However, wet bottom has been recorded in koalas free of C. pecorum, suggesting other causative agents in those individuals. We used 16S rRNA diversity profiling to investigate the microbiome of the urogenital tract of ten female koalas in order to identify potential causative agents of wet bottom, other than C. pecorum. Five urogenital samples were processed from koalas presenting with wet bottom and five were clinically normal. All koalas were negative for C. pecorum infection. We detected thirteen phyla across the ten samples, with Firmicutes occurring at the highest relative abundance (77.6%). The order Lactobacillales, within the Firmicutes, comprised 70.3% of the reads from all samples. After normalising reads using DESeq2 and testing for significant differences (P < 0.05), there were 25 operational taxonomic units (OTUs) more commonly found in one group over the other. The families Aerococcaceae and Tissierellaceae both had four significantly differentially abundant OTUs. These four Tissierellaceae OTUs were all significantly more abundant in koalas with wet bottom. This study provides the foundation for future investigations of causes of koala wet bottom, other than C. pecorum infection. This is of clinical relevance as wet bottom is often assumed to be caused by C. pecorum and treated accordingly. Our research highlights that other organisms may be causing wet bottom, and these potential aetiological agents need to be further investigated to fully address the problems this species faces. PMID:29579080

  14. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

    Science.gov (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

    2017-04-01

    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  15. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  16. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  17. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  18. Cytochrome P450 CYP3A in marsupials: cloning and characterisation of the second identified CYP3A subfamily member, isoform 3A78 from koala (Phascolarctos cinereus).

    Science.gov (United States)

    El-Merhibi, Adaweyah; Ngo, Suong N T; Crittenden, Tamara A; Marchant, Ceilidh L; Stupans, Ieva; McKinnon, Ross A

    2011-11-01

    Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of xenobiotics and endogenous substrates. Previously, we cloned and characterised the CYP2C, CYP4A, and CYP4B gene subfamilies from marsupials and demonstrated important species-differences in both activity and tissue expression of these CYP enzymes. Recently, we isolated the Eastern grey kangaroo CYP3A70. Here we have cloned and characterised the second identified member of marsupial CYP3A gene subfamily, CYP3A78 from the koala (Phascolarctos cinereus). In addition, we have examined the gender-differences in microsomal erythromycin N-demethylation activity (a CYP3A marker) and CYP3A protein expression across test marsupial species. Significant differences in hepatic erythromycin N-demethylation activity were observed between male and female koalas, with the activity detected in female koalas being 2.5-fold higher compared to that in male koalas (p<0.01). No gender-differences were observed in tammar wallaby or Eastern grey kangaroo. Immunoblot analysis utilising anti-human CYP3A4 antibody detected immunoreactive proteins in liver microsomes from all test male and female marsupials including the koala, tammar wallaby, and Eastern grey kangaroo, with no gender-differences detected across test marsupials. A 1610 bp koala hepatic CYP3A complete cDNA, designated CYP3A78, was cloned by reverse transcription-polymerase chain reaction approaches. It displays 64% nucleotide and 57% amino acid sequence identity to the Eastern grey kangaroo CYP3A70. The CYP3A78 cDNA encodes a protein of 515 amino acids, shares approximately 68% nucleotide and 56% amino acid sequence identity to human CYP3A4, and displays high sequence similarity to other published mammalian CYP3As from human, monkey, cow, pig, dog, rat, rabbit, mouse, hamster, and guinea pig. Collectively, this study provides primary molecular data regarding koala hepatic CYP3A78 gene and enables further functional analyses of CYP

  19. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus and their ticks identified using next-generation sequencing (NGS.

    Directory of Open Access Journals (Sweden)

    Amanda D Barbosa

    Full Text Available Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus, particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8% were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%, T. gilletti (25%, 95% CI: 18.7-32.3%, T. copemani (27.4%, 95% CI: 20.8-34.8% and T. vegrandis (10.1%, 95% CI: 6.0-15.7%. Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%, and a novel species (Trypanosoma sp. AB-2017 was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%. Mixed infections with up to five species were present in 27.4% (95% CI: 21-35% of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%. Overall, a considerably higher proportion (79.7% of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights

  20. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus) and their ticks identified using next-generation sequencing (NGS).

    Science.gov (United States)

    Barbosa, Amanda D; Gofton, Alexander W; Paparini, Andrea; Codello, Annachiara; Greay, Telleasha; Gillett, Amber; Warren, Kristin; Irwin, Peter; Ryan, Una

    2017-01-01

    Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus), particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS)-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani) removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8%) were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%), T. gilletti (25%, 95% CI: 18.7-32.3%), T. copemani (27.4%, 95% CI: 20.8-34.8%) and T. vegrandis (10.1%, 95% CI: 6.0-15.7%). Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%), and a novel species (Trypanosoma sp. AB-2017) was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%). Mixed infections with up to five species were present in 27.4% (95% CI: 21-35%) of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%). Overall, a considerably higher proportion (79.7%) of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS) within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights on the

  1. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  2. Development and characterization of 21 polymorphic microsatellite markers for the barren-ground shrew, Sorex ugyunak (Mammalia: Sorcidae), through next-generation sequencing, and cross-species amplification in the masked shrew, S. cinereus

    Science.gov (United States)

    Sonsthagen, Sarah A.; Sage, G. Kevin; Fowler, Megan C.; Hope, Andrew G.; Cook, J.A.; Talbot, Sandra L.

    2013-01-01

    We used next generation shotgun sequencing to develop 21 novel microsatellite markers for the barren-ground shrew (Sorex ugyunak), which were polymorphic among individuals from northern Alaska. The loci displayed moderate allelic diversity (averaging 6.81 alleles per locus) and heterozygosity (averaging 70 %). Two loci deviated from Hardy–Weinberg equilibrium (HWE) due to heterozygote deficiency. While the population did not deviate from HWE overall, it showed significant linkage disequilibrium suggesting this population is not in mutation-drift equilibrium. Nineteen of 21 loci were polymorphic in masked shrews (S. cinereus) from interior Alaska and exhibited linkage equilibrium and HWE overall. All loci yielded sufficient variability for use in population studies.

  3. Surveys on the distribution and abundance of the Hawaiian hoary bat (Lasiurus cinereus semotus) in the vicinity of proposed geothermal project subzones in the District of Puna, Hawaii. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Reynolds, M.; Ritchotte, G.; Dwyer, J.; Viggiano, A.; Nielsen, B.; Jacobi, J.D. [Fish and Wildlife Service, Hawaii National Park, HI (United States). Hawaii Research Station

    1994-08-01

    In 1993 the US Fish and Wildlife Service (USFWS) entered into an interagency agreement with the Department of Energy (DOE) to conduct wildlife surveys relative to identifying potential impacts of geothermal resource development on the native biota of the east rift zone of Kilauea volcano in the Puna district on the island of Hawaii. This report presents data on the endangered Hawaiian hoary bat (Hawaiian bat), or opeapea (Lasiurus cinereus semotus), within the proposed Hawaii geothermal subzones. Potential effects of geothermal development on Hawaiian bat populations are also discussed. Surveys were conducted to determine the distribution and abundance of bats throughout the District of Puna. Baseline information was collected to evaluate the status of bats within the study area and to identify important foraging habitats. Little specific data exists in the published literature on the population status and potential limiting factors affecting the Hawaiian bat. A USFWS recovery plan does not exist for this endangered species.

  4. Behavior of the Hawaiian Hawaiian Hoary Bat (Lasiurus cinereus semotus) at wind turbines and its distribution across the North Ko'olau Mountains, O'ahu

    Science.gov (United States)

    Gorresen, P.M.; Cryan, Paul M.; Huso, Manuela M.P.; Hein, Cris D.; Schirmacher, Michael; Johnson, Jessica H.; Montoya-Aiona, Kristina; Brinck, Kevin W.; Bonaccorso, Frank

    2015-01-01

    We studied the landscape distribution of endemic Hawaiian hoary bats (Lasiurus cinereus semotus) on the north Ko‘olau Mountains of O‘ahu, Hawai‘i, from May 2013 to May 2014, while simultaneously studying their behavior at wind turbines within the broader landscape. This research aimed to assess the risk that wind turbines pose to bats on the island and integrated a variety of methods, including acoustic monitoring, thermal videography, and fatality searches.Our findings indicate that hoary bats were acoustically cryptic and occurred sparsely in the region. Overall site occupancy rate was 55% during the 1-year period of acoustic monitoring at 23 sites, and there was only an 8% chance of acoustically detecting a bat on a given night if it was present. We detected bats less frequently in windward northern parts of the study area and at windy, lower-elevation sites with rough terrain. Bats were detected more frequently in leeward southern parts of the study area and at wind-sheltered, higher-elevation sites with flat ridgetops. Acoustic detections were consistently low from October through February and increased at most sites to peak in April through August. However, meteorological conditions were not found to be associated with the acoustic prevalence of bats on a night-to-night basis. We observed more than three thousand events involving bats during six months of nightly video surveillance at four wind turbines. Video monitoring revealed several links to weather at the local scale, despite acoustic detections not clearly relating to weather in our broader landscape analysis. Video demonstrated bats occurring near turbines more often on nights with little rain, warmer temperatures, moderate wind speeds, low humidity, and the low but rising barometric pressures indicative of fair weather and improved foraging conditions. Video monitoring also demonstrated that the presence of bats near turbines strongly correlates with insect presence. We detected bats on video

  5. Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

    Science.gov (United States)

    Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

    2013-06-01

    Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

  6. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  7. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  8. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

    Science.gov (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

    2017-10-01

    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  10. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus) by qRT-PCR.

    Science.gov (United States)

    Maher, Iona E; Griffith, Joanna E; Lau, Quintin; Reeves, Thomas; Higgins, Damien P

    2014-01-01

    Investigation of the immune response of the koala (Phascolarctos cinereus) is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV), which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala's susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1) and Th2 lymphocyte responses are important to an individual's susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala's adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 10 (IL-10) and interferon gamma (IFNγ) along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A). Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not consistently up-regulated by

  11. Type studies in Basidiomycetes. X

    NARCIS (Netherlands)

    Singer, R.

    1961-01-01

    For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The

  12. Immunomics of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Abts, Kendra C; Ivy, Jamie A; DeWoody, J Andrew

    2015-06-01

    The study of the koala transcriptome has the potential to advance our understanding of its immunome--immunological reaction of a given host to foreign antigens--and to help combat infectious diseases (e.g., chlamydiosis) that impede ongoing conservation efforts. We used Illumina sequencing of cDNA to characterize genes expressed in two different koala tissues of immunological importance, blood and spleen. We generated nearly 600 million raw sequence reads, and about 285 million of these were subsequently assembled and condensed into ~70,000 subcomponents that represent putative transcripts. We annotated ~16% of these subcomponents and identified those related to infection and the immune response, including Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), major histocompatibility complex (MHC) genes, and koala retrovirus (KoRV). Using phylogenetic analyses, we identified 29 koala genes in these target categories and report their concordance with currently accepted gene groups. By mapping multiple sequencing reads to transcripts, we identified 56 putative SNPs in genes of interest. The distribution of these SNPs indicates that MHC genes (34 SNPs) are more diverse than KoRV (12 SNPs), TLRs (8 SNPs), or RLRs (2 SNPs). Our sequence data also indicate that KoRV sequences are highly expressed in the transcriptome. Our efforts have produced full-length sequences for potentially important immune genes in koala, which should serve as targets for future investigations that aim to conserve koala populations.

  13. Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologues, Lim15/Dmc1, but does not stimulate its strand transfer activity

    International Nuclear Information System (INIS)

    Hamada, Fumika N.; Koshiyama, Akiyo; Namekawa, Satoshi H.; Ishii, Satomi; Iwabata, Kazuki; Sugawara, Hiroko; Nara, Takayuki Y.; Sakaguchi, Kengo; Sawado, Tomoyuki

    2007-01-01

    PCNA is a multi-functional protein that is involved in various nuclear events. Here we show that PCNA participates in events occurring during early meiotic prophase. Analysis of protein-protein interactions using surface plasmon resonance indicates that Coprinus cinereus PCNA (CoPCNA) specifically interacts with a meiotic specific RecA-like factor, C. cinereus Lim15/Dmc1 (CoLim15) in vitro. The binding efficiency increases with addition of Mg 2+ ions, while ATP inhibits the interaction. Co-immunoprecipitation experiments indicate that the CoLim15 protein interacts with the CoPCNA protein in vitro and in the cell extracts. Despite the interaction between these two factors, no enhancement of CoLim15-dependent strand transfer activity by CoPCNA was found in vitro. We propose that the interaction between Lim15/Dmc1 and PCNA mediates the recombination-associated DNA synthesis during meiosis

  14. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    Science.gov (United States)

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  15. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  16. Microbiological decomposition of bagasse after radiation pasteurization

    International Nuclear Information System (INIS)

    Ito, Hitoshi; Ishigaki, Isao

    1987-01-01

    Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms. (author)

  17. Microbiological decomposition of bagasse after radiation pasteurization

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Hitoshi; Ishigaki, Isao

    1987-11-01

    Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms.

  18. Peroxide accumulation and cell death in filamentous fungi induced by contact with a contestant.

    Science.gov (United States)

    Silar, Philippe

    2005-02-01

    Podospora anserina and Coprinopsis cinerea (syn. Coprinus cinereus) are endowed with a defence system able to differentiate self vs. non-self and involving the generation of peroxide. Indeed, they produce peroxide when confronted with a filamentous fungus, only in non-self confrontations. Both species are not able to recognize yeasts and show a differential response to bacteria. The accumulation of peroxides in the ascomycete Podospora anserina requires an NADPH oxidase and a MAP kinase cascade, previously shown to be involved in fruit body formation, cell differentiation and cell degeneration. Confrontation is accompanied by the death of the contestant hyphae only in specific combinations of species. As in animals and plants, data suggest that peroxide is likely involved in signalling rather than playing a direct toxic role. Fungi display more complex behaviours than generally acknowledged, i.e. they are able to recognize potential contestants and built up defence reactions involving evolutionary conserved enzymes.

  19. First report of Trypanosoma vegrandis in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Barbosa, Amanda; Austen, Jill; Gillett, Amber; Warren, Kristin; Paparini, Andrea; Irwin, Peter; Ryan, Una

    2016-08-01

    The present study describes the first report of Trypanosoma vegrandis in koalas using morphology and sequence analysis of the 18S rRNA gene. The prevalence of T. vegrandis in koalas was 13.6% (6/44). It is likely that the small size of T. vegrandis (<10μm in length), coupled with the difficulties in amplifying DNA of this parasite in mixed infections using trypanosome generic primers, are the reason why this organism has not been identified in koalas until now. This study highlights the importance of further research comprising a larger sample size to determine the prevalence of T. vegrandis in koalas as well as its potential impacts upon this marsupial species' health. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Chemical characterization of milk oligosaccharides of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Urashima, Tadasu; Taufik, Epi; Fukuda, Rino; Nakamura, Tadashi; Fukuda, Kenji; Saito, Tadao; Messer, Michael

    2013-11-01

    Previous structural characterizations of marsupial milk oligosaccharides had been performed in only two macropod species, the tammar wallaby and the red kangaroo. To clarify the homology and heterogeneity of milk oligosaccharides among marsupial species, which could provide information on their evolution, the oligosaccharides of the koala milk carbohydrate fraction were characterized in this study. Neutral and acidic oligosaccharides were separated from the carbohydrate fraction of milk of the koala, a non-macropod marsupial, and characterized by (1)H-nuclear magnetic resonance spectroscopy. The structures of the neutral saccharides were found to be Gal(β1-4)Glc (lactose), Gal(β1-3)Gal(β1-4)Glc (3'-galactosyllactose), Gal(β1-3)Gal(β1-3)Gal(β1-4)Glc (3',3″-digalactosyllactose), Gal(β1-3)[Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (lacto-N-novopentaose I) and Gal(β1-3){Gal(β1-4)[Fuc(α1-3)]GlcNAc(β1-6)}Gal(β1-4)Glc (fucosyl lacto-N-novopentaose I), while those of the acidic saccharides were Neu5Ac(α2-3)Gal(β1-4)Glc (3'-SL), Neu5Ac(α2-3)Gal(β1-3)Gal(β1-4)Gal (sialyl 3'-galactosyllactose), Neu5Ac(α2-3)Gal(β1-3)[Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose a), Gal(β1-3)[Neu5Ac(α2-6)Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose b), Gal(β1-3)[Neu5Ac(α2-3)Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose c), and Neu5Ac(α2-3)Gal(β1-3){Gal(β1-4)[Fuc(α1-3)]GlcNAc(β1-6)}Gal(β1-4)Glc (fucosyl sialyl lacto-N-novopentaose a). The neutral oligosaccharides, other than fucosyl lacto-N-novopentaose I, a novel hexasaccharide, had been found in milk of the tammar wallaby, a macropod marsupial, while the acidic oligosaccharides, other than fucosyl sialyl lacto-N-novopentaose a had been identified in milk carbohydrate of the red kangaroo. The presence of fucosyl oligosaccharides is a significant feature of koala milk, in which it differs from milk of the tammar wallaby and the red kangaroo.

  1. Production of antibacterial peptide from bee venom via a new strategy for heterologous expression.

    Science.gov (United States)

    Hou, Chunsheng; Guo, Liqiong; Lin, Junfang; You, Linfeng; Wu, Wuhua

    2014-12-01

    Honey bee is important economic insect that not only pollinates fruits and crops but also provides products with various physiological activities. Bee venom is a functional agent that is widely applied in clinical treatment and pharmacy. Secapin is one of these agents that have a significant role in therapy. The functions of secapin from the bee venom have been documented, but little information is known about its heterologous expression under natural condition. Moreover, few scholars verified experimentally the functions of secapin from bee venom in vitro. In this study, we successfully constructed a heterologous expression vector, which is different from conventional expression system. A transgenic approach was established for transformation of secapin gene from the venom of Apis mellifera carnica (Ac-sec) into the edible fungi, Coprinus cinereus. Ac-sec was encoded by a 234 bp nucleotide that contained a signal peptide domain and two potential phosphorylation sites. The sequence exhibited highly homology with various secapins characterized from honey bee and related species. Southern blot data indicated that Ac-sec was present as single or multiple copy loci in the C. cinereus genome. By co-transformation and double-layer active assay, Ac-sec was expressed successfully in C. cinereus and the antibacterial activity of the recombinants was identified, showing notable antibacterial activities on different bacteria. Although Ac-sec is from the venom of Apidae, phylogenetic analysis demonstrated that Ac-sec was more closely related to that of Vespid than to bee species from Apidae. The molecular characteristics of Ac-sec and the potential roles of small peptides in biology were discussed.

  2. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  3. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  4. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  5. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  6. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    of their ability to degrade xenobiotic compounds. Owing to extra- cellular non-specific free-radical-based ligninolytic system of WRF, they can completely eliminate a variety of xenobiotics, including synthetic dyes, giving rise to non-toxic compounds (Kuhad et al... and decolorization and ligninolytic enzymes activity was determined in the cell-free supernatant (CS). 2.5 Decolorization Assays The fungal biomass from each 250-ml Erlenmeyer flask was taken after respective incubation period. It was crushed into a paste...

  7. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.

    1996-05-01

    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  8. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  9. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.

    2009-01-01

    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  10. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

    Science.gov (United States)

    Yitzhak Hadar; Daniel Cullen

    2013-01-01

    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  11. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  12. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  13. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  14. Scale-up fermentation of oil palm empty fruit bunch to produce ruminant feed by radiation processing

    International Nuclear Information System (INIS)

    Awang, M.R.; Mutaat, H.H.; Deres, R.M.; Kume, Tamikazu.

