WorldWideScience

Sample records for basidiomycete coprinus cinereus

  1. DNA-mediated transformation of the basidiomycete Coprinus cinereus.

    OpenAIRE

    Binninger, D M; Skrzynia, C.; Pukkila, P. J.; Casselton, L A

    1987-01-01

    We have developed a simple and efficient transformation system for the agaric fungus, Coprinus cinereus. Protoplasts were prepared from asexual spores that harbor one or two mutations in the structural gene for tryptophan synthetase. The protoplasts can be stably transformed using the cloned Coprinus gene at a frequency of 1 in 10(4) viable protoplasts. A variety of molecular events accompanies the formation of stable transformants, including insertion of the transforming DNA at the homologou...

  2. Primary structure of dihydrofolate reductase and mitochondrial ribosomal protein L36 genes from the basidiomycete Coprinus cinereus.

    Science.gov (United States)

    Aimi, Tadanori; Fukuhara, Shoji; Ishiguro, Maki; Kitamoto, Yutaka; Morinaga, Tsutomu

    2004-08-01

    We amplified and sequenced the dihydrofolate reductase (DHFR) gene of the basidiomycete Coprinus cinereus. Downstream of the DHFR coding region, a mitochondrial (mt) ribosomal protein L36 (RPL36) gene was discovered in the opposite orientation to DHFR gene. Putative polyadenylation signals of the two genes overlapped, both containing the 8-bp palindrome 5'-aatatatt-3'. The finding that C. cinereus DHFR gene is closely clustered with a mt protein gene strongly suggests that C. cinereus DHFR is closely related to mt function and evolution. The amino acid sequence of C. cinereus DHFR is most homologous to eukaryotic proteins such as Cryptococcus neoformans and Pneumocystis carinii DHFRs. However, the sequence of C. cinereus mt RPL36 closely resembles RPL36 of bacteria and cyanobacteria such as Synechocystis sp. and Escherichia coli. This result strongly supports the serial endosymbiotic theory of the development of ancestral eukaryotes, and suggests that C. cinereus mt RPL36 gene originated from the ancestral eubacterial genome. PMID:15620217

  3. Elucidation of the product synthesis of the sesquiterpene synthase Cop6 isolated from Coprinus cinereus

    OpenAIRE

    Andersson, Marie

    2009-01-01

    Mushrooms are believed to have a great potential for production of bioactive metabolites e. g. terpenes, a group of interesting compounds with diverse chemical properties such as antitumour and antibacterial activity. Cop6 is a terpene cyclase isolated from the mushroom Coprinus cinereus that catalyzes the cyclization of farnesyl diphosphate (FPP) to mainly α-cuprenene. In this study gas chromatography combined with mass spectroscopy (GC-MS) is used to analyze the product profile of Cop6 muta...

  4. Kinetics of stem gravitropism in Coprinus cinereus: determination of presentation time and "dosage-response" relationships using clinostats.

    Science.gov (United States)

    Hatton, J P; Moore, D

    1992-12-15

    The sensitivity to gravitational stimulation of excised stems of the mushroom fruit body of Coprinus cinereus was determined using clinostat rotation to remove partially-stimulated stems from the normal unidirectional gravitational field. For the strain and conditions tested, the presentation time (the minimum time of stimulation required to elicit a gravitropic reaction) was determined to be 9.6 min. This is the first time the presentation time has been determined for a fungal gravitropic response. Constructional details are given of the clinostats employed in the research and their further use is discussed. PMID:11541046

  5. Studies in Coprinus IV — Coprinus section coprinus. Subdivision and revision of subsection Alachuani

    OpenAIRE

    Uljé, C.B.; Noordeloos, M.E.

    1997-01-01

    Coprinus section Coprinus is defined and delimited to comprise four subsections: Atramentarii, Coprinus, Lanatuli and Alachuani. A key to the subsections is given as well as a key to the species of subsection Alachuani known from the Netherlands or to be expected in the Netherlands on account of records from neighbouring countries. Three new species, Coprinus epichloeus, Coprinus fluvialis and Coprinus sclerotiorum are described as well as a new variety of C. urticicola: var. salicicola. In a...

  6. Studies in Coprinus IV — Coprinus section coprinus. Subdivision and revision of subsection Alachuani

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1997-01-01

    Coprinus section Coprinus is defined and delimited to comprise four subsections: Atramentarii, Coprinus, Lanatuli and Alachuani. A key to the subsections is given as well as a key to the species of subsection Alachuani known from the Netherlands or to be expected in the Netherlands on account of rec

  7. Type studies in Coprinus subsection Lanatuli

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    2001-01-01

    As a prelude to a monograph of the genus Coprinus, types were studied of a number of species said to belong to Coprinus subsection Lanatuli (Coprinus alnivorus. C. alutaceivelatus, C. ammophilae, C. arachnoideus, C. asterophoroides, C. brunneistragulatus, C. bubalinus, C. citrinovelatus, C. colosseu

  8. Type studies in Coprinus subsection Lanatuli

    OpenAIRE

    Uljé, C.B.; Noordeloos, M.E.

    2001-01-01

    As a prelude to a monograph of the genus Coprinus, types were studied of a number of species said to belong to Coprinus subsection Lanatuli (Coprinus alnivorus. C. alutaceivelatus, C. ammophilae, C. arachnoideus, C. asterophoroides, C. brunneistragulatus, C. bubalinus, C. citrinovelatus, C. colosseus, C. jonesii, C. lagopides, C. marcidus, C. pachydermus, C. palmeranus, C. roseistipitatus, C. scobicola, C. spadiceisporus, C. sylvicola, C. tectisporus, C. undulatus and C. xerophilus). As a res...

  9. Screening of Coprinus species for the production of extracellular peroxidase and evaluation of its applicability to the treatment of aqueous phenol

    International Nuclear Information System (INIS)

    Twenty-nine strains of Coprinus species comprising 16 strains from 12 identified species and 13 unidentified strains as well as one Arthromyces ramosus strain were screened for the production of extracellular peroxidase. Among the fungi examined, three strains of C. cinereus, UAMH 4103, UAMH 7907 and IFO 30116, as well as one Coprinus sp., UAMH 10067, which was isolated from urea treated soil, were shown to produce large amounts of extracellular peroxidase. The performance of crude peroxidase, obtained from liquid culture of C. cinereus, (CIP) on phenol removal from synthetic wastewater was evaluated and compared with that of purified horseradish peroxidase and A. ramosus peroxidase. Although crude CIP performed better than both purified enzymes, its superiority vanished in the presence of poly(ethylene glycol), a known protective agent of peroxidase. This suggests that the residual soluble substances present in crude CIP have protective effects similar to those of poly(ethylene glycol). (author)

  10. Meiosis in Coprinus: characterization and activities of two forms of DNA polymerase during meiotic stages.

    OpenAIRE

    K. Sakaguchi; Lu, B C

    1982-01-01

    Two forms of DNA polymerase have been studied in the basidiomycete Coprinus. DNA polymerase from basidiocarp tissues at zygotene-pachytene stage has been purified 3,500-fold and defined as DNA polymerase b by virtue of its insensitivity to N-ethylmaleimide and by its low molecular weight (76,000). This enzyme has optimal activity at pH 7.0 to 7.5, at 200 mM KCl, and at 25 degrees C incubation temperature. It can use polycytidylic acid-oligo(dG)12-18 as template primer in addition to homodeoxy...

  11. Studies in Coprinus III — Coprinus section Veliformes. Subdivision and revision of subsection Nivei emend

    OpenAIRE

    Uljé, C.B.; Noordeloos, M.E.

    1993-01-01

    Coprinus section Veliformes is defined and delimited to comprise four subsections: subsection Micacei, subsection Domestici, subsection Nivei, and subsection Narcotici, subsection nov. A key to the subsections is given. Subsection Nivei is emended, including also most taxa of subsection Flocculosi Citerin. A key is given to all species known from the Netherlands, or to be expected in the Netherlands on account of records from neighbouring countries. Three new species are described, viz. Copri...

  12. Screening of Brazilian basidiomycetes for antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Rosa Luiz Henrique

    2003-01-01

    Full Text Available A total of 103 isolates of basidiomycetes, representing 84 species from different Brazilian ecosystems, were evaluated for their antifungal and antibacterial activity in a panel of pathogenic and non-pathogenic microorganisms. Tissue plugs of the fruiting bodies were cultivated in liquid media and the whole culture extracted with ethyl acetate. Crude extracts from Agaricus cf. nigrecentulus, Agrocybe perfecta, Climacodon pulcherrimus, Gloeoporus thelephoroides, Hexagonia hydnoides, Irpex lacteus, Leucoagaricus cf. cinereus, Marasmius cf. bellus, Marasmius sp., Nothopanus hygrophanus, Oudemansiella canarii, Pycnoporus sanguineus, Phellinus sp., and Tyromyces duracinus presented significant activity against one or more of the target microorganisms. Eight isolates were active only against bacteria while three inhibited exclusively the growth of fungi. Two extracts presented wide antimicrobial spectrum and were active against both fungi and bacteria. Differences in the bioactivity of extracts obtained from isolates from the same species were observed.

  13. Enzymes of Saprotrophic Basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    Amsterdam: Academic Press, 2007, s. 19-41. ISBN 978-0-12-374185-1 R&D Projects: GA AV ČR KJB600200516; GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : saprotrophic basidiomycetes * extracellular enzymes * polymers Subject RIV: EE - Microbiology, Virology

  14. Studies in Coprinus—I. Subsections Auricomi and Glabri of Coprinus section Pseudocoprinus

    OpenAIRE

    Uljé, C.B.; Bas, C.

    1988-01-01

    A key is given to the Netherlands’ species of subsect. Auricomi Sing. and Glabri J. Lange of Coprinus sect. Pseudocoprinus (Kühn.) Orton & Watling. All species concerned are concisely described and amply discussed. Coprinus plicatilis var. microsporus Kühn. is raised to species level as C. kuehneri and described in detail

  15. [Antiviral properties of basidiomycetes metabolites].

    Science.gov (United States)

    Avtonomova, A V; Krasnopolskaya, L M

    2014-01-01

    The data on the antiviral action of the Ganoderma lucidum, Lentinus edodes, Grifola frondosa, Agaricus brasiliensis and other basidiomycetes metabolites are summurized. The metabolites of these species of basidiomycetes exhibit a direct antiviral effect on herpes simplex virus types I and II, human immunodeficiency virus (HIV), hepatitis B virus, vesicular stomatitis virus, influenza virus, Epstein-Barr virus, and others. Moreover, metabolites of basidiomycetes increased antiviral immunity. PMID:25975107

  16. Determination of trace elements in three mushroom samples of basidiomycetes from Shandong, China.

    Science.gov (United States)

    Wang, Chao; Hou, Yunhua

    2011-09-01

    We have determined the trace element composition of three mushrooms of Basidiomycetes, used in traditional Chinese medicine using atomic absorption spectrophotometer (AAS). Metal concentrations in mushrooms were 203-401 mg/kg for iron, 22-51 mg/kg for manganese, 84-116 mg/kg for zinc, 24.1-41.3 mg/kg for copper, 1.6-5.6 mg/kg for lead, 3.3-4.4 mg/kg for chromium, 9.3-11.5 mg/kg for nickel, 0 mg/kg for vanadium, and 55.3-71 mg/kg for magnesium. The trace metal concentrations in mushrooms are hardly affected by the ecosystem and soil where they grew, as well as by the mushroom species and trace metal species. The results can be used to set new standards to control the quality of the three mushrooms of Basidiomycetes-Ganoderma lucidum, Coprinus comatus, and Grifola frondosa. PMID:20665124

  17. Antioxidant Properties of Cap and Stipe from Coprinus comatus

    Directory of Open Access Journals (Sweden)

    Haijuan Nan

    2010-03-01

    Full Text Available Coprinus comatus, also called chicken drumstick mushroom, is currently commercially available in China. Hot water and ethanolic extracts were prepared from cap and stipe of C. comatus fruit bodies and their antioxidant properties were studied. Ethanolic extract from stipe showed high antioxidant activity (80.6% at 1 mg/mL. Reducing power of hot water extracts from cap was 1.653 at 10 mg/mL. Extracts from cap showed better scavenging ability on DPPH (57.9% at 1 mg/mL than stipe ones. Ethanolic extracts were more effective in scavenging ability on hydroxyl radicals (57.4–61.3% at 5 mg/mL than hot water extracts. Ethanolic extracts showed moderate scavenging ability on superoxide radicals (46.3–47.0% at 20 mg/mL. Naturally occurring antioxidant components including total phenols (3.60–20.00 mg/g, tocopherols (0.58–11.93 mg/g, flavonoids (0.19–3.52 mg/g and polysaccharides (58.52–547.86 mg/g were found in the extracts. Overall, extracts from cap were more effective for the antioxidant properties assayed.

  18. Isolation of Saprophytic Basidiomycetes from Soil

    OpenAIRE

    Thorn, R.G.; Reddy, C. A.; Harris, D.; Paul, E. A.

    1996-01-01

    A method with the combined advantages of soil particle washing, selective inhibitors, and an indicator substrate was developed to isolate saprophytic basidiomycetes from soil. Organic particles were washed from soil and plated on a medium containing lignin, guaiacol, and benomyl, which reduced mold growth and allowed detection of basidiomycetes producing laccase or peroxidase. The 64 soil samples yielded 67 basidiomycete isolates, representing 51 groups on the basis of morphology and physiolo...

  19. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  20. Some morphological and physiological aspects and cultivation of Coprinus comatus (O. F. Mull.) Gray

    OpenAIRE

    Petcharat, V.; Chaiyama, V; Kritsaneepaiboon, P.

    2007-01-01

    Some morphological and physiological aspects and cultivation of Coprinus comatus (O.F. Mull.) Gray were investigated. Malt extract agar turned out to be the best in supporting the mycelial growth of C.comatus. Mannose and maltose were the best carbon sources in supporting mycelial growth. C. comatus utilized peptone and NH4NO3 better than other nitrogen sources. The optimum temperature and pH on maltextract agar were 25oC and 6, respectively. Light retarded mycelial growth of C. comatus. For ...

  1. Larval distribution pattern of Muraenesox cinereus (Anguilliformes: Muraenesocidae) leptocephali in waters adjacent to Korea

    Science.gov (United States)

    Ji, Hwan-Sung; Kim, Jin-Koo; Oh, Taeg Yun; Choi, Kwang Ho; Choi, Jung Hwa; Seo, Young Il; Lee, Dong Woo

    2015-09-01

    To understand the transport and recruitment processes of the daggertooth pike conger, Muraenesox cinereus, in the marginal seas of East Asia, we investigated the distribution pattern, estimated spawning areas and periods, and recruitment mechanisms of M. cinereus, based on 51 individuals of leptocephali collected from Korean waters during 2010-2014. Back-calculated hatching dates, determined from the daily incremental growth rates of the otoliths, indicated that the spawning period for M. cinereus was during July-September. The size range of M. cinereus leptocephali collected offshore of Jeju Island and southeast of the Korea-Japan intermediate zone was 16.6-20.9 mm TL (age, 18-23 d). We hypothesize that one of the spawning grounds of M. cinereus is located offshore in the East China Sea. In Korean waters, the ages and body lengths of M. cinereus leptocephali increased northward from latitude 31°30'N to 34°40'N, with metamorphosis occurring at latitude 34°40'N. Therefore, we surmised that the hatched preleptocephali of M. cinereus were transported from offshore areas in the East China Sea to Jeju Island and the Korea Strait (KS) by the Kuroshio and Tsushima Warm Current.

  2. Microascus cinereus (Anamorph Scopulariopsis) Brain Abscess in a Bone Marrow Transplant Recipient

    OpenAIRE

    Baddley, John W.; Moser, Stephen A.; Sutton, Deanna A.; Pappas, Peter G.

    2000-01-01

    We report the first documented case of brain abscess due to the dematiaceous fungus Microascus cinereus, an organism common in soil and stored grain. M. cinereus was isolated from brain abscess material from a bone marrow transplant recipient. The patient responded well to treatment by amphotericin B lipid complex, itraconazole, and a craniotomy but later died from secondary complications caused by graft-versus-host disease.

  3. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  4. Biological activities of selected basidiomycetes from Yemen.

    Science.gov (United States)

    Al-Fatimi, M; Schröder, G; Kreisel, H; Lindequist, U

    2013-03-01

    In a previous paper we demonstrated the results of biological screening of Yemeni basidiomycetes. The present study was aimed to investigate the antimicrobial and the antioxidant activity of further basidiomycetes collected in Yemen. Dichloromethane, methanol and aqueous extracts of the fruiting bodies of 25 species were screened in vitro for their antibacterial activities against three Gram-positive bacteria (Staphyloccocus aureus, Bacillus subtilis, Micrococcus flavus) and two Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa), against six human fungal pathogens (Candida albicans, Candida krusei, Aspergillus fumigatus, Mucor sp., Microsporum gypseum, Trichophyton mentagrophytes) and against one non human pathogenic fungus (Candida maltosa). The results indicated that 75 extracts exhibited activity against one or more of the bacteria. The methanol extracts of Agaricus cf. bernardii, Agrocybe pediades, Chlorophyllum molybdites, Coriolopsis polyzona, Ganoderma xylonoides, Pycnoporus sanguineus, Trametes lactinea and Trametes cingulata showed activity against all tested bacteria. The highest antibacterial activity was exhibited by methanol extracts from Chlorophyllum molybdites, Ganoderma xylonoides and Trametes cingulata and Agaricus cf. bernardii, Agrocybe pediades, Coriolopsis polyzona, Pycnoporus sanguineus and Trametes lactinea. The methanol extracts of Chlorophyllum molybdites, Ganoderma xylonoides and Pycnoporus sanguineus showed considerable antifungal activities against the tested fungal strains. Strong antioxidative effects employing the DPPH assay were exhibited by methanol extracts from Chlorophyllum molybdites, Ganoderma xylonoides, Hexagonia velutina, Pycnoporus sanguineus, Trametes lactinea and Trametes cingulata. Our previous and presented studies about 48 basidiomycetes collected in Yemen provide evidence that basidiomycetes from the Arabic region so far should attract more attention as potential source for new biologically active

  5. Lignicolous Basidiomycetes as Valuable Biotechnological Agents

    Directory of Open Access Journals (Sweden)

    Cristiana-Virginia Petre

    2014-10-01

    Full Text Available Lignicolous basidiomycetes are highly specialized organisms that are capable of degrading lignin, one of the most abundant and resistant organic compounds. Through their enzymes and secondary metabolites, these fungi have a great potential that can be successfully used in various biotechnological processes, ranging from mycoremediation of different pollutants and isolation of bioactive molecules with applications in the pharmacological industry and agriculture, as biocontrol agents of phytopathogens.

  6. Some morphological and physiological aspects and cultivation of Coprinus comatus (O. F. Mull. Gray

    Directory of Open Access Journals (Sweden)

    Petcharat, V.

    2007-03-01

    Full Text Available Some morphological and physiological aspects and cultivation of Coprinus comatus (O.F. Mull. Gray were investigated. Malt extract agar turned out to be the best in supporting the mycelial growth of C.comatus. Mannose and maltose were the best carbon sources in supporting mycelial growth. C. comatus utilized peptone and NH4NO3 better than other nitrogen sources. The optimum temperature and pH on maltextract agar were 25oC and 6, respectively. Light retarded mycelial growth of C. comatus. For cultivation, the method of growing mushroom in autoclavable plastic bags was applied. Three different combinations of agricultural products were used for growing C. comatus. The combination ofpararubber sawdust : kapok waste : boiled sorghum seeds (3:3:1 by volume supported higher yields of basidiocarps. Time required for full colonization of the mycelia on 500 gm substrate at room temperature(28-30oC was 20.3 days. After casing with the mixed soil (loam soil : rice husk : cow manure, 2:2:1 the cultivating bags were incubated in the growth chamber at 20oC and 65% relative humidity. Fructificationbegan after 20.6 days of watering, and the average yield obtained was 165.6 g/bag.

  7. [Morphology and structural peculiarities of Basidiomycetes pathogens].

    Science.gov (United States)

    Boĭko, O A; Shevchenko, T P; Boĭko, A A

    2013-01-01

    The materials of studies of morphology and structural peculiarities of viruses, fungi and bacteria, which affect Basidiomycetes under biotechnology process and nature biocenosis conditions are given. The analysis of infection development in button mushroom (Agaricus bisporus) (J.Lge) Imbach and in oyster mushroom (Pleurotus ostreatus Kumm.), which served as model objects in the experiments of various levels of complexity has been carried out. Other kinds of edible and medicinal mushrooms, which were a source of biochemical fractions to form biologicals were investigated. PMID:23866587

  8. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  9. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Avila Arcos, Maria del Carmen; Ishida, Yasuko;

    2012-01-01

    The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in...

  10. Degradation of cellulose by basidiomycetous fungi.

    Science.gov (United States)

    Baldrian, Petr; Valásková, Vendula

    2008-05-01

    Cellulose is the main polymeric component of the plant cell wall, the most abundant polysaccharide on Earth, and an important renewable resource. Basidiomycetous fungi belong to its most potent degraders because many species grow on dead wood or litter, in environment rich in cellulose. Fungal cellulolytic systems differ from the complex cellulolytic systems of bacteria. For the degradation of cellulose, basidiomycetes utilize a set of hydrolytic enzymes typically composed of endoglucanase, cellobiohydrolase and beta-glucosidase. In some species, the absence of cellobiohydrolase is substituted by the production of processive endoglucanases combining the properties of both of these enzymes. In addition, systems producing hydroxyl radicals based on cellobiose dehydrogenase, quinone redox cycling or glycopeptide-based Fenton reaction are involved in the degradation of several plant cell wall components, including cellulose. The complete cellulolytic complex used by a single fungal species is typically composed of more than one of the above mechanisms that contribute to the utilization of cellulose as a source of carbon or energy or degrade it to ensure fast substrate colonization. The efficiency and regulation of cellulose degradation differs among wood-rotting, litter-decomposing, mycorrhizal or plant pathogenic fungi and yeasts due to the different roles of cellulose degradation in the physiology and ecology of the individual groups. PMID:18371173

  11. Basidiomycete cryopreservation on perlite: Evaluation of a new method

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    2006-01-01

    Roč. 52, - (2006), s. 446-453. ISSN 0011-2240 Institutional research plan: CEZ:AV0Z50200510 Keywords : cryopreservation * perlite * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.162, year: 2006

  12. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  13. Survey of Basidiomycets and Insect Infested Roadside Trees

    OpenAIRE

    Oga, Shoji; Nomura, Shuhei; Inoue, Susumu

    1995-01-01

    Some biotic and abiotic factors causal to the deterioration of roadside trees were surveyed in Fukuoka City on 23 species planted along 22 main streets. Various fruit bodies of basidiomycete, imperfect fungi and bacterial canker disease as well as insect pests were detected. Forty-six fungi strains were obtained in this survey. Aphyllophorales basidiomycete was the most abundant fungi found in surveyed raodside trees. Fruit bodies of 7 edible mushroom species were identified on the scaffold l...

  14. Coprinus comatus cap inhibits adipocyte differentiation via regulation of PPARγ and Akt signaling pathway.

    Directory of Open Access Journals (Sweden)

    Hyoung Joon Park

    Full Text Available This study assessed the effects of Coprinus comatus cap (CCC on adipogenesis in 3T3-L1 adipocytes and the effects of CCC on the development of diet-induced obesity in rats. Here, we showed that the CCC has an inhibitory effect on the adipocyte differentiation of 3T3-L1 cells, resulting in a significant decrease in lipid accumulation through the downregulation of several adipocyte specific-transcription factors, including CCAAT/enhancer binding protein β, C/EBPδ, and peroxisome proliferator-activated receptor gamma (PPARγ. Moreover, treatment with CCC during adipocyte differentiation induced a significant down-regulation of PPARγ and adipogenic target genes, including adipocyte protein 2, lipoprotein lipase, and adiponectin. Interestingly, the CCC treatment of the 3T3-L1 adipocytes suppressed the insulin-stimulated Akt and GSK3β phosphorylation, and these effects were stronger in the presence of an inhibitor of Akt phosphorylation, LY294002, suggesting that CCC inhibited adipocyte differentiation through the down-regulation of Akt signaling. In the animal study, CCC administration significantly reduced the body weight and adipose tissue weight of rats fed a high fat diet (HFD and attenuated lipid accumulation in the adipose tissues of the HFD-induced obese rats. The size of the adipocyte in the epididymal fat of the CCC fed rats was significantly smaller than in the HFD rats. CCC treatment significantly reduced the total cholesterol and triglyceride levels in the serum of HFD rats. These results strongly indicated that the CCC-mediated decrease in body weight was due to a reduction in adipose tissue mass. The expression level of PPARγ and phospho-Akt was significantly lower in the CCC-treated HFD rats than that in the HFD obesity rats. These results suggested that CCC inhibited adipocyte differentiation by the down-regulation of major transcription factor involved in the adipogenesis pathway including PPARγ through the regulation of the

  15. Microbial community dynamics and effect of environmental microbial reservoirs on red-backed salamanders (Plethodon cinereus)

    OpenAIRE

    Loudon, Andrew H.; Douglas C Woodhams; Parfrey, Laura Wegener; Archer, Holly; Knight, Rob; McKenzie, Valerie; Harris, Reid N.

    2013-01-01

    Beneficial cutaneous bacteria on amphibians can protect against the lethal disease chytridiomycosis, which has devastated many amphibian species and is caused by the fungus Batrachochytrium dendrobatidis. We describe the diversity of bacteria on red-backed salamanders (Plethodon cinereus) in the wild and the stability of these communities through time in captivity using culture-independent Illumina 16S rRNA gene sequencing. After field sampling, salamanders were housed with soil from the fiel...

  16. A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity

    OpenAIRE

    Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J.; Eldridge, Mark DB; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R.; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N.; Timms, Peter

    2014-01-01

    Background The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. Results RNA-Seq data was ge...

  17. Study on High-yield Cultivation Techniques of Coprinus comatus%鸡腿菇高产栽培技术研究

    Institute of Scientific and Technical Information of China (English)

    张荣

    2014-01-01

    Coprinus comatus is a kind of rare edible fungus with high health care value of nutrition,wide market prospects. Cultivation of Coprinus comatus should suit one's measures to local conditions,combined with local conditions,in this experiment,the new cultivation technology of Coprinus comatus was studied mainly from the several aspects,variety selection,prescription of raw materials,cultivation mode. The re-sults show that:the strains of Coprinus comatus Tebai-33 and Tebai-39 have high yield,good quality,suit-able for cultivation and promotion in Anqing. On the prescriptions of culture material,using part of straw instead of cotton seed hull for the Coprinus comatus cultivation can make full use of local rich straw re-sources,lower production costs and at the same time raise economic benefits. In the cultivation mode,the plastic frame planting mode is better than the outdoor plastic bags planting mode,is the future develop-ment direction of Coprinus comatus cultivation.%鸡腿菇是一种营养保健价值较高、市场前景广阔的珍稀食用菌。该试验主要从品种选择、原料配方、栽培模式几个方面研究了鸡腿菇栽培新技术。结果表明:鸡腿菇菌株特白33和特白39产量高,品质优,适合在安庆地区栽培推广。在栽培配方上,用部分稻草代替棉子壳栽培鸡腿菇,可充份利用当地丰富的稻草资源,降低生产成本,增加经济效益。在栽培模式上,室内箱栽模式优于室外袋栽模式,是鸡腿菇栽培的未来发展方向。

  18. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  19. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described. PMID:19341364

  20. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  1. A redescription of grey pomfret Pampus cinereus (Bloch,1795) with the designation of a neotype (Teleostei:Stromateidae)

    Institute of Scientific and Technical Information of China (English)

    LIU Jing; LI Chunsheng; NING Ping

    2013-01-01

    Pampus cinereus (Bloch,1795) (Stromateidae),a species believed to be widely distributed throughout the Indo-Western Pacific region,was redescribed and a neotype was designated.The designation of a neotype was necessary because of ambiguous data in Bloch's original description and the loss of the original type specimen.Morphological data indicated that 10 recently-collected specimens from the coasts of southern China agreed well with Bloch's original description and figure ofP.cinereus.A neotype for this species was selected from among the 10 specimens,and a detailed description is presented in this paper.

  2. Degradation of humic acids by letter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Trögl, Josef; Steffen, K.; Heeg, K.; Hofrichter, M.; Baldrian, Petr

    Praha: ČSSM, 2007, s. 105-108. [Kongres Československé společnosti mikrobiologické /24./. Liberec (CZ), 02.10.2007-05.10.2007] R&D Projects: GA ČR GA526/05/0168 Institutional research plan: CEZ:AV0Z50200510 Keywords : saprotrophic basidiomycetes Subject RIV: EE - Microbiology, Virology

  3. Oxidases and peroxidases of saprotrophic basidiomycetes decomposing leaf litter

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Bittner, B.; Šnajdr, Jaroslav; Hofrichter, M.; Baldrian, Petr

    Barcelona : Verlag, 2007, s. 15-15. [COST Action 868 – Biotechnical functionalisation of renewable polymeric materials. Sitges (ES), 14.04.2007-17.04.2007] R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes Subject RIV: EE - Microbiology, Virology

  4. Enzyme Profiles of Basidiomycete Strains Growing on Different Wood Substrates

    Czech Academy of Sciences Publication Activity Database

    Nerud, František; Homolka, Ladislav; Lisá, Ludmila

    Riga : Riga centre, 2007, s. 44-44. [International conference Biodeterioration of Wood and Wood Products. Riga (LT), 26.09.2007-29.09.2007] R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete Subject RIV: EE - Microbiology, Virology

  5. The correct citation and spelling of Ptiliogonys and type locality of Ptiliogonys cinereus

    Science.gov (United States)

    Browning, M. Ralph

    1989-01-01

    William Swainson published descriptions and illustrations of many new forms of New World birds. In some of his earlier papers, Swainson cited his own works (of which only some parts have been published) as well as some manuscripts that were never published (see McMillan 1971). Swainson also referred to works that were published later under different titles. For example, Swainson (1827a) listed several names of birds and cited his "Mexican Zoology," a work that was never published. Later he (Swainson 1831-1832) referred to the "Cat. of Mex. Mus. App. p. 4 (1824)," in which he claimed to have described the taxa he had listed in Swainson (1827a). Modern authorities (e.g. Greenway 1960: 371; American Ornithologists' Union [AOU] 1983: 582) refer to the 1824 source as the original publication for the genus they render as Ptilogonys and (AOU 1983) for the species Ptilogonys cinereus. However, there is no evidence that the 1824 work was ever seen as a manuscript or published. In this paper, I review the use of "Swainson, 1824," as a citation and discuss the actual publication, spelling of the names Ptiliogonys and Ptiliogonys cinereus, and type locality of the species.

  6. Calibrating abundance indices with population size estimators of red back salamanders (Plethodon cinereus in a New England forest

    Directory of Open Access Journals (Sweden)

    Ahmed A. Siddig

    2015-05-01

    Full Text Available Herpetologists and conservation biologists frequently use convenient and cost-effective, but less accurate, abundance indices (e.g., number of individuals collected under artificial cover boards or during natural objects surveys in lieu of more accurate, but costly and destructive, population size estimators to detect and monitor size, state, and trends of amphibian populations. Although there are advantages and disadvantages to each approach, reliable use of abundance indices requires that they be calibrated with accurate population estimators. Such calibrations, however, are rare. The red back salamander, Plethodon cinereus, is an ecologically useful indicator species of forest dynamics, and accurate calibration of indices of salamander abundance could increase the reliability of abundance indices used in monitoring programs. We calibrated abundance indices derived from surveys of P. cinereus under artificial cover boards or natural objects with a more accurate estimator of their population size in a New England forest. Average densities/m2 and capture probabilities of P. cinereus under natural objects or cover boards in independent, replicate sites at the Harvard Forest (Petersham, Massachusetts, USA were similar in stands dominated by Tsuga canadensis (eastern hemlock and deciduous hardwood species (predominantly Quercus rubra [red oak] and Acer rubrum [red maple]. The abundance index based on salamanders surveyed under natural objects was significantly associated with density estimates of P. cinereus derived from depletion (removal surveys, but underestimated true density by 50%. In contrast, the abundance index based on cover-board surveys overestimated true density by a factor of 8 and the association between the cover-board index and the density estimates was not statistically significant. We conclude that when calibrated and used appropriately, some abundance indices may provide cost-effective and reliable measures of P. cinereus

  7. A New Subspecies Identification and Population Study of the Asian Small-Clawed Otter (Aonyx cinereus in Malay Peninsula and Southern Thailand Based on Fecal DNA Method

    Directory of Open Access Journals (Sweden)

    M. K. A. Rosli

    2014-01-01

    Full Text Available Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  8. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    proteins. Several TCS proteins are highly conserved among all the basidiomycetes, and other TCS proteins appear to be specific to particular species of basidiomycetes. Moreover, some species appear to have developed a unique histidine kinase group with unusual domain architecture, the Dual-histidine...

  9. Development of novel fermentation systems for the production of nonalcoholic beverages with basidiomycetes

    OpenAIRE

    Zhang, Yanyan

    2015-01-01

    Basidiomycetes represent the highest developed class of fungi. They are able to synthesize pharmacological relevant secondary metabolites, natural flavor compounds, and highly sought after enzymes. Because of their biochemical potential, basidiomycetes are ideal tools for the food industry. With the recent worldwide declining consumption of beer, breweries are eagerly searching for innovative nonalcoholic fermented beverages to compensate for this negative trend. Different from microorgan...

  10. 鸡腿菇液体菌种的制备及应用%Study on the Preparation of Liquid Spawn and Application of Coprinus comatus

    Institute of Scientific and Technical Information of China (English)

    聂建军; 李彩萍; 杨玉画; 李兆斌

    2011-01-01

    The edible fungus liquid spawn has the advantages of short production cycle, consistent bacteria age, vital exuberant, easy inoculation with less seeds, low bacteria contamination, and rapid growth after inoculation. This test used solid-state-special seeds for the preparation of liquid spawn of Coprinus comatus and the cultivation experiment was done. Results showed that cultivation of Coprinus comatus species, compared to the solid, liquid spawn contamination rate could decrease by 4 per cent, and biological conversion rate increase by 10 per cent.%食用菌液体菌种具有生产周期短、菌龄一致、生命力旺盛、接种方便、用种量少、染菌率低、接种后生长迅速等优点.试验采用固态专用菌种制备鸡腿菇液体菌种并进行栽培试验,结果表明,与同体菌种栽培鸡腿菇相比,制得的液体菌种栽培的鸡腿菇杂菌感染率可降低4百分点,生物转化率提高10百分点.

  11. Identification, characterisation and expression analysis of natural killer receptor genes in Chlamydia pecorum infected koalas (Phascolarctos cinereus)

    OpenAIRE

    Morris, Katrina M.; Mathew, Marina; Waugh, Courtney; Ujvari, Beata; Timms, Peter; Polkinghorne, Adam; Belov, Katherine

    2015-01-01

    Background Koalas (Phascolarctos cinereus), an iconic Australian marsupial, are being heavily impacted by the spread of Chlamydia pecorum, an obligate intracellular bacterial pathogen. Koalas vary in their response to this pathogen, with some showing no symptoms, while others suffer severe symptoms leading to infertility, blindness or death. Little is known about the pathology of this disease and the immune response against it in this host. Studies have demonstrated that natural killer (NK) c...

  12. The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus

    Directory of Open Access Journals (Sweden)

    Niewiarowski Peter H

    2006-07-01

    Full Text Available Abstract Background In eastern North America two common colour morphs exist in most populations of redback salamanders (Plethodon cinereus. Previous studies have indicated that the different morphs may be adapted to different thermal niches and the morphological variation has been linked to standard metabolic rate at 15°C in one population of P. cinereus. It has therefore been hypothesized that a correlated response to selection on metabolic rate across thermal niches maintains the colour polymorphism in P. cinereus. This study tests that hypothesis. Results We found that the two colour morphs do sometimes differ in their maintenance metabolic rate (MMR profiles, but that the pattern is not consistent across populations or seasons. We also found that when MMR profiles differ between morphs those differences do not indicate that distinct niches exist. Field censuses showed that the two colour morphs are sometimes found at different substrate temperatures and that this difference is also dependent on census location and season. Conclusion While these morphs sometimes differ in their maintenance energy expenditures, the differences in MMR profile in this study are not consistent with maintenance of the polymorphism via a simple correlated response to selection across multiple niches. When present, differences in MMR profile do not indicate the existence of multiple thermal niches that consistently mirror colour polymorphism. We suggest that while a relationship between colour morph and thermal niche selection appears to exist it is neither simple nor consistent.

  13. Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher Basidiomycetes mushrooms.

    Science.gov (United States)

    Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P

    2014-01-01

    This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources

  14. Toxicological responses of red-backed salamanders (Plethodon cinereus) to soil exposures of copper.

    Science.gov (United States)

    Bazar, Matthew A; Quinn, Michael J; Mozzachio, Kristie; Bleiler, John A; Archer, Christine R; Phillips, Carlton T; Johnson, Mark S

    2009-07-01

    Copper (Cu) has widespread military use in munitions and small arms, particularly as a protective jacket for lead projectiles. The distribution of Cu at many US military sites is substantial and sites of contamination include habitats in and around military storage facilities, manufacturing, load and packing plants, open burning/open detonation areas, and firing ranges. Some of these areas include habitat for amphibian species, which generally lack toxicity data for risk assessment purposes. In an effort to ascertain Cu concentrations in soil that are toxic to terrestrial amphibians, 100 red-backed salamanders (Plethodon cinereus) were randomly sorted by weight, assigned to either a control soil or one of four treatments amended with copper acetate in soil, and exposed for 28 days. Analytical mean soil concentrations were 18, 283, 803, 1333, and 2700 mg Cu/kg soil dry weight. Food consisted of uncontaminated flightless Drosophila melanogaster. Survival was reduced in salamanders exposed to 1333 and 2700 mg/kg by 55% and 100%, respectively. Mortality/morbidity occurred within the first 4 days of exposure. These data suggest that a Cu soil concentration of and exceeding 1333.3 +/- 120.2 mg/kg results in reduced survival, whereas hematology analyses suggest that a concentration of and exceeding 803.3 +/- 98.4 mg/kg might result in reduced total white blood cell count. No effects were observed at 283.3 +/- 36.7 mg/kg. PMID:18825446

  15. Memory of conspecifics in male salamanders Plethodon cinereus: Implications for territorial defense

    Institute of Scientific and Technical Information of China (English)

    Nancy R.KOHN; Jennifer M.DEITLOFF; Schuyler F.DARTEZ; Michelle M.WILCOX; Robert G.JAEGER

    2013-01-01

    We investigated how exposure duration (time that two individuals initially interact) and separation interval (time between the initial interaction and a subsequent interaction) affect recognition memory of conspecifics in male red-backed salamanders Plethodon cinereus.Previous studies have demonstrated that this species aggressively defends territories.We recorded aggressive behavior to assess recognition memory,because aggression is more intense toward previously unencountered individuals compared to previously encountered individuals in this species.We found that with 15-min exposures and 5-day separation intervals,focal males did not spend significantly more time threatening ‘unfamiliar' intruders than ‘familiar' intruders.After either 8-hour exposures and 5-day separation intervals and 5-day exposures and 5-day separation intervals,focal males spent significantly more time threatening unfamiliar intruders than familiar intruders.These results suggest that male red-backed salamanders can remember familiar conspecifics (e.g.,territorial neighbors) after at least an 8-hour exposure duration and that memory persists at least as long as 5 days.After 5-day exposure and 15-day separation intervals,we found no significant difference in aggressive behavior toward familiar and unfamiliar intruders.Long separation intervals (15 days) may lead either to loss of memory of previously familiar individuals or,alternatively,aggressive reassessment of individuals as only a change in behavior indicates positively that memory has occurred.Thus,variance in territorial defense within an individual may depend on its ability to recognize conspecific males.