    1992-01-01

    Scale-up fermentation and irradiation conditions of empty fruit bunch (EFB) of oil palm were examined to produce a large amount of fermented products for animal feeds. The EFB substrates pasteurized by irradiation were inoculated with Coprinus cinereus. After 1 month incubation, the crude fiber contents decreased to 20 - 38% and crude protein contents increased to 9 - 13% in small scale fermentation using conical flask (6 - 20 g EFB). In the case of fermentation using polypropylene bags with 400 g EFB, crude fiber and protein contents were 32 - 34% and 11 - 14%, respectively. A larger plastic container packed with 1.5 kg EFB fiber of 10cm thickness was used for mushroom cultivation. After harvest of mushroom (yields were about 250 g per container), the quality of residual substrates improved further as reflected by its crude fiber content of only 16 - 20%, crude protein content of 6 - 8%. These results show that a large volume of products are available under the good aeration by increasing the number of plastic bags or containers. For the irradiation of a lot of fermentation substrates, the advantage of 60 Co gamma-ray and electron beam irradiator was also discussed. (author)

  15. Preliminary study on isolation and quality analysis of enzymes from fermented oil palm empty fruit bunch

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Tamikazu Kume; Shinpei Matsuhashi

    1998-01-01

    Palm Empty Fruit Bunch (EFB) is a cellulosic waste, consisting of 40 - 60 % cellulose with the remaining components comprised of hemicellulose, lignin and other materials. Cellulase is a complex of enzymes containing chiefly endo and exo glucanase, as well as cellobiase plus others (Mandel et al, 1976). Studies on cellulase production from Trichodermaa viride have been reported. The enzyme system from this fungi is considered to be a complete composition of cellulase; and it was reported to be able to hydrolyse slowly a more resistant or crystalline portion of cellulose. Previous work showed Pleorotus sajor-caju and Coprinus cinereus can be easily grown on EFB. The quality of this enzyme system was characterized based on its degradation activity on filter paper, salicin and xylan into simple sugars. These activity tests would revealed the ability of cellulase enzyme system to break down insoluble cellulose, and hydrolysing salicin such as cellobiose and xylanase for breaking down hemicellulose. In this study, the enzyme system derived from liquid state fermentation by these fungi utilizing EFB as carbon source was investigated

  16. In vitro activity of chloramphenicol, florfenicol and enrofloxacin against Chlamydia pecorum isolated from koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Black, L A; Higgins, D P; Govendir, M

    2015-11-01

    To determine the in vitro susceptibilities of koala isolates of Chlamydia pecorum to enrofloxacin and chloramphenicol, which are frequently used to treat koalas with chlamydiosis, and florfenicol, a derivative of chloramphenicol. The in vitro susceptibilities were determined by culturing three stored isolates and seven clinical swabs of C. pecorum. Susceptibility testing was undertaken using cycloheximide-treated buffalo green monkey kidney cells in 96 well microtitre plates. The minimum inhibitory concentrations (MICs) for all isolates were 0.25-0.50 µg/mL (enrofloxacin), 1-2 µg/mL (chloramphenicol), and 1-2 µg/mL (florfenicol). Minimum bactericidal concentration (MBC) values for five isolates were also determined and were within one two-fold dilution of MICs. The MICs and MBCs of these antimicrobials were within ranges previously reported for other chlamydial species. When combined with previously published pharmacokinetic data, the in vitro susceptibility results support chloramphenicol as a more appropriate treatment option than enrofloxacin for koalas with chlamydiosis. The susceptibility results also indicate florfenicol may be an appropriate treatment option for koalas with chlamydiosis, warranting further investigation. © 2015 Australian Veterinary Association.

  17. Evaluation of enrofloxacin use in koalas (Phascolarctos cinereus) via population pharmacokinetics and Monte Carlo simulation.

    Science.gov (United States)

    Black, L A; Landersdorfer, C B; Bulitta, J B; Griffith, J E; Govendir, M

    2014-06-01

    Clinically normal koalas (n = 6) received a single dose of intravenous enrofloxacin (10 mg/kg). Serial plasma samples were collected over 24 h, and enrofloxacin concentrations were determined via high-performance liquid chromatography. Population pharmacokinetic modeling was performed in S-ADAPT. The probability of target attainment (PTA) was predicted via Monte Carlo simulations (MCS) using relevant target values (30-300) based on the unbound area under the curve over 24 h divided by the minimum inhibitory concentration (MIC) (fAUC0-24 /MIC), and published subcutaneous data were incorporated (Griffith et al., 2010). A two-compartment disposition model with allometrically scaled clearances (exponent: 0.75) and volumes of distribution (exponent: 1.0) adequately described the disposition of enrofloxacin. For 5.4 kg koalas (average weight), point estimates for total clearance (SE%) were 2.58 L/h (15%), central volume of distribution 0.249 L (14%), and peripheral volume 2.77 L (20%). MCS using a target fAUC0-24 /MIC of 40 predicted highest treatable MICs of 0.0625 mg/L for intravenous dosing and 0.0313 mg/L for subcutaneous dosing of 10 mg/kg enrofloxacin every 24 h. Thus, the frequently used dosage of 10 mg/kg enrofloxacin every 24 h subcutaneously may be appropriate against gram-positive bacteria with MICs ≤ 0.03 mg/L (PTA > 90%), but appears inadequate against gram-negative bacteria and Chlamydiae in koalas. © 2013 John Wiley & Sons Ltd.

  18. Isolation and characterization of gonadotropin isohormones from the pituitary gland of pike eel (Muraenesox cinereus)

    International Nuclear Information System (INIS)

    Huang, F.-L.; Huang, C.-J.; Lin, S.-H.; Lo, T.-B.; Papkoff, H.

    1981-01-01

    Pike eel gonadotropins were isolated from pituitary glands by 40% alcohol-6% ammonium acetate, pH 5.1 extraction and were purified by DEAE-cellulose chromatography and electrophoresis into four electrophoretically homogeneous forms. These four isohormones were biologically identified as gonadotropins by the stimulation of 32 P-uptake in 1-day-old chick testes, by the induction of ovulation in catfish, and by the in vitro production of testosterone from isolated rat Leydig cells and of androgen from carp testes. The amino acid composition of the isohormones were similar to other known piscine gonadotropins (carp and salmon) and were composed of two non-identical subunits with Tyr and Ser as N-terminal amino acid residues. The molecular weights of two subunits were 15000 and 10500, respectively, as estimated by SDS-gel disc electrophoresis. (author)

  19. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus in Southeast Queensland

    Directory of Open Access Journals (Sweden)

    Emily Burton

    2016-09-01

    Full Text Available Koala populations in southeast Queensland are under threat from many factors, particularly habitat loss, dog attack, vehicle trauma and disease. Animals not killed from these impacts are often rescued and taken into care for rehabilitation, and eventual release back to the wild if deemed to be healthy. This study investigated current rescue, rehabilitation and release data for koalas admitted to the four major wildlife hospitals in southeast Queensland (Australia Zoo Wildlife Hospital (AZWH, Currumbin Wildlife Sanctuary Hospital (CWH, Moggill Koala Hospital (MKH and the Royal Society for the Prevention Against Cruelty to Animals Wildlife Hospital at Wacol (RSPCA, and suggests aspects of the practice that may be changed to improve its contribution to the preservation of the species. It concluded that: (a the main threats to koalas across southeast Queensland were related to urbanization (vehicle collisions, domestic animal attacks and the disease chlamydiosis; (b case outcomes varied amongst hospitals, including time spent in care, euthanasia and release rates; and (c the majority (66.5% of rescued koalas were either euthanized or died in care with only 27% released back to the wild. The results from this study have important implications for further research into koala rescue and rehabilitation to gain a better understanding of its effectiveness as a conservation strategy.

  20. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Quintin Lau

    2014-06-01

    Full Text Available Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60 are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII alleles or genotypes, and higher c-hsp 60 antibody levels or chlamydia-associated disease and infertility. In this study, we characterised partial MHCII DAB and DBB genes in female koalas (n = 94 from a single geographic population, and investigated associations among antibody responses to c-hsp60 quantified by ELISA, susceptibility to chlamydial infection, or age. The identification of three candidate MHCII variants provides additional support for the functional role of MHCII in the koala, and will inform more focused future studies. This is the first study to investigate an association between MHC genes with chlamydial pathogenesis in a non-model, free-ranging species.

  1. Establishment and characterization of a new epithelial cell line, KC-1, from koala (Phascolarctos cinereus) conjunctiva.

    Science.gov (United States)

    Girjes, Adeeb A; Lee, Kristen E; Carrick, Frank N

    2003-01-01

    A novel, untransformed koala cell line (KC-1) was established by culturing koala conjunctival tissue in growth medium, which has permitted the study of the cell biology of this unique system. After the establishment of the KC-1 cell line, the cells were characterized by light microscopy, doubling time, and Western blot analysis. Light microscopy revealed that the cells have an epithelial morphology. Doubling times were significantly different (P koala cell line was adapted to grow continuously in Dulbecco modified Eagle medium containing 10% FCS for at least 30 passages. This unique cell line is an ideal tool for further investigation on koala cell biology and cytogenetics and for exploration of the pathophysiological mechanism of eye infections caused by different pathogens in koalas.

  2. Perception of male caller identity in Koalas (Phascolarctos cinereus): acoustic analysis and playback experiments.

    Science.gov (United States)

    Charlton, Benjamin D; Ellis, William A H; McKinnon, Allan J; Brumm, Jacqui; Nilsson, Karen; Fitch, W Tecumseh

    2011-01-01

    The ability to signal individual identity using vocal signals and distinguish between conspecifics based on vocal cues is important in several mammal species. Furthermore, it can be important for receivers to differentiate between callers in reproductive contexts. In this study, we used acoustic analyses to determine whether male koala bellows are individually distinctive and to investigate the relative importance of different acoustic features for coding individuality. We then used a habituation-discrimination paradigm to investigate whether koalas discriminate between the bellow vocalisations of different male callers. Our results show that male koala bellows are highly individualized, and indicate that cues related to vocal tract filtering contribute the most to vocal identity. In addition, we found that male and female koalas habituated to the bellows of a specific male showed a significant dishabituation when they were presented with bellows from a novel male. The significant reduction in behavioural response to a final rehabituation playback shows this was not a chance rebound in response levels. Our findings indicate that male koala bellows are highly individually distinctive and that the identity of male callers is functionally relevant to male and female koalas during the breeding season. We go on to discuss the biological relevance of signalling identity in this species' sexual communication and the potential practical implications of our findings for acoustic monitoring of male population levels.

  3. Pharmacokinetics of posaconazole in koalas (Phascolarctos cinereus) after intravenous and oral administration.

    Science.gov (United States)

    Gharibi, S; Kimble, B; Vogelnest, L; Barnes, J; Stadler, C K; Govendir, M

    2017-12-01

    The pharmacokinetic profile of posaconazole in clinically normal koalas (n = 8) was investigated. Single doses of posaconazole were administered intravenously (i.v.; 3 mg/kg; n = 2) or orally (p.o.; 6 mg/kg; n = 6) with serial plasma samples collected over 24 and 36 hr, respectively. Plasma concentrations of posaconazole were quantified by validated high-performance liquid chromatography. A noncompartmental pharmacokinetic analysis of data was performed. Following i.v. administration, estimates of the median (range) of plasma clearance (CL) and steady-state volume of distribution (V ss ) were 0.15 (0.13-0.18) L hr -1  kg -1 and 1.23 (0.93-1.53) L/kg, respectively. The median (range) elimination half-life (t 1/2 ) after i.v. and p.o. administration was 7.90 (7.62-8.18) and 12.79 (11.22-16.24) hr, respectively. Oral bioavailability varied from 0.43 to 0.99 (median: 0.66). Following oral administration, maximum plasma concentration (C max ; median: 0.72, range: 0.55-0.93 μg/ml) was achieved in 8 (range 6-12) hr. The in vitro plasma protein binding of posaconazole incubated at 37°C was 99.25 ± 0.29%. Consideration of posaconazole pharmacokinetic/pharmacodynamic (PK/PD) targets for some yeasts such as disseminated candidiasis suggests that posaconazole could be an efficacious treatment for cryptococcosis in koalas. © 2017 John Wiley & Sons Ltd.

  4. Plasma biochemistry and urinalysis variables of koalas (Phascolarctos cinereus) with and without oxalate nephrosis.

    Science.gov (United States)

    Speight, K Natasha; Haynes, Julie I; Boardman, Wayne; Breed, William G; Taggart, David A; Rich, Brian; Woolford, Lucy

    2014-06-01

    Oxalate nephrosis is a highly prevalent disease in the Mount Lofty Ranges koala population in South Australia, but associated clinicopathologic findings remain undescribed. The aims of this study were to determine plasma biochemical and urinalysis variables, particularly for renal function and urinary crystal morphology and composition, in koalas with oxalate nephrosis. Blood and urine samples from Mount Lofty Ranges koalas with oxalate nephrosis were compared with those unaffected by renal oxalate crystal deposition from Mount Lofty and Kangaroo Island, South Australia and Moggill, Queensland. Plasma and urine biochemistry variables were analyzed using a Cobas Bio analyzer, and urinary oxalate by high-performance liquid chromatography. Urinary crystal composition was determined by infrared spectroscopy and energy dispersive X-ray analysis. Azotemia (urea > 6.6 mmol/L, creatinine > 150 μmol/L) was found in 93% of koalas with oxalate nephrosis (n = 15). All azotemic animals had renal insufficiency (urine specific gravity [USG] < 1.035), and in 83%, USG was < 1.030. Koalas with oxalate nephrosis were hyperoxaluric compared with Queensland koalas (P < .01). Urinary crystals from koalas with oxalate nephrosis had atypical morphology and were composed of calcium oxalate. Mount Lofty Ranges koalas unaffected by renal oxalate crystal deposition had renal insufficiency (43%), although only 14% had USG < 1.030 (n = 7). Unaffected Mount Lofty Ranges and Kangaroo Island koalas were hyperoxaluric compared with Queensland koalas (P < .01). Koalas with oxalate nephrosis from the Mount Lofty Ranges had renal insufficiency, hyperoxaluria, and pathognomonic urinary crystals. The findings of this study will aid veterinary diagnosis of this disease. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  5. Activity patterns of free-ranging koalas (Phascolarctos cinereus revealed by accelerometry.

    Directory of Open Access Journals (Sweden)

    Michelle A Ryan

    Full Text Available An understanding of koala activity patterns is important for measuring the behavioral response of this species to environmental change, but to date has been limited by the logistical challenges of traditional field methodologies. We addressed this knowledge gap by using tri-axial accelerometer data loggers attached to VHF radio collars to examine activity patterns of adult male and female koalas in a high-density population at Cape Otway, Victoria, Australia. Data were obtained from 27 adult koalas over two 7-d periods during the breeding season: 12 in the early-breeding season in November 2010, and 15 in the late-breeding season in January 2011. Multiple 15 minute observation blocks on each animal were used for validation of activity patterns determined from the accelerometer data loggers. Accelerometry was effective in distinguishing between inactive (sleeping, resting and active (grooming, feeding and moving behaviors. Koalas were more active during the early-breeding season with a higher index of movement (overall dynamic body acceleration [ODBA] for both males and females. Koalas showed a distinct temporal pattern of behavior, with most activity occurring from mid-afternoon to early morning. Accelerometry has potential for examining fine-scale behavior of a wide range of arboreal and terrestrial species.

  6. Can Citizen Science Assist in Determining Koala (Phascolarctos cinereus Presence in a Declining Population?

    Directory of Open Access Journals (Sweden)

    Emily Flower

    2016-07-01

    Full Text Available The acceptance and application of citizen science has risen over the last 10 years, with this rise likely attributed to an increase in public awareness surrounding anthropogenic impacts affecting urban ecosystems. Citizen science projects have the potential to expand upon data collected by specialist researchers as they are able to gain access to previously unattainable information, consequently increasing the likelihood of an effective management program. The primary objective of this research was to develop guidelines for a successful regional-scale citizen science project following a critical analysis of 12 existing citizen science case studies. Secondly, the effectiveness of these guidelines was measured through the implementation of a citizen science project, Koala Quest, for the purpose of estimating the presence of koalas in a fragmented landscape. Consequently, this research aimed to determine whether citizen-collected data can augment traditional science research methods, by comparing and contrasting the abundance of koala sightings gathered by citizen scientists and professional researchers. Based upon the guidelines developed, Koala Quest methodologies were designed, the study conducted, and the efficacy of the project assessed. To combat the high variability of estimated koala populations due to differences in counting techniques, a national monitoring and evaluation program is required, in addition to a standardised method for conducting koala population estimates. Citizen science is a useful method for monitoring animals such as the koala, which are sparsely distributed throughout a vast geographical area, as the large numbers of volunteers recruited by a citizen science project are capable of monitoring a similarly broad spatial range.

  7. Some pharmacokinetic indices of oral fluconazole administration to koalas (Phascolarctos cinereus) infected with cryptococcosis.

    Science.gov (United States)

    Govendir, M; Black, L A; Jobbins, S E; Kimble, B; Malik, R; Krockenberger, M B

    2016-08-01

    Three asymptomatic koalas serologically positive for cryptococcosis and two symptomatic koalas were treated with 10 mg/kg fluconazole orally, twice daily for at least 2 weeks. The median plasma Cmax and AUC0-8 h for asymptomatic animals were 0.9 μg/mL and 4.9 μg/mL·h, respectively; and for symptomatic animals 3.2 μg/mL and 17.3 μg/mL·h, respectively. An additional symptomatic koala was treated with fluconazole (10 mg/kg twice daily) and a subcutaneous amphotericin B infusion twice weekly. After 2 weeks the fluconazole Cmax was 3.7 μg/mL and the AUC0-8 h was 25.8 μg/mL*h. An additional three koalas were treated with fluconazole 15 mg/kg twice daily for at least 2 weeks, with the same subcutaneous amphotericin protocol co-administered to two of these koalas (Cmax : 5.0 μg/mL; mean AUC0-8 h : 18.1 μg/mL*h). For all koalas, the fluconazole plasma Cmax failed to reach the MIC90 (16 μg/mL) to inhibit C. gattii. Fluconazole administered orally at either 10 or 15 mg/kg twice daily in conjunction with amphotericin is unlikely to attain therapeutic plasma concentrations. Suggestions to improve treatment of systemic cryptococcosis include testing pathogen susceptibility to fluconazole, monitoring plasma fluconazole concentrations, and administration of 20-25 mg/kg fluconazole orally, twice daily, with an amphotericin subcutaneous infusion twice weekly. © 2015 The Authors. Journal of Veterinary Pharmacology and Therapeutics Published by John Wiley & Sons Ltd.

  8. Perception of male caller identity in Koalas (Phascolarctos cinereus: acoustic analysis and playback experiments.

    Directory of Open Access Journals (Sweden)

    Benjamin D Charlton

    Full Text Available The ability to signal individual identity using vocal signals and distinguish between conspecifics based on vocal cues is important in several mammal species. Furthermore, it can be important for receivers to differentiate between callers in reproductive contexts. In this study, we used acoustic analyses to determine whether male koala bellows are individually distinctive and to investigate the relative importance of different acoustic features for coding individuality. We then used a habituation-discrimination paradigm to investigate whether koalas discriminate between the bellow vocalisations of different male callers. Our results show that male koala bellows are highly individualized, and indicate that cues related to vocal tract filtering contribute the most to vocal identity. In addition, we found that male and female koalas habituated to the bellows of a specific male showed a significant dishabituation when they were presented with bellows from a novel male. The significant reduction in behavioural response to a final rehabituation playback shows this was not a chance rebound in response levels. Our findings indicate that male koala bellows are highly individually distinctive and that the identity of male callers is functionally relevant to male and female koalas during the breeding season. We go on to discuss the biological relevance of signalling identity in this species' sexual communication and the potential practical implications of our findings for acoustic monitoring of male population levels.