  16. Foraging range movements of the endangered Hawaiian hoary bat, Lasiurus cinereus semotus (Chiroptera: Vespertilionidae)

    Science.gov (United States)

    Bonaccorso, Frank J.; Todd, Christopher M.; Miles, Adam C.; Gorresen, P. Marcos

    2015-01-01

    We documented nightly movements of Hawaiian hoary bats (Lasiurus cinereus semotus) on the island of Hawai’i. Based on data from 28 radiotagged individuals mean foraging range (FR) was 230.7±72.3 ha, core-use area (CUA) was 25.5±6.9 ha (or 11.1% of mean FR), and the mean long axis (LAX) across the FR was 3,390.8±754.3 m. There was almost no overlap in CUAs among 4 adult males having overlapping foraging areas and tracked simultaneously or within a 90-day window of each other. CUAs of subadults partially overlapped with multiple adult males or with one other subadult. High variance in FRs, cores use areas, and LAX across the FR perhaps reflect localized stochastic variables such as weather, habitat, and food resources. Hawaiian hoary bats use moderately large FRs among insectivorous bats studied with comparable methodologies; however, foraging activity indicated by documentation of acoustic feeding buzzes is concentrated within one or a few disjunct areas cumulatively forming the 50% fixed kernel of CUA. The concentration of feeding activity, low values of individual overlap, and agonistic chasing behavior within CUAs all demonstrate a structured use of individual space by Hawaiian hoary bats.

  17. Insect prey eaten by Hoary Bats (Lasiurus cinereus) prior to fatal collisions with wind turbines

    Science.gov (United States)

    Valdez, Ernest W.; Cryan, Paul M.

    2013-01-01

    Wind turbines are being deployed all across the world to meet the growing demand for energy, and in many areas, these turbines are causing the deaths of insectivorous migratory bats. One of the hypothesized causes of bat susceptibility is that bats are attracted to insects on or near the turbines. We examined insect remains in the stomachs and intestines of hoary bats (Lasiurus cinereus) found dead beneath wind turbines in New York and Texas to evaluate the hypothesis that bats die while feeding at turbines. Most of the bats we examined had full stomachs, indicating that they fed in the minutes to hours leading up to their deaths. However, we did not find prey in the mouths or throats of any bats that would indicate the bats died while capturing prey. Hoary bats fed mostly on moths, but we also detected the regular presence of beetles, true bugs, and crickets. Presence of terrestrial insects in stomachs indicates that bats may have gleaned them from the ground or the turbine surfaces, yet aerial capture of winged insect stages cannot be ruled out. Our findings confirm earlier studies that indicate hoary bats feed during migration and eat mostly moths. Future studies on bat behaviors and insect presence at wind turbines could help determine whether feeding at turbines is a major fatality risk for bats.

  18. Food habits of the hoary bat (LASIURUS CINEREUS) during spring migration through new mexico

    Science.gov (United States)

    Valdez, E.W.; Cryan, P.M.

    2009-01-01

    Hoary bats (Lasiums cinernis) exhibit continental patterns of migration that are unique to bats, but details about their behaviors during migration are lacking. We captured 177 hoary bats in spring and early summer 2002 as individuals migrated through the Sandia Mountains of north-central New Mexico. Our results support earlier observations of asynchronous timing of migration between sexes of L. cinernis during spring, with females preceding males by ca. 1 month. We provide the first evidence that hoary bats may travel in dispersed groups, fly below the tree canopy along streams, and feed while migrating during spring. Analysis of guano revealed that diet of L. cinereus consisted mostly of moths, with more than one-half of samples identified as Noctuidae and Geometridae. We observed a late-spring decline in consumption of moths that might be related to seasonal changes in abundance of prey, differential selection of prey by bats, or sampling bias. We suspect that spring migration of L. cinernis through New Mexico temporally coincides with the seasonal abundance of moths.

  19. Complete mitochondrial genome of Grey-headed Lapwing Vanellus cinereus (Ciconiiformes: Charadriidae).

    Science.gov (United States)

    She, Huishang; Zhao, Guanghong; Zhou, Lizhi; Gu, Changming

    2016-09-01

    The Grey-headed Lapwing (Vanellus cinereus) is a Vanellus bird belonging to the group Ciconiiformes, which breeds in northeast China and Japan. In this study, we sequenced its complete mitochondrial genome by PCR-based method. The mitochondrial DNA is packaged in a compact 17,135 based pair (bp) circular molecule with A + T content of 55.14%. It contains 37 typical mitochondrial genes, including 13 protein-coding genes, 2 rRNAs and 22 tRNAs and a non-coding control region (D-loop). All protein-coding genes are initiated by ATG codon, except for the COI gene and ND5 gene starting with GTG codon, and ND3 uses ATC codon. TAA is the most frequent stop codon. All tRNAs possess the classic cloverleaf secondary structure except for tRNA(Ser(AGY)) and tRNA(Leu(CUN)), which lack the ''DHU'' stem. The D-loop is a 1563 bp long A + T-rich region, which is located between tRNA(Glu) and tRNA(Phe). PMID:25758042

  20. Note on the Giant Woolly Gliding Squirrel Eupetaurus cinereus (Mammalia: Rodentia: Sciuridae in northern Pakistan

    Directory of Open Access Journals (Sweden)

    Jaffar Ud Din

    2015-07-01

    Full Text Available The Woolly Gliding Squirrel Eupetaurus cinereus is an extremely rare, localized, and endangered mammal and may constitute one of the endemic species of Pakistan. The species was rediscovered in northern Pakistan in the mid-1990s after a 70-year absence of records. All the previous information regarding this giant squirrel was limited to museum specimens, collected mostly from areas presently in northern Pakistan in the late 1800s. Sighting of the species is extremely challenging owing to its nocturnal behavior, low densities and the inhospitable terrain it is reported from. Here we report detailed information about the species collected during the rescue of a young male individual from Gilgit City followed by its successful release in its natural habitat. We report that the species is still facing human-induced threats and may disappear from the mountains of northern Pakistan if informed management measures are not taken. Moreover, the occurrence of the species outside its core distribution range, i.e., districts Gilgit and Diamer, still remains questionable; therefore, it is recommended that further in-depth research studies be undertaken to determine the status of the species across the entire reported range. 

  1. Viability of Basidiomycete Strains after Cryopreservation: Compatison of Ewo Different Freezing Protocols

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    2003-01-01

    Roč. 48, č. 2 (2003), s. 219-226. ISSN 0015-5632 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycete strains * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.857, year: 2003

  2. Сultivation Features of Higher Basidiomycetes Trametes zonatus for Liquid Medium

    OpenAIRE

    Тітова, Лариса Олександрівна; Клечак, Інна Рішардівна

    2016-01-01

    Background. The basidiomycetes T. zonatus are producers and cellulose oxidative enzymes and polysaccharides with antitumor activity. The feasibility of this study is that the creation of functional food biotechnology from strains of biomass from domestic collections is not enough initial data: fragmentary data on cultivation conditions and culture medium composition, biochemical biomass of T. zonatus.Оbjective. The aim of the study is to conduct screening of basidiomycetes strains T. zonatus ...

  3. Gene knockdown by ihpRNA-triggering in the ectomycorrhizal basidiomycete fungus Laccaria bicolor

    OpenAIRE

    Kemppainen, Minna J.; Pardo, Alejandro G.

    2010-01-01

    Ectomycorrhiza (ECM) is a mutualistic association between fungi and the roots of the vast majority of trees. These include numerous ecologically and economically relevant species and the participating fungal symbionts are predominantly filamentous basidiomycetes. In natural ecosystems the plant nutrient uptake from soil takes place via the extraradical mycelia of these ECM mycosimbionts as a trade for plant photosyntates. The symbiotic phase in the life cycle of ECM basidiomycetes is the dika...

  4. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Science.gov (United States)

    David-Palma, Márcia; Sampaio, José Paulo; Gonçalves, Paula

    2016-06-01

    In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R) and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD) transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism will benefit from

  5. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Directory of Open Access Journals (Sweden)

    Márcia David-Palma

    2016-06-01

    Full Text Available In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism

  6. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    OpenAIRE

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant ...

  7. Serum Antibody Response to Koala Retrovirus Antigens Varies in Free-Ranging Koalas ( Phascolarctos cinereus ) in Australia: Implications for Vaccine Design.

    Science.gov (United States)

    Waugh, Courtney; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2016-04-28

    Little is known about the immune response in the koala ( Phascolarctos cinereus ) to its retroviruses. Koala retroviruses (KoRVs) have been linked to neoplasia in wild and captive koalas, but there is no treatment available. We tested the KoRV-specific serum immunoglobulin G antibody response in nonimmunized and immunized koalas. PMID:27054470

  8. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  9. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  10. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  11. Subcutaneous abscess due to the basidiomycete Phellinus mori in a patient with chronic granulomatous disease.

    Science.gov (United States)

    Shigemura, T; Nakazawa, Y; Amano, Y; Sudo, A; Watanabe, M; Kobayashi, M; Kobayashi, N; Koike, K; Agematsu, K; Nishimura, K

    2015-06-01

    Chronic granulomatous disease (CGD), a primary immunodeficiency caused by impaired phagocyte killing of intracellular pathogens, is characterized by recurrent, life-threatening, bacterial and fungal infections. As a result of improvements in microbiologic culture and identification techniques, a number of unique filamentous fungi have been reported as significant pathogens in patients with CGD. We report a case of subcutaneous basidiomycete Phellinus mori infection in a patient with CGD. To the best of our knowledge, this is the first reported case of human infection by this fungus. The causative fungus was identified on the basis of its morphological characteristics and nucleotide sequence on the internal transcribed spacer region of the ribosomal RNA gene. This is the fifth case report of filamentous basidiomycetes infecting a patient with CGD; all of these cases have been caused by Phellinus species. We highlight the importance of recognizing filamentous basidiomycetes Phellinus species as possible agents of non-Aspergillus fungal infections in patients with CGD. PMID:25600930

  12. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  13. A five-year study of Hawaiian hoary bat (Lasiurus cinereus semotus) occupancy on the island of Hawai`i

    Science.gov (United States)

    Gorressen, Marcos P.; Bonaccorso, Frank J.; Pinzari, Corinna A.; Todd, Christopher M.; Montoya-Aiona, Kristina; Brinck, Kevin W.

    2013-01-01

    Using acoustic recordings of the vocalizations of the endangered Hawaiian hoary bat (Lasiurus cinereus semotus) collected over a five-year period (2007–2011) from 25 survey areas across the island of Hawai`i, we modeled the relationship between habitat attributes and bat occurrence. Our data support the conclusion that hoary bats concentrate in the coastal lowlands of Hawai`i during the breeding season, May through October, and migrate to interior highlands during the winter non-breeding season. Highest occupancy peaked on the Julian date 15 September across the five-year average and during the season of fledging by the young of the year. Although the Hawaiian hoary bat is a habitat generalist species and occurs from sea level to the highest volcanic peaks on Hawai`i, there was a significant association between

  14. Saprotrophic basidiomycetes from temperate oak (Quercus petraea) forest soil: degradation of soil organic matter

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Cajthaml, Tomáš; Merhautová, Věra; Baldrian, Petr

    Vienna: Verlag, 2006, A141-A141. [International Symposium on Microbial Ecology – ISME-11 /11./. Vienna (AT), 20.08.2006-25.08.2006] R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * forest soil * saprotrophic fungi Subject RIV: EE - Microbiology, Virology

  15. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  16. Distribution of Brown Blotch Bacteria in Wild and Cultivated Species of Basidiomycetes

    OpenAIRE

    Bessette, Alan E.

    1984-01-01

    Wild and cultivated Basidiomycetes species were cultured to determine the distribution of bacteria causing brown blotch disease of Agaricus bisporus. Colonies from each basidiocarp were screened for brown blotch organisms by the white line and host pathogenicity tests. Isolates causing brown blotch were identified as Pseudomonas tolaasi and an Arthrobacter species.

  17. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  18. A Record of Small-Clawed Otters (Aonyx cinereus) Foraging on an Invasive Pest Species, Golden Apple Snails (Pomacea canaliculata) in a West Sumatra Rice Field

    OpenAIRE

    Jabang; Wilson Novarino; Aadrean

    2011-01-01

    A small-clawed otter (Aonyx cinereus) survey in West Sumatran rice fields was conducted from April to September 2010. During this survey, golden apple snail (Pomacea canaliculata) shell remains were found on a rice field bank as suspected prey remains of small-clawed otters. This suspicion was later proved by the occurrence of snail material (pieces of operculum and shell) in otter spraints. This is the first evidence of small-clawed otters foraging on this invasive pest species. Characterist...

  19. Metabolic pathways of biotransformation and biosynthesis of aromatic compounds for the flavour industry by the basidiomycete Pycnoporus cinnabarinus

    OpenAIRE

    Asther, Marcel; Lomascolo, A.; Asther, M.; Moukha, S.; Lesage-Meessen, L.

    1998-01-01

    Among filamentous fungi, white-rot Basidiomycetes have become a strategic group to generate industrial aromatic flavours. In the course of a basidiomycete screening, the biotechnological potential of #Pycnoporus cinnabarinus$ strains was studied in order to produce, by transformation or de novo, natural aromatic flavours in liquid cultures. Ferulic acid and L-phenylalanine were found to be suitable substrates for vanillin and benzaldehyde (bitter almond aroma) production, respectively. These ...

  20. Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi.

    OpenAIRE

    Bakkeren, G; Kronstad, J. W.

    1994-01-01

    Sexual compatibility requires self vs. non-self recognition. Genetically, two compatibility or mating-type systems govern recognition in heterothallic basidiomycete fungi such as the edible and woodrotting mushrooms and the economically important rust and smut phytopathogens. A bipolar system is defined by a single genetic locus (MAT) that can have two or multiple alleles. A tetrapolar system has two loci, each with two or more specificities. We have employed two species from the genus Ustila...

  1. Mating System and Basidiospore Formation in the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Alic, Margaret; Letzring, Celia; Gold, Michael H.

    1987-01-01

    Prototrophic strains recovered from crosses between auxotrophic strains of the lignin-degrading basidiomycete Phanerochaete chrysosporium were induced to fruit. The progeny of most of these self-crosses were prototrophic, indicating that the nuclei of the original prototroph were wild-type recombinants rather than complementary heterokaryons and that the binucleate basidiospores of this organism are homokaryotic. Various wild-type strains were shown to have multinucleate cells lacking clamp c...

  2. Patterns of Repeat-Induced Point Mutation in Transposable Elements of Basidiomycete Fungi

    OpenAIRE

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E.

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-...

  3. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    OpenAIRE

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree...

  4. Iron-Binding Compounds Produced by Wood-Decaying Basidiomycetes

    OpenAIRE

    Fekete, Frank A.; Chandhoke, Vikas; Jellison, Jody

    1989-01-01

    The chrome azurol-S universal siderophore assay and the rapid paper electrophoresis siderophore assay were used to screen 10 wood-decaying basidiomycete isolates for the formation of iron-chelating compounds. All 10 isolates were positive for chrome azurol-S reactivity on solid plating medium and in liquid cultures, and 9 of the 10 isolates produced fluorescent iron-binding compounds in the paper electrophoresis assay.

  5. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing basidiomycetes strains

    OpenAIRE

    Moreira Neto, S. L.; Solange I. Mussatto; Machado, K. M. G.; Milagres, Adriane M. F.

    2013-01-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Ciba...

  6. Decolorization of Several Polymeric Dyes by the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Glenn, Jeffrey K.; Michael H Gold

    1983-01-01

    The polymeric dyes Poly B-411, Poly R-481, and Poly Y-606 were examined as possible alternatives to the radiolabeled lignin previously used as a substrate in lignin biodegradation assays. Like lignin degradation, the decolorization of these dyes by the white rot basidiomycete Phanerochaete chrysosporium occurred during secondary metabolism, was suppressed in cultures grown in the presence of high levels of nitrogen, and was strongly dependent on the oxygen concentration in the cultures. A var...

  7. Basidiomycete DyPs: Genomic diversity, structural–functional aspects, reaction mechanism and environmental significance

    OpenAIRE

    Linde, Dolores; Ruiz-Dueñas, Francisco J.; Fernandez-Fueyo, Elena; Guallar, Víctor; Hammel, Kenneth E.; Pogni, Rebecca; Martínez, Angel T.

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes...

  8. A Record of Small-Clawed Otters (Aonyx cinereus Foraging on an Invasive Pest Species, Golden Apple Snails (Pomacea canaliculata in a West Sumatra Rice Field

    Directory of Open Access Journals (Sweden)

    Jabang

    2011-01-01

    Full Text Available A small-clawed otter (Aonyx cinereus survey in West Sumatran rice fields was conducted from April to September 2010. During this survey, golden apple snail (Pomacea canaliculata shell remains were found on a rice field bank as suspected prey remains of small-clawed otters. This suspicion was later proved by the occurrence of snail material (pieces of operculum and shell in otter spraints. This is the first evidence of small-clawed otters foraging on this invasive pest species. Characteristics of the shell remains and spraints are described.

  9. Characterisation of CD4 T cells in healthy and diseased koalas (Phascolarctos cinereus) using cell-type-specific monoclonal antibodies.

    Science.gov (United States)

    Mangar, Chandan; Armitage, Charles W; Timms, Peter; Corcoran, Lynn M; Beagley, Kenneth W

    2016-07-01

    The koala (Phascolarctos cinereus) is an arboreal herbivorous marsupial that is an Australian icon. Koalas in many parts of Australia are under multiple threats including habitat destruction, dog attacks, vehicular accidents, and infectious diseases such as Chlamydia spp. and the koala retrovirus (KoRV), which may contribute to the incidence of lymphoma and leukaemia in this species. Due to a lack of koala-specific immune reagents and assays there is currently no way to adequately analyse the immune response in healthy, diseased or vaccinated animals. This paper reports the production and characterisation of the first anti-koala CD4 monoclonal antibody (mAb). The koala CD4 gene was identified and used to develop recombinant proteins for mAb production. Fluorochrome-conjugated anti-CD4 mAb was used to measure the levels of CD4(+) lymphocytes collected from koala spleens (41.1%, range 20-45.1%) lymph nodes (36.3%, range 19-55.9%) and peripheral blood (23.8%, range 17.3-35%) by flow cytometry. Biotin-conjugated anti-CD4 mAb was used for western blot to determine an approximate size of 52 kDa for the koala CD4 molecule and used in immunohistochemistry to identify CD4(+) cells in the paracortical region and germinal centres of spleen and lymph nodes. Using the anti-CD4 mab we showed that CD4 cells from vaccinated, but not control, koalas proliferated following in vitro stimulation with UV-inactivated Chlamydia pecorum and recombinant chlamydial antigens. Since CD4(+) T cells have been shown to play a pivotal role in clearing chlamydial infection in both human and mouse infections, using this novel antibody will help determine the role CD4(+) T cells play in protection against chlamydial infection in koalas and also enhance our knowledge of how KoRV affects the koala immune system. PMID:26905635

  10. Winter distribution and use of high elevation caves as foraging sites by the endangered Hawaiian hoary bat, Lasiurus cinereus semotus

    Science.gov (United States)

    Bonaccorso, Frank; Montoya-Aiona, Kristina; Pinzari, Corinna A.; Todd, Christopher M.

    2016-01-01

    We examine altitudinal movements involving unusual use of caves by Hawaiian hoary bats, Lasiurus cinereus semotus, during winter and spring in the Mauna Loa Forest Reserve (MLFR), Hawai‘i Island. Acoustic detection of hoary bat vocalizations, were recorded with regularity outside 13 lava tube cave entrances situated between 2,200 to 3,600 m asl from November 2012 to April 2013. Vocalizations were most numerous in November and December with the number of call events and echolocation pulses decreasing through the following months. Bat activity was positively correlated with air temperature and negatively correlated with wind speed. Visual searches found no evidence of hibernacula nor do Hawaiian hoary bats appear to shelter by day in these caves. Nevertheless, bats fly deep into caves as evidenced by numerous carcasses found in cave interiors. The occurrence of feeding buzzes around cave entrances and visual observations of bats flying in acrobatic fashion in cave interiors point to the use of these spaces as foraging sites. Peridroma moth species (Noctuidae), the only abundant nocturnal, flying insect sheltering in large numbers in rock rubble and on cave walls in the MLFR, apparently serve as the principal prey attracting hoary bats during winter to lava tube caves in the upper MLFR. Caves above 3,000 m on Mauna Loa harbor temperatures suitable for Pseudogymnoascus destructansfungi, the causative agent of White-nose Syndrome that is highly lethal to some species of North American cave-dwelling bats. We discuss the potential for White-nose Syndrome to establish and affect Hawaiian hoary bats.

  11. Identification of unusual Chlamydia pecorum genotypes in Victorian koalas (Phascolarctos cinereus) and clinical variables associated with infection.

    Science.gov (United States)

    Legione, Alistair R; Patterson, Jade L S; Whiteley, Pam L; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Polkinghorne, Adam; Devlin, Joanne M; Sansom, Fiona M

    2016-05-01

    Chlamydia pecorum infection is a threat to the health of free-ranging koalas (Phascolarctos cinereus) in Australia. Utilizing an extensive sample archive we determined the prevalence of C. pecorum in koalas within six regions of Victoria, Australia. The ompA genotypes of the detected C. pecorum were characterized to better understand the epidemiology of this pathogen in Victorian koalas. Despite many studies in northern Australia (i.e. Queensland and New South Wales), prior Chlamydia studies in Victorian koalas are limited. We detected C. pecorum in 125/820 (15 %) urogenital swabs, but in only one ocular swab. Nucleotide sequencing of the molecular marker C. pecorum ompA revealed that the majority (90/114) of C. pecorum samples typed were genotype B. This genotype has not been reported in northern koalas. In general, Chlamydia infection in Victorian koalas is associated with milder clinical signs compared with infection in koalas in northern populations. Although disease pathogenesis is likely to be multifactorial, the high prevalence of genotype B in Victoria may suggest it is less pathogenic. All but three koalas had C. pecorum genotypes unique to southern koala populations (i.e. Victoria and South Australia). These included a novel C. pecorum ompA genotype and two genotypes associated with livestock. Regression analysis determined that significant factors for the presence of C. pecorum infection were sex and geographical location. The presence of 'wet bottom' in males and the presence of reproductive tract pathology in females were significantly associated with C. pecorum infection, suggesting variation in clinical disease manifestations between sexes. PMID:26932792

  12. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. PMID:25637654

  13. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  14. Purification and Characterization of a Trehalose Synthase from the Basidiomycete Grifola frondosa

    OpenAIRE

    Saito, Koki; Kase, Toshiya; Takahashi, Eiichi; Takahashi, Eisaku; Horinouchi, Sueharu

    1998-01-01

    A trehalose synthase (TSase) that catalyzes the synthesis of trehalose from d-glucose and α-d-glucose 1-phosphate (α-d-glucose 1-P) was detected in a basidiomycete, Grifola frondosa. TSase was purified 106-fold to homogeneity with 36% recovery by ammonium sulfate precipitation and several steps of column chromatography. The native enzyme appears to be a dimer since it has apparent molecular masses of 120 kDa, as determined by gel filtration column chromatography, and 60 kDa, as determined by ...

  15. Lignin-Modifying Enzymes of Flavodon flavus, a Basidiomycete Isolated from a Coastal Marine Environment†

    OpenAIRE

    Raghukumar, C.; D’Souza, T. M.; Thorn, R. G.; Reddy, C A

    1999-01-01

    A basidiomycetous fungus Flavodon flavus (Klotzsch) Ryvarden (strain 312), isolated from decaying sea grass from a coral lagoon off the west coast of India, mineralized nearly 24% of 14C-labeled synthetic lignin to 14CO2 in 24 days. When grown in low-nitrogen medium (2.4 mM N) this fungus produced three major classes of extracellular lignin-modifying enzymes (LMEs): manganese-dependent peroxidase (MNP), lignin peroxidase (LIP), and laccase. Low MNP and laccase activities were seen in high-nit...

  16. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants. PMID:24502208

  17. Extracellular laccase produced by an edible basidiomycetous mushroom, Grifola frondosa: purification and characterization.

    Science.gov (United States)

    Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko

    2011-01-01

    A major laccase isozyme (Lac 1) was isolated from the culture fluid of an edible basidiomycetous mushroom, Grifola frondosa. Lac 1 was revealed to be a monomeric protein with a molecular mass of 71 kDa. The N-terminal amino acid sequence of Lac 1 was highly similar to those of laccases of some other white-rot basidiomycetes. Lac 1 showed the typical absorption spectrum of a copper-containing enzyme. The enzyme was stable in a wide pH range (4.0 to 10.0), and lost no activity up to 60 °C for 60 min. The optimal pH of the enzyme activity varied among substrates. The K(m) values of Lac 1 toward 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 2,6-dimethoxyphenol, guaiacol, catechol, and 3,4-dihydroxy-L-phenylalanine were 0.0137 mM, 0.608 mM, 0.531 mM, 2.51 mM, and 0.149 mM respectively. Lac 1 activity was remarkably inhibited by the chloride ion, in a reversible manner. Lac 1 activity was also inhibited by thiol compounds. PMID:21389619

  18. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  19. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  20. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions. PMID:27481160

  1. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  2. In vitro decomposition of Sphagnum-derived acrotelm and mesotelm peat by indigenous and alien basidiomycetous fungi

    Directory of Open Access Journals (Sweden)

    M.N. Thormann

    2011-05-01

    Full Text Available Northern peatlands have accumulated significant quantities of peat, and it has been predicted that rates of peat decomposition may increase due to climate warming. In peatlands, organic matter decomposition in the acrotelm is accomplished primarily by fungi that act differentially through time on various peat constituents. After four months of decomposition in vitro, I show a distinct microbiological limitation to the decomposition of Sphagnum-derived peat (mean mass losses of 1.1–7.1 % by indigenous and alien basidiomycetous fungi of both acrotelm and mesotelm peat (the mesotelm is the lower part of the acrotelm sensu lato, in which conditions fluctuate between oxic and anoxic. Neither acrotelm nor mesotelm Sphagnum peat can be degraded effectively by many fungi (mean mass losses of 2.7 % and 4.3 % for acrotelm and mesotelm peat, respectively, including the ubiquitous wood decomposing basidiomycetes known to decompose some of nature’s most complex polymers. Peatland basidiomycetes caused significantly greater mass losses of acrotelm and mesotelm peat than wood decay basidiomycetes (mean mass losses of 5.7 % and 1.4 %, respectively. Brown rot fungi caused significantly greater mass losses to acrotelm and mesotelm peat than white rot fungi and non-wood-decay fungi (mean mass losses of 10.1 %, 1.7 %, and 2.3 %, respectively. Rates of peat decomposition may not increase to the extent previously predicted, and peatlands may not necessarily be long-term sources of CO2 in response to a warming climate.

  3. Gene expression profiling of the plant pathogenic basidiomycetous fungus Rhizoctonia solani AG 4 reveals putative virulence factors

    Science.gov (United States)

    Rhizoctonia solani is a ubiquitous basidiomycetous soilborne fungal pathogen causing damping off of seedlings, aerial blights and postharvest diseases. To gain insight into the molecular mechanisms of pathogenesis a global approach based on analysis of expressed sequence tags (ESTs) was undertaken. ...

  4. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  5. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524. E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  6. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol. PMID:17697987

  7. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  8. Effect of UV Irradiation on Content of Vitamin D2 in Coprinus comatus%紫外辐照对鸡腿菇中维生素D2含量的影响

    Institute of Scientific and Technical Information of China (English)

    胡彬彬; 武忠伟; 王振河; 王斌; 赵现方

    2012-01-01

    The contents of vitamin D2 were detected by High Performance Liquid Chromatography (HPLC) after the tissues of Coprinus conwtus at young, premature and mature stages were irradiated by ultraviolet light (UV) respectively. The result showed that there was no content of vitamin D2 detected in pileus without UV irradiations while the vitamin D2 content in Btape was relatively high, which reached 3.473 1 μ/g at the premature stage. Content of vitamin D2 in C. comatus was increased significantly after irradiated by UV. The highest content of vitamin D2, 23.309 3 μg/g and 22.858 5 μg/g in pileus ans stipe were detected at pre-mature stage.%以紫外线分别辐照菇蕾期、成熟前期和成熟期的鸡腿菇(Coprinus comatus),利用高效液相色谱法检测其中维生素D2的含量.结果发现,未经紫外照射时,菇蕾期、成熟前期和成熟期的鸡腿菇菌盖中均未检测到维生素D2,但在各时期的鸡腿菇菌柄中维生素D2含量较高,其中成熟前期的维生素D2含量达3.473 1 μg/g.经紫外线辐照处理后,鸡腿菇的菌柄和菌盖中的维生素D2含量均显著增加,其中成熟前期的菌盖和菌柄中含量最高,分别为23.309 3 μg/g和22.858 5 μg/h.紫外线辐照可以提高鸡腿菇中维生素D2的含量.

  9. Gene knockdown by ihpRNA-triggering in the ectomycorrhizal basidiomycete fungus Laccaria bicolor.

    Science.gov (United States)

    Kemppainen, Minna J; Pardo, Alejandro G

    2010-01-01

    Ectomycorrhiza (ECM) is a mutualistic association between fungi and the roots of the vast majority of trees. These include numerous ecologically and economically relevant species and the participating fungal symbionts are predominantly filamentous basidiomycetes. In natural ecosystems the plant nutrient uptake from soil takes place via the extraradical mycelia of these ECM mycosimbionts as a trade for plant photosyntates. The symbiotic phase in the life cycle of ECM basidiomycetes is the dikaryotic hyphae. Therefore, studies on symbiotic relevant gene functions require the inactivation of both gene copies in these dikaryotic fungi. RNA silencing is a eukaryotic sequence homology-dependent degradation of target RNAs which is believed to have evolved as a protection mechanism against invading nucleic acids. In different eukaryotic organisms, including fungi, the RNA silencing pathway can be artificially triggered to target and degrade gene transcripts of interest, resulting in gene knock-down. Most importantly, RNA silencing can act at the cytosolic level affecting mRNAs originating from several gene copies and different nuclei thus offering an efficient means of altering gene expression in dikaryotic organisms. Therefore, the pHg/pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII-promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy two-step PCR-cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300-based binary vector carrying a hygromycin resistance cassette, makes the pHg/pSILBAγ plasmid compatible with Agrobacterium-mediated transformation. The pHg/pSILBAγ-system results in predominantly single integrations of RNA silencing triggering T-DNAs in the fungal genome

  10. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  11. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. PMID:24800960

  12. [Biological synthesis of gold nanoparticles by the xylotrophic basidiomycete Lentinula edodes].

    Science.gov (United States)

    Vetchinkina, E P; Burov, A M; Ageeva, M V; Dykman, L A; Nikitina, V E

    2013-01-01

    This is the first study to demonstrate that the medicinal basidiomycete Lentinula edodes can reduce gold (III) ions from hydrogen tetrachloaurate (chloroauric acid) H[AuCl4] to the elementary state with the formation of spherical nanoparticles (nanospheres). When a culture was grown under submerged conditions in the presence of chloroauric acid, the appearance of an intense purple-red color of L. edodes filamentous hyphae was recorded, which indicates that gold ions were reduced to gold nanoparticles. Using transmission electron microscopy and X-ray fluorescence, we observed accumulation of colloidal gold by the fungal mycelium in the form of electron-dense nanospheres of 5 to 50 nm in diameter on the surface and inside fungal cells. PMID:24455867

  13. Cardiovascular effects of the fungal extract of basidiomycetes sp. YL8006.

    Science.gov (United States)

    Andreacchi, A S; Wang, T; Wu, J H

    1997-01-01

    Many fungal products are known to possess biological activity towards the mammalian tissues. We studied vasodilating activity in the crude ethanol extract of the dried mycelia of Basidiomycetes sp. YL8006, cultured by submerged fermentation with a complex medium. The activity was assayed using the isolated perfused rat heart in the working mode. Immediately following injection of the extract into the perfusion system, a 20-25% increase in coronary flow was observed (pvehicle control). There was a concurrent decrease in diastolic pressure and coronary vascular resistance. Aortic flow, systolic pressure, and cardiac output declined slightly over time after treatment. No significant changes in heart rate, efficiency, and oxygen consumption were observed. Solvent vehicle did not cause any changes in hemodynamic performance. PMID:9180352

  14. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  15. Coprinopsis cinerea as a Model Fungus to Evaluate Genes Underlying Sexual Development in Basidiomycetes

    Directory of Open Access Journals (Sweden)

    P. Srivilai

    2009-01-01

    Full Text Available Coprinopsis cinerea is an excellent model for study of sexual reproduction and development in basidiomycetes because of its short-life cycle, capability to grow and fruit on artificial media under laboratory conditions. Deepening the understanding of genes underlying sexual reproduction and development in this mushroom model is expected to help in the future the world mushroom cultivation of any other basidiomycetes concerning the potential agronomic, economic and environmental benefits. This study presents findings with clear statements from the literature as well as own results focusing on the genetic analysis of genes acting in sexual reproduction and development in C. cinerea. Sexual reproduction and development in C. cinerea are regulated by the A and B mating type genes that encode two types of homeodomain transcription factors, pheromones and pheromone receptors, respectively. Coprinopsis cinerea has two different mycelial stages defined as the monokaryotic-(primary and dikaryotic-(secondary mycelium. When two compatible haploid monokaryons with different mating type alleles at A and B loci are fused, the fertile dikaryons are formed and developed into fruiting bodies, indicating that mating type genes regulate sexual development in C. cinerea. Self-fertile homokaryon AmutBmut strain with mutations in the A and B mating loci is ideal for production of mutants in fruiting body formation. Co-isogenic strains were generated by the repeated back-crossing against AmutBmut to analyze the genetic background of such mutants and the functions of genes in the fruiting pathway. Genetic analysis of AmutBmut fruiting mutants that are blocked at different stages in fruiting pathway will be described.

  16. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Science.gov (United States)

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  17. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  18. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  19. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    Science.gov (United States)

    Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  20. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus) by qRT-PCR

    OpenAIRE

    Iona E. Maher; Joanna E. Griffith; Quintin Lau; Thomas Reeves; Damien P. Higgins

    2014-01-01

    Investigation of the immune response of the koala (Phascolarctos cinereus) is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV), which is of 100% prevalence in northern Australia, has b...

  1. A Checklist of the Basidiomycetous Macrofungi and a Record of Five New Species from Mt. Oseo in Korea

    Science.gov (United States)

    Lee, Won Dong; Lee, Hyun; Fong, Jonathan J.; Oh, Seung-Yoon; Park, Myung Soo; Quan, Ying; Jung, Paul E.

    2014-01-01

    Basidiomycetous macrofungi play important roles in maintaining forest ecosystems via carbon cycling and the mobilization of nitrogen and phosphorus. To understand the impact of human activity on macrofungi, an ongoing project at the Korea National Arboretum is focused on surveying the macrofungi in unexploited areas. Mt. Oseo was targeted in this survey because the number of visitors to this destination has been steadily increasing, and management and conservation plans for this destination are urgently required. Through 5 field surveys of Mt. Oseo from April to October 2012, 116 specimens of basidiomycetous macrofungi were collected and classified. The specimens were identified to the species level by analyzing their morphological characteristics and their DNA sequence data. A total of 80 species belonging to 57 genera and 25 families were identified. To the best of our knowledge, this is the first study to identify five of these species-Artomyces microsporus, Hymenopellis raphanipes, Pholiota abietis, Phylloporus brunneiceps, and Sirobasidium magnum-in Korea. PMID:25071381

  2. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications. PMID:23558529

  3. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment. PMID:20585855

  4. Biomass estimation during macro-scale solid-state fermentation of basidiomycetes using established and novel approaches.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-07-01

    Solid-state fermentation (SSF) has been utilised in food production for millennia and is well suited for the cultivation of basidiomycetes, due to the robustness of the process and the possibility of using lignocellulose as the substrate. Basidiomycetes produce diverse enzymes and various primary and secondary metabolites, many of which have biotechnological potential. The quantification of the fungal biomass present is essential for the characterisation of growth kinetics in processes such as SSF. In SSF, fungi grow into the substrate and use it as a nutrient source. Therefore, direct biomass determination is not possible and indirect methods have to be employed. In the presented study, we compared 11 methods for quantifying fungal biomass during SSF of the basidiomycete Trametes hirsuta in a newly developed laboratory reactor (working volume 10 L). The methods were based on measuring the levels of six cell-specific components (ergosterol, glucosamine, nucleic acids, number of fungal nuclei, protein and genomic DNA) and estimations of biological activity (respiration, activities of lignolytic and cellulolytic enzymes, and the glucose and protein contents of the liquid). The methods were evaluated with regards to reproducibility and plausibility of the results, time and resource requirements, possible influential factors, and matrix effects. The most reliable biomass estimates were obtained from measurements of ergosterol content, number of nuclei, and respiration. Thus, these three methods were deemed most suitable for process control and modelling. PMID:25656698

  5. Optimization of Extraction Process and Studies on Functional Properties of Fruit Bodies Protein of Coprinus Comatus%鸡腿菇子实体蛋白提取工艺优化及其特性研究

    Institute of Scientific and Technical Information of China (English)

    赵春江; 孙进; 程玉; 孟天真; 闫永芳; 叶兴乾; 陈健初

    2012-01-01

    The extraction process of fruit bodies protein of Coprinus comatus was optimized and its functional properties was studied. The effects of leaching solution pH value, temperature, ratio of solid to liquid, time on the extraction of the protein from fruit bodies of Coprinus comatus were investigated. The optimum condition of alkaline extraction was determined by orthogonal test plan and the isoelectric point of deposited protein was explored. In addition, the molecular weight distribution, amino acid composition and functional properties of the protein were studied. The results showed that the optimum extraction conditions were: pH 11.5, 50 ℃, ratio of solid to liquid 1:15, 50 min. The isoelectric point was pH 3.8. At this condition, protein extraction rate was 24.3%, purity was 80.7%. The molecular weight of the extracted protein mainly distributed in 50-90 ku, 20-35 ku and 13-17 ku areas and contained relatively complete amino acid composition, with its nutrition values exceeding the values recommended by FAO/WHO. The protein has good solubility, emulsifying and foaming properties.%以鸡腿菇子实体为原料,研究其蛋白的提取工艺及特性.以提取液pH值、提取温度、料液比、提取时间为提取鸡腿菇子实体蛋白的影响因素,采用正交试验优化碱溶酸沉法提取蛋白的工艺条件,结果表明:鸡腿菇子实体蛋白的最佳提取工艺参数为提取液pH 11.5,提取温度50℃,料液比1∶15,提取时间50 min,此时蛋白提取率为24.3%.在pH 3.5条件下沉淀蛋白效果最佳.对制备的鸡腿菇子实体蛋白特性的分析表明:其分子质量主要集中在50~90 ku,20~35 ku和13~17 ku等区间内;必需氨基酸(EAA)占氨基酸总量(TAA)的40.57%,必需氨基酸与非必需氨基酸(NEAA)的比值为0.68,为理想蛋白质,且其所含人体必需氨基酸种类齐全,比例均衡,比值系数分(SRC)为80.69;在碱性条件下,鸡腿菇子实体蛋白具有良好的溶解性、乳化性和起泡能力.

  6. Patterns of repeat-induced point mutation in transposable elements of basidiomycete fungi.

    Science.gov (United States)

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-T transition mutations in particular di- and trinucleotide target sites for TE-like sequences from nine fungal genomes. We find evidence of RIP-like patterns of hypermutation at TpCpG trinucleotide sites in repetitive sequences from all species of the Pucciniomycotina subphylum of the Basidiomycota, Microbotryum lychnidis-dioicae, Puccinia graminis, Melampsora laricis-populina, and Rhodotorula graminis. In contrast, we do not find evidence for RIP-like hypermutation in four species of the Agaricomycotina and Ustilaginomycotina subphyla of the Basidiomycota. Our results suggest that a RIP-like process and the specific nucleotide context for mutations are conserved within the Pucciniomycotina subphylum. These findings imply that coevolutionary interactions between TEs and a hypermutating genome defense are stable over long evolutionary timescales. PMID:22250128

  7. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  8. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. PMID:22954341

  9. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively. PMID:23510286

  10. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment. PMID:23350659

  11. Sympodiomycopsis yantaiensis sp. nov., a basidiomycetous yeast isolated from insect frass.

    Science.gov (United States)

    Chen, Liang; Zhang, Lin; Li, Zhi-Hui; Hui, Feng-Li

    2013-09-01

    Two strains (NYNU 121010(T) and NYNU 121032) of a novel basidiomycetous yeast species belonging to the genus Sympodiomycopsis were isolated from insect frass collected from trunks of a pagoda tree (Sophora japonica L.) in Yantai, Shandong province, east China. The sequence analyses of the D1/D2 domain of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region indicated that the closest relatives were Sympodiomycopsis kandeliae FIRDI 007(T), Sympodiomycopsis paphiopedili CBS 7429(T) and Sympodiomycopsis sp. S6A. The D1/D2 sequences of the novel strains differed by 12 nt substitutions (2%) from the type strain of S. kandeliae, and by 13 nt substitutions (2.2%) from the type strain of S. paphiopedili and from Sympodiomycopsis sp. S6A. The novel strains differed from closely related species by more than 4.6% substitutions in the ITS region. The novel strains can also be distinguished from S. kandeliae and S. paphiopedili on the basis of a number of morphological and physiological characteristics and represent a novel species in the genus Sympodiomycopsis, for which the name Sympodiomycopsis yantaiensis sp. nov. is proposed. The type strain is NYNU 121010(T) ( =CICC 32998(T) = CBS 12813(T)). The Mycobank deposit number is MB 804119. PMID:23838443

  12. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs. PMID:18805521

  13. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis. PMID:16885300

  14. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site. PMID:17922847

  15. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-02-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  16. Penarines A-F, (nor-)sesquiterpene carboxylic acids from Hygrophorus penarius (Basidiomycetes).