  9. Multifarious activities of cellulose degrading bacteria from Koala (Phascolarctos cinereus) faeces.

    Science.gov (United States)

    Singh, Surender; Thavamani, Palanisami; Megharaj, Mallavarapu; Naidu, Ravi

    2015-01-01

    Cellulose degrading bacteria from koala faeces were isolated using caboxymethylcellulose-Congo red agar, screened in vitro for different hydrolytic enzyme activities and phylogenetically characterized using molecular tools. Bacillus sp. and Pseudomonas sp. were the most prominent bacteria from koala faeces. The isolates demonstrated good xylanase, amylase, lipase, protease, tannase and lignin peroxidase activities apart from endoglucanase activity. Furthermore many isolates grew in the presence of phenanthrene, indicating their probable application for bioremediation. Potential isolates can be exploited further for industrial enzyme production or in bioremediation of contaminated sites.

  10. Antigenic specificity of a monovalent versus polyvalent MOMP based Chlamydia pecorum vaccine in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Kollipara, Avinash; Wan, Charles; Rawlinson, Galit; Brumm, Jacqui; Nilsson, Karen; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2013-02-06

    Chlamydia continues to be a major pathogen of koalas. The bacterium is associated with ocular, respiratory and urogenital tract infections and a vaccine is considered the best option to limit the decline of mainland koala populations. Over the last 20 years, efforts to develop a chlamydial vaccine in humans have focussed on the use of the chlamydial major outer membrane protein (MOMP). Potential problems with the use of MOMP-based vaccines relate to the wide range of genetic diversity in its four variable domains. In the present study, we evaluated the immune response of koalas vaccinated with a MOMP-based C. pecorum vaccine formulated with genetically and serologically diverse MOMPs. Animals immunised with individual MOMPs developed strong antibody and lymphocyte proliferation responses to both homologous as well as heterologous MOMP proteins. Importantly, we also showed that vaccine induced antibodies which effectively neutralised various heterologous strains of koala C. pecorum in an in vitro assay. Finally, we also demonstrated that the immune responses in monovalent as well as polyvalent MOMP vaccine groups were able to recognise whole chlamydial elementary bodies, illustrating the feasibility of developing an effective MOMP based C. pecorum vaccine that could protect against a range of strains. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  11. Characterisation of four major histocompatibility complex class II genes of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Lau, Quintin; Jobbins, Sarah E; Belov, Katherine; Higgins, Damien P

    2013-01-01

    Major histocompatibility complex (MHC) class II molecules have an integral role in the adaptive immune response, as they bind and present antigenic peptides to T helper lymphocytes. In this study of koalas, species-specific primers were designed to amplify exon 2 of the MHC class II DA and DB genes, which contain much of the peptide-binding regions of the α and β chains. A total of two DA α1 domain variants and eight DA β1 (DAB), three DB α1 and five DB β1 variants were amplified from 20 koalas from two free-living populations from South East Queensland and the Port Macquarie region in northern New South Wales. We detected greater variation in the β1 than in the α1 domains as well as evidence of positive selection in DAB. The present study provides a springboard to future investigation of the role of MHC in disease susceptibility in koalas.

  12. Activity patterns of free-ranging koalas (Phascolarctos cinereus) revealed by accelerometry.

    Science.gov (United States)

    Ryan, Michelle A; Whisson, Desley A; Holland, Greg J; Arnould, John P Y

    2013-01-01

    An understanding of koala activity patterns is important for measuring the behavioral response of this species to environmental change, but to date has been limited by the logistical challenges of traditional field methodologies. We addressed this knowledge gap by using tri-axial accelerometer data loggers attached to VHF radio collars to examine activity patterns of adult male and female koalas in a high-density population at Cape Otway, Victoria, Australia. Data were obtained from 27 adult koalas over two 7-d periods during the breeding season: 12 in the early-breeding season in November 2010, and 15 in the late-breeding season in January 2011. Multiple 15 minute observation blocks on each animal were used for validation of activity patterns determined from the accelerometer data loggers. Accelerometry was effective in distinguishing between inactive (sleeping, resting) and active (grooming, feeding and moving) behaviors. Koalas were more active during the early-breeding season with a higher index of movement (overall dynamic body acceleration [ODBA]) for both males and females. Koalas showed a distinct temporal pattern of behavior, with most activity occurring from mid-afternoon to early morning. Accelerometry has potential for examining fine-scale behavior of a wide range of arboreal and terrestrial species.

  13. Pharmacokinetics of fluconazole following intravenous and oral administration to koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Black, L A; Krockenberger, M B; Kimble, B; Govendir, M

    2014-02-01

    Clinically normal koalas (n = 12) received a single dose of 10 mg/kg fluconazole orally (p.o.; n = 6) or intravenously (i.v.; n = 6). Serial plasma samples were collected over 24 h, and fluconazole concentrations were determined using a validated HPLC assay. A noncompartmental pharmacokinetic analysis was performed. Following i.v. administration, median (range) plasma clearance (CL) and steady-state volume of distribution (Vss ) were 0.31 (0.11-0.55) L/h/kg and 0.92 (0.38-1.40) L/kg, respectively. The elimination half-life (t1/2 ) was much shorter than in many species (i.v.: median 2.25, range 0.98-6.51 h; p.o.: 4.69, range 2.47-8.01 h), and oral bioavailability was low and variable (median 0.53, range 0.20-0.97). Absorption rate-limited disposition was evident. Plasma protein binding was 39.5 ± 3.5%. Although fluconazole volume of distribution (Varea ) displayed an allometric relationship with other mammals, CL and t1/2 did not. Allometrically scaled values were approximately sevenfold lower (CL) and sixfold higher (t1/2 ) than observed values, highlighting flaws associated with this technique in physiologically distinct species. On the basis of fAUC/MIC pharmacodynamic targets, fluconazole is predicted to be ineffective against Cryptococcus gattii in the koala as a sole therapeutic agent administered at 10 mg/kg p.o. every 12 h. © 2013 John Wiley & Sons Ltd.

  14. Reliable genotyping of the koala (Phascolarctos cinereus) using DNA isolated from a single faecal pellet.

    Science.gov (United States)

    Wedrowicz, Faye; Karsa, Mawar; Mosse, Jennifer; Hogan, Fiona E

    2013-07-01

    The koala, an Australian icon, has been added to the threatened species list. Rationale for the listing includes proposed declines in population size, threats to populations (e.g. disease) and loss and fragmentation of habitat. There is now an urgent need to obtain accurate data to assess the status of koala populations in Australia, to ensure the long-term viability of this species. Advances in genetic techniques have enabled DNA analysis to study and inform the management of wild populations; however, sampling of individual koalas is difficult in tall, often remote, eucalypt forest. The collection of faecal pellets (scats) from the forest floor presents an opportunistic sampling strategy, where DNA can be collected without capturing or even sighting an individual. Obtaining DNA via noninvasive sampling can be used to rapidly sample a large proportion of a population; however, DNA from noninvasively collected samples is often degraded. Factors influencing DNA quality and quantity include environmental exposure, diet and methods of sample collection, storage and DNA isolation. Reduced DNA quality and quantity can introduce genotyping errors and provide inaccurate DNA profiles, reducing confidence in the ability of such data to inform management/conservation strategies. Here, we present a protocol that produces a reliable individual koala genotype from a single faecal pellet and highlight the importance of optimizing DNA isolation and analysis for the species of interest. This method could readily be adapted for genetic studies of mammals other than koalas, particularly those whose diet contains high proportions of volatile materials that are likely to induce DNA damage. © 2013 John Wiley & Sons Ltd.

  15. Pathological features of oxalate nephrosis in a population of koalas (Phascolarctos cinereus) in South Australia.

    Science.gov (United States)

    Speight, K N; Boardman, W; Breed, W G; Taggart, D A; Woolford, L; Haynes, J I

    2013-03-01

    The wild and captive koala population of the Mt Lofty Ranges in South Australia has a high level of renal dysfunction in which crystals consistent with calcium oxalate have been observed in the kidneys. This study aimed to describe the pathological features of the renal disease in this population, confirm the composition of renal crystals as calcium oxalate, and determine whether any age or sex predispositions exist for this disease. A total of 51 koalas (28 wild rescues, 23 captive) were examined at necropsy, of which 28 (55%) were found to have gross and/or histological evidence of oxalate nephrosis. Histopathological features included intratubular and interstitial inflammation, tubule dilation, glomerular atrophy, tubule loss, and cortical fibrosis. Calcium oxalate crystals were demonstrated using a combination of polarization microscopy, alizarin red S staining, infrared spectroscopy, and energy-dispersive X-ray analysis with scanning electron microscopy. Uric acid and phosphate deposits were also shown to be present but were associated with minimal histopathological changes. No significant differences were found between the numbers of affected captive and wild rescued koalas; also, there were no sex or age predispositions identified, but it was found that oxalate nephrosis may affect koalas <2 years of age. The findings of this study suggest that oxalate nephrosis is a leading disease in this koala population. Possible causes of this disease are currently under investigation.

  16. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus)

    Science.gov (United States)

    2011-01-01

    Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58), we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP) were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine-detailed molecular marker for epidemiological analysis appears justified, the tarP and ORF663 genes also appear to be valuable markers of phylogenetic or biogeographic divisions at the C. pecorum intra-species level. This research has significant implications for future typing studies to understand the phylogeny, genetic diversity, and epidemiology of C. pecorum infections in the koala and other animal species. PMID:21496349

  17. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus)

    OpenAIRE

    Lau, Quintin; Griffith, Joanna E.; Higgins, Damien P.

    2014-01-01

    Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60) are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII) alleles or genotypes, and higher c-hsp 60 antibody levels or c...

  18. Assessment of florfenicol as a possible treatment for chlamydiosis in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Budd, C; Flanagan, C; Gillett, A; Hanger, J; Loader, J J; Govendir, M

    2017-09-01

    Because of limited availability of chloramphenicol to veterinary suppliers, a preliminary study was performed to predict whether an analogue, florfenicol, is an efficacious treatment for chlamydiosis in koalas. Florfenicol was administered to koalas with naturally occurring chlamydiosis at 20 mg/kg SC (n = 3) and at 5 mg/kg (n = 3) and 10 mg/kg (n = 3) IV. The estimated areas under the plasma concentration versus time curves (AUC) were compared with the minimum inhibitory concentration to inhibit Chlamydia pecorum. Clinical data were also examined from field trials conducted on koalas (n = 19) with naturally occurring chlamydiosis and treated with florfenicol at a range of dosages (5-20 mg/kg SC and 6-15 mg/kg IV). Florfenicol binding to proteins in plasma was also determined. Florfenicol was not detectable in plasma 24 h post-administration at 20 mg/kg SC. The estimated AUC 0-24 h following administration at 10 mg/kg IV suggests florfenicol might be effective against Chlamydia spp. via this route. Florfenicol binding to plasma proteins was 13.0% (± 0.30 SEM). After treatment with florfenicol in field trials, 5 of 19 koalas (26%) were released without further treatment, 4 with no long-term follow-up; 6 (32%) required additional treatment with chloramphenicol to resolve chlamydiosis; 7 (36%) failed to clinically improve, of which 3 had clinical signs and/or necropsy findings suggestive of antibiotic-related gastrointestinal dysbiosis; another koala died within minutes of florfenicol administered IV at 7 mg/kg. When administered at dosages tolerable in the field, florfenicol is a problematic treatment for chlamydiosis based on equivocal outcomes and plasma concentrations below those that inhibit the pathogen. © 2017 Australian Veterinary Association.

  19. Pharmacokinetics of meloxicam in koalas (Phascolarctos cinereus) after intravenous, subcutaneous and oral administration.

    Science.gov (United States)

    Kimble, B; Black, L A; Li, K M; Valtchev, P; Gilchrist, S; Gillett, A; Higgins, D P; Krockenberger, M B; Govendir, M

    2013-10-01

    The pharmacokinetic profile of meloxicam in clinically healthy koalas (n = 15) was investigated. Single doses of meloxicam were administered intravenously (i.v.) (0.4 mg/kg; n = 5), subcutaneously (s.c.) (0.2 mg/kg; n = 1) or orally (0.2 mg/kg; n = 3), and multiple doses were administered to two groups of koalas via the oral or s.c. routes (n = 3 for both routes) with a loading dose of 0.2 mg/kg for day 1 followed by 0.1 mg/kg s.i.d for a further 3 days. Plasma meloxicam concentrations were quantified by high-performance liquid chromatography. Following i.v. administration, meloxicam exhibited a rapid clearance (CL) of 0.44 ± 0.20 (SD) L/h/kg, a volume of distribution at terminal phase (Vz ) of 0.72 ± 0.22 L/kg and a volume of distribution at steady state (Vss ) of 0.22 ± 0.12 L/kg. Median plasma terminal half-life (t(1/2)) was 1.19 h (range 0.71-1.62 h). Following oral administration either from single or repeated doses, only maximum peak plasma concentration (C(max) 0.013 ± 0.001 and 0.014 ± 0.001 μg/mL, respectively) was measurable [limit of quantitation (LOQ) >0.01 μg/mL] between 4-8 h. Oral bioavailability was negligible in koalas. Plasma protein binding of meloxicam was ~98%. Three meloxicam metabolites were detected in plasma with one identified as the 5-hydroxy methyl derivative. This study demonstrated that koalas exhibited rapid CL and extremely poor oral bioavailability compared with other eutherian species. Accordingly, the currently recommended dose regimen of meloxicam for this species appears inadequate. © 2013 John Wiley & Sons Ltd.

  20. Orchitis and Epididymitis in Koalas (Phascolarctos cinereus) Infected With Chlamydia pecorum.

    Science.gov (United States)

    Johnston, S D; Deif, H H; McKinnon, A; Theilemann, P; Griffith, J E; Higgins, D P

    2015-11-01

    Although Chlamydia causes disease of the urethra and prostate of male koalas, its impact on the testis and epididymis has not been examined. This study describes chronic-active and granulomatous orchitis and epididymitis with interstitial fibrosis associated with infection by Chlamydia pecorum in 2 of 18 adult male koalas being euthanized at a koala hospital, 8 of which also had chlamydial prostatitis. By immunohistochemistry and transmission electron microscopy, chlamydial inclusions were demonstrated within Sertoli cells directly associated with mild inflammation surrounding intact seminiferous and epididymal tubules, marked pyogranulomatous inflammation around disrupted tubules, replacement of tubules by interstitial fibrosis, and aspermia. The presence of C. pecorum but not Chlamydia pneumoniae was detected by quantitative polymerase chain reaction of formalin-fixed tissues of the left and right testes and right epididymis in 1 animal. This is the first report of orchitis and epididymitis in a koala infected with C. pecorum. © The Author(s) 2015.

  1. Validation of ultrasonography in detecting structural disease of the urogenital tract of the koala, Phascolarctos cinereus.

    Science.gov (United States)

    Marschner, C; Flanagan, C; Higgins, D P; Krockenberger, M B

    2014-05-01

    A retrospective review of case records of ultrasonography and necropsy outcomes of 62 koalas was used to investigate the accuracy of ultrasonography in assessing koala urogenital tract structural disease at the Port Macquarie Koala Hospital. The results showed high concordance, supporting ultrasonography as an effective tool for evaluating structural disease of the koala urogenital tract, most commonly seen with chlamydiosis. The study also illustrates the advances benefiting animal welfare that can be made by wildlife carer groups through using a scientific, evidence-based approach. © 2014 Australian Veterinary Association.

  2. A Survey of Pesticide Accumulation in a Specialist Feeder, the Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Marschner, Caroline; Higgins, Damien P; Krockenberger, Mark B

    2017-09-01

    To maintain profitability in Australia's agricultural and urban landscapes pesticides are used throughout the range of koala habitats. The koala is a specialist feeder, reliant on metabolic enzyme capacities to utilise a toxic diet of eucalypt leaves and is potentially prone to adverse effects when xenobiotic interactions between dietary and anthropogenic xenobiotics occur. The aim of this study was to investigate accumulation of frequently used pesticides in wild koalas in 4 areas of New South Wales and Queensland. Liver samples of 57 deceased koalas were collected from care facilities and analysed using a modified QuEChERS extraction method followed by GCMSMS, HRLCMS and LCMSMS. No accumulation of any of the 166 investigated pesticides was found. Data indicate hepatic accumulation of pesticides in this species is uncommon even with close interactions with intensive land use. Despite the lack of hepatic bioaccumulation, this study cannot exclude a direct effect on hepatocellular metabolic pathways.

  3. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus) in Southeast Queensland.

    Science.gov (United States)

    Burton, Emily; Tribe, Andrew

    2016-09-15

    Koala populations in southeast Queensland are under threat from many factors, particularly habitat loss, dog attack, vehicle trauma and disease. Animals not killed from these impacts are often rescued and taken into care for rehabilitation, and eventual release back to the wild if deemed to be healthy. This study investigated current rescue, rehabilitation and release data for koalas admitted to the four major wildlife hospitals in southeast Queensland (Australia Zoo Wildlife Hospital (AZWH), Currumbin Wildlife Sanctuary Hospital (CWH), Moggill Koala Hospital (MKH) and the Royal Society for the Prevention Against Cruelty to Animals Wildlife Hospital at Wacol (RSPCA)), and suggests aspects of the practice that may be changed to improve its contribution to the preservation of the species. It concluded that: (a) the main threats to koalas across southeast Queensland were related to urbanization (vehicle collisions, domestic animal attacks and the disease chlamydiosis); (b) case outcomes varied amongst hospitals, including time spent in care, euthanasia and release rates; and (c) the majority (66.5%) of rescued koalas were either euthanized or died in care with only 27% released back to the wild. The results from this study have important implications for further research into koala rescue and rehabilitation to gain a better understanding of its effectiveness as a conservation strategy.

  4. Potential ?Ecological Traps? of Restored Landscapes: Koalas Phascolarctos cinereus Re-Occupy a Rehabilitated Mine Site

    OpenAIRE

    Cristescu, Romane H.; Banks, Peter B.; Carrick, Frank N.; Fr?re, C?line

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations...

  5. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Timms Peter

    2011-04-01

    Full Text Available Abstract Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58, we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine-detailed molecular marker for epidemiological analysis appears justified, the tarP and ORF663 genes also appear to be valuable markers of phylogenetic or biogeographic divisions at the C. pecorum intra-species level. This research has significant implications for future typing studies to understand the phylogeny, genetic diversity, and epidemiology of C. pecorum infections in the koala and other animal species.

  6. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Lau, Quintin; Griffith, Joanna E; Higgins, Damien P

    2014-01-01

    Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60) are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII) alleles or genotypes, and higher c-hsp 60 antibody levels or chlamydia-associated disease and infertility. In this study, we characterised partial MHCII DAB and DBB genes in female koalas (n = 94) from a single geographic population, and investigated associations among antibody responses to c-hsp60 quantified by ELISA, susceptibility to chlamydial infection, or age. The identification of three candidate MHCII variants provides additional support for the functional role of MHCII in the koala, and will inform more focused future studies. This is the first study to investigate an association between MHC genes with chlamydial pathogenesis in a non-model, free-ranging species.