    Science.gov (United States)

    Otto, Alexander; Porzel, Andrea; Schmidt, Jürgen; Wessjohann, Ludger; Arnold, Norbert

    2014-12-01

    Five sesquiterpene carboxylic acids (1-5) and one nor-sesquiterpene carboxylic acid (6) of the very rare ventricosane type, named penarines A-F, were isolated from fruiting bodies of the basidiomycete Hygrophorus penarius (Hygrophoraceae). This is the first report of (nor)-sesquiterpenes isolated from basidiocarps of the family Hygrophoraceae. Their structures were elucidated on the basis of extensive 1D ((1)H, (13)C) and 2D (HSQC, HMBC, COSY, ROESY) NMR spectroscopic analyses as well as high-resolution mass spectrometry studies. Additionally, the only known member of this rare type of sesquiterpenes, ventricos-7(13)-ene (7), could be identified via headspace GC-MS analysis in a fruiting body of H. penarius. Compounds 1-6 were devoid of remarkable antifungal activity against Cladosporium cucumerinum. Additionally, the cytotoxic activities of compounds 1 and 2 were evaluated against the human prostate cancer cell line PC-3 and the colon cancer cell line HT-29 showing no significant cytotoxic activity. PMID:25269661

  17. Three-dimensional organization of three-domain copper oxidases: A review

    International Nuclear Information System (INIS)

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms

  18. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi.

    Science.gov (United States)

    Riley, Robert; Salamov, Asaf A; Brown, Daren W; Nagy, Laszlo G; Floudas, Dimitrios; Held, Benjamin W; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika A; Sun, Hui; LaButti, Kurt M; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E; Pisabarro, Antonio G; Walton, Jonathan D; Blanchette, Robert A; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David S; Grigoriev, Igor V

    2014-07-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white-rot/brown-rot classification paradigm, we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically informed principal-components analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white-rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown-rot fungi. Our results suggest a continuum rather than a dichotomy between the white-rot and brown-rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay. PMID:24958869

  19. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  20. The BETA-1, 3-Glucanase of Basidiomycete QM 806: Studies on it's production and application in yeast cell wall hydrolysis

    OpenAIRE

    Ryan, Eleanor

    1986-01-01

    In this project the growth and production of JB-1,3-glucanase by Basidiomycete sp QM 806 was investigated, with a view to studying its application in B-1,3-glucan degradation and in yeast extract production. The effect of various parameters on 3-1 »3-glucanase production was examined. The optimal conditions for enzyme production in submerged shake-flask culture were chosen. Two B-1,3-glucans (laminarin and yeast cell walls) were degraded using the B-1,3-glucanase produced. The degra...

  1. Lignocellulose-Degrading Enzymes of Hardwood Forest Soil: Their Activity, Spatial Distribution and Their Producers - Saprotrophic Basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Šnajdr, Jaroslav; Valášková, Vendula; Cajthaml, Tomáš; Trögl, Josef; Bittner, B.; Hofrichter, M.

    Wisconsin: Verlag, 2007, s. 58-58. [International Congress on Biotechnology in the Pulp and Paper Industry /10./. Madison (US), 10.06.2007-15.06.2007] R&D Projects: GA ČR GA526/05/0168; GA AV ČR KJB600200516 Grant ostatní: CZ(CZ) PPP D17-CZ27/06-07 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje Keywords : basidiomycetes Subject RIV: EE - Microbiology, Virology

  2. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia)

    OpenAIRE

    Siabatto F. Helbert David

    2005-01-01

    Se realizó la colección de especímenes jóvenes de Basidiomycetes en el páramo de Ocetá, ubicado en el municipio de Monguí, Boyacá, Colombia. Con el fin de crear un inventario de cada morfoespecie colectada, se realizó una descripción macroscópica, microscópica y pruebas químicas con
    el fin de obtener los principales taxones. Se encontraron 11 géneros: Gomphydus, Chroogomphus, Paneolus, Macrolepiota, Tricholoma, Lentinellus, Crepidotus, Amanita, Polyborus, Lycoperdon y Tubaria, pert...

  3. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  4. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  5. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD+-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  6. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  7. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935. ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  8. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence. PMID:23814110

  9. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  10. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi. PMID:25239747

  11. Kenaf biomass biodecomposition by basidiomycetes and actinobacteria in submerged fermentation for production of carbohydrates and phenolic compounds.

    Science.gov (United States)

    Brzonova, Ivana; Kozliak, Evguenii; Kubátová, Alena; Chebeir, Michelle; Qin, Wensheng; Christopher, Lew; Ji, Yun

    2014-12-01

    The efficiency and dynamics of simultaneous kenaf biomass decomposition by basidiomycetous fungi and actinobacteria were investigated. After 8weeks of incubation, up to 34wt.% of the kenaf biomass was degraded, with the combination of fungi and bacteria being the most efficient. Lignin decomposition accounted for ∼20% of the observed biomass reduction, regardless of the culture used. The remaining 80% of biomass degradation was due to carbohydrate based polymers. Major monosaccharides were produced in tangible yields (26-38%) at different times. Glucose, fructose and xylose were then fully consumed by day 25 while some galactose persisted until day 45. Once monosaccharides were depleted, the production of laccase, manganese-dependent peroxidase and lignin peroxidase enzymes, essential for lignin decomposition, was induced. The products of lignin biodecomposition were shown to be water-soluble and characterized by thermal desorption-pyrolysis-gas chromatography. PMID:25314665

  12. Evidence from Serpula lacrymans that 2,5-dimethoxyhydroquinone Is a lignocellulolytic agent of divergent brown rot basidiomycetes.

    Science.gov (United States)

    Korripally, Premsagar; Timokhin, Vitaliy I; Houtman, Carl J; Mozuch, Michael D; Hammel, Kenneth E

    2013-04-01

    Basidiomycetes that cause brown rot of wood are essential biomass recyclers in coniferous forest ecosystems and a major cause of failure in wooden structures. Recent work indicates that distinct lineages of brown rot fungi have arisen independently from ligninolytic white rot ancestors via loss of lignocellulolytic enzymes. Brown rot thus proceeds without significant lignin removal, apparently beginning instead with oxidative attack on wood polymers by Fenton reagent produced when fungal hydroquinones or catechols reduce Fe(3+) in colonized wood. Since there is little evidence that white rot fungi produce these metabolites, one question is the extent to which independent lineages of brown rot fungi may have evolved different Fe(3+) reductants. Recently, the catechol variegatic acid was proposed to drive Fenton chemistry in Serpula lacrymans, a brown rot member of the Boletales (D. C. Eastwood et al., Science 333:762-765, 2011). We found no variegatic acid in wood undergoing decay by S. lacrymans. We found also that variegatic acid failed to reduce in vitro the Fe(3+) oxalate chelates that predominate in brown-rotting wood and that it did not drive Fenton chemistry in vitro under physiological conditions. Instead, the decaying wood contained physiologically significant levels of 2,5-dimethoxyhydroquinone, a reductant with a demonstrated biodegradative role when wood is attacked by certain brown rot fungi in two other divergent lineages, the Gloeophyllales and Polyporales. Our results suggest that the pathway for 2,5-dimethoxyhydroquinone biosynthesis may have been present in ancestral white rot basidiomycetes but do not rule out the possibility that it appeared multiple times via convergent evolution. PMID:23377930

  13. Polycyclic aromatic hydrocarbons (PAHs) biodegradation by basidiomycetes fungi, Pseudomonas isolate, and their cocultures: comparative in vivo and in silico approach.

    Science.gov (United States)

    Arun, A; Raja, P Praveen; Arthi, R; Ananthi, M; Kumar, K Sathish; Eyini, M

    2008-12-01

    The polycyclic aromatic hydrocarbons (PAHs) biodegradation potential of the five basidiomycetes' fungal monocultures and their cocultures was compared with that of a Pseudomonas isolate recovered from oil-spilled soil. As utilization of hydrocarbons by the microorganisms is associated with biosurfactant production, the level of biosurfactant production and its composition by the selected microorganisms was also investigated. The Pseudomonas isolate showed higher ability to degrade three of the five PAHs but the isolate did not produce biosurfactant higher than C. versicolor and P. ostreatus. Among the PAHs, the most effective biodegradation of PAH--pyrene (42%)--was obtained with the fungus C. versicolor. Cocultures involving the fungi and Pseudomonas could not significantly degrade the selected PAHs compounds above that degraded by the most efficient monoculture. A slight increase in pyrene degradation was observed in cocultures of C. versicolor and F. palustris (93.7% pyrene). The crude biosurfactant was biochemically characterized as a multicomponent surfactant consisting of protein and polysaccharides. The PAH biodegradation potential of the basidiomycetes fungi positively correlated with their potential to express ligninolytic enzymes such as lignin peroxidase (Lip), manganese peroxidase (Mnp), and laccase. The present study utilized in silico method such as protein-ligand docking using the FRED in Open Eye software as a tool to assess the level of ligninolytic enzymes and PAHs interactions. The in silico analysis using FRED revealed that of the five PAHs, maximum interaction occurred between pyrene and all the three ligninolytic enzymes. The results of the in silico analysis corroborated with our experimental results showing that pyrene was degraded to the maximum extent by species such as C. versicolor and P. ostreatus. PMID:18975143

  14. Behavior of the Hawaiian Hawaiian Hoary Bat (Lasiurus cinereus semotus ) at wind turbines and its distribution across the North Ko`olau Mountains , O`ahu

    Science.gov (United States)

    Bonaccorso, Frank; Gorresen, P.M.; Cryan, Paul M.; Huso, Manuela M.P.; Hein, Cris D.; Schirmacher, Michael; Johnson, Jessica H.; Montoya-Aiona, Kristina; Brinck, Kevin W.

    2015-01-01

    We studied the landscape distribution of endemic Hawaiian hoary bats (Lasiurus cinereus semotus) on the north Ko‘olau Mountains of O‘ahu, Hawai‘i, from May 2013 to May 2014, while simultaneously studying their behavior at wind turbines within the broader landscape. This research aimed to assess the risk that wind turbines pose to bats on the island and integrated a variety of methods, including acoustic monitoring, thermal videography, and fatality searches. Our findings indicate that hoary bats were acoustically cryptic and occurred sparsely in the region. Overall site occupancy rate was 55% during the 1-year period of acoustic monitoring at 23 sites, and there was only an 8% chance of acoustically detecting a bat on a given night if it was present. We detected bats less frequently in windward northern parts of the study area and at windy, lower-elevation sites with rough terrain. Bats were detected more frequently in leeward southern parts of the study area and at wind-sheltered, higher-elevation sites with flat ridgetops. Acoustic detections were consistently low from October through February and increased at most sites to peak in April through August. However, meteorological conditions were not found to be associated with the acoustic prevalence of bats on a night-to-night basis.We observed more than three thousand events involving bats during six months of nightly video surveillance at four wind turbines. Video monitoring revealed several links to weather at the local scale, despite acoustic detections not clearly relating to weather in our broader landscape analysis. Video demonstrated bats occurring near turbines more often on nights with little rain, warmer temperatures, moderate wind speeds, low humidity, and the low but rising barometric pressures indicative of fair weather and improved foraging conditions. Video monitoring also demonstrated that the presence of bats near turbines strongly correlates with insect presence. We detected bats on video

  15. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  16. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  17. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  18. Biological characteristics of teleomorph and optimized in vitro fruiting conditions of the Hoelen medicinal mushroom, Wolfiporia extensa (Higher Basidiomycetes).

    Science.gov (United States)

    Xu, Zhangyi; Meng, Hu; Xiong, Huan; Bian, Yinbing

    2014-01-01

    Wolfiporia extensa is a basidiomycetous brown rot fungus and is of well-known medicinal import in China, Japan, and other Asiatic countries. Fruiting body induction is of major relevance for basic biological research and for their use in industrial applications. Based on the evaluation of the effects of temperature, time in the dark before induction and culture, and wounding treatment on fruiting, this report describes the most efficient protocol for inducing fruiting of W. extensa growing on agar plates. Furthermore, several biological characteristics of teleomorph, such as the locations of hymenium, the configuration of basidiospores and primary mycelia, and events involved in basidiosporogenesis in W. extensa, were analyzed for the first time using fluorescence microscopy. The results showed that the hymenium born on both sides of the wall of the honeycomb-like structure on the surface of fruiting bodies and the hymenophoral trama situated in the middle. Each basidia has 4 binuclear basidiospores, and the primary mycelia are multinucleate without clamp connections. These results broaden our knowledge about this brown rot fungus and promote further studies of the sexual reproduction, fruiting body development, and advancement of breeding program, new topics related to the contents of pharmacologically active substances in W. extensa fruiting bodies. PMID:25271978

  19. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities. PMID:26616098

  20. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5. PMID:20652239

  1. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  2. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process. PMID:26797957

  3. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Siabatto F. Helbert David

    2005-12-01

    Full Text Available Se realizó la colección de especímenes jóvenes de Basidiomycetes en el páramo de Ocetá, ubicado en el municipio de Monguí, Boyacá, Colombia. Con el fin de crear un inventario de cada morfoespecie colectada, se realizó una descripción macroscópica, microscópica y pruebas químicas con
    el fin de obtener los principales taxones. Se encontraron 11 géneros: Gomphydus, Chroogomphus, Paneolus, Macrolepiota, Tricholoma, Lentinellus, Crepidotus, Amanita, Polyborus, Lycoperdon y Tubaria, pertenecientes a diez familias: Gomphidiaceae, Coprinaceae, Agaricaceae, Tricholomataceae, Pleurotaceae, Crepidotaceae, Amanitaceae, Poliporaceae, Lycoperdaceae y Entolomalaceae; distribuidas éstas en cuatro
    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  4. In vitro anti-Helicobacter pylori effects of medicinal mushroom extracts, with special emphasis on the Lion's Mane mushroom, Hericium erinaceus (higher Basidiomycetes).

    Science.gov (United States)

    Shang, Xiaodong; Tan, Qi; Liu, Ruina; Yu, Kangying; Li, Pingzuo; Zhao, Guo-Ping

    2013-01-01

    Although the medicinal mushroom Hericium erinaceus is used extensively in traditional Chinese medicine to treat chronic superficial gastritis, the underlining pharmaceutical mechanism is yet to be fully understood. In this study, minimum inhibitory concentration (MIC) values of extracts prepared from the fruiting bodies of 14 mushroom species (H. erinaceus, Ganoderma lucidum, Cordyceps militaris, Pleurotus eryngii, P. ostreatus, Agrocybe aegerita, Lentinus edodes, Agaricus brasiliensis, A. bisporus, Coprinus comatus, Grifola frondosa, Phellinus igniarius, Flammulina velutipes, and Hypsizygus marmoreus) were determined against Helicobacter pylori using laboratory strains of ATCC 43504 and SS1 as well as 9 clinical isolates via an in vitro microplate agar diffusion assay. Ethanol extracts (EEs) of 12 mushrooms inhibited the growth of H. pylori in vitro, with MIC values 10 mg/mL). MIC values of ethyl acetate fractions (EAFs) of H. erinaceus against 9 clinical isolates of H. pylori ranged between 62.5 and 250 µg/mL. The bacteriostatic activity of EAFs was found to be concentration-dependant, and the half maximal inhibitory concentration and minimum bactericidal concentration values for H. pylori ATCC 43504 were 73.0 and 200 µg/mL, respectively. The direct inhibitory effect of EEs and EAFs of H. erinaceus against H. pylori could be another pharmaceutical mechanism of medicinal mushrooms-besides the immunomodulating effect of polysaccharides, suggested previously-in the treatment of H. pylori-associated gastrointestinal disorders. Further research to identify the active component(s) is currently undertaking in our laboratory. PMID:23557368

  5. The Shaggy Inc Cap medicinal mushroom, Coprinus comatus (O.F.Mull.: Fr.) Pers. (Agaricomycetideae) substances interfere with H2O2 induction of the NF-kappaB pathway through inhibition of Ikappaalpha phosphorylation in MCF7 breast cancer cells.

    Science.gov (United States)

    Asatiani, Mikheil D; Wasser, Solomon P; Nevo, Eviatar; Ruimi, Nili; Mahajna, Jamal; Reznick, Abraham Z

    2011-01-01

    Breast cancer is the most commonly diagnosed cancer among women. Currently, there is no effective therapy for malignant estrogen-independent breast cancer. In our study, we used hydrogen peroxide, a well-known strong oxidative reagent capable of activating the nuclear factor kappa B (NF-kappaB) transcription factor. The IC50 value of the culinary-medicinal Shaggy Inc Cap mushroom Coprinus comatus culture liquid crude extract on MCF7 cell viability was found to be as low as 76 microg/mL, and the IC50 value of C. comatus ethyl acetate extract was only 32 microg/ mL. Our results also showed that both extracts significantly affected IkappaBalpha phosphorylation in a dose-dependent manner. The effect of ethyl acetate extract was comparable to the effect of curcumin, a known NF-kappaB pathway inhibitor, and seemed to be the most active inhibitor of H2O2-dependent IkappaBalpha phosphorylation. In addition, the data obtained showed that only ethyl acetate extract inhibited the activity of IKK complex, at close to 90% as compared to the control of the untreated sample. These results suggest that C. comatus contains potent compounds capable of inhibiting NF-kappaB function and also possibly acts as an antitumor agent. PMID:22135900

  6. Inonotus rickii (Pat.) Reid: an important legnicolous basidiomycete in urban trees Inonotus rickii (Pat.) Reid: um importante basidomiceta lenhícola em árvores urbanas

    OpenAIRE

    Ana Paula Ramos; Maria Filomena Caetano; Ireneia Melo

    2008-01-01

    Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of heartwood. In some cases, chlamy...

  7. Purification and characterization of a novel detergent- and organic solvent-resistant endo-beta-1,4-glucanase from a newly isolated basidiomycete Peniophora sp. NDVN01

    OpenAIRE

    TRINH, Dinh Kha; Quyen, Dinh Thi; Do, Thi Tuyen; Nghiem, Ngoc Minh

    2013-01-01

    A novel extracellular endoglucanase from a basidiomycete strain Peniophora sp. NDVN01 was purified 2.8-fold to homogeneity through ammonium sulfate precipitation and gel filtration with Bio-Gel P-100 and Sephadex G-75. The endoglucanase had a specific activity of 163.8 U/mg protein and a molecular mass of 32 kDa. Optimum temperature and pH were at 60 °C and 4.5, respectively. The enzyme was stable at up to 42 °C and in the pH range of 3.5-5.5 with a residual activity of over 80% for 24 h of t...

  8. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  9. High Level Secretion of Laccase (LccH) from a Newly Isolated White-Rot Basidiomycete, Hexagonia hirta MSF2

    Science.gov (United States)

    Kandasamy, Sujatha; Muniraj, Iniya K.; Purushothaman, Namitha; Sekar, Ashika; Sharmila, D. J. S.; Kumarasamy, Ramasamy; Uthandi, Sivakumar

    2016-01-01

    Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH) in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY) medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modeling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7) with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5%, respectively. Such high level secretion, thermal and solvent stability of LccH make H. hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications. PMID:27242729

  10. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  11. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  12. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Science.gov (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) region and fungal internal transcribed spacer 2 (ITS2) region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity. PMID:25884708

  13. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied. PMID:26330322

  14. Evaluation of different lignocellulosic substrates for the production of cellulases and xylanases by the basidiomycete fungi Bjerkandera adusta and Pycnoporus sanguineus.

    Science.gov (United States)

    Quiroz-Castañeda, Rosa Estela; Pérez-Mejía, Nancy; Martínez-Anaya, Claudia; Acosta-Urdapilleta, Lourdes; Folch-Mallol, Jorge

    2011-06-01

    Agricultural waste products are potential resources for the production of a number of industrial compounds, including biofuels. Basidiomycete fungi display a battery of hydrolytic enzymes with prospective use in lignocellulosic biomass transformation, however little work has been done regarding the characterization of such activities. Growth in several lignocellulosic substrates (oak and cedar sawdust, rice husk, corn stubble, wheat straw and Jatropha seed husk) and the production of cellulases and xylanases by two basidiomycete fungi: Bjerkandera adusta and Pycnoporus sanguineus were analyzed. Growth for P. sanguineus was best in rice husk while corn stubble supported the highest growth rate for B. adusta. Among the substrates tested, cedar sawdust produced the highest cellulolytic activities in both fungal species, followed by oak sawdust and wheat straw. Xylanolytic activity was best in oak and cedar sawdust for both species. We found no correlation between growth and enzyme production. Zymogram analysis of xylanases and cellulases showed that growth in different substrates produced particular combinations of protein bands with hydrolytic activity. PMID:20963471

  15. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  16. High-level recombinant protein production by the basidiomycetous yeast Pseudozyma antarctica under a xylose-inducible xylanase promoter.

    Science.gov (United States)

    Watanabe, Takashi; Morita, Tomotake; Koike, Hideaki; Yarimizu, Tohru; Shinozaki, Yukiko; Sameshima-Yamashita, Yuka; Yoshida, Shigenobu; Koitabashi, Motoo; Kitamoto, Hiroko

    2016-04-01

    Yeast host-vector systems are useful tools for the production of recombinant proteins. Here, we report the construction of a new high-level expression plasmid pPAX1-neo for the basidiomycetous yeast, Pseudozyma antarctica. pPAX1-neo harbours a xylose-inducible expression cassette under control of the xylanase promoter and terminator of P. antarctica T-34, a selection cassette of neomycin/G418 with an Escherichia coli neomycin resistance gene under control of the homocitrate synthase promoter of strain T-34, and an autonomously replicating sequence fragment of Ustilago maydis (UARS). Biodegradable plastic (BP)-degrading enzymes of P. antarctica JCM10317 (PaE) and Paraphoma-related fungal strain B47-9 (PCLE) were used as reporter proteins and inserted into pPAX1-neo, resulting in pPAX1-neo::PaCLE1 and pPAX1-neo::PCLE, respectively. Homologous and heterologous BP-degrading enzyme production of transformants of P. antarctica T-34 were detected on agar plates containing xylose and emulsified BP. Recombinant PaE were also produced by transformants of other Pseudozyma strains including Pseudozyma aphidis, Pseudozyma rugulosa, and Pseudozyma tsukubaensis. To improve the stability of transformed genes in cells, the UARS fragment was removed from linearized pPAX1-neo::PaCLE1 and integrated into the chromosome of the P. antarctica strain, GB-4(0), which was selected as a PaE producer in xylose media. Two transformants, GB-4(0)-X14 and X49, had an 11-fold higher activity compared with the wild type strain in xylose-containing liquid media. By xylose fed-batch cultivation using a 3-L jar fermentor, GB-4(0)-X14 produced 73.5 U mL(-1) of PaE, which is 13.4-fold higher than that of the wild type strain GB-4(0), which produced 5.5 U mL(-1) of PaE. PMID:26695155

  17. Ectomycorrhizas in vitro between Tricholoma matsutake, a basidiomycete that associates with Pinaceae, and Betula platyphylla var. japonica, an early-successional birch species, in cool-temperate forests.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Maruyama, Tsuyoshi; Neda, Hitoshi

    2015-04-01

    Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates with Pinaceae in the Northern Hemisphere and produces prized "matsutake" mushrooms. We questioned whether the symbiont could associate with a birch that is an early-successional species in boreal, cool-temperate, or subalpine forests. In the present study, we demonstrated that T. matsutake can form typical ectomycorrhizas with Betula platyphylla var. japonica; the associations included a Hartig net and a thin but distinct fungal sheath, as well as the rhizospheric mycelial aggregate "shiro" that is required for fruiting in nature. The in vitro shiro also emitted a characteristic aroma. This is the first report of an ectomycorrhizal formation between T. matsutake and a deciduous broad-leaved tree in the boreal or cool-temperate zones that T. matsutake naturally inhabits. PMID:25236465

  18. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes

    Science.gov (United States)

    Álvarez-Cervantes, Jorge; Díaz-Godínez, Gerardo; Mercado-Flores, Yuridia; Gupta, Vijai Kumar; Anducho-Reyes, Miguel Angel

    2016-01-01

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to determine that the proteins under study were classified into the GH10 and GH11 families, based on the regions of highly conserved amino acids, 233–318 and 180–193 respectively, where glutamate residues are responsible for the catalysis. PMID:27040368

  19. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  20. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus) by qRT-PCR.

    Science.gov (United States)

    Maher, Iona E; Griffith, Joanna E; Lau, Quintin; Reeves, Thomas; Higgins, Damien P

    2014-01-01

    Investigation of the immune response of the koala (Phascolarctos cinereus) is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV), which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala's susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1) and Th2 lymphocyte responses are important to an individual's susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala's adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 10 (IL-10) and interferon gamma (IFNγ) along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A). Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not consistently up-regulated by

  1. Molecular analysis of ectomycorrhizal basidiomycete communities in a Pinus sylvestris L. stand reveals long-term increased diversity after removal of litter and humus layers.

    Science.gov (United States)

    Smit, Eric; Veenman, Christiaan; Baar, Jacqueline

    2003-07-01

    Abstract The number of fruiting bodies of ectomycorrhizal species in pine forests in The Netherlands has decreased dramatically in recent decades. This decrease has been attributed to an increase in nitrogen deposition and the accumulation of litter and humus. The effects of sod cutting and the removal of litter and humus, to restore ectomycorrhizal diversity in a Scots pine forest in Dwingeloo, The Netherlands, were investigated previously from 1990 to 1993. Removal of the litter and humus resulted in a significant increase in the numbers of species and fruiting bodies of ectomycorrhizal fungi. However, until now all data were obtained by counting fruiting bodies and the effects on mycelial development below ground were not assessed. To investigate hyphal development, DNA was extracted from bulk soil and polymerase chain reaction products were obtained by amplification using basidiomycete-specific internal transcribed spacer (ITS) primers. The differences in diversity between the control plots and the treated plots were analyzed using denaturing gradient gel electrophoresis. To assess the species composition and differences, ITS regions of the amplified fragments were cloned and sequenced. Sequences were compared with sequences from GenBank and from fruiting bodies collected from the same plots. Data indicated increased below-ground ectomycorrhizal diversity in the plots that had been subjected to removal of the litter and humus layers. PMID:19719606

  2. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi. PMID:16447071

  3. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies. PMID:25954907

  4. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with the degree of soil organic matter humification and available electrolytes.

    Science.gov (United States)

    Gryndler, M; Soukupová, L; Gryndlerová, H; Baldrian, P; Hršelová, H

    2010-09-01

    Spatial distribution of ectomycorrhizae-associated basidiomycetes was determined in oakbirch forest using terminal restriction fragment length polymorphism (T-RFLP) analysis. The data were correlated with actual soil humidity, pH, electric conductivity of the soil extract, absorbance A(465) and A(665) of water and alkali soil extracts and with the ratio A(465)/A(665) (parameter A4/A6). Natural non-homogeneity of the soil parameters was used as experimental gradient. Distance-based redundancy analysis of the T-RFLP data (with soil parameters being taken as environmental parameters) provided significant results when ITS1F-terminanted restriction fragments were analyzed. Among other fungi, a Mycena galericulata related fungus was observed to correlate negatively with A4/A6, indicating its association with highly humified soil organic matter. Positive association of other, unidentified fungi with A4/A6 was also observed. Several other unidentified fungi negatively correlated with electric conductivity of the soil extract. The results may explain nonhomogeneity of the spatial distribution of the fungi associated with ectomycorrhizae as a result of their interaction with non-homogeneous soil environment. PMID:20941580

  5. Screening of basidiomycetes for the production of exopolysaccharide and biomass in submerged culture Triagem de basidiomicetos para a produção de exopolissacarídeos e biomassa em cultura líquida

    OpenAIRE

    Rosana Maziero; Valeria Cavazzoni; Vera Lúcia Ramos Bononi

    1999-01-01

    Fifty-six strains of Basidiomycetes, including native Brazilian fungi isolated from different ecosystems and edible mushrooms, were screened for production of exopolysaccharides and biomass in submerged culture. Agaricus sp. (CCB 280) and Oudemansiella canarii (Jungh.) Hohn (CCB 179) were the highest exopolysaccharide producers (6.01 and 3.54 g dry w./l respectively) after 7 days of incubation. The best producer of biomass was Schizophyllum commune Fr.:Fr. (CCB 473) with 16.68 g dry w./l in 1...

  6. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants. PMID:26756185

  7. Inonotus rickii (Pat. Reid: an important legnicolous basidiomycete in urban trees Inonotus rickii (Pat. Reid: um importante basidomiceta lenhícola em árvores urbanas

    Directory of Open Access Journals (Sweden)

    Ana Paula Ramos

    2008-12-01

    Full Text Available Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of heartwood. In some cases, chlamydospores masses and basidiocarps occurred on trunks and branches, especially on trees with more than 40 cm of DBH. Considering the increasingly importance of I. rickii and being C. australis one of the most important ornamental species used in the green areas of Lisbon, morphological and cultural characteristics of the pathogen are presented and its impact as agent of decline of urban trees is discussed.Inonotus rickii é um basidiomiceta que causa cancros, exsudações e podridão branca do cerne em diversas espécies arbóreas, tendo sido identificado em Portugal em 2002. No presente trabalho pretendeu-se avaliar a incidência da doença causada por I. rickii em Celtis australis, numa zona de Lisboa onde esta espécie é a principal árvore de alinhamento. A incidência da doença ronda os 19%, sendo os sintomas mais frequentes a redução do tamanho das folhas, morte de ramos e podridão branca do lenho. Por vezes, observaram-se a presença de massas de clamidósporos e a formação de basidiomas nos troncos e nas pernadas, essencialmente nas árvores com DAP superior a 40 cm. Considerando a importância crescente de I. rickii e sendo o lodão a espécie de eleição da cidade de Lisboa, descrevem-se as características morfológicas e culturais do fungo e discutese o papel que este patogénio pode assumir no declínio do arvoredo urbano.

  8. Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologues, Lim15/Dmc1, but does not stimulate its strand transfer activity

    International Nuclear Information System (INIS)

    PCNA is a multi-functional protein that is involved in various nuclear events. Here we show that PCNA participates in events occurring during early meiotic prophase. Analysis of protein-protein interactions using surface plasmon resonance indicates that Coprinus cinereus PCNA (CoPCNA) specifically interacts with a meiotic specific RecA-like factor, C. cinereus Lim15/Dmc1 (CoLim15) in vitro. The binding efficiency increases with addition of Mg2+ ions, while ATP inhibits the interaction. Co-immunoprecipitation experiments indicate that the CoLim15 protein interacts with the CoPCNA protein in vitro and in the cell extracts. Despite the interaction between these two factors, no enhancement of CoLim15-dependent strand transfer activity by CoPCNA was found in vitro. We propose that the interaction between Lim15/Dmc1 and PCNA mediates the recombination-associated DNA synthesis during meiosis

  9. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    Directory of Open Access Journals (Sweden)

    García Torres Angélica María

    2003-06-01

    Full Text Available La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de éstas es de gran importancia para la degradación de diversas sus­tancias recalcitrantes que muestran similitudes estructurales con la lignina como son los PAH's, PCB's, DDT, colo­rantes azoicos, etc. El trabajo de investigación se realizó utilizando reactores a nivel de matraces y teniendo como sustrato siete diferentes desechos agroindustriales de la región de Santander ( de los cuales se desconoce su pro­ducción de enzimas lignolíticas: tuza de mazorca, bagazo de caña, hoja de pina, cacota de cacao, cereza de café, tamo de arroz, salvado de trigo y paja de trigo. El objetivo general fue evaluar la capacidad de los Basidiomycetes: Trametes versicolor, Pleurotus floridae y Phanerochaete chrysosporium de crecer sobre los desechos agroindustriales y producir las enzimas lignolíticas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; mediante la técnica de fermentación sólida. Se encontró que la producción de enzimas lignolíticas en los sustratos mencionados fue sensible a la concentración de azúcares reductores, condiciones de pH, contenidos de humedad y, dependiente del tipo de inductor presente en el medio de cultivo. El sustrato que presentó una mejor producción de Lacasa y Manganeso-peroxidasa fue la paja de trigo. Se observó la producción de Lignina-peroxidasa en cultivos de tuza de mazorca y salvado de trigo. Palabras clave: enzimas inducibles; Lacasa; Mn-peroxidasa; Li-peroxidasa; desechos agroindustriales; represi

  10. Heterologous expression of fungal cytochromes P450 (CYP5136A1 and CYP5136A3) from the white-rot basidiomycete Phanerochaete chrysosporium: Functionalization with cytochrome b5 in Escherichia coli.

    Science.gov (United States)

    Hatakeyama, Mayumi; Kitaoka, Takuya; Ichinose, Hirofumi

    2016-07-01

    Cytochromes P450 from the white-rot basidiomycete Phanerochaete chrysosporium, CYP5136A1 and CYP5136A3, are capable of catalyzing oxygenation reactions of a wide variety of exogenous compounds, implying their significant roles in the metabolism of xenobiotics by the fungus. It is therefore interesting to explore their biochemistry to better understand fungal biology and to enable the use of fungal enzymes in the biotechnology sector. In the present study, we developed heterologous expression systems for CYP5136A1 and CYP5136A3 using the T7 RNA polymerase/promoter system in Escherichia coli. Expression levels of recombinant P450s were dramatically improved by modifications and optimization of their N-terminal amino acid sequences. A CYP5136A1 reaction system was reconstructed in E. coli whole cells by coexpression of CYP5136A1 and a redox partner, NADPH-dependent P450 reductase (CPR). The catalytic activity of CYP5136A1 was significantly increased when cytochrome b5 (Cyt-b5) was further coexpressed with CPR, indicating that Cyt-b5 supports electron transfer reactions from NAD(P)H to CYP5136A1. Notably, P450 reaction occurred in E. coli cells that harbored CYP5136A1 and Cyt-b5 but not CPR, implying that the reducing equivalents required for the P450 catalytic cycle were transferred via a CPR-independent pathway. Such an "alternative" electron transfer system in CYP5136A1 reaction was also demonstrated using purified enzymes in vitro. The fungal P450 reaction system may be associated with sophisticated electron transfer pathways. PMID:27233123

  11. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  12. First report of Trypanosoma vegrandis in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Barbosa, Amanda; Austen, Jill; Gillett, Amber; Warren, Kristin; Paparini, Andrea; Irwin, Peter; Ryan, Una

    2016-08-01

    The present study describes the first report of Trypanosoma vegrandis in koalas using morphology and sequence analysis of the 18S rRNA gene. The prevalence of T. vegrandis in koalas was 13.6% (6/44). It is likely that the small size of T. vegrandis (potential impacts upon this marsupial species' health. PMID:26970295

  13. Fungal degradation of oil palm cellulosic wastes after radiation pasteurisation

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Hitoshi; Kume, Tamikazu; Ishigaki, Isao (Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment); Mat Rasol Awang; Fajah Bt Ali

    1990-10-01

    The fungal degradation ability was appreciated for upgrading of oil palm cellulosic wastes. In this work, Empty Fruit Bunch (EFB) and Palm press Fiber (PPF) were fermented in an attempt to upgrade to animal feed. However, the heavy contamination of microorganisms in EFB and PPF was observed, and they consist of largely spore forming bacteria and toxigenic moulds of Aspergillus flavus, A. versicolor, A. fumigatus and etc. Therefore, pasteurisation was necessary to be carried out before fermentation, and gamma-irradiation of ca. 10 kGy was employed. Solid-state culture media from EFB and PPF for cultivation of cellulolytic fungi were prepared by addition of some inorganic salts as nitrogen source. The degradation of crude fibre by Coprinus cinereus, Pleurotus species, Aspergillus niger, Trichoderma koningi, and T. viride was obtained in the range between 18 to 76 % after 18 to 20 days cultivation on non-alkali treated cellulosic wastes. C. cinereus could degradate crude fiber more than 50 %, and which resulted in reduction of crude fibre content to 20{approx}28 % and giving to 10-13 % crude protein content. Release of reducing sugars was obtained as 40 to 145 mg glucose/g after saccharification of precultivated alkali-treated EFB by C. cinereus, A. niger, T. knoningi and T. viride. (author).

  14. Fungal degradation of oil palm cellulosic wastes after radiation pasteurisation

    International Nuclear Information System (INIS)

    The fungal degradation ability was appreciated for upgrading of oil palm cellulosic wastes. In this work, Empty Fruit Bunch (EFB) and Palm press Fiber (PPF) were fermented in an attempt to upgrade to animal feed. However, the heavy contamination of microorganisms in EFB and PPF was observed, and they consist of largely spore forming bacteria and toxigenic moulds of Aspergillus flavus, A. versicolor, A. fumigatus and etc. Therefore, pasteurisation was necessary to be carried out before fermentation, and gamma-irradiation of ca. 10 kGy was employed. Solid-state culture media from EFB and PPF for cultivation of cellulolytic fungi were prepared by addition of some inorganic salts as nitrogen source. The degradation of crude fibre by Coprinus cinereus, Pleurotus species, Aspergillus niger, Trichoderma koningi, and T. viride was obtained in the range between 18 to 76 % after 18 to 20 days cultivation on non-alkali treated cellulosic wastes. C. cinereus could degradate crude fiber more than 50 %, and which resulted in reduction of crude fibre content to 20∼28 % and giving to 10-13 % crude protein content. Release of reducing sugars was obtained as 40 to 145 mg glucose/g after saccharification of precultivated alkali-treated EFB by C. cinereus, A. niger, T. knoningi and T. viride. (author)

  15. Análisis de las reacciones de hipersensibilidad tipo I a los basidiomicetes en una población alérgica costarricense, durante 2009 Analysis of the reactions of type I hypersensitivity to the Basidiomycetes in a Costa Rican allergic population during 2009

    Directory of Open Access Journals (Sweden)

    Daniela Jaikel-Víquez

    2012-12-01

    Full Text Available Justificación y objetivos: Costa Rica es un país tropical en donde se ha encontrado una alta concentración de basidiosporas aéreas, las cuales miden alrededor de 4-13µm de diámetro, y son por definición aerobiológicas, capaces de penetrar a tracto respiratorio inferior, irrespetando la barrera nasal. El presente estudio tiene como objetivos encontrar posibles fuentes de contaminación ambiental por basidiomicetes y determinar si en Costa Rica sería necesario analizar, de forma rutinaria, la reactividad por alergenos a basidiomicetes en la población portadora de enfermedad rinobronquial alérgica. Métodos: se determinó el porcentaje de pacientes alérgicos a los extractos de basidiomicetes, tipo carbón Sporisorium cruentum y Ustilago cynodontis y tipo roya Puccinia graminis subsp. graminis. A la vez, se recolectaron panículas de Panicum maximum para evaluar su contaminación por basidiomicetes. Resultados: se encontró que el 59,23% de los pacientes eran alérgicos a hongos y que el tipo de hongo al que más pacientes presentaron alergia fueron los basidiomicetes. El 100% de las panículas recolectadas estaban contaminadas con un hongo del género Ustilago. Conclusión: se recomienda el testeo continuo por basidiomicetes, ya que estos son los hongos a los que la mayoría de los pacientes estudiados presentó alergia.Background and aim: Costa Rica is a tropical country in which a high concentration of aerial basidiospores has been found, which measure between 4-13 µm and are capable of arriving to the lower respiratory system, surpassing the nasal barrier. This study aims to find possible sources of environmental contamination by basidiomycetes and to determine if it is necessary to routinely analyze this allergen in the Costa Rican population that suffer from rhino bronchial allergy. Methods: The percentage of patients allergic to the extracts of basidiomycetes, specifically smuts like Sporisorium cruentum and Ustilago cynodontis

  16. DELIGNIFICACIÓN SELECTIVA DEL PASTO Pennisetum purpureum x Pennisetum typhoides USANDO BASIDIOMICETOS LIGNINOLÍTICOS SELECTIVE DELIGNIFICATION OF THE Pennisetum purpureum x Pennisetum typhoides GRASS USING LIGNINOLYTIC BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Freimar SEGURA S

    2008-01-01

    Full Text Available Muestras de pasto Pennisetum purpureum x Pennisetum typhoides de 120 días de corte se someten durante siete semanas a fermentación selectiva en estado sólido (FES con cepas de Ganoderma ssp y Lentinus ssp. Se realiza la caracterización de la delignificación por Infrarrojo con Transformada de Fourier (IR-TF midiendo las áreas de las principales bandas características. Mediante esta técnica se establece que en las muestras tratadas con Ganoderma spp se obtiene una pérdida del 70% de los compuestos aromáticos con relación a los alifáticos. En las semanas cero y séptima se establecieron valores de lignina en detergente ácido (LDA de 55,9% y 10,7%, respectivamente. En este mismo período los contenidos de materia seca y celulosa variaron del 73,3% al 92,9% y del 3,1% al 51,7% respectivamente. Estos resultados confirman una degradación selectiva de la lignina en las muestras tratadas con Ganoderma spp y medios suplementados con manganeso. Las pruebas de degradabilidad in situ, utilizando la técnica de la bolsa de nailon y de digestibilidad in vitro de la materia seca basada en técnicas enzimáticas y gravimétricas, no mostraron mejoramiento de la digestibilidad de la materia seca del pasto como consecuencia de la fermentación con las dos cepas de hongos basidiomicetos, corroborando lo indicado por otros autores que afirman que los hongos pueden ser tóxicos para la microflora del rumen y, por lo tanto, pueden afectar la digestibilidad de la materia seca.Samples of Pennisetum purpureum x Pennisetum typhoides grass of 120 days are put under selective fermentation in solid state with two strains of basidiomycetes fungi Ganoderma ssp and Lentinus ssp, during seven weeks. The delignification characterization is made by Fourier Transform Infrared Spectroscopy (FTIR measuring the areas of the main characteristic bands. In the samples treated with the Ganoderma ssp strain, a loss of 70% of aromatic compounds in relation to the aliphatics is

  17. Endogenous cytokinins in medicinal basidiomycetes mycelial biomass

    OpenAIRE

    VEDENICHEVA N.P.; AL-MAALI G.A.; MYTROPOLSKA N. YU.; MYKHAYLOVA O.B.; N. A. Bisko; I.V. Kosakivska

    2016-01-01

    The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species ( Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa ) using HPLC. Trans and cis -zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species ( G. lucidum, strain 1900) contain...