  7. Can Citizen Science Assist in Determining Koala (Phascolarctos cinereus) Presence in a Declining Population?

    Science.gov (United States)

    Flower, Emily; Jones, Darryl; Bernede, Lilia

    2016-07-14

    The acceptance and application of citizen science has risen over the last 10 years, with this rise likely attributed to an increase in public awareness surrounding anthropogenic impacts affecting urban ecosystems. Citizen science projects have the potential to expand upon data collected by specialist researchers as they are able to gain access to previously unattainable information, consequently increasing the likelihood of an effective management program. The primary objective of this research was to develop guidelines for a successful regional-scale citizen science project following a critical analysis of 12 existing citizen science case studies. Secondly, the effectiveness of these guidelines was measured through the implementation of a citizen science project, Koala Quest, for the purpose of estimating the presence of koalas in a fragmented landscape. Consequently, this research aimed to determine whether citizen-collected data can augment traditional science research methods, by comparing and contrasting the abundance of koala sightings gathered by citizen scientists and professional researchers. Based upon the guidelines developed, Koala Quest methodologies were designed, the study conducted, and the efficacy of the project assessed. To combat the high variability of estimated koala populations due to differences in counting techniques, a national monitoring and evaluation program is required, in addition to a standardised method for conducting koala population estimates. Citizen science is a useful method for monitoring animals such as the koala, which are sparsely distributed throughout a vast geographical area, as the large numbers of volunteers recruited by a citizen science project are capable of monitoring a similarly broad spatial range.

  8. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  9. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.

    2017-01-01

    Documenting succession in forest canopy gaps provides insights into the ecological processes governing the temporal dynamics of species within communities. We analyzed the fruiting patterns of a rare but widely distributed saproxylic macromycete, Xylobolus subpileatus, during the ageing of natura...

  10. Hydrophobins in the Life Cycle of the Ectomycorrhizal Basidiomycete Tricholoma vaccinum.

    Directory of Open Access Journals (Sweden)

    Dominik Sammer

    Full Text Available Hydrophobins-secreted small cysteine-rich, amphipathic proteins-foster interactions of fungal hyphae with hydrophobic surfaces, and are involved in the formation of aerial hyphae. Phylogenetic analyses of Tricholoma vaccinum hydrophobins showed a grouping with hydrophobins of other ectomycorrhizal fungi, which might be a result of co-evolution. Further analyses indicate angiosperms as likely host trees for the last common ancestor of the genus Tricholoma. The nine hydrophobin genes in the T. vaccinum genome were investigated to infer their individual roles in different stages of the life cycle, host interaction, asexual and sexual development, and with respect to different stresses. In aerial mycelium, hyd8 was up-regulated. In silico analysis predicted three packing arrangements, i.e., ring-like, plus-like and sheet-like structure for Hyd8; the first two may assemble to rodlets of hydrophobin covering aerial hyphae, whereas the third is expected to be involved in forming a two-dimensional network of hydrophobins. Metal stress induced hydrophobin gene hyd5. In early steps of mycorrhization, induction of hyd4 and hyd5 by plant root exudates and root volatiles could be shown, followed by hyd5 up-regulation during formation of mantle, Hartig' net, and rhizomorphs with concomitant repression of hyd8 and hyd9. During fruiting body formation, mainly hyd3, but also hyd8 were induced. Host preference between the compatible host Picea abies and the low compatibility host Pinus sylvestris could be linked to a stronger induction of hyd4 and hyd5 by the preferred host and a stronger repression of hyd8, whereas the repression of hyd9 was comparable between the two hosts.

  11. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415 ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  12. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi

    Science.gov (United States)

    Dana L. Richter; Jessie A. Glaeser

    2015-01-01

    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  13. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  15. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    seen, but LIP production either was not seen or was minimal. LME rpoduction was also seen in media prepared with artificial seawater. Fast rpotein liquid chromatography and isoelectric focusing resolved LMEs into four isozymes each of MNP and LIP, while...

  16. Cd and Zn interactions and toxicity in ectomycorrhizal basidiomycetes in axenic culture

    Directory of Open Access Journals (Sweden)

    Vinicius H. De Oliveira

    2018-03-01

    Full Text Available Background Metal contamination in soils affects both above- and belowground communities, including soil microorganisms. Ectomycorrhizal (ECM fungi are an important component in belowground community and tolerant strains have great potential in enhancing plant-based remediation techniques. We assessed cadmium and zinc toxicity in five ECM species in liquid media (Hebeloma subsaponaceum; H. cylindrosporum; H. crustuliniforme; Scleroderma sp.; Austroboletus occidentalis and investigated the potential of Zn to alleviate Cd toxicity. Due to highly divergent results reported in the literature, liquid and solid media were compared experimentally for the first time in terms of differential toxicity thresholds in Cd and Zn interactions. Methods A wide range of Cd and Zn concentrations were applied to ectomycorrhizal fungi in axenic cultures (in mg L−1: 0; 1; 3; 9; 27; 81; 243 for the Cd treatments, and 0; 1; 30; 90; 270; 810; 2,430 for Zn. Combined Zn and Cd treatments were also applied to H. subsaponaceum and Scleroderma sp. Dry weight was recorded after 30 days, and in case of solid medium treatments, radial growth was also measured. Results and Discussion All species were adversely affected by high levels of Cd and Zn, and A. occidentalis was the most sensitive, with considerable biomass decrease at 1 mg L−1 Cd, while Scleroderma sp. and H. subsaponaceum were the most tolerant, which are species commonly found in highly contaminated sites. Cd was generally 10 times more toxic than Zn, which may explain why Zn had little impact in alleviating Cd effects. In some cases, Cd and Zn interactions led to a synergistic toxicity, depending on the concentrations applied and type of media used. Increased tolerance patterns were detected in fungi grown in solid medium and may be the cause of divergent toxicity thresholds found in the literature. Furthermore, solid medium allows measuring radial growth/mycelial density as endpoints which are informative and in this case appeared be related to the high tolerance indices found in H. subsaponaceum.

  17. Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.

    Science.gov (United States)

    Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina

    2011-01-01

    Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

  18. Cytotoxic activity of methanol extracts from Basidiomycete mushrooms on murine cancer cell lines.

    Science.gov (United States)

    Tomasi, S; Lohézic-Le Dévéhat, F; Sauleau, P; Bézivin, C; Boustie, J

    2004-04-01

    Crude methanol extracts of 58 mushroom species were screened for their cytotoxic activities against two murine cancer cell lines, L1210 and 3LL, using the tetrazolium assay. A majority of extracts (74%) exhibited IC50 > 100 microg/ml against both cell lines. A most marked activity against one of the cell lines was noted for nine species (14% of the tested species). While Amanitales and Russulales tested were not found active, Polyporales and Boletales gave better results. Four species exhibited a significant cytotoxic activity (IC50 Suillus granulatus, S. luteus). The last one had never been investigated for its cytotoxic compounds before.

  19. Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes.

    Science.gov (United States)

    Shi, Liang; Chen, Dongdong; Xu, Chao; Ren, Ang; Yu, Hanshou; Zhao, Mingwen

    2017-07-11

    Flammulina velutipes is a well-known edible mushroom cultivated all over the world. However, because of the low transformation frequency, the expensive instruments required, and the complicated, time-consuming procedures necessary, there is insufficient genetic research on F. velutipes. In this study, we report a liposome-mediated transformation (LMT) system for the genetic transformation of F. velutipes. Using the LMT system, we obtained 82 ± 4 stable F. velutipes transformants per 10 5 protoplasts, which is a clear increase in transformation frequency compared to the other methods used. We were able to detect the expression of an EGFP reporter gene in the F. velutipes transformants using fluorescence imaging assays. Furthermore, we used this method to transfer the laccase gene into F. velutipes and found that the transcriptional level and enzymatic activity increased in these transformants. Mitotic stability analysis showed that all of the selected transformants remained mitotically stable, even after five successive rounds of sub-culturing. These results demonstrate a new transgenic approach that will facilitate F. velutipes research.

  20. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete

    OpenAIRE

    Kerem, Zohar; Bao, Wuli; Hammel, Kenneth E.

    1998-01-01

    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes....

  1. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete.

    Science.gov (United States)

    Kerem, Z; Bao, W; Hammel, K E

    1998-09-01

    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes. Analyses of degraded PEOs by gel permeation chromatography showed that the fungus cleaved PEO rapidly by an endo route. 13C NMR analyses of unlabeled and perdeuterated PEOs recovered from G. trabeum cultures showed that a major route for depolymerization was oxidative C---C bond cleavage, a reaction diagnostic for hydrogen abstraction from a PEO methylene group by a radical oxidant. Fenton reagent (Fe(II)/H2O2) oxidized PEO by the same route in vitro and therefore might account for PEO biodegradation if it is produced by the fungus, but the data do not rule out involvement of less reactive radicals. The reactivity and extrahyphal location of this PEO-degrading system suggest that its natural function is to participate in the brown rot of wood and that it may enable brown-rot fungi to degrade recalcitrant organopollutants.

  2. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  3. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

    Science.gov (United States)

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

    2015-07-01

    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  4. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes).

    Science.gov (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik

    2009-09-01

    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  5. Concentration and behavior of radiocesium in higher basidiomycetes in some Kanto and the Koshin districts, Japan

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Iwashima, Kiyoshi; Shibata, Hisashi.

    1990-01-01

    Concentration of 137 Cs, 134 Cs and potassium were measured in several higher fungi and in substrates, soils, woods and litters in some Kanto and the Koshin districts, Japan, following the Chernobyl accident during October to November 1989. 137 Cs concentrations in fungi were in the range of 0.7-101 Bq kg -1 · fresh. Maximum 137 Cs level in them was observed in Boletopsis leucomelas (Pers.: Fr.) Fayod. Significantly higher levels of concentration ratios of 137 Cs in fungi to substrates (e.g.; 137 Cs concentration · fresh in fungus/ 137 Cs concentration · dry in soil), 10 -1 to 10 x 10 -1 , were found nearly 10 to 1000 times as much as leaf vegetables, root crops and potatoes to substrates. It was confirmed that levels of concentration ratios of potassium were similar to those of 137 Cs. In all fungi, 134 Cs which released from the Chernobyl accident and is not present in nuclear weapons fallout was not detected. (author)

  6. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.

    2009-01-01

    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  7. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90 ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  8. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  9. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  10. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455 ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  11. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80 ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  12. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  13. Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth.

    Science.gov (United States)

    Mata, Juan Luis; Mishra, Nutan Tulapurkar

    2015-01-01

    Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

  14. Cellulase production by white-rot basidiomycetous fungi: solid-state versus submerged cultivation

    DEFF Research Database (Denmark)

    Bentil, Joseph A.; Thygesen, Anders; Mensah, Moses

    2018-01-01

    fungi for improved enzyme expression, as well as on-site approaches for production of enzyme blends for industrial biomass conversion. The quantitative comparisons made have implications for selection of the most appropriate cultivation method for WRB fungi for attaining maximal cellulase production....... on different biomass residues in SSC or SmC systems. Although some variation in cellulase production yields have been reported for certain substrates, the analysis convincingly shows that SmC is generally more efficient than SSC for obtaining high cellulase production yields and high cellulase production rates......) or submerged cultivation (SmC) systems. In this review, we quantitatively assess the data available in the literature on cellulase production yields by WRB fungi cultivated by SSC or SmC. The review also assesses cellulolytic enzyme production rates and enzyme recovery when WRB fungi are cultivated...

  15. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2,6-dichloroindophenol. While L. shimeji P2Ox is the least thermostable of these three enzymes (melting temperature Tm of 54.9°C; half-life time of activity τ1/2 of 0.12 at 50°C and pH 6.5, P. chrysosporium P2Ox showed remarkable thermostability with Tm of 75.4°C and τ1/2 of 96 h under identical conditions.

  16. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  17. Decomposition, nitrogen and phosphorus mineralization from beech leaf litter colonized with ectomycorrhizal or litter decomposing basidiomycetes

    OpenAIRE

    COLPAERT, Jan; VAN TICHELEN, Katia

    1996-01-01

    The decomposition and the nitrogen and phosphorus mineralization of fresh beech (Fagus sylvatica L.) leaf litter are described. Leaves were buried for up to 6 months in plant containers in which Scots pine (Pinus sylvestris L.) seedlings were cultivated at a low rate of nutrient addition. The saprotrophic abilities of three ectomycorrhizal fungi, Thelephora terrestris Ehrh.: Fr., Suillus bovinus (L.: Fr.) O. Kuntze and Paxillus involutes (Batsch: Fr) Fr., were compared with the degradation ca...

  18. Spectroscopic evidence for an engineered, catalytically active Trp radical that creates the unique reactivity of lignin peroxidase.

    Science.gov (United States)

    Smith, Andrew T; Doyle, Wendy A; Dorlet, Pierre; Ivancich, Anabella

    2009-09-22

    The surface oxidation site (Trp-171) in lignin peroxidase (LiP) required for the reaction with veratryl alcohol a high-redox-potential (1.4 V) substrate, was engineered into Coprinus cinereus peroxidase (CiP) by introducing a Trp residue into a heme peroxidase that has similar protein fold but lacks this activity. To create the catalytic activity toward veratryl alcohol in CiP, it was necessary to reproduce the Trp site and its negatively charged microenvironment by means of a triple mutation. The resulting D179W+R258E+R272D variant was characterized by multifrequency EPR spectroscopy. The spectra unequivocally showed that a new Trp radical [g values of g(x) = 2.0035(5), g(y) = 2.0027(5), and g(z) = 2.0022(1)] was formed after the [Fe(IV)=O Por(*+)] intermediate, as a result of intramolecular electron transfer between Trp-179 and the porphyrin. Also, the EPR characterization crucially showed that [Fe(IV)=O Trp-179(*)] was the reactive intermediate with veratryl alcohol. Accordingly, our work shows that it is necessary to take into account the physicochemical properties of the radical, fine-tuned by the microenvironment, as well as those of the preceding [Fe(IV)=O Por(*+)] intermediate to engineer a catalytically competent Trp site for a given substrate. Manipulation of the microenvironment of the Trp-171 site in LiP allowed the detection by EPR spectroscopy of the Trp-171(*), for which direct evidence has been missing so far. Our work also highlights the role of Trp residues as tunable redox-active cofactors for enzyme catalysis in the context of peroxidases with a unique reactivity toward recalcitrant substrates that require oxidation potentials not realized at the heme site.

  19. Biogenic porous silica and silicon sourced from Mexican Giant Horsetail (Equisetum myriochaetum) and their application as supports for enzyme immobilization.

    Science.gov (United States)

    Sola-Rabada, Anna; Sahare, Padma; Hickman, Graham J; Vasquez, Marco; Canham, Leigh T; Perry, Carole C; Agarwal, Vivechana

    2018-06-01

    Porous silica-based materials are attractive for biomedical applications due to their biocompatibility and biodegradable character. In addition, inorganic supports such as porous silicon are being developed due to integrated circuit chip compatibility and tunable properties leading to a wide range of multidisciplinary applications. In this contribution, biosilica extracted from a rarely studied plant material (Equisetum Myriochaetum), its conversion to silicon and the potential for both materials to be used as supports for enzyme immobilization are investigated. E. myriochaetum was subject to conventional acid digestion to extract biogenic silica with a% yield remarkably higher (up to 3 times) than for other Equisetum sp. (i.e. E. Arvense). The surface area of the isolated silica was ∼400 m 2 /g, suitable for biotechnological applications. Biogenic silicon was obtained by magnesiothermic reduction. The materials were characterized by SEM-EDX, XRD, FT-IR, ICP-OES, TGA and BET analysis and did not contain significant levels of class 1 heavy elements (such as Pb, Cd, Hg and As). Two commercial peroxidases, horseradish peroxidase (HRP) and Coprinus cinereus peroxidase (CiP) were immobilized onto the biogenic materials using three different functionalization routes: (A) carbodiimide, (B) amine + glutaraldehyde and (C) amine + carbodiimide. Although both biogenic silica and porous silicon could be used as supports differences in behaviour were observed for the two enzymes. For HRP, loading onto biogenic silica via the glutaraldehyde immobilization technique (route B) was most effective. The loading of CiP showed a much higher peroxidase activity onto porous silicon than silica functionalized by the carbodiimide method (route A). From the properties of the extracted materials obtained from Equisetum Myriochaetum and the immobilization results observed, these materials appear to be promising for industrial and biomedical applications. Copyright © 2018 Elsevier

  20. Management and Level of Asian small-clawed otter (Aonyx cinereus Illinger, 1815 as Display Animal in Indonesia Conservation Institution

    Directory of Open Access Journals (Sweden)

    Ulfa Hansyari Ar-Rasyid

    2017-09-01

    Full Text Available Education and breeding become main reasons for asian small-clawed otter placement as display animal in zoo. Proper management is needed to maintain asian small-clawed otter welfare. This research objectives were to examine and assess asian small-clawed otter welfare in three Indonesia zoos. The study was conducted from December 2016 to February 2017 in Bandung Zoo, Ragunan Zoo and Ocean Dream Samudra Ancol. The methods of this research were literature review, interview and field observation. Data were analyzed using the suitability of management and animal welfare assessment. The result showed that there were three main management activities conducted at the three study locations, i.e., nutrition, housing, and health management. Bandung Zoo achieved the lowest score of asian small-clawed otter welfare (45,24% compared to Ragunan Zoo (62,24% and Ocean Dream Samudra (65,90%. Asian small-clawed otter welfare in three institutions were relatively low to fair category, this was due to the unfilled quality of food and water i.e.,  the type, amount, feeding frequency, diet and preparing of food; the unavailability of suitable and favorable environmental conditions; the care facilities provided could not ensure the health of animal; the appearance of abnormal behavior that affected the growth and breeding of animal; and animal had no freedom to behave as in their natural habitat. Keywords: animal display, animal welfare, Asian small-clawed otter, zoo 

  1. The Distribution and Abundance of an Island Population of Koalas (Phascolarctos cinereus) in the Far North of Their Geographic Range

    Science.gov (United States)

    McGregor, Denise C.; Kerr, Sarah E.; Krockenberger, Andrew K.

    2013-01-01

    Koalas are an iconic species of charismatic megafauna, of substantial social and conservation significance. They are widely distributed, often at low densities, and individuals can be difficult to detect, making population surveys challenging and costly. Consequently, koala population estimates have been limited and the results inconsistent. The aims of this study were to estimate the distribution, relative abundance and population size of the koalas on Magnetic Island, far north Queensland. Population densities were estimated in 18 different vegetation types present on the island using a Fecal Standing Crop Method. Koala density ranged from 0.404 ha−1, recorded in forest red gum and bloodwood woodland, to absence from eight of the vegetation types surveyed. The second highest density of 0.297 koalas ha−1 was recorded in mixed eucalypt woodland, which covers 45% of the island. The total abundance of koalas on Magnetic Island, not including those present in urban areas, was estimated at 825±175 (SEM). The large variation in koala density across vegetation types reinforces the need for sampling stratification when calculating abundance over large areas, as uniformity of habitat quality cannot be assumed. In this context, koala populations also occur in low densities in areas generally regarded as poor quality koala habitat. These results highlight the importance of protecting vegetation communities not traditionally considered to have high conservation value to koalas, as these habitats may be essential for maintaining viable, widespread, low-density populations. The results from this study provide a baseline to assess future trends in koala distribution, density and abundance on Magnetic Island. PMID:23527258

  2. Cryptococcus neoformans in the koala (Phascolarctos cinereus): colonization by C n. var. gattii and investigation of environmental sources.

    Science.gov (United States)

    Krockenberger, M B; Canfield, P J; Malik, R

    2002-06-01

    This study is the one in a series looking at the relationship among Cryptococcus neoformans var. gattii, koalas and the environment. The koala was used as a natural biological sampler in an attempt to understand the dynamics of C. neoformans var. gattii in Australian environments. Evidence of asymptomatic nasal and skin colonization for extended periods by large numbers of C. n. var. gattii was obtained and geographical factors assessed. The key finding was the ability of koalas to amplify numbers of C. n. var. gattii in certain environments. Koalas were not found to be obligatory for the survival of the organism in all environments. Geographical factors alone could not explain differing rates of nasal and skin colonization in koalas in different environments. A strong association between healthy koalas and C. n. var. gattii was confirmed and C n. var. gattii was isolated from novel sources, including the turpentine gum tree (Syncarpia glomulifera), tallowwood (Eucalyptus microcorys) and flooded gum (E. grandis). It seems likely that as yet undiscovered environmental sources of C. n. var. gattii exist in eastern Australia. Further investigation of host, environmental and organism factors integral to the hostpathogen relationship will assist an understanding of the progression from colonization to tissue invasion and cryptococcosis in all species.

  3. Cues to body size in the formant spacing of male koala (Phascolarctos cinereus) bellows: honesty in an exaggerated trait.

    Science.gov (United States)

    Charlton, Benjamin D; Ellis, William A H; McKinnon, Allan J; Cowin, Gary J; Brumm, Jacqui; Nilsson, Karen; Fitch, W Tecumseh

    2011-10-15

    Determining the information content of vocal signals and understanding morphological modifications of vocal anatomy are key steps towards revealing the selection pressures acting on a given species' vocal communication system. Here, we used a combination of acoustic and anatomical data to investigate whether male koala bellows provide reliable information on the caller's body size, and to confirm whether male koalas have a permanently descended larynx. Our results indicate that the spectral prominences of male koala bellows are formants (vocal tract resonances), and show that larger males have lower formant spacing. In contrast, no relationship between body size and the fundamental frequency was found. Anatomical investigations revealed that male koalas have a permanently descended larynx: the first example of this in a marsupial. Furthermore, we found a deeply anchored sternothyroid muscle that could allow male koalas to retract their larynx into the thorax. While this would explain the low formant spacing of the exhalation and initial inhalation phases of male bellows, further research will be required to reveal the anatomical basis for the formant spacing of the later inhalation phases, which is predictive of vocal tract lengths of around 50 cm (nearly the length of an adult koala's body). Taken together, these findings show that the formant spacing of male koala bellows has the potential to provide receivers with reliable information on the caller's body size, and reveal that vocal adaptations allowing callers to exaggerate (or maximise) the acoustic impression of their size have evolved independently in marsupials and placental mammals.

  4. The first case of onychomycosis in a koala (Phascolarctos cinereus due to atypical isolates of Microsporum gypseum, a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Hossein Mirhendi

    2016-06-01

    Conclusion: To the best of our knowledge, the present report is the first confirmed case of dermatophytosis in a koala. The genetics underlying a variety of phenotypic traits in most classical dermatophyte species are unknown, and further studies are needed to understand this phenomenon. 

  5. Review of some pharmacokinetic and pharmacodynamic properties of anti-infective medicines administered to the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Govendir, M

    2018-02-01

    Although koalas are iconic Australian animals, no pharmacokinetic studies of any first-line medicines used to treat diseased or injured koalas had been published prior to 2010. Traditionally, medicine dosages suggested for this species underwent linear extrapolation from those recommended for domesticated species. The koala, a specialist folivore whose natural diet consists of almost exclusively Eucalyptus spp. foliage has anatomical and physiological adaptations for detoxifying their diet which also affect medicine pharmacokinetic profiles. This review addresses aspects of medicine absorption, clearance, and other indices (such as medicine binding to plasma proteins) of enrofloxacin/marbofloxacin and chloramphenicol used for the systemic treatment of chlamydiosis, and fluconazole ± amphotericin, and posaconazole for the treatment of cryptococcosis. Based on observations from published studies, this review includes suggestions to improve therapeutic outcomes when administering medicines to diseased koalas. © 2017 John Wiley & Sons Ltd.

  6. The distribution and abundance of an island population of Koalas (Phascolarctos cinereus in the far north of their geographic range.

    Directory of Open Access Journals (Sweden)

    Denise C McGregor

    Full Text Available Koalas are an iconic species of charismatic megafauna, of substantial social and conservation significance. They are widely distributed, often at low densities, and individuals can be difficult to detect, making population surveys challenging and costly. Consequently, koala population estimates have been limited and the results inconsistent. The aims of this study were to estimate the distribution, relative abundance and population size of the koalas on Magnetic Island, far north Queensland. Population densities were estimated in 18 different vegetation types present on the island using a Fecal Standing Crop Method. Koala density ranged from 0.404 ha(-1, recorded in forest red gum and bloodwood woodland, to absence from eight of the vegetation types surveyed. The second highest density of 0.297 koalas ha(-1 was recorded in mixed eucalypt woodland, which covers 45% of the island. The total abundance of koalas on Magnetic Island, not including those present in urban areas, was estimated at 825±175 (SEM. The large variation in koala density across vegetation types reinforces the need for sampling stratification when calculating abundance over large areas, as uniformity of habitat quality cannot be assumed. In this context, koala populations also occur in low densities in areas generally regarded as poor quality koala habitat. These results highlight the importance of protecting vegetation communities not traditionally considered to have high conservation value to koalas, as these habitats may be essential for maintaining viable, widespread, low-density populations. The results from this study provide a baseline to assess future trends in koala distribution, density and abundance on Magnetic Island.

  7. Plasma prolactin concentrations during lactation, pouch young development and the return to behavioural oestrus in captive koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Ballantyne, K; Anderson, S T; Mucci, A; Nicolson, V; Johnston, S D

    2015-05-29

    Plasma prolactin (PRL) concentrations in captive koalas during lactation were determined by serial blood sampling. PRL concentrations were low (1.3 ± 0.1 ng mL-1; n = 5) during early lactation until pouch young (PY) began to emerge from the pouch (around Day 130) before significantly (P < 0.05) increasing between Day 161 and Day 175 (5.3 ± 1.0 ng mL-1). A significant (P < 0.001) peak in PRL (7.7 ± 0.6 ng mL-1) coincided with maturing young between Day 189 and Day 231. All females failed to exhibit any signs of oestrous behaviour until Day 268.8 ± 8.5 (n = 4), some 102 ± 19 days before PY were weaned following achieving target weights of 2.5-2.7 kg. Throughout lactation, plasma LH concentrations were relatively high (range 4.9-8.7 ng mL-1) and LH responses to exogenous gonadotrophin-releasing hormone were observed in all koalas at all times during lactation.

  8. Molecular characterisation and expression analysis of interferon gamma in response to natural Chlamydia infection in the koala, Phascolarctos cinereus.

    Science.gov (United States)

    Mathew, Marina; Pavasovic, Ana; Prentis, Peter J; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-09-25

    Interferon gamma (IFNγ) is a key Th1 cytokine, with a principal role in the immune response against intracellular organisms such as Chlamydia. Along with being responsible for significant morbidity in human populations, Chlamydia is also responsible for wide spread infection and disease in many animal hosts, with reports that many Australian koala subpopulations are endemically infected. An understanding of the role played by IFNγ in koala chlamydial diseases is important for the establishment of better prophylactic and therapeutic approaches against chlamydial infection in this host. A limited number of IFNγ sequences have been published from marsupials and no immune reagents to measure expression have been developed. Through preliminary analysis of the koala transcriptome, we have identified the full coding sequence of the koala IFNγ gene. Transcripts were identified in spleen and lymph node tissue samples. Phylogenetic analysis demonstrated that koala IFNγ is closely related to other marsupial IFNγ sequences and more distantly related to eutherian mammals. To begin to characterise the role of this important cytokine in the koala's response to chlamydial infection, we developed a quantitative real time PCR assay and applied it to a small cohort of koalas with and without active chlamydial disease, revealing significant differences in expression patterns between the groups. Description of the IFNγ sequence from the koala will not only assist in understanding this species' response to its most important pathogen but will also provide further insight into the evolution of the marsupial immune system. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Surgical implantation of temperature-sensitive transmitters and data-loggers to record body temperature in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Adam, D; Johnston, S D; Beard, L; Nicholson, V; Lisle, A; Gaughan, J; Larkin, R; Theilemann, P; Mckinnon, A; Ellis, W

    2016-01-01

    Under predicted climate change scenarios, koala distribution in Australia is expected to be adversely affected. Recent studies have attempted to identify suitable habitat, based on models of bioclimatic regions, but to more accurately reflect the thermal tolerance and behavioural adaptations of the various regional populations, the koala's response to periods of heat stress will need to be investigated at the individual animal level. To explore the safety and suitability of temperature-sensitive intra-abdominal implants for monitoring core body temperature in the koala. A temperature-sensitive radio transmitter and thermal iButton data-logger, waxed together as a package, were surgically implanted into the abdominal cavity of four captive koalas. In one animal the implant was tethered and in the other three, it was left free-floating. After 3 months, the implants were removed and all four koalas recovered without complications. The tethering of the package in the one koala resulted in minor inflammation and adhesion, so this practice was subsequently abandoned. The free-floating deployments were complication-free and revealed a diurnal body temperature rhythm, with daily ranges of 0.4-2.8°C. The minimum recorded body temperature was 34.2°C and the maximum was 37.7°C. The difference in the readings obtained from the transmitters and iButtons never exceeded 0.3°C. The suitability of the surgical approach was confirmed, from both the animal welfare and data collection points of view. © 2016 Australian Veterinary Association.

  10. Microbiota composition of the koala (Phascolarctos cinereus) ocular and urogenital sites, and their association with Chlamydia infection and disease.

    Science.gov (United States)

    Vidgen, Miranda E; Hanger, Jonathan; Timms, Peter

    2017-07-12

    Disease caused by Chlamydia pecorum is characterised by ocular and urogenital infections that can lead to blindness and infertility in koalas. However, koalas that are infected with C. pecorum do not always progress to disease. In other host systems, the influence of the microbiota has been implicated in either accelerating or preventing infections progressing to disease. This study investigates the contribution of koala urogenital and ocular microbiota to Chlamydia infection and disease in a free ranging koala population. Using univariate and multivariate analysis, it was found that reproductive status in females and sexual maturation in males, were defining features in the koala urogenital microbiota. Changes in the urogenital microbiota of koalas is correlated with infection by the common pathogen, C. pecorum. The correlation of microbiota composition and C. pecorum infection is suggestive of members of the microbiota being involved in the acceleration or prevention of infections progressing to disease. The analysis also suggests that multiple microbes are likely to be associated with this process of disease progression, rather than a single organism. While other Chlamydia-like organisms were also detected, they are unlikely to contribute to chlamydial disease as they are rare members of the urogenital and ocular microbiota communities.

  11. Use of the gonadotrophin-releasing hormone antagonist azaline B to control the oestrous cycle in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Ballantyne, K; Anderson, S T; Pyne, M; Nicolson, V; Mucci, A; Lisle, A; Johnston, S D

    2015-05-01

    The present study examined the effectiveness of the gonadotrophin-releasing hormone (GnRH) antagonist azaline B to suppress plasma LH and 17β-oestradiol concentrations in koalas and its potential application for oestrous synchronisation. In Experiment 1, single subcutaneous injections of azaline B successfully blocked the LH response to exogenous mammalian (m) GnRH in a dose-dependent manner; specifically, 0 mg (n = 4) did not suppress the LH response, 1 mg azaline B (n = 6) suppressed the LH response for 24 h (P < 0.05), 3.3 mg azaline B (n = 8) suppressed the LH response significantly in all animals only for 3 h (P < 0.05), although in half the animals LH remained suppressed for up to 3 days, and 10 mg azaline B (n = 4) suppressed the LH response for 7 days (P < 0.05). In Experiment 2, daily 1 mg, s.c., injections of azaline B over a 10-day period during seasonal anoestrus (June-July; n = 6) suppressed (P < 0.01) the LH response to mGnRH consecutively over the 10-day treatment period and, 4 days after cessation of treatment, the LH response had not recovered. Experiment 3 was designed to test the efficacy of daily 1 mg, s.c., azaline B over 10 days to suppress plasma LH and 17β-oestradiol concentrations and ultimately synchronise timed return to oestrus during the breeding season. Although azaline B treatment did not suppress basal LH or 17β-oestradiol, oestrus was delayed in all treated females by 24.2 days, but with high variability (range 9-39 days). Overall, the present study demonstrates that the GnRH antagonist azaline B is able to inhibit the LH response in koalas to exogenous mGnRH and successfully delay the return to oestrus. However, although azaline B clearly disrupts folliculogenesis, it has not been able to effectively synchronise return to oestrus in the koala.

  12. Pharmacokinetics of chloramphenicol following administration of intravenous and subcutaneous chloramphenicol sodium succinate, and subcutaneous chloramphenicol, to koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Black, L A; McLachlan, A J; Griffith, J E; Higgins, D P; Gillett, A; Krockenberger, M B; Govendir, M

    2013-10-01

    Clinically normal koalas (n = 19) received a single dose of intravenous (i.v.) chloramphenicol sodium succinate (SS) (25 mg/kg; n = 6), subcutaneous (s.c.) chloramphenicol SS (60 mg/kg; n = 7) or s.c. chloramphenicol base (60 mg/kg; n = 6). Serial plasma samples were collected over 24-48 h, and chloramphenicol concentrations were determined using a validated high-performance liquid chromatography assay. The median (range) apparent clearance (CL/F) and elimination half-life (t(1/2)) of chloramphenicol after i.v. chloramphenicol SS administration were 0.52 (0.35-0.99) L/h/kg and 1.13 (0.76-1.40) h, respectively. Although the area under the concentration-time curve was comparable for the two s.c. formulations, the absorption rate-limited disposition of chloramphenicol base resulted in a lower median C(max) (2.52; range 0.75-6.80 μg/mL) and longer median tmax (8.00; range 4.00-12.00 h) than chloramphenicol SS (C(max) 20.37, range 13.88-25.15 μg/mL; t(max) 1.25, range 1.00-2.00 h). When these results were compared with susceptibility data for human Chlamydia isolates, the expected efficacy of the current chloramphenicol dosing regimen used in koalas to treat chlamydiosis remains uncertain and at odds with clinical observations. © 2012 John Wiley & Sons Ltd.

  13. The first case of onychomycosis in a koala (Phascolarctos cinereus) due to atypical isolates of Microsporum gypseum, a diagnostic challenge.

    Science.gov (United States)

    Mirhendi, H; Nishiyama, Y; Rezaei-Matehkolaei, A; Satoh, K; Makimura, K

    2016-06-01

    Superficial mycotic infections have been only poorly described in koalas and there are no reliable mycologically confirmed data regarding clinical isolation of dermatophytes in this animal. We report an 11-year-old female koala, kept in a zoo in Tokyo, Japan, and presenting with hyperkeratotic lesions and scaly plaques on forepaw claws and pads reminiscent of fungal infection. Direct microscopy of the scrapings was indicative of a dermatophyte infection. By culture and subsequent repeated subculturing of clinical specimens on Sabouraud dextrose agar, Mycobiotic agar, and potato dextrose agar, two distinct strains with different colony morphotypes (designed as types I and II) were identified. Macroscopic and microscopic characteristics of the strains were suggestive of three different species, i.e. Microsporum canis , M. gypseum , and M. fulvum . However, partial sequencing of internal transcribed spacer (ITS) region of rDNA, translation elongation factor-1α ( Tef-1α ), and beta-tubulin ( BT2 ) genes confirmed the identity of both isolates as M. gypseum. The animal was treated with a continuous terbinafine regimen (250 mg/kg) once daily for 12 weeks. To the best of our knowledge, the present report is the first confirmed case of dermatophytosis in a koala. The genetics underlying a variety of phenotypic traits in most classical dermatophyte species are unknown, and further studies are needed to understand this phenomenon.

  14. Chlamydiaceae and Chlamydia-like organisms in the koala (Phascolarctos cinereus)--organ distribution and histopathological findings.

    Science.gov (United States)

    Burach, Fabienne; Pospischil, Andreas; Hanger, Jon; Loader, Jo; Pillonel, Trestan; Greub, Gilbert; Borel, Nicole

    2014-08-06

    Chlamydial infections in koalas can cause life-threatening diseases leading to blindness and sterility. However, little is known about the systemic spread of chlamydiae in the inner organs of the koala, and data concerning related pathological organ lesions are limited. The aim of this study was to perform a thorough investigation of organs from 23 koalas and to correlate their histopathological lesions to molecular chlamydial detection. To reach this goal, 246 formalin-fixed and paraffin embedded organ samples from 23 koalas were investigated by histopathology, Chlamydiaceae real-time PCR and immunohistochemistry, ArrayTube Microarray for Chlamydiaceae species identification as well as Chlamydiales real-time PCR and sequencing. By PCR, two koalas were positive for Chlamydia pecorum whereas immunohistochemical labelling for Chlamydiaceae was detected in 10 tissues out of nine koalas. The majority of these (n=6) had positive labelling in the urogenital tract related to histopathological lesions such as cystitis, endometritis, pyelonephritis and prostatitis. Somehow unexpected was the positive labelling in the gastrointestinal tract including the cloaca as well as in lung and spleen indicating systemic spread of infection. Uncultured Chlamydiales were detected in several organs of seven koalas by PCR, and four of these suffered from plasmacytic enteritis of unknown aetiology. Whether the finding of Chlamydia-like organisms in the gastrointestinal tract is linked to plasmacytic enteritis is unclear and remains speculative. However, as recently shown in a mouse model, the gastrointestinal tract might play a role being the site for persistent chlamydial infections and being a source for reinfection of the genital tract. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. The remarkable vocal anatomy of the koala (Phascolarctos cinereus): insights into low-frequency sound production in a marsupial species.

    Science.gov (United States)

    Frey, Roland; Reby, David; Fritsch, Guido; Charlton, Benjamin D

    2018-04-01

    Koalas are characterised by a highly unusual vocal anatomy, with a descended larynx and velar vocal folds, allowing them to produce calls at disproportionately low frequencies. Here we use advanced imaging techniques, histological data, classical macroscopic dissection and behavioural observations to provide the first detailed description and interpretation of male and female koala vocal anatomy. We show that both males and females have an elongated pharynx and soft palate, resulting in a permanently descended larynx. In addition, the hyoid apparatus has a human-like configuration in which paired dorsal, resilient ligaments suspend the hyoid apparatus from the skull, while the ventral parts tightly connect to the descended larynx. We also show that koalas can retract the larynx down into the thoracic inlet, facilitated by a dramatic evolutionary transformation of the ventral neck muscles. First, the usual retractors of the larynx and the hyoid have their origins deep in the thorax. Secondly, three hyoid muscles have lost their connection to the hyoid skeleton. Thirdly, the genioglossus and geniohyoid muscles are greatly increased in length. Finally, the digastric, omohyoid and sternohyoid muscles, connected by a common tendinous intersection, form a guiding channel for the dynamic down-and-up movements of the ventral hyoid parts and the larynx. We suggest that these features evolved to accommodate the low resting position of the larynx and assist in its retraction during call production. We also confirm that the edges of the intra-pharyngeal ostium have specialised to form the novel, extra-laryngeal velar vocal folds, which are much larger than the true intra-laryngeal vocal folds in both sexes, but more developed and specialised for low frequency sound production in males than in females. Our findings illustrate that strong selection pressures on acoustic signalling not only lead to the specialisation of existing vocal organs but can also result in the evolution of novel vocal structures in both sexes. © 2018 Anatomical Society.

  16. Season- and age-related reproductive changes based on fecal androgen concentrations in male koalas, Phascolarctos cinereus.