  18. Cryopreservation of basidiomycete strains using perlite

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Nerud, František

    2001-01-01

    Roč. 2001, - (2001), s. 1281-1287. ISSN 0167-7012 Institutional research plan: CEZ:AV0Z5020903 Keywords : macrolactone * glycoside * esters Subject RIV: EE - Microbiology, Virology Impact factor: 1.810, year: 2001

  19. Disulfide bonds and glycosylation in fungal peroxidases.

    Science.gov (United States)

    Limongi, P; Kjalke, M; Vind, J; Tams, J W; Johansson, T; Welinder, K G

    1995-01-15

    Four conserved disulfide bonds and N-linked and O-linked glycans of extracellular fungal peroxidases have been identified from studies of a lignin and a manganese peroxidase from Trametes versicolor, and from Coprinus cinereus peroxidase (CIP) and recombinant C. cinereus peroxidase (rCIP) expressed in Aspergillus oryzae. The eight cysteine residues are linked 1-3, 2-7, 4-5 and 6-8, and are located differently from the four conserved disulfide bridges present in the homologous plant peroxidases. CIP and rCIP were identical in their glycosylation pattern, although the extent of glycan chain heterogeneity depended on the fermentation batch. CIP and rCIP have one N-linked glycan composed only of GlcNAc and Man at residue Asn142, and two O-linked glycans near the C-terminus. The major glycoform consists of single Man residues at Thr331 and at Ser338. T. versicolor lignin isoperoxidase TvLP10 contains a single N-linked glycan composed of (GlcNAc)2Man5 bound to Asn103, whereas (GlcNAc)2Man3 was found in T. versicolor manganese isoperoxidase TvMP2 at the same position. In addition, mass spectrometry of the C-terminal peptide of TvMP2 indicated the presence of five Man residues in O-linked glycans. No phosphate was found in these fungal peroxidases. PMID:7851395

  20. Production of antibacterial peptide from bee venom via a new strategy for heterologous expression.

    Science.gov (United States)

    Hou, Chunsheng; Guo, Liqiong; Lin, Junfang; You, Linfeng; Wu, Wuhua

    2014-12-01

    Honey bee is important economic insect that not only pollinates fruits and crops but also provides products with various physiological activities. Bee venom is a functional agent that is widely applied in clinical treatment and pharmacy. Secapin is one of these agents that have a significant role in therapy. The functions of secapin from the bee venom have been documented, but little information is known about its heterologous expression under natural condition. Moreover, few scholars verified experimentally the functions of secapin from bee venom in vitro. In this study, we successfully constructed a heterologous expression vector, which is different from conventional expression system. A transgenic approach was established for transformation of secapin gene from the venom of Apis mellifera carnica (Ac-sec) into the edible fungi, Coprinus cinereus. Ac-sec was encoded by a 234 bp nucleotide that contained a signal peptide domain and two potential phosphorylation sites. The sequence exhibited highly homology with various secapins characterized from honey bee and related species. Southern blot data indicated that Ac-sec was present as single or multiple copy loci in the C. cinereus genome. By co-transformation and double-layer active assay, Ac-sec was expressed successfully in C. cinereus and the antibacterial activity of the recombinants was identified, showing notable antibacterial activities on different bacteria. Although Ac-sec is from the venom of Apidae, phylogenetic analysis demonstrated that Ac-sec was more closely related to that of Vespid than to bee species from Apidae. The molecular characteristics of Ac-sec and the potential roles of small peptides in biology were discussed. PMID:25189650

  1. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  2. Activity patterns of free-ranging koalas (Phascolarctos cinereus revealed by accelerometry.

    Directory of Open Access Journals (Sweden)

    Michelle A Ryan

    Full Text Available An understanding of koala activity patterns is important for measuring the behavioral response of this species to environmental change, but to date has been limited by the logistical challenges of traditional field methodologies. We addressed this knowledge gap by using tri-axial accelerometer data loggers attached to VHF radio collars to examine activity patterns of adult male and female koalas in a high-density population at Cape Otway, Victoria, Australia. Data were obtained from 27 adult koalas over two 7-d periods during the breeding season: 12 in the early-breeding season in November 2010, and 15 in the late-breeding season in January 2011. Multiple 15 minute observation blocks on each animal were used for validation of activity patterns determined from the accelerometer data loggers. Accelerometry was effective in distinguishing between inactive (sleeping, resting and active (grooming, feeding and moving behaviors. Koalas were more active during the early-breeding season with a higher index of movement (overall dynamic body acceleration [ODBA] for both males and females. Koalas showed a distinct temporal pattern of behavior, with most activity occurring from mid-afternoon to early morning. Accelerometry has potential for examining fine-scale behavior of a wide range of arboreal and terrestrial species.

  3. Can Citizen Science Assist in Determining Koala (Phascolarctos cinereus Presence in a Declining Population?

    Directory of Open Access Journals (Sweden)

    Emily Flower

    2016-07-01

    Full Text Available The acceptance and application of citizen science has risen over the last 10 years, with this rise likely attributed to an increase in public awareness surrounding anthropogenic impacts affecting urban ecosystems. Citizen science projects have the potential to expand upon data collected by specialist researchers as they are able to gain access to previously unattainable information, consequently increasing the likelihood of an effective management program. The primary objective of this research was to develop guidelines for a successful regional-scale citizen science project following a critical analysis of 12 existing citizen science case studies. Secondly, the effectiveness of these guidelines was measured through the implementation of a citizen science project, Koala Quest, for the purpose of estimating the presence of koalas in a fragmented landscape. Consequently, this research aimed to determine whether citizen-collected data can augment traditional science research methods, by comparing and contrasting the abundance of koala sightings gathered by citizen scientists and professional researchers. Based upon the guidelines developed, Koala Quest methodologies were designed, the study conducted, and the efficacy of the project assessed. To combat the high variability of estimated koala populations due to differences in counting techniques, a national monitoring and evaluation program is required, in addition to a standardised method for conducting koala population estimates. Citizen science is a useful method for monitoring animals such as the koala, which are sparsely distributed throughout a vast geographical area, as the large numbers of volunteers recruited by a citizen science project are capable of monitoring a similarly broad spatial range.

  4. Perception of male caller identity in Koalas (Phascolarctos cinereus: acoustic analysis and playback experiments.

    Directory of Open Access Journals (Sweden)

    Benjamin D Charlton

    Full Text Available The ability to signal individual identity using vocal signals and distinguish between conspecifics based on vocal cues is important in several mammal species. Furthermore, it can be important for receivers to differentiate between callers in reproductive contexts. In this study, we used acoustic analyses to determine whether male koala bellows are individually distinctive and to investigate the relative importance of different acoustic features for coding individuality. We then used a habituation-discrimination paradigm to investigate whether koalas discriminate between the bellow vocalisations of different male callers. Our results show that male koala bellows are highly individualized, and indicate that cues related to vocal tract filtering contribute the most to vocal identity. In addition, we found that male and female koalas habituated to the bellows of a specific male showed a significant dishabituation when they were presented with bellows from a novel male. The significant reduction in behavioural response to a final rehabituation playback shows this was not a chance rebound in response levels. Our findings indicate that male koala bellows are highly individually distinctive and that the identity of male callers is functionally relevant to male and female koalas during the breeding season. We go on to discuss the biological relevance of signalling identity in this species' sexual communication and the potential practical implications of our findings for acoustic monitoring of male population levels.

  5. Can Citizen Science Assist in Determining Koala (Phascolarctos cinereus) Presence in a Declining Population?

    Science.gov (United States)

    Flower, Emily; Jones, Darryl; Bernede, Lilia

    2016-01-01

    The acceptance and application of citizen science has risen over the last 10 years, with this rise likely attributed to an increase in public awareness surrounding anthropogenic impacts affecting urban ecosystems. Citizen science projects have the potential to expand upon data collected by specialist researchers as they are able to gain access to previously unattainable information, consequently increasing the likelihood of an effective management program. The primary objective of this research was to develop guidelines for a successful regional-scale citizen science project following a critical analysis of 12 existing citizen science case studies. Secondly, the effectiveness of these guidelines was measured through the implementation of a citizen science project, Koala Quest, for the purpose of estimating the presence of koalas in a fragmented landscape. Consequently, this research aimed to determine whether citizen-collected data can augment traditional science research methods, by comparing and contrasting the abundance of koala sightings gathered by citizen scientists and professional researchers. Based upon the guidelines developed, Koala Quest methodologies were designed, the study conducted, and the efficacy of the project assessed. To combat the high variability of estimated koala populations due to differences in counting techniques, a national monitoring and evaluation program is required, in addition to a standardised method for conducting koala population estimates. Citizen science is a useful method for monitoring animals such as the koala, which are sparsely distributed throughout a vast geographical area, as the large numbers of volunteers recruited by a citizen science project are capable of monitoring a similarly broad spatial range. PMID:27429008

  6. The anatomy and histology of the nasal cavity of the koala (Phascolarctos cinereus).

    OpenAIRE

    Kratzing, J E

    1984-01-01

    The anatomy of the nose of the koala was studied from fixed 0.5 cm thick sections of a whole head. Right and left nasal cavities are separated by a slender septum which does not exhibit 'swell bodies'. Dorsal and ventral conchae are simple curved plates without elaborate scrolls; the ventral concha is recurved to form a bulla. The nasal cavity communicates with confluent rostral maxillary and frontal air sinuses. A ventrocaudal maxillary sinus opens from the ventral meatus close to the choana...

  7. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Quintin Lau

    2014-06-01

    Full Text Available Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60 are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII alleles or genotypes, and higher c-hsp 60 antibody levels or chlamydia-associated disease and infertility. In this study, we characterised partial MHCII DAB and DBB genes in female koalas (n = 94 from a single geographic population, and investigated associations among antibody responses to c-hsp60 quantified by ELISA, susceptibility to chlamydial infection, or age. The identification of three candidate MHCII variants provides additional support for the functional role of MHCII in the koala, and will inform more focused future studies. This is the first study to investigate an association between MHC genes with chlamydial pathogenesis in a non-model, free-ranging species.

  8. Social partner discrimination based on sounds and scents in Asian small-clawed otters ( Aonyx cinereus)

    Science.gov (United States)

    Lemasson, A.; Mikus, M.-A.; Blois-Heulin, C.; Lodé, T.

    2013-03-01

    Ability to discriminate familiar conspecifics is an essential competence in any group-living species, ensuring socio-spatial cohesion, but in many animals, such as mustelids, the relative importance of the different communicative modalities for discrimination is poorly understood. In otters, there is evidence of intra-specific variation in physical appearance and in feces chemical profile, but the potential for acoustic identity coding as well as for identity decoding in visual, acoustic and olfactive domains remains unexplored. We investigated the acoustic structure of contact calls in five captive groups of small-clawed otters and found that it is possible to reliably assign one particular call to a given adult male caller. Females discriminated between familiar and unfamiliar adult males based on their sound (playback) and smell (feces) but not based on their picture, suggesting abilities to memorize and use acoustic and olfactive signatures in their daily social life.

  9. Low carbon/nitrogen ratio increases laccase production from basidiomycetes in solid substrate cultivation Reduzida relação carbono/nitrogênio aumenta a produção de lacase por basidiomicetos em cultivo de semissólido

    Directory of Open Access Journals (Sweden)

    Érica Clarissa D'Agostini

    2011-06-01

    Full Text Available Basidiomycetes are laccase producers used for hydrolysis of lignocellulosic byproducts in fermentative processes and could be used on biofuel production or ruminant feeding. The objective of this study was to evaluate the effect of concentrations of non-protein nitrogen sources on laccase production and mycelial growth of Pleurotus ostreatus, Lentinula edodes and Agaricus blazei. The fungi were grown on soybean hulls to which urea (U, ammonium sulfate (AS or mixture of AS:U (1:1 were added to achieve carbon/nitrogen (C/N ratios of 5, 15, 20 or 30. The average longitudinal mycelial growth was measured and laccase activity was determined by the oxidation of 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid. Higher C/N ratios increased mycelial growth and decreased laccase production. The highest activities were obtained with a C/N ratio of 5. P. ostreatus, L. edodes and A. blazei produced more laccase when AS, AS:U and U, respectively, were added. In addition, C/N ratios lower than 30 induced laccase syntheses, inhibited mycelial growth and were a better condition for pre-hydrolysis of plant residues.Basidiomicetos são produtores de lacases utilizadas na hidrólise de subprodutos lignocelulósicos em processos fermentativos e pode ser utilizado na produção de biocombustíveis ou na alimentação de ruminantes. Avaliou-se o efeito da adição de fontes e concentrações de nitrogênio não-protéico na produção de lacase e no crescimento micelial de Pleurotus ostreatus, Lentinula edodes e Agaricus blazei. Os fungos foram cultivados em cascas de soja com adição de uréia (U, sulfato de amônio (AS ou AS:U (1:1 de forma a manter a relação carbono/ nitrogênio (C/N de 5, 15, 20 ou 30. O crescimento micelial longitudinal médio foi medido, e a atividade da lacase foi determinada pela oxidação do ácido 2,2'-azino-bis-3-etilbenzotiazolina-6-sulfônico. O crescimento micelial foi diretamente proporcional à relação C/N, enquanto a

  10. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  11. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015). E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.234, year: 2014

  12. A New p-Terphenyl Derivative from Basidiomycetes Boletopsis grisea

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new p-terphenyl derivative 1 was isolated from the fruiting bodies of Boletopsis grisea. Its structure was established as 2, 3-diacetoxy-4', 4", 5, 6-tetrahydroxy-p-terphenyl by spectroscopic and chemical means.

  13. Prevalence of transcription factors in ascomycete and basidiomycete fungi

    OpenAIRE

    Todd, Richard B.; Zhou, Miaomiao; Ohm, Robin A.; Leeggangers, Hendrika ACF; Visser, Loek; de Vries, Ronald P

    2014-01-01

    Background Gene regulation underlies fungal physiology and therefore is a major factor in fungal biodiversity. Analysis of genome sequences has revealed a large number of putative transcription factors in most fungal genomes. The presence of fungal orthologs for individual regulators has been analysed and appears to be highly variable with some regulators widely conserved and others showing narrow distribution. Although genome-scale transcription factor surveys have been performed before, no ...

  14. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448. ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  15. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125. ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  16. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S; Kharb, D.; Raghukumar, C.; Kuhad, R

    isolate RCK-3 was found to decolorizemore of Congo Red (69%), Xylidine Ponceau 2R (100%), Poly R-478 (96%), Indigo Carmine (99%), Lissamine Green B (90%), Toluidine Blue (57%) and textile effluent B (54%), than the rest of fungi. Percentage decolorization...

  17. Transgene expression in the basidiomycete root pathogen Armillaria mellea.

    Science.gov (United States)

    Toward development of a genetic transformation system for Armillaria mellea, we used particle bombardment to identify promoters for driving transgene expression. The plasmid tested was pYES-hph-004iGFP, on which the green fluorescence protein gene, gfp, is linked to the Agaricus bisporus gpdII promo...

  18. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  19. Characterization of the systems governing sexual and self-recognition in the white rot homobasidiomycete Amylostereum areolatum.

    Science.gov (United States)

    van der Nest, Magriet A; Slippers, Bernard; Stenlid, Jan; Wilken, Pieter M; Vasaitis, Rimvis; Wingfield, Michael J; Wingfield, Brenda D

    2008-06-01

    This study considered the systems controlling sexual and self-recognition in Amylostereum areolatum, a homobasidiomycetous symbiont of the Sirex woodwasp. To investigate the structure and organization of these systems in A. areolatum, we identified a portion of a putative homologue (RAB1) of the pheromone receptor genes of Schizophyllum commune and Coprinus cinereus, and a portion of a putative homologue of the S. commune mitochondrial intermediate peptidase (mip) gene. Diagnostic DNA-based assays for mating-type were developed and their application confirmed that the fungus has a heterothallic tetrapolar mating system. Segregation analysis showed that RAB1 is linked to mating-type B, while mip is linked to mating-type A. The results of sexual and vegetative compatibility tests suggest that sexual recognition in A. areolatum is controlled by two multiallelic mat loci, while self-recognition is controlled by at least two multiallelic het loci. Therefore, despite the association of A. areolatum with the woodwasp and the unique mixture of sexual and clonal reproduction of the fungus, both recognition systems of the fungus appear to be similar in structure and function to those of other homobasidiomycetes. This is the first report regarding the genes controlling recognition of a homobasidiomycete involved in an obligate mutualistic relationship with an insect. PMID:18414867

  20. Preliminary study on isolation and quality analysis of enzymes from fermented oil palm empty fruit bunch

    International Nuclear Information System (INIS)

    Palm Empty Fruit Bunch (EFB) is a cellulosic waste, consisting of 40 - 60 % cellulose with the remaining components comprised of hemicellulose, lignin and other materials. Cellulase is a complex of enzymes containing chiefly endo and exo glucanase, as well as cellobiase plus others (Mandel et al, 1976). Studies on cellulase production from Trichodermaa viride have been reported. The enzyme system from this fungi is considered to be a complete composition of cellulase; and it was reported to be able to hydrolyse slowly a more resistant or crystalline portion of cellulose. Previous work showed Pleorotus sajor-caju and Coprinus cinereus can be easily grown on EFB. The quality of this enzyme system was characterized based on its degradation activity on filter paper, salicin and xylan into simple sugars. These activity tests would revealed the ability of cellulase enzyme system to break down insoluble cellulose, and hydrolysing salicin such as cellobiose and xylanase for breaking down hemicellulose. In this study, the enzyme system derived from liquid state fermentation by these fungi utilizing EFB as carbon source was investigated

  1. Scale-up fermentation of oil palm empty fruit bunch to produce ruminant feed by radiation processing

    International Nuclear Information System (INIS)

    Scale-up fermentation and irradiation conditions of empty fruit bunch (EFB) of oil palm were examined to produce a large amount of fermented products for animal feeds. The EFB substrates pasteurized by irradiation were inoculated with Coprinus cinereus. After 1 month incubation, the crude fiber contents decreased to 20 - 38% and crude protein contents increased to 9 - 13% in small scale fermentation using conical flask (6 - 20 g EFB). In the case of fermentation using polypropylene bags with 400 g EFB, crude fiber and protein contents were 32 - 34% and 11 - 14%, respectively. A larger plastic container packed with 1.5 kg EFB fiber of 10cm thickness was used for mushroom cultivation. After harvest of mushroom (yields were about 250 g per container), the quality of residual substrates improved further as reflected by its crude fiber content of only 16 - 20%, crude protein content of 6 - 8%. These results show that a large volume of products are available under the good aeration by increasing the number of plastic bags or containers. For the irradiation of a lot of fermentation substrates, the advantage of 60Co gamma-ray and electron beam irradiator was also discussed. (author)

  2. The Distribution and Abundance of an Island Population of Koalas (Phascolarctos cinereus) in the Far North of Their Geographic Range

    OpenAIRE

    McGregor, Denise C.; Sarah E Kerr; Krockenberger, Andrew K.