    Science.gov (United States)

    Kusuda, Satoshi; Hashikawa, Hisashi; Takeda, Masato; Ito, Hideki; Goto, Atsushi; Oguchi, Jun; Doi, Osamu

    2013-01-01

    The purposes of the present study were to clarify age- and season- related androgen patterns, and to compare the reproductive physiology between Japanese captive koala populations and Australian populations. To measure fecal androgens, feces were collected from male koalas (4.2 to 13.8 years of age) kept in Japanese zoos. Fecal androgens were extracted with methanol from the lyophilized samples and determined by enzyme immunoassay using 4-androstene-3,17-dione antibody. Fecal androgen concentration in male koalas increased after sexual maturation and remained relatively high until old age. In the survey with the Japanese zoo studbook of koalas, copulation (conception) month showed a pyramid shape with a peak in March to June (60.7%) in koalas born and reared in Japanese zoos and from July to April with the highest concentration in September to January (69.7%) in Australian institutes. Japanese zoo koala populations have a characteristic physiological cycle adapted to Japan's seasonal changes. The suitable month of year for copulation or conception in Japan is diametrically opposed to that in Australia. Mean fecal androgen concentrations by month in the males born and reared in Japan indicated annual changes with the highest concentration in May and the lowest value in November. Fecal androgen analysis may be a noninvasive alternative tool to monitor circulating testosterone and may be helpful in understanding reproductive activity and physiology in male koalas.

  17. First report of a spermatic granuloma and varicocele in a marsupial: A Koala (Phascolarctos cinereus) Case Study.

    Science.gov (United States)

    Schultz, B K; Palmieri, C; Nicolson, V; Larkin, R; Keeley, T; McGowan, M; Johnston, S D

    2016-08-01

    This study reports the first documented clinical case of a spermatic granuloma and varicocele in a marsupial. Initial clinical presentation included gross morphological changes in the left scrotal cord, epididymis and testis. Ultrasonography of the scrotum and spermatic cord, and gross and histopathological examination after hemicastration, confirmed the condition as a spermatic granuloma affecting the left caput epididymis, with a varicocele in the left proximal spermatic cord, which was causing azoospermia and infertility. Semen quality and serum testosterone secretion following a GnRH challenge was assessed prior to, and following surgery. After hemi-castration, an increase in androgen secretion to within normal reference ranges for the koala was observed with a subsequent increase in semen production and sperm quality resulting in the sire of a pouch young, 12months later. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  19. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p < 0.01). A positive correlation existed between the phenolic content and antioxidant activity. Our results indicated that fruiting bodies of G. lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application.

  20. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  1. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  2. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  3. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  4. Effect of cultural conditions on antrodin C production by basidiomycete Antrodia camphorata in solid-state fermentation.

    Science.gov (United States)

    Xia, Yongjun; Wang, Yuanlong; Zhang, Bobo; Xu, Ganrong; Ai, Lianzhong

    2014-01-01

    Antrodia camphorata is a medicinal fungus and antrodin C is one of the main bioactive components of A. camphorata in the submerged fermentation (SmF). To optimize the culture conditions, the factors influencing the production of antrodin C by A. camphorata under solid-state fermentation (SSF) were investigated in this study. Different solid substrates and external nitrogen sources were tested for their efficiency in producing antrodin C. The response surface methodology was applied to evaluate the influence of several variables, namely, the concentrations of soybean meal, initial moisture content, and inoculum density on antrodin C production in solid-state fermentation. The experimental results show that the optimum fermentation medium for antrodin C production by A. camphorata was composed of 0.578 g soybean meal, 0.05 g Na2 HPO4 , 0.05 g MgSO4 for 100 g rice, with 51.83% initial moisture content, 22 day culture time, 28 °C culture temperature, and 35.54% inoculum density. At optimized conditions, 6,617.36 ± 92.71 mg kg(-1) yield of antrodin C was achieved. Solid-state fermentation is one good cultural method to improve the production of antrodin C by A. camphorata. © 2014 International Union of Biochemistry and Molecular Biology, Inc.

  5. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Helbert David Siabatto F.

    2005-07-01

    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  6. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  7. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  8. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  9. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots

    NARCIS (Netherlands)

    Tagu, D; De Bellis, R; Balestrini, R; De Vries, OMH; Piccoli, G; Stocchi, [No Value; Bonfante, P; Martin, F

    The immunolocalization of one of the hydrophobins of Pisolithus tinctorius (HYDPt-1) is reported. Hydrophobin proteins play key roles in adhesion and aggregation of fungal hyphae, and it is already known that formation of ectomycorrhizas on eucalypt roots enhances the accumulation of hydrophobin

  10. Cryptococcus haglerorum, sp. nov., an anamorphic basidiomycetous yeast isolated from nests of the leaf-cutting ant Atta sexdens.

    NARCIS (Netherlands)

    Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.

    2003-01-01

    A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus

  11. Immunomodulatory activities of different solvent extracts from Tricholoma matsutake (S. Ito et S. Imai) singer (higher basidiomycetes) on normal mice.

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Jiang, Zhonghai

    2012-01-01

    The immunomodulatory activities of different solvent extracts from the culinary-medicinal mushroom Tricholoma matsutake were studied in vivo in normal mice. The extracts were prepared using different solvents in an order of increasing polarity. The immunomodulatory activities were investigated by measuring the thymus and spleen index, phagocytic rate of macrophage phagocytosis, delayed-type hypersensitivity, plaque-forming cell, and proliferation of splenocytes. Results demonstrated that water extract (WE) and n-butyl alcohol extract (BAE) of T. matsutake could enhance the immunity of mice significantly compared with the control group. Main components of WE and BAE were polysaccharides, proteins, and flavonoids; we presume that these may be the main immunomodulating and immuno-enhancing agents in T. matsutake.

  12. Extraction, Antimicrobial, and Antioxidant Activities of Crude Polysaccharides from the Wood Ear Medicinal Mushroom Auricularia auricula-judae (Higher Basidiomycetes).

    Science.gov (United States)

    Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long

    2015-01-01

    In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.

  13. Mating tests among geographically separated collections of the Trametes versicolor (Fr.) Pilát (Basidiomycetes, Polyporales) group

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 79, 3-4 (2004), s. 425-431 ISSN 0029-5035 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : trametes versicolor * mating tests Subject RIV: EE - Microbiology, Virology Impact factor: 0.594, year: 2004

  14. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660 ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  15. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    with Anaeroclip® clips and Anaerotest® indicatorwere incubated at 25ºC, according to the 4 manufacturer’s instructions, either directly orafter oxicpre-incubation for 24 or 48 h. Growth was inspected at regular intervals up to one year. 2.3 Electron... °C. The PCR amplicons were purified using GenEluteTMGel Extraction kit (Sigma Aldrich, USA) and cloned individually for each gene using the TA cloning kit (Invitrogen, USA) according to the manufacturer’s instructions. A representative clone...

  16. Medicinal Mushroom Cracked-Cap Polypore, Phellinus rimosus (Higher Basidiomycetes) Attenuates Acute Ethanol-Induced Lipid Peroxidation in Mice.

    Science.gov (United States)

    Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Alcohol abuse and alcoholism remain one of the major health issues worldwide, especially in developing countries. The protective effect of Phellinus rimosus against acute alcohol-induced lipid peroxidation in the liver, kidney, and brain as well as its effect against antioxidant enzyme activity such as superoxide (SOD) and catalase (CAT) in the liver was evaluated in mice. Ethyl acetate extract of Ph. Rimosus (50 mg/kg body wt, p.o.) 1 h before each administration of alcohol (3 mL/kg, p.o.; total 2 doses at 24-h intervals) protected against lipid peroxidation in all organs and attenuated the decline of SOD and CAT activity in the liver. The fold increase in lipid peroxidation, including conjugated diene and thiobarbituric acid reactive substance (TBARS) levels, was highest in the liver. There were 2.6- and 1.5- fold increases in TBARS levels in the liver of the alcohol alone- and alcohol+Ph. Rimosus-treated groups, compared with that of the normal group. Activity of SOD and CAT in the liver of alcohol- and alcohol+Ph. Rimosus- treated animals was 9.05±1.38, 18.76±1.71, and 11.26±1.02, 31.58±3.35 IU/mg protein, respectively. Extract at 1 mg/mL inhibited 50.6% activity of aniline hydroxylase (CYP2E1) in liver homogenate. From these results, we concluded that the extract significantly protected against the lipid peroxidation. Protection in the liver may be due to the inhibitory effect on CYP2E1 as well as the direct radical scavenging effect of Ph. Rimosus, which warrants further research.

  17. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat; Bakkeren, Guus

    2014-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer

  18. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  19. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  20. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  1. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  2. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

    Science.gov (United States)

    Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

    2012-10-23

    Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

  3. Infection with koala retrovirus subgroup B (KoRV-B), but not KoRV-A, is associated with chlamydial disease in free-ranging koalas (Phascolarctos cinereus)

    OpenAIRE

    Waugh, Courtney A.; Hanger, Jonathan; Loader, Joanne; King, Andrew; Hobbs, Matthew; Johnson, Rebecca; Timms, Peter

    2017-01-01

    The virulence of chlamydial infection in wild koalas is highly variable between individuals. Some koalas can be infected (PCR positive) with Chlamydia for long periods but remain asymptomatic, whereas others develop clinical disease. Chlamydia in the koala has traditionally been studied without regard to coinfection with other pathogens, although koalas are usually subject to infection with koala retrovirus (KoRV). Retroviruses can be immunosuppressive, and there is evidence of an immunosuppr...

  4. A Prototype Recombinant-Protein Based Chlamydia pecorum Vaccine Results in Reduced Chlamydial Burden and Less Clinical Disease in Free-Ranging Koalas (Phascolarctos cinereus.

    Directory of Open Access Journals (Sweden)

    Courtney Waugh

    Full Text Available Diseases associated with Chlamydia pecorum infection are a major cause of decline in koala populations in Australia. While koalas in care can generally be treated, a vaccine is considered the only option to effectively reduce the threat of infection and disease at the population level. In the current study, we vaccinated 30 free-ranging koalas with a prototype Chlamydia pecorum vaccine consisting of a recombinant chlamydial MOMP adjuvanted with an immune stimulating complex. An additional cohort of 30 animals did not receive any vaccine and acted as comparison controls. Animals accepted into this study were either uninfected (Chlamydia PCR negative at time of initial vaccination, or infected (C. pecorum positive at either urogenital (UGT and/or ocular sites (Oc, but with no clinical signs of chlamydial disease. All koalas were vaccinated/sampled and then re-released into their natural habitat before re-capturing and re-sampling at 6 and 12 months. All vaccinated koalas produced a strong immune response to the vaccine, as indicated by high titres of specific plasma antibodies. The incidence of new infections in vaccinated koalas over the 12-month period post-vaccination was slightly less than koalas in the control group, however, this was not statistically significant. Importantly though, the vaccine was able to significantly reduce the infectious load in animals that were Chlamydia positive at the time of vaccination. This effect was evident at both the Oc and UGT sites and was stronger at 6 months than at 12 months post-vaccination. Finally, the vaccine was also able to reduce the number of animals that progressed to disease during the 12-month period. While the sample sizes were small (statistically speaking, results were nonetheless striking. This study highlights the potential for successful development of a Chlamydia vaccine for koalas in a wild setting.

  5. Infection with koala retrovirus subgroup B (KoRV-B), but not KoRV-A, is associated with chlamydial disease in free-ranging koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Waugh, Courtney A; Hanger, Jonathan; Loader, Joanne; King, Andrew; Hobbs, Matthew; Johnson, Rebecca; Timms, Peter

    2017-03-09

    The virulence of chlamydial infection in wild koalas is highly variable between individuals. Some koalas can be infected (PCR positive) with Chlamydia for long periods but remain asymptomatic, whereas others develop clinical disease. Chlamydia in the koala has traditionally been studied without regard to coinfection with other pathogens, although koalas are usually subject to infection with koala retrovirus (KoRV). Retroviruses can be immunosuppressive, and there is evidence of an immunosuppressive effect of KoRV in vitro. Originally thought to be a single endogenous strain, a new, potentially more virulent exogenous variant (KoRV-B) was recently reported. We hypothesized that KoRV-B might significantly alter chlamydial disease outcomes in koalas, presumably via immunosuppression. By studying sub-groups of Chlamydia and KoRV infected koalas in the wild, we found that neither total KoRV load (either viraemia or proviral copies per genome), nor chlamydial infection level or strain type, was significantly associated with chlamydial disease risk. However, PCR positivity with KoRV-B was significantly associated with chlamydial disease in koalas (p = 0.02961). This represents an example of a recently evolved virus variant that may be predisposing its host (the koala) to overt clinical disease when co-infected with an otherwise asymptomatic bacterial pathogen (Chlamydia).

  6. Comparison of subcutaneous versus intranasal immunization of male koalas (Phascolarctos cinereus) for induction of mucosal and systemic immunity against Chlamydia pecorum.

    Science.gov (United States)

    Waugh, Courtney A; Timms, Peter; Andrew, Dean; Rawlinson, Galit; Brumm, Jacqui; Nilsson, Karen; Beagley, Kenneth W

    2015-02-11

    Chlamydia pecorum infections are debilitating in the koala, contributing significantly to morbidity and mortality, with current antibiotic treatments having minimal success and adversely affecting gut microflora. This, combined with the sometimes-asymptomatic nature of the infection, suggests that an efficacious anti-chlamydial vaccine is required to control chlamydial infections in the koala. To date vaccination studies have focused primarily on female koalas, however, given the physiological differences between male and female reproductive tracts, we tested the efficacy of a vaccine in 12 captive male koalas. We evaluated the potential of both subcutaneous and intranasal vaccine delivery to elicit mucosal immunity in male koalas. Our results showed that both intranasal and subcutaneous delivery of a vaccine consisting of C. pecorum major outer membrane protein (MOMP) and the adjuvant immunostimulating complex (ISC) induced significant immune responses in male koalas. Subcutaneous immunization elicited stronger cell-mediated responses in peripheral blood lymphocytes (PBL), and greater plasma antibody levels whereas the intranasal immunization elicited stronger humoral responses in urogenital tract (UGT) secretions. This is the first time a Chlamydia vaccine has been tested in the male koala and the first assessment of a mucosal vaccination route in this species. Our results suggest that vaccination of male koalas can elicit mucosal immunity and could contribute to the long-term survivability of wild populations of the koala. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. In vitro hepatic microsomal metabolism of meloxicam in koalas (Phascolarctos cinereus), brushtail possums (Trichosurus vulpecula), ringtail possums (Pseudocheirus peregrinus), rats (Rattus norvegicus) and dogs (Canis lupus familiaris).

    Science.gov (United States)

    Kimble, B; Li, K M; Valtchev, P; Higgins, D P; Krockenberger, M B; Govendir, M

    2014-04-01

    Quantitative and qualitative aspects of in vitro metabolism of the non-steroidal anti-inflammatory drug meloxicam, mediated via hepatic microsomes of specialized foliage (Eucalyptus) eating marsupials (koalas and ringtail possums), a generalized foliage eating marsupial (brushtail possum), rats, and dogs, are described. Using a substrate depletion method, intrinsic hepatic clearance (in vitro Clint) was determined. Significantly, rates of oxidative transformation of meloxicam, likely mediated via cytochromes P450 (CYP), were higher in marsupials compared to rats or dogs. The rank order of apparent in vitro Clint was brushtail possums (n=3) (mean: 394μL/min/mg protein), >koalas (n=6) (50), >ringtail possums (n=2) (36) (with no significant difference between koalas and ringtail possums), >pooled rats (3.2)>pooled dogs (in which the rate of depletion, as calculated by the ratio of the substrate remaining was <20% and too slow to determine). During the depletion of meloxicam, at a first-order rate constant, 5-hydroxymethyl metabolite (M1) was identified in the brushtail possums and the rat as the major metabolite. However, multiple hydroxyl metabolites were observed in the koala (M1, M2, and M3) and the ringtail possum (M1 and M3) indicating that these specialized foliage-eating marsupials have diverse oxidation capacity to metabolize meloxicam. Using a well-stirred model, the apparent in vitro Clint of meloxicam for koalas and the rat was further scaled to compare with published in vivo Cl. The closest in vivo Cl prediction from in vitro data of koalas was demonstrated with scaled hepatic Cl(total) (average fold error=1.9) excluding unbound fractions in the blood and microsome values; whereas for rats, the in-vitro scaled hepatic Cl fu(blood, mic), corrected with unbound fractions in the blood and microsome values, provided the best prediction (fold error=1.86). This study indicates that eutherians such as rats or dogs serve as inadequate models for dosage extrapolation of this drug to marsupials due to differences in hepatic turnover rate. Furthermore, as in vivo Cl is one of the pharmacokinetic indexes for determining therapeutic drug dosages, this study demonstrates the utility of in vitro to in vivo scaling as an alternative prediction method of drug Cl in koalas. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Humoral immune responses in koalas (Phascolarctos cinereus) either naturally infected with Chlamydia pecorum or following administration of a recombinant chlamydial major outer membrane protein vaccine.

    Science.gov (United States)

    Khan, Shahneaz Ali; Polkinghorne, Adam; Waugh, Courtney; Hanger, Jon; Loader, Jo; Beagley, Kenneth; Timms, Peter

    2016-02-03

    The development of a vaccine is a key strategy to combat the widespread and debilitating effects of chlamydial infection in koalas. One such vaccine in development uses recombinant chlamydial major outer membrane protein (rMOMP) as an antigen and has shown promising results in several koala trials. Previous chlamydial vaccine studies, primarily in the mouse model, suggest that both cell-mediated and antibody responses will be required for adequate protection. Recently, the important protective role of antibodies has been highlighted. In our current study, we conducted a detailed analysis of the antibody-mediated immune response in koalas that are either (a) naturally-infected, and/or (b) had received an rMOMP vaccine. Firstly, we observed that naturally-infected koalas had very low levels of Chlamydia pecorum-specific neutralising antibodies. A strong correlation between low IgG total titers/neutralising antibody levels, and higher C. pecorum infection load was also observed in these naturally-infected animals. In vaccinated koalas, we showed that the vaccine was able to boost the humoral immune response by inducing strong levels of C. pecorum-specific neutralising antibodies. A detailed characterisation of the MOMP epitope response was also performed in naturally-infected and vaccinated koalas using a PepScan epitope approach. This analysis identified unique sets of MOMP epitope antibodies between naturally-infected non-protected and diseased koalas, versus vaccinated koalas, with the latter group of animals producing a unique set of specific epitope-directed antibodies that we demonstrated were responsible for the in vitro neutralisation activity. Together, these results show the importance of antibodies in chlamydial infection and immunity following vaccination in the koala. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. A Prototype Recombinant-Protein Based Chlamydia pecorum Vaccine Results in Reduced Chlamydial Burden and Less Clinical Disease in Free-Ranging Koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Waugh, Courtney; Khan, Shahneaz Ali; Carver, Scott; Hanger, Jonathan; Loader, Joanne; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2016-01-01

    Diseases associated with Chlamydia pecorum infection are a major cause of decline in koala populations in Australia. While koalas in care can generally be treated, a vaccine is considered the only option to effectively reduce the threat of infection and disease at the population level. In the current study, we vaccinated 30 free-ranging koalas with a prototype Chlamydia pecorum vaccine consisting of a recombinant chlamydial MOMP adjuvanted with an immune stimulating complex. An additional cohort of 30 animals did not receive any vaccine and acted as comparison controls. Animals accepted into this study were either uninfected (Chlamydia PCR negative) at time of initial vaccination, or infected (C. pecorum positive) at either urogenital (UGT) and/or ocular sites (Oc), but with no clinical signs of chlamydial disease. All koalas were vaccinated/sampled and then re-released into their natural habitat before re-capturing and re-sampling at 6 and 12 months. All vaccinated koalas produced a strong immune response to the vaccine, as indicated by high titres of specific plasma antibodies. The incidence of new infections in vaccinated koalas over the 12-month period post-vaccination was slightly less than koalas in the control group, however, this was not statistically significant. Importantly though, the vaccine was able to significantly reduce the infectious load in animals that were Chlamydia positive at the time of vaccination. This effect was evident at both the Oc and UGT sites and was stronger at 6 months than at 12 months post-vaccination. Finally, the vaccine was also able to reduce the number of animals that progressed to disease during the 12-month period. While the sample sizes were small (statistically speaking), results were nonetheless striking. This study highlights the potential for successful development of a Chlamydia vaccine for koalas in a wild setting.

  10. 78 FR 16292 - Endangered Species; Receipt of Applications for Permit

    Science.gov (United States)

    2013-03-14

    ... Lorisidae Rhinocerotidae Tapiridae Gruidae Threskiornithidae Genus: Tragopan Species: Koala (Phascolarctos cinereus) Applicant: Field Museum of Natural History, Chicago, IL; PRT-698170 The applicant requests...

  11. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes).

    Science.gov (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin

    2017-01-01

    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  12. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  13. Metabolic regulation at the tricarboxylic acid and glyoxylate cycles of the lignin-degrading basidiomycete Phanerochaete chrysosporium against exogenous addition of vanillin.

    Science.gov (United States)

    Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki

    2005-10-01

    A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.

  14. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation.

    Science.gov (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2013-01-01

    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  15. The Effects of Light Intensity, Casing Layers, and Layering Styles on Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) Cultivation in Turkey.

    Science.gov (United States)

    Adanacioglu, Neşe; Boztok, Kaya; Akdeniz, Ramazan Cengiz

    2015-01-01

    The aim of this research is to evaluate the effects of light intensity, casing layers, and layering styles on the production of the culinary-medicinal mushroom Agaricus brasiliensis in Turkey. The experiments were designed in split-split plots and replicated twice. Three different light intensities-I1, 350 lux; I2, 450 lux; and I3, 750 lux-were used in main plots as environmental factors. A mixture of 4 different casing layers- peat (100%), peat-perlite (75%:25%), peat-clinoptilolite (75%:25%), and peat-perlite-clinoptilolite (60%:20%:20%)-were used at split plots and at split plots. S1, a flat, 3-cm casing layer; S2, a flat, 5-cm casing layer; and S3, casing soil ridges 10 cm wide × 4 cm high, 10 cm apart, were deposited on top of 1-cm overall soil casing layers. At the end of the harvest phase, the total yield was estimated per 100 kg of substrate. Biological efficiency (percentage) was determined from the fresh weight of the mushrooms and the dry weight of the compost at the end of the harvesting period. The highest total yield (7.2 kg/100 kg compost) and biological efficiency (27.63%) were achieved from I2 × peat-perlite-clinoptilolite × S2 treatment. Influence of light intensity, casing layer, layering style, and their interaction in treatments with color values (L*, a*, b*, chroma*, and hue*) also were examined. It has been shown that within color values, chroma* (saturation) values of mushroom caps were affected by light intensity, casing layer, and layering style treatments and light intensity × casing layer treatments and the brightness of mushroom caps tended to increase as light intensity increased.

  16. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  17. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells.

    Science.gov (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan

    2015-01-01

    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells.

  18. COMPARATIVE GENOME ANALYSES OF MONILIOPHTHORA PERNICIOSA AND MONILIOPHTHORA RORERI: TWO CLOSELY RELATED PHYTOPATHOGENIC BASIDIOMYCETES THAT CAUSE DISTINCTLY DIFFERENT DISEASES OF THEOBROMA CACAO

    Science.gov (United States)

    Theobroma cacao (cacao), the source of chocolate, is a tropical understory tree. Fungal diseases such as Witches’ Broom Disease (WBD) and Frosty Pod Rot Disease (FPRD) of cacao have devastated cacao production in much of the Western Hemisphere and are threats to the main cacao producing regions in A...

  19. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.

    2016-02-01

    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  20. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  1. Antitumor and Immunomodulating Activities of Exopolysaccharide Produced by Big Cup Culinary- Medicinal Mushroom Clitocybe maxima (Higher Basidiomycetes) in Liquid Submerged Culture.

    Science.gov (United States)

    Hu, Shu-Hui; Cheung, Peter Chi Keung; Hung, Raw-Pou; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2015-01-01

    Water-soluble polysaccharides extracted from mushrooms have been found to have some physiological effects. In this study, exopolysaccharides (EPSs) were extracted by alcohol precipitation from cultivated broth of the mushroom Clitocybe maxima. EPSs with molecular weights of 10(4) and 10(5) Da were obtained by ultrafiltration; they are referred to as EPA and EPB, respectively. The major components of these EPSs were glucose, galactose, mannose, rhamnose, and arabinose. ICR mice with artificially induced metastatic pulmonary tumors were fed a daily diet containing EPA or EPB at doses of 8, 20, or 50 mg/kg. Results showed that the proliferation of pulmonary sarcoma lesions was lower in the groups fed EPS. In addition, the numbers of total T cells, CD4+ cells, CD8+ cells, and macrophages significantly increased in EPS-fed mice compared with the negative control group. The antitumor and immunomodulating effects observed in the EPB-fed groups were higher than those of EPA-fed groups. These results demonstrate the ability of EPSs of C. maxima to inhibit tumor cells while enhancing immune response.

  2. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav

    2012-01-01

    Roč. 355, č. 1-2 (2012), s. 341-352 ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  3. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages.

    Science.gov (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie

    2015-01-01

    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  4. A shift in nuclear state as the result of natural interspecific hybridization between two North American taxa of the basidiomycete complex Heterobasidion

    Science.gov (United States)

    Matteo Garbelotto; Paolo Gonthier; Rachel Linzer; Giovanni Nicolotti; William Otrosina

    2004-01-01

    A natural first generation hybrid fungus shows interspecific heterozygosity. The nuclear condition of a rare natural hybrid between two taxa of the Heterobasidion complex is investigated. Heterobasidion species are known to be either homokaryotic (haploid) or heterokaryotic (n + n), but heterokaryons are made up of both...

  5. Oxalic acid overproduction by copper-tolerant brown-rot basidiomycetes on southern yellow pine treated with copper-based preservatives

    Science.gov (United States)

    Carol A. Clausen; Frederick Green

    2003-01-01

    Accumulation of oxalic acid (OA) by brown-rot fungi and precipitation of copper oxalate crystals in wood decayed by copper-tolerant decay fungi has implicated OA in the mechanism of copper tolerance. Understanding the role of OA in copper tolerance is important due to an increasing reliance on copper-based wood preservatives. In this study, four copper-tolerant brown-...

  6. HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

    Science.gov (United States)

    Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

    2014-01-01

    The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

  7. Transformation of 14C-labelled lignin and humic substances in forest soil by the saprobic basidiomycetes Gymnopus erythropus and Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    2010-01-01

    Roč. 42, č. 9 (2010), s. 1541-1548 ISSN 0038-0717 R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : Forest soil * Humic acid * Gymnopus erythropus Subject RIV: EE - Microbiology, Virology Impact factor: 3.242, year: 2010

  8. Hypoglycemic and Hypolipidemic Effects of the Cracked-Cap Medicinal Mushroom Phellinus rimosus (Higher Basidiomycetes) in Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Rony, Kuttikkadan A; Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Phellinus rimosus is a parasitic host specific polypore mushroom with profound antioxidant, antihepatotoxic, anti-inflammatory, antitumor, and antimutagenic activities. This study investigated the hypoglycemic and hypolipidemic activities of the wood-inhabiting polypore mushroom Ph. Rimosus in streptozotocin (STZ)-induced diabetic rats. Diabetes was induced by single intraperitoneal injection of STZ (45 mg/kg) to Wistar rats. The effects of 30 days treatment with Ph. Rimosus (50 and 250 mg/ kg) and glibenclamide (0.65 mg/kg) on blood glucose level, serum insulin, serum lipid profile, liver glycogen, liver function enzymes, and non-enzymic and enzymic antioxidants activities in pancreas, liver, and kidney were evaluated in STZ-induced diabetic rats. Oral administration of Ph. Rimosus extract exhibited a significant reduction in blood glucose, triacylglycerol, total cholesterol, LDL-cholesterol, and liver function enzymes, and increased serum insulin, liver glycogen, and HDL-cholesterol levels in STZ-induced diabetic rats. Furthermore, Ph. Rimosus treatment increased antioxidant status in pancreas, liver, and kidney tissues with concomitant decreases in levels of thiobarbituric acid- reactive substances. Results of this study indicated that Ph. Rimosus possessed significant hypoglycemic and hypolipidemic activities and this effect may be related to its insulinogenic and antioxidant effect.

  9. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  10. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  11. Evaluation of the antigenotoxic effects of the royal sun mushroom, agaricus brasiliensis (Higher basidiomycetes) in human lymphocytes treated with thymol in the comet assay

    NARCIS (Netherlands)

    Radaković, Milena; Stevanović, Jevrosima; Soković, Marina; Radović, Dejan; Griensven, Van Leo J.L.D.; Stanimirović, Zoran

    2015-01-01

    The aim of this investigation was to evaluate the possible protective activity of Agaricus brasiliensis (=A. blazei sensu Murrill) ethanol extract against thymol-induced DNA damage in human lymphocytes. Before we studied the possible interaction of thymol and A. brasiliensis extract, each

  12. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  13. Higher marine fungi from mangroves (Manglicolous fungi)

    Digital Repository Service at National Institute of Oceanography (India)

    ChinnaRaj, S.

    of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

  14. Genes controlling plant growth habit in Leymus (Triticeae): maize barren stalk1 (ba1), rice lax panicle, and wheat tiller inhibition (tin3) genes as possible candidates

    Science.gov (United States)

    Parminder Kaur; Steven R. Larson; B. Shaun Bushman; Richard R.-C. Wang; Ivan W. Mott; David Hole; Jyothi Thimmapuram; George Gong; Lei Liu

    2008-01-01

    Leymus cinereus and L. triticoides are large caespitose and rhizomatous perennial grasses, respectively. Previous studies detected quantitative trait loci (QTL) controlling rhizome spreading near the viviparous1 (vp1) gene markers on linkage groups LG3a and LG3b in two families, TTC1 and TTC2, derived from Leymus triticoides x Leymus cinereus hybrids. The wheat tiller...

  15. A survey of ticks (Acari: Ixodidae) from an over-abundant koala (Phascolarctos cinereus) population in south eastern Australia, with an overview of the ticks and mites of koalas.

    Science.gov (United States)

    Kwak, M L; Reed, J

    2017-09-01

    Within Australia, koala over-abundance has become a serious problem in some areas resulting in significant damage to native forests through defoliation. An over-abundant Victorian koala population was surveyed for ticks in the autumn of 2016. During the survey 1036 ticks were collected from 158 koalas. All ticks collected were identified as Ixodes tasmani. Tick prevalence, infestation intensity and on-host sex ratios were calculated for the population. An overview of the ticks and mites associated with koalas in Australia is also presented.

  16. Vaccination of koalas (Phascolarctos cinereus) with a recombinant chlamydial major outer membrane protein adjuvanted with poly I:C, a host defense peptide and polyphosphazine, elicits strong and long lasting cellular and humoral immune responses.

    Science.gov (United States)

    Khan, Shahneaz Ali; Waugh, Courtney; Rawlinson, Galit; Brumm, Jacqui; Nilsson, Karen; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2014-10-07

    Chlamydial infections are wide spread in koalas across their range and a solution to this debilitating disease has been sought for over a decade. Antibiotics are the currently accepted therapeutic measure, but are not an effective treatment due to the asymptomatic nature of some infections and a low efficacy rate. Thus, a vaccine would be an ideal way to address this infectious disease threat in the wild. Previous vaccine trials have used a three-dose regimen; however this is very difficult to apply in the field as it would require multiple capture events, which are stressful and invasive processes for the koala. In addition, it requires skilled koala handlers and a significant monetary investment. To overcome these challenges, in this study we utilized a polyphosphazine based poly I:C and a host defense peptide adjuvant combined with recombinant chlamydial major outer membrane protein (rMOMP) antigen to induce long lasting (54 weeks) cellular and humoral immunity in female koalas with a novel single immunizing dose. Immunized koalas produced a strong IgG response in plasma, as well as at mucosal sites. Moreover, they showed high levels of C. pecorum specific neutralizing antibodies in the plasma as well as vaginal and conjunctival secretions. Lastly, Chlamydia-specific lymphocyte proliferation responses were produced against both whole chlamydial elementary bodies and rMOMP protein, over the 12-month period. The results of this study suggest that a single dose rMOMP vaccine incorporating a poly I:C, host defense peptide and polyphosphazine adjuvant is able to stimulate both arms of the immune system in koalas, thereby providing an alternative to antibiotic treatment and/or a three-dose vaccine regime. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  18. Pro- and antioxidative properties of medicinal mushroom extracts

    NARCIS (Netherlands)

    Song, W.; Griensven, van L.J.L.D.

    2008-01-01

    Hot water extracts of 2 groups of medicinal mushrooms have been tested from the genera Agaricus, Antrodia, Auricularia, Coprinus, Cordyceps, Hericium, Grifola, Ganoderma, Lentinus, Phellinus, and Trametes for ROS-generating activity in human cells and for DPPH-TEAC antioxidant activity. Group 1

  19. Indigenous knowledge and utilization of edible mushrooms in parts ...

    African Journals Online (AJOL)

    Heim and Coprinus disseminatus (Pers.: Fr.) S. F. Gray. Among the local people, names of edible mushrooms are based on the substrates on which they grow, their association with insects, and unrelated taxa are given collective names. Rural people believe mushrooms have medicinal values and can serve as blood tonic, ...

  20. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  1. 78 FR 23286 - Endangered Species; Marine Mammals; Receipt of Applications for Permit

    Science.gov (United States)

    2013-04-18

    ...-horned oryx (Oryx dammah), from the captive herd maintained at their facility, for the purpose of...) African wild dog (Lycaon pictus) Rothschild's starling (Leucopsar rothschildi) Radiated tortoise...) Koala (Phascolarctos cinereus) African wild dog (Lycaon pictus) Andean condor (Vultur gryphus) Harpy...

  2. Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes.

    Science.gov (United States)

    Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin

    2015-01-01

    Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

  3. The protective effects of aqueous extracts of wild-growing and fermented Royal Sun mushroom, Agaricus brasiliensis S. Wasser et al. (higher basidiomycetes), in CCl4-induced oxidative damage in rats.

    Science.gov (United States)

    Zhang, Chunjing; Han, Chunchao; Zhao, Baosheng; Yu, Haitao

    2012-01-01

    Culinary-medicinal Royal Sun mushroom, Agaricus brasiliensis (AbS), has traditionally been used for the prevention of a range of diseases, including cancer, hepatitis, atherosclerosis, hypercholesterolemia, diabetes, and dermatitis. The hepatoprotective effect of the fermented mushroom of A. brasiliensis (FMAE) and wild-growing A. brasiliensis (WMAE) were studied in this paper. An in vivo study of carbon tetrachloride (CCl4)-induced antioxidant activity in 2-month-old rats was conducted by examining the levels of activities of alanine aminotransaminase (ALT) and aspartate aminotransaminase (AST) and the antioxidant enzymes, including glutathione peroxidase (GSHPx) and catalase (CAT). Rats were divided into four groups, each containing six rats. The first group served as a control group. The second group was the CCl4 group. Group I and group II were treated orally with distilled water for 14 days respectively. Group III and Group IV were treated orally by WMAE and FMAE at oral doses of 50 mg/kg-day, respectively. Both WMAE and FMAE could reduce CCl4-induced toxicity, particularly hepatotoxicity, by suppressing ALT and AST activities, and increasing antioxidant enzyme activity. The studies demonstrate that both the fermented and wild-growing A. brasiliensis could protect the liver against CCl4-induced oxidative damage in rats.

  4. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  5. The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster.

    Science.gov (United States)

    Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis

    2014-01-01

    Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

  6. The Anti-Inflammatory Effects of Lion's Mane Culinary-Medicinal Mushroom, Hericium erinaceus (Higher Basidiomycetes) in a Coculture System of 3T3-L1 Adipocytes and RAW264 Macrophages.

    Science.gov (United States)

    Mori, Koichiro; Ouchi, Kenji; Hirasawa, Noriyasu

    2015-01-01

    Chronic low-grade inflammation in the adipose tissue accompanying obesity is thought to be an underlying driver of metabolic diseases. In this study, we aimed to investigate the efficacy of Hericium erinaceus on adipose tissue inflammation. The anti-inflammatory effects of the ethyl acetate soluble fraction of H. erinaceus (EAHE) were examined using cocultures of 3T3-L1 adipocytes and RAW264 macrophages. EAHE significantly suppressed tumor necrosis factor (TNF)-α and interleukin (IL)-6 production in cultured RAW264 macrophages stimulated by lipopolysaccharide (LPS). EAHE also caused notable inhibition of c-Jun N-terminal kinase (JNK) activation, which is thought to be involved in the suppression of proinflammatory cytokines by EAHE. In a coculture system with 3T3-L1 and RAW264 cells stimulated with LPS, EAHE reduced TNF-α and IL-6 concentrations in the conditioned medium and lowered the gene expression levels of these cytokines in 3T3-L1 adipocytes. Furthermore, EAHE suppressed the LPS-induced reduction of adiponectin mRNA levels in 3T3-L1 adipocytes cocultured with RAW264 macrophages. However, in 3T3-L1 adipocytes cultured alone, the concentration of LPS used in this study did not affect the gene expression levels of these adipokines. We attributed the anti-inflammatory effects of EAHE on 3T3-L1 adipocytes cocultured with RAW264 macrophages to the suppression of Toll-like receptor 4 (TLR4) signaling and subsequent proinflammatory cytokine secretion in RAW264 cells. Our findings indicate the possibility that H. erinaceus exerts anti-inflammatory effects on macrophages through the inhibition of TLR4-JNK signaling and prevents or ameliorates adipose tissue inflammation associated with obesity.

  7. Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study.

    Science.gov (United States)

    Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary

    2015-01-01

    Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

  8. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1982-01-01

    A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

  9. 26 - 30 Kutama

    African Journals Online (AJOL)

    DR. AMINU

    wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

  10. A metagenomics-based approach to the top-down effect on the detritivore food web: a salamanders influence on fungal communities within a deciduous forest.

    Science.gov (United States)

    Walker, Donald M; Lawrence, Brandy R; Esterline, Dakota; Graham, Sean P; Edelbrock, Michael A; Wooten, Jessica A

    2014-11-01

    The flow of energy within an ecosystem can be considered either top-down, where predators influence consumers, or bottom-up, where producers influence consumers. Plethodon cinereus (Red-backed Salamander) is a terrestrial keystone predator who feeds on invertebrates within the ecosystem. We investigated the impact of the removal of P. cinereus on the detritivore food web in an upland deciduous forest in northwest Ohio, U.S.A. A total of eight aluminum enclosures, each containing a single P. cinereus under a small log, were constructed in the deciduous forest. On Day 1 of the experiment, four salamanders were evicted from four of the eight enclosures. Organic matter and soil were collected from the center of each enclosure at Day 1 and Day 21. From each sample, DNA was extracted, fungal-specific amplification performed, and 454 pyrosequencing was used to sequence the nuclear ribosomal internal transcribed spacer (ITS2) region and partial ribosomal large subunit (LSU). Changes in overall fungal community composition or species diversity were not statistically significant between treatments. Statistically significant shifts in the most abundant taxonomic groups of fungi were documented in presence but not absence enclosures. We concluded that P. cinereus does not affect the overall composition or diversity of fungal communities, but does have an impact on specific groups of fungi. This study used a metagenomics-based approach to investigate a missing link among a keystone predator, P. cinereus, invertebrates, and fungal communities, all of which are critical in the detritivore food web.