    2013-01-01

    Koalas are an iconic species of charismatic megafauna, of substantial social and conservation significance. They are widely distributed, often at low densities, and individuals can be difficult to detect, making population surveys challenging and costly. Consequently, koala population estimates have been limited and the results inconsistent. The aims of this study were to estimate the distribution, relative abundance and population size of the koalas on Magnetic Island, far north Queensland. ...

  3. The distribution and abundance of an island population of Koalas (Phascolarctos cinereus in the far north of their geographic range.

    Directory of Open Access Journals (Sweden)

    Denise C McGregor

    Full Text Available Koalas are an iconic species of charismatic megafauna, of substantial social and conservation significance. They are widely distributed, often at low densities, and individuals can be difficult to detect, making population surveys challenging and costly. Consequently, koala population estimates have been limited and the results inconsistent. The aims of this study were to estimate the distribution, relative abundance and population size of the koalas on Magnetic Island, far north Queensland. Population densities were estimated in 18 different vegetation types present on the island using a Fecal Standing Crop Method. Koala density ranged from 0.404 ha(-1, recorded in forest red gum and bloodwood woodland, to absence from eight of the vegetation types surveyed. The second highest density of 0.297 koalas ha(-1 was recorded in mixed eucalypt woodland, which covers 45% of the island. The total abundance of koalas on Magnetic Island, not including those present in urban areas, was estimated at 825±175 (SEM. The large variation in koala density across vegetation types reinforces the need for sampling stratification when calculating abundance over large areas, as uniformity of habitat quality cannot be assumed. In this context, koala populations also occur in low densities in areas generally regarded as poor quality koala habitat. These results highlight the importance of protecting vegetation communities not traditionally considered to have high conservation value to koalas, as these habitats may be essential for maintaining viable, widespread, low-density populations. The results from this study provide a baseline to assess future trends in koala distribution, density and abundance on Magnetic Island.

  4. Topography of the major superficial lymph nodes and their efferent lymph pathways in the koala (Phascolarctos cinereus).

    OpenAIRE

    Hanger, J J; Heath, T J

    1991-01-01

    The koala has an inguinoaxillary lymph trunk on either side of the ventral midline, and this carries efferent lymph from the superficial inguinal lymph node directly to the deep axillary lymph node. The superficial lymph nodes are large and soft compared with those of the domestic species, and each lymph centre usually contains only one or two large lymph nodes. Koalas have a rostral mandibular lymph node which has not been described in other species, but lack popliteal and subiliac lymph nod...

  5. Assessing The Welfare Of Captive Asian Small-Clawed Otters (Amblonyx cinereus): Can Inductive Methods Play A Part?

    OpenAIRE

    Wright L.C.

    2003-01-01

    A large number of factors need to be taken into account when assessing an animal's welfare under field conditions. Grounded Theory, an inductive method, might be of use in correlating these factors with the results of scientific studies to produce a freely available IT tool that could be used by relatively untrained persons to assess the welfare of animals. This ongoing work is intended to establish whether inductive techniques can contribute to welfare assessment of captive Asian Small-Clawe...

  6. First report of a spermatic granuloma and varicocele in a marsupial: A Koala (Phascolarctos cinereus) Case Study.

    Science.gov (United States)

    Schultz, B K; Palmieri, C; Nicolson, V; Larkin, R; Keeley, T; McGowan, M; Johnston, S D

    2016-08-01

    This study reports the first documented clinical case of a spermatic granuloma and varicocele in a marsupial. Initial clinical presentation included gross morphological changes in the left scrotal cord, epididymis and testis. Ultrasonography of the scrotum and spermatic cord, and gross and histopathological examination after hemicastration, confirmed the condition as a spermatic granuloma affecting the left caput epididymis, with a varicocele in the left proximal spermatic cord, which was causing azoospermia and infertility. Semen quality and serum testosterone secretion following a GnRH challenge was assessed prior to, and following surgery. After hemi-castration, an increase in androgen secretion to within normal reference ranges for the koala was observed with a subsequent increase in semen production and sperm quality resulting in the sire of a pouch young, 12months later. PMID:27473971

  7. Potential ‘Ecological Traps’ of Restored Landscapes: Koalas Phascolarctos cinereus Re-Occupy a Rehabilitated Mine Site

    OpenAIRE

    Romane H. Cristescu; Banks, Peter B.; Carrick, Frank N.; Frère, Céline

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations...

  8. Season- and age-related reproductive changes based on fecal androgen concentrations in male koalas, Phascolarctos cinereus.

    Science.gov (United States)

    Kusuda, Satoshi; Hashikawa, Hisashi; Takeda, Masato; Ito, Hideki; Goto, Atsushi; Oguchi, Jun; Doi, Osamu

    2013-01-01

    The purposes of the present study were to clarify age- and season- related androgen patterns, and to compare the reproductive physiology between Japanese captive koala populations and Australian populations. To measure fecal androgens, feces were collected from male koalas (4.2 to 13.8 years of age) kept in Japanese zoos. Fecal androgens were extracted with methanol from the lyophilized samples and determined by enzyme immunoassay using 4-androstene-3,17-dione antibody. Fecal androgen concentration in male koalas increased after sexual maturation and remained relatively high until old age. In the survey with the Japanese zoo studbook of koalas, copulation (conception) month showed a pyramid shape with a peak in March to June (60.7%) in koalas born and reared in Japanese zoos and from July to April with the highest concentration in September to January (69.7%) in Australian institutes. Japanese zoo koala populations have a characteristic physiological cycle adapted to Japan's seasonal changes. The suitable month of year for copulation or conception in Japan is diametrically opposed to that in Australia. Mean fecal androgen concentrations by month in the males born and reared in Japan indicated annual changes with the highest concentration in May and the lowest value in November. Fecal androgen analysis may be a noninvasive alternative tool to monitor circulating testosterone and may be helpful in understanding reproductive activity and physiology in male koalas. PMID:23502854

  9. Espécies raras de Phallales (Agaricomycetidae, Basidiomycetes no Nordeste do Brasil Rare species of Phallales (Agaricomycetidae, Basidiomycetes in Northeast Brazil

    Directory of Open Access Journals (Sweden)

    Anileide Gomes Leite

    2007-03-01

    Full Text Available Seis espécies interessantes de Phallales são registradas para a Mata Atlântica: Aseroë floriformis Baseia & Calonge, Geastrum setiferum Baseia, Ileodictyon cibarium Tulasne ex Raoul, Laternea triscapa Turpin, Phallus pygmaeus Baseia e Staheliomyces cinctus E. Fischer. Adicionalmente, são fornecidas chave de identificação e comentários sobre a taxonomia e ecologia dessas espécies.Six interesting species of Phallales are recorded from the Atlantic rainforest: Aseroë floriformis Baseia & Calonge, Geastrum setiferum Baseia, Ileodictyon cibarium Tulasne ex Raoul, Laternea triscapa Turpin, Phallus pygmaeus Baseia and Staheliomyces cinctus E. Fischer. A key and comments on taxonomy and ecology of these species are also provided.

  10. Coprophilous fungi of the horse.

    Science.gov (United States)

    Pointelli, E; Santa-maria, M A; Caretta, G

    1981-05-01

    A total of 1267 microfungi, including 35 Myxomycetes, were recorded from the fecal samples of the 60 horses; of these 395 were found on 20 saddle-horse feces, 363 on 20 race-horses and 509 on 20 working horses. Eighty two species representing 53 genera were recorded; of these 7 were Zygomycetes, 18 Ascomycetes, 1 Basidiomycetes and 25 Fungi Imperfecti: 2 Myxomycetes. Common coprophilous fungi are in decreasing order Pilobolus kleinii, Saccobolus depauperatus, Mucor hiemalis, Lasiobolus ciliatus, Podospora curvula, Petriella guttulata, M. circinelloides, Coprinus radiatus, Dictyostelium mucoroides, Sordaria fimicola, C. miser, C. stercorariusm, Acremonium sp., Coprotus granuliformis, Graphium putredinis, Iodophanus carneus, Chaetomium murorum, Podospora communis, P. inaequalis, P. setosa, Saccobolus versicolor and Cladosporium cucumerinum. Species of Myrothecium verrucaria, Actinomucor elegans, Kernia nitida, Spiculostilbella dendritica and Mucor parvispora were found exclusively in working-horses feces. Badhamia sp., Anixiopsis stercoraria, Echinobotryum state of D. stemonitis, Geotrichum candidum and Oidiodendron sp. were found only in saddle-horses feces. Chlamidomyces palmarum, Philocopra sp. were found exclusively in race-horses feces. Notes on infrequent or interesting fungi include Thamnostylum piriforme, Phialocephala dimorphospora, Rhopalomyces elegans and Spiculostilbella dendritica. PMID:7242651

  11. Upgrading of oil palm wastes to animal feeds

    International Nuclear Information System (INIS)

    A huge amount of agricultural wastes are discarded or burned causing the serious environmental pollution problems in the world. Upgrading of these wastes into useful end-products is suggested not only to recycle the agro-resources but also to reduce pollution. Empty fruit bunch (EFB), stalk material after fruit stripping, is a major cellulosic waste of the palm oil industry. The current availability of EFB in Malaysia is estimated to be 3 million tones per year. EFB is normally incinerated to produce bunch ash. Burning and incineration processes emit considerable amount of smokes and pollutants thus affecting surrounding areas. Recently, it has been realized that there is a need to utilize these by-products effectively in order to improve the economic situation of the oil palm industry as well as to reduce pollution problems. EFB is a valuable and useful biomass. This paper describes the production of animal feed and mushroom from oil palm wastes by radiation and fermentation treatment. The process is as follows: decontamination of microorganisms in fermentation media of EFB by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 30 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, Coprinus cinereus and Pleurotus sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased and the crude fiber content decreased after solid state fermentation. P.sajor-caju was suitable for the mushroom production on EFB with rich bran and the residue can be used as the ruminant animal feeds. It is expected that the process is applicable to other cellulosic wastes such as sugar cane bagasse, rice straw, etc. produced in other Asian countries, and contribute to reduce the environmental pollution problems. (author)

  12. ИСПОЛЬЗОВАНИЕ ДЕРЕВОРАЗРУШАЮЩИХ ГРИБОВ КЛАССА BASIDIOMYCETES В НЕТРАДИЦИОННОЙ МЕДИЦИНЕ (АМУРСКАЯ ОБЛАСТЬ)

    OpenAIRE

    Кочунова, Наталья

    2014-01-01

    В последние годы, как за рубежом, так и в России усиленно ведутся поиск и испытание новых лекарственных препаратов, полученных из грибов. Перспективным источником целебных веществ являются базидиальные грибы (класс Basidiomycetes ), В статье приводятся литературные сведения и собственные данные относительно лекарственных свойств 52 видов дереворазрушающих базидиальных грибов, распространенных в Амурской области и перспективных для использования местным населением в нетрадиционной медицине. Ра...

  13. Degradation of lignin and humic substances in forest soil by saprotrophic basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    České Budějovice: Ústav půdní biologie BC AV ČR, 2009, s. 170-179. ISBN 978-80-86525-16-7. [Život v půdě /10./. České Budějovice (CZ), 27.01.2009-28.01.2009] R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : soil * enzyme * interaction Subject RIV: EE - Microbiology, Virology

  14. Evaluation of Pb (II) biosorption utilizing sugarcane bagasse colonized by Basidiomycetes.

    Science.gov (United States)

    Palin, D; Rufato, K B; Linde, G A; Colauto, N B; Caetano, J; Alberton, O; Jesus, D A; Dragunski, D C

    2016-05-01

    The contamination of water resources by metallic ions is a serious risk to public health and the environment. Therefore, a great emphasis has been given to alternative biosorption methods that are based on the retention of aqueous-solution pollutants; in the last decades, several agricultural residues have been explored as low-cost adsorbent. In this study, the ability of Pb (II) biosorption using sugarcane bagasse modified by different fungal species was evaluated. The presence of carbonyl, hydroxyl, and carboxyl groups in the biosorbent was observed by spectroscopy in the infrared region. By scanning electron microscopy, changes in the morphology of modified material surfaces were observed. The highest adsorption capacity occurred at pH 5.0, while the shorter adsorbate-adsorbent equilibrium was at 20 min, and the system followed the pseudo-second-order model. The maximum biosorption in isotherms was found at 58.34 mg g(-1) for modified residue by Pleurotus ostreatus U2-11, and the system followed the Langmuir isotherm. The biosorption process was energetically spontaneous with low desorption values. This modification showed great potential for filters to remove Pb (II) and provide the preservation of water resources and animal health. PMID:27063515

  15. Transformation of lignin and humic acids by extracellular enzymes of saprotrophic basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    Gent : Universiteit Gent, 2009, s. 271-272. ISBN 978-90-813924-1-9. [International Conference on Textile and Polymer Biotechnology /6./. Gent (BE), 23.09.2009-25.09.2009] R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : soil * fungi * enzyme Subject RIV: EE - Microbiology, Virology

  16. Antioxidant Effects of Medicinal Mushrooms Agaricus brasiliensis and Ganoderma lucidum (Higher Basidiomycetes): Evidence from Animal Studies.

    Science.gov (United States)

    Yurkiv, Borys; Wasser, Solomon P; Nevo, Eviatar; Sybirna, Nataliya O

    2015-01-01

    With diabetes mellitus and increased glucose concentrations, the mitochondria electron transport chain is disrupted, superoxide anions are overproduced, and oxidative stress develops in cells. Thus, preventing oxidative stress can produce a decrease in the antioxidant system activity and an increase in apoptosis in immune cells. The application of medicinal mushrooms is a new possible approach to diabetes mellitus treatment. Therefore, the aim of this work was to investigate the influence of administration of the medicinal mushrooms Agaricus brasiliensis and Ganoderma lucidum on antioxidant enzyme activity in rat leukocytes. Wistar outbred white rats were used in the study. Streptozotocin was intraperitoneally injected once at a dose of 50 mg/kg body weight. Mushroom preparations were orally administered at a dose of 1 g/kg/day for 2 weeks. This revealed that in diabetes mellitus, the level of antioxidant enzyme activity is significantly decreased compared with control values, whereas the levels of lipid peroxidation is increased; this manifested in an increase in the amount of thiobarbituric acid reactive substances (TBARS). The medicinal mushrooms' administration is accompanied by an increase in antioxidant enzyme activity to control values and is even higher in the case of A. brasiliensis administration when compared with the diabetic group. As for the indicators of lipid peroxidation under mushroom administration of A. brasiliensis and G. lucidum, we observed a significant decrease of TBARS levels compared with the diabetic group. Increased activity of antioxidant enzymes and reduction of TBARS level indicate pronounced antioxidant properties of studied mushrooms. PMID:26756186

  17. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  18. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium.

    OpenAIRE

    Boominathan, K; Dass, S B; Randall, T A; Kelley, R.L.; Reddy, C A

    1990-01-01

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study we isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin----14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical...

  19. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12. ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  20. Phylogenetic, genomic organization and expression analysis of hydrophobin genes in the ectomycorrhizal basidiomycete Laccaria bicolor

    OpenAIRE

    Plett, Jonathan M.

    2014-01-01

    Hydrophobins are morphogenetic, small secreted hydrophobic fungal proteins produced in response to changing development and environmental conditions. These proteins are important in the interaction between certain fungi and their hosts. In mutualistic ectomycorrhizal fungi several hydrophobins form a subclass of mycorrhizal-induced small secreted proteins that are likely to be critical in the formation of the symbiotic interface with host root cells. In this study, two genomes of the ectomyco...

  1. Studies on ectomycorrhizal basidiomycete in pine forest on the Lithuania-Poland transboundary region

    OpenAIRE

    Danutė Stankovičienė; Jonas Kaspravičius

    2013-01-01

    The diversity of ectomycorrhizal fungi and sporocarps abundance were investigated in 2003-2005 at nine permanent study plots in a 50-year-old pine forest. Diversity of ectomycorrhizal fungi consisted of 53 taxa and the majority of them belonged to the genera Cortinarius, Russula, Amanita and Tricholoma. The most frequent species, whose fruit bodies were found in each study plot, were C. cibarius, L. necator L. rufus, P. involutus, R. aeruginea, T. saponaceum and the most abundant species whic...

  2. A fungal conserved gene from the basidiomycete Hebeloma cylindrosporum is essential for efficient ectomycorrhiza formation.

    Science.gov (United States)

    Doré, Jeanne; Marmeisse, Roland; Combier, Jean-Philippe; Gay, Gilles

    2014-10-01

    We used Agrobacterium-mediated insertional mutagenesis to identify genes in the ectomycorrhizal fungus Hebeloma cylindrosporum that are essential for efficient mycorrhiza formation. One of the mutants presented a dramatically reduced ability to form ectomycorrhizas when grown in the presence of Pinus pinaster. It failed to form mycorrhizas in the presence of glucose at 0.5 g liter(-1), a condition favorable for mycorrhiza formation by the wild-type strain. However, it formed few mycorrhizas when glucose was replaced by fructose or when glucose concentration was increased to 1 g liter(-1). Scanning electron microscopy examination of these mycorrhizas revealed that this mutant was unable to differentiate true fungal sheath and Hartig net. Molecular analyses showed that the single-copy disrupting T-DNA was integrated 6,884 bp downstream from the start codon, of an open reading frame potentially encoding a 3,096-amino-acid-long protein. This gene, which we named HcMycE1, has orthologs in numerous fungi as well as different other eukaryotic microorganisms. RNAi inactivation of HcMycE1 in the wild-type strain also led to a mycorrhizal defect, demonstrating that the nonmycorrhizal phenotype of the mutant was due to mutagenic T-DNA integration in HcMycE1. In the wild-type strain colonizing P. pinaster roots, HcMycE1 was transiently upregulated before symbiotic structure differentiation. Together with the inability of the mutant to differentiate these structures, this suggests that HcMycE1 plays a crucial role upstream of the fungal sheath and Hartig net differentiation. This study provides the first characterization of a fungal mutant altered in mycorrhizal ability. PMID:24918768

  3. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    in high-nitrogen medium (24 mM N), but no LIP activity was seen. In media containing lignocellulosic substrates such as pine, poplar, or sugarcane bagasse as the sole source of carbon and nitrogen, relatively hgih MNP and moderate levels of laccases were...

  4. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens. PMID:27279445

  5. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study the authors isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin →14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical conditions, produced 96 U of lignin peroxidase per liter. Both the wild type and the mutant produced comparable levels of manganese peroxidase and glucose oxidases, a key H2O2-generating secondary metabolic enzyme in P. chrysosporium. Fast protein liquid chromatographic analysis of the concentrated extracellular fluid of the lip mutant confirmed that it produced only heme proteins with manganese peroxidase activities were produced by the wild type. The lip mutant appears to be a regulatory mutant that is defective in the production of all the lignin peroxidases

  6. Genetic characterization of isolates of the basidiomycete