  11. Diversity of edible mushrooms in pakistan

    International Nuclear Information System (INIS)

    Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

    2007-01-01

    Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

  12. Climate-mediated competition in a high-elevation salamander community

    Science.gov (United States)

    Dallalio, Eric A.; Brand, Adrianne B,; Grant, Evan H. Campbell

    2017-01-01

    The distribution of the federally endangered Shenandoah Salamander (Plethodon shenandoah) is presumed to be limited by competition with the Red-backed Salamander (Plethodon cinereus). In particular, the current distribution of P. shenandoah is understood to be restricted to warmer and drier habitats because of interspecific interactions. These habitats may be particularly sensitive to climate change, though the influence of competition may also be affected by temperature and relative humidity. We investigated the response of P. shenandoah to competition with P. cinereus under four climate scenarios in 3-dimensional mesocosms. The results suggest that, although climate change may alleviate competitive pressure from P. cinereus, warmer temperatures may also significantly influence the persistence of the species across its known range.

  13. In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.

    Science.gov (United States)

    Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S

    2006-06-01

    The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

  14. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  15. Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.

    Science.gov (United States)

    Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

    2008-07-01

    Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

  16. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  17. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  18. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)

    DR GATSING

    Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.

  19. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1993-01-01

    Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

  20. Bioleaching of copper, aluminum, magnesium and manganese from ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.

  1. 12038_2016_9614_Article_print 265..275

    Indian Academy of Sciences (India)

    2016-05-13

    May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.

  2. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  3. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

    Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...

  4. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  5. octadecenoic acid in tomato

    African Journals Online (AJOL)

    User

    bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.

  6. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  7. Formation and cell wall regeneration of protoplasts from Schizophyllum commune

    NARCIS (Netherlands)

    de Vries, Onno Minne Hotze

    1974-01-01

    Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.

  8. Characterization and cultivation of a wild mushroom species isolated in Brazil
    Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil

    OpenAIRE

    Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki

    2002-01-01

    Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

  9. Decolorization of six synthetic dyes by fungi

    OpenAIRE

    Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.

    2016-01-01

    To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...

  10. Bats of the Colorado oil shale region

    Energy Technology Data Exchange (ETDEWEB)

    Finley, R.B. Jr.; Caire, W.; Wilhelm, D.E.

    1984-10-31

    New records for Myotis californicus, M. evotis, M. leibii, M. lucifugus, M. thysanodes, M. volans, M. yumanensis, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Lasiurus cinereus, Plecotus townsendii, and Antrozous pallidus and their habitat occurrence in northwestern Colorado are reported. Mortality of 27 bats of six species trapped in an oil sludge pit is described. 7 references.

  11. A nondestructive technique to monitor the relative abundance of terrestrial salamanders

    Science.gov (United States)

    Richard M. DeGraaf; Mariko. Yamasaki

    1992-01-01

    Salamanders are abundant vertebrates in many forest ecosystems, and their annual biomass production can be important in forest food webs (Pough et al. 1987). Population densities of eastern redback salamanders (Plethodon cinereus) can exceed 2 individuals/m2 in deciduous forests of the United States (Heatwole 1962, Jaeger 1980...

  12. 50 CFR 17.84 - Special rules-vertebrates.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 2 2010-10-01 2010-10-01 false Special rules-vertebrates. 17.84 Section 17.84 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR....84 Special rules—vertebrates. (a) Delmarva Peninsula fox squirrel (Sciurus niger cinereus). (1) The...

  13. Fatalities at wind turbines may threaten population viability of a migratory bat

    Science.gov (United States)

    W.F. Frick; E.F. Baerwald; J.F. Pollock; R.M.R. Barclay; J.A. Szymanski; Ted Weller; A.L. Russell; Susan Loeb; R.A. Medellin; L.P. McGuire

    2017-01-01

    Large numbers of migratory bats are killed every year at wind energy facilities. However, population-level impacts are unknown as we lack basic demographic information about these species. We investigated whether fatalities at wind turbines could impact population viability of migratory bats, focusing on the hoary bat (Lasiurus cinereus),...

  14. Wide-scale population sampling identifies three phylogenetic races of basin wildrye and low-level genetic admixture with creeping wildrye

    Science.gov (United States)

    C. Mae Culumber; Steven R. Larson; Thomas A. Jones; Kevin B. Jensen

    2013-01-01

    Basin wildrye [Leymus cinereus (Scribn. & Merr.) Á. Löve] and creeping wildrye [Leymus triticoides (Buckley) Pilg.] are outcrossing perennial grasses native to western North America. These divergent species are generally adapted to different habitats but can form fertile hybrids. Cultivars of both species are used in agriculture and conservation, but little is...

  15. Effects of edge contrast on redback salamander distribution in even-aged northern hardwoods

    Science.gov (United States)

    Richard M. DeGraaf; Mariko. Yamasaki

    2002-01-01

    Terrestrial salamanders are sensitive to forest disturbance associated with even-aged management. We studied the distribution of redback salamanders (Plethodon cinereus) for 4 yr at edges between even-aged northern hardwood stands along three replicate transects in each of three edge contrast types: regeneration/mature, sapling/mature, and...

  16. Roost characteristics of hoary bats in Arkansas

    Science.gov (United States)

    Roger W. Perry; Ronald E. Thill

    2007-01-01

    We radiotracked nine hoary bats (Lasiurus cinereus) and characterized 12 roosts during late spring and early summer in the Ouachita Mountains of central Arkansas. Hoary bats generally roosted on the easterly sides of tree canopies in the foliage of white oaks (Quercus alba), post oaks (Q. stellata) and shortleaf pines (Pinus...

  17. Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.

  18. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines

    Science.gov (United States)

    Cryan, P.M.; Jameson, J.W.; Baerwald, E.F.; Willis, C.K.R.; Barclay, R.M.R.; Snider, E.A.; Crichton, E.G.

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  19. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Directory of Open Access Journals (Sweden)

    Paul M Cryan

    Full Text Available Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus, eastern red bats (L. borealis, and silver-haired bats (Lasionycteris noctivagans found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  20. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Science.gov (United States)

    Cryan, Paul M; Jameson, Joel W; Baerwald, Erin F; Willis, Craig K R; Barclay, Robert M R; Snider, E Apple; Crichton, Elizabeth G

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  1. Mold biomass as a potential source of nutrient proteins

    Energy Technology Data Exchange (ETDEWEB)

    Fuska, J; Kollarova, A

    1977-01-01

    In submerged cultures of Penicillium resticulosum, Mycelium sterilium, Gibberella fuiikuroi, and Coprinus species grown for 72 hours in medium containing 5 to 7% sawdust hydrolyzate, 1.28 to 1.45 g of dry biomass per 100 mL of culture was produced with 28.1 to 35.3% total amino acids and 15 to 18% essential amino acids; 80 to 90% of the cellular protein was digestible. Mannose, glucose and galactose of the hydrolyzate were utilized faster than xylose and arabinose.

  2. Nueva contribución al conocimiento de los macromicetos de la Reserva Ecológica del Pedregal de San Ángel, D.F., México New contribution to the knowledge of the macromycetes of the Ecological Reserve of the Pedregal of San Ángel, D.F., Mexico

    Directory of Open Access Journals (Sweden)

    Teófilo Herrera

    2006-06-01

    Full Text Available Se citan 8 especies de macromicetos recolectados en el área poniente de la Reserva Ecológica del Pedregal de San Ángel, D.F., México, de las cuales 5 son lignícolas y 3 humícolas, Se desarrollan a la sombra y entre hojarasca de plantas superiores. Entre los agaricales la familia Agaricaceae es la mejor representada. Se citan por primera vez en la micobiota del Pedregal de San Ángel: Gymnopus confluens, Agrocybe pediades, Agaricus arvensis y A. silvaticus, Setchelliogaster rheophyllus y Coprinus truncorumse citan por primera vez para México.Eight species of macromycetes were collected from the Ecological Reserve of the Pedregal de San Angel D.F. Mexico. Five of them are lignicolous, and 3 are humicolous developing under the shade of trees and among the litter of vascular plants. In the Agaricales the family Agaricaceae is the best represented. Gymnopus confluens, Agrocybe pediades, Agaricus arvensis and A. silvaticus, are first records in the mycobiota of the Pedregal de San Ángel. Setchelliogaster rheophyllus and Coprinus truncorum first records for Mexico are presented in this paper.

  3. The effects of meteorological factors on airborne fungal spore concentration in two areas differing in urbanisation level

    Science.gov (United States)

    Oliveira, M.; Ribeiro, H.; Delgado, J. L.; Abreu, I.

    2009-01-01

    Although fungal spores are an ever-present component of the atmosphere throughout the year, their concentration oscillates widely. This work aims to establish correlations between fungal spore concentrations in Porto and Amares and meteorological data. The seasonal distribution of fungal spores was studied continuously (2005-2007) using volumetric spore traps. To determine the effect of meteorological factors (temperature, relative humidity and rainfall) on spore concentration, the Spearman rank correlation test was used. In both locations, the most abundant fungal spores were Cladosporium, Agaricus, Agrocybe, Alternaria and Aspergillus/Penicillium, the highest concentrations being found during summer and autumn. In the present study, with the exception of Coprinus and Pleospora, spore concentrations were higher in the rural area than in the urban location. Among the selected spore types, spring-autumn spores ( Coprinus, Didymella, Leptosphaeria and Pleospora) exhibited negative correlations with temperature and positive correlations both with relative humidity and rainfall level. On the contrary, late spring-early summer (Smuts) and summer spores ( Alternaria, Cladosporium, Epicoccum, Ganoderma, Stemphylium and Ustilago) exhibited positive correlations with temperature and negative correlations both with relative humidity and rainfall level. Rust, a frequent spore type during summer, had a positive correlation with temperature. Aspergillus/Penicillium, showed no correlation with the meteorological factors analysed. This knowledge can be useful for agriculture, allowing more efficient and reliable application of pesticides, and for human health, by improving the diagnosis and treatment of respiratory allergic disease.

  4. A study of bat populations at Los Alamos National Laboratory and Bandelier National Monument, Jemez Mountains, New Mexico: FY95--97 report to Los Alamos National Laboratory and Bandelier National Monument

    Energy Technology Data Exchange (ETDEWEB)

    Bogan, M.A.; O`Shea, T.J.; Cryan, P.M.; Ditto, A.M.; Schaedla, W.H.; Valdez, E.W.; Castle, K.T.; Ellison, L. [Univ. of New Mexico, Albuquerque, NM (United States)

    1998-12-31

    In 1995, a three-year study was initiated to assess the current status of bat species of concern, elucidate distribution and relative abundance, and obtain information on roosting sites of bats. The authors captured and released 1532 bats of 15 species (Myotis californicus, M. ciliolabrum, M. evotis, M. thysanodes, M. volans, M. yumanensis, Lasiurus cinereus, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Euderma maculatum, Corynorhinus townsendii, Antrozous pallidus, Tadarida brasiliensis, and Nyctinomops macrotis) and followed 32 bats of eight species (M. evotis, M. thysanodes, M. volans, E. fuscus, E. maculatum, C. townsendii, A. pallidus, and N. macrotis) to 51 active diurnal roosts. The most abundant species were L. noctivagans, E. fuscus, L. cinereus, M. evotis, M. volans, and M. ciliolabrum. Most of these species are typical inhabitants of ponderosa pine-mixed coniferous forests.

  5. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  7. Comparison of nine antigen detection kits for diagnosis of urogenital infections due to Chlamydia psittaci in koalas.

    OpenAIRE

    Wood, M M; Timms, P

    1992-01-01

    Chlamydia psittaci is the major cause of infectious disease in the koala (Phascolarctos cinereus). It causes four disease syndromes in the koala, namely, conjunctivitis, rhinitis, cystitis, and infertility (females only). Diagnosis of chlamydial infections in koalas relies primarily on isolation of the organism in cell culture. Serology has generally not been useful, and little use has previously been made of the commercially available antigen detection kits. We examined the sensitivity, spec...

  8. Comparison of trace element content in marine organisms collected from the La Maddalena archipelago and other Mediterranean and Pacific ocean sites

    International Nuclear Information System (INIS)

    Boniforti, R.; Moauro, A.

    1982-01-01

    As, Sb, Zn, Hg, Fe, Co and Cs were analysed by instrumental neutron activation analysis in four fish species (Mullus surmuletus, Scorpaena porcus, Crenilabus cinereus, and Serranus scriba) and one gesteropod (Sepia officinalis). The results were compared with those obtained by other authors for fish collected both in the Mediterranean and the Pacific. The difficulty of comparing results obtained by different authors was stressed and some suggestions to overcome this difficulty were given

  9. Habitat and food resources of otters (Mustelidae) in Peninsular Malaysia

    Science.gov (United States)

    Abdul-Patah, P.; Nur-Syuhada, N.; Md-Nor, S.; Sasaki, H.; Md-Zain, B. M.

    2014-09-01

    Habitat and food resources of otters were studied in several locations in Peninsular Malaysia. A total of 210 fecal samples were collected from April 2010 to March 2011 believed to be of otter's were analyzed for their diet composition and their habitat preferences. The DNA testing conducted revealed that only 126 samples were identified as Lultrogale perspicillata and Aonyx cinereus with 105 and 21 samples, respectively. Habitat analyses revealed that these two species preferred paddy fields and mangroves as their main habitats but L. perspicillata preferred to hunt near habitat with large water bodies, such as mangroves, rivers, ponds, and lakes. A. cinereus on the other hand, were mainly found near land-based habitat, such as paddy fields, casuarinas forest and oil palms near mangroves. Habitats chosen were influenced by their food preferences where L. perspicillata consumed a variety of fish species with a supplementary diet of prawns, small mammals, and amphibians, compared to A. cinereus which consumed less fish and more non-fish food items, such as insects, crabs, and snails. Since, the most of the otter habitats in this study are not located within the protected areas, conservation effort involving administrations, landowners, private organizations and public are necessary.

  10. Rediscovery of the type series of the Acadian Masked Shrew, Sorex acadicus Gilpin, 1865 (Mammalia: Soricidae), with the designation of a neotype and a reevaluation of its taxonomic status

    Science.gov (United States)

    Woodman, Neal

    2018-01-01

    The name Sorex acadicus Gilpin, 1865 is currently recognized as the valid name for the Nova Scotian subspecies of the masked shrew, S. cinereus Kerr, 1792 (Mammalia: Soricidae), but a holotype for the taxon was never designated, and the location of the type series has been a mystery. The authority for this species, John Bernard Gilpin, was associated with the Nova Scotia Museum, Halifax, NS, but that institution has no Gilpin specimens in its possession, and I could find no record of Gilpin shrews in any other Canadian Museum. I recently discovered a series of Gilpin specimens in the Mammal Collection of the National Museum of Natural History, Washington, DC (USNM), some of which may have been part of the original type series of S. acadicus, and I show that these specimens best represent Gilpin's concept of the taxon. From this series, I designate a neotype for S. acadicus. I also evaluate the distinctiveness of Nova Scotian S. c. acadicus compared with S. c. cinereus from Maine, New Brunswick, and New Hampshire and determine that S. acadicus should be considered a junior synonym of S. c. cinereus.

  11. Conservation genetics of the endangered Shenandoah salamander (Plethodon shenandoah, Plethodontidae)

    Science.gov (United States)

    Carpenter, D.W.; Jung, R.E.; Sites, J.W.

    2001-01-01

    The Shenandoah salamander (Plethodon shenandoah) is restricted to three isolated talus outcrops in Shenandoah National Park, VA, USA and has one of the smallest ranges of any tetrapod vertebrate. This species was listed as endangered under the US Endangered Species Act in 1989 over concern that direct competition with the red-backed salamander (Plethodon cinereus), successional habitat changes, and human impacts may cause its decline and possible extinction. We address two issues herein: (1) whether extensive introgression (through long-term hybridization) is present between the two species and threatens the survival of P. shenandoah, and (2) the level of population structure within P. shenandoah. We provide evidence from mtDNA haplotypes that shows no genetic differentiation among the three isolates of P. shenandoah, suggesting that their fragmentation is a geologically recent event, and/or that the isolates are still connected by occasional gene flow. There is also no evidence for extensive introgression of alleles in either direction between P. cinereus and P. shenandoah, which suggests that P. shenandoah may not be in danger of being genetically swamped out through hybridization with P. cinereus.

  12. Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.

    Science.gov (United States)

    Kozar, F; MacDonald, B R; Weijer, J

    1977-01-01

    The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

  13. Antibiotics in the chemical communication of fungi.

    Science.gov (United States)

    Kettering, Melanie; Sterner, Olov; Anke, Timm

    2004-01-01

    In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.

  14. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  15. [Characterization of an extracellular glycolipid from Lentinus edodes (Berk.) Sing [Lentinula edodes (Berk.) Pegler

    Science.gov (United States)

    Tsivileva, O M; Nikitina, V E; Makarov, O E

    2008-01-01

    Submerged mycelium of a xylotrophic basidiomycete Lentinus edodes produces an extracellular glycolipid, S3, associated with a lectin. Galactose glycan residue, as well as the lipid pool composition, which includes nonhydroxylated short-chain fatty acids, is uncommon for basidiomycetes. The glycolipid consists of D-galactopyranose (15% of S3 contains galactose sulfate) acylated by octadecanoic and nonadecanoic fatty acid residues (28 and 72%, respectively). The glycolipid structure and composition are confirmed by physicochemical analysis. The glycolipid is assumed to be a regulator of lectin activity.

  16. Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications

    Science.gov (United States)

    Cathy L. Cripps

    2001-01-01

    Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...

  17. Global warming and mycoflora in the Baltic Region

    Directory of Open Access Journals (Sweden)

    Hanns Kreisel

    2013-12-01

    Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

  18. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  19. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter

    2010-01-01

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  20. Novel mandibular gland volatiles from Apterostigma ants

    DEFF Research Database (Denmark)

    Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya

    2017-01-01

    The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...

  1. On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.

    2013-01-01

    Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

  2. Molecular identification, genetic diversity, population genetics and genomics of Rhizoctonia solani. In:perspective of plant pathology in genomic era

    Science.gov (United States)

    The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...

  3. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

    2000-01-01

    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  4. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  5. Clonality and α-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia

    NARCIS (Netherlands)

    Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland

    2011-01-01

    Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the

  6. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  7. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  8. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

    2015-01-01

    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  9. [First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].

    Science.gov (United States)

    Madrid Lorca, Hugo; Muñoz, Mélica

    2006-06-01

    Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

  10. Moniliophthora roreri Genome and Transcriptome

    Science.gov (United States)

    Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

  11. Elevated tropospheric CO2 and O3 may not alter initial wood decomposition rate or wood-decaying fungal community composition of Northern hardwoods

    Science.gov (United States)

    Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser

    2016-01-01

    We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...

  12. Fungal Systematics and Evolution: FUSE 3

    NARCIS (Netherlands)

    Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying

    2017-01-01

    The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra

  13. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

    2014-01-01

    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  14. Bio-softening of mature coconut husk for facile coir recovery.

    Science.gov (United States)

    Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

    2007-06-01

    Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

  15. A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao

    Science.gov (United States)

    The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

  16. Identification and first report of Inonotus (Phellinus) tropicalis as an etiologic agent in a patient with chronic granulomatous disease

    Science.gov (United States)

    D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul

    2005-01-01

    Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.

  17. Fungal Systematics and Evolution: FUSE 2

    NARCIS (Netherlands)

    Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.

    2016-01-01

    The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature

  18. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  19. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    DEFF Research Database (Denmark)

    Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H

    2007-01-01

    BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...

  20. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.

    2007-01-01

    Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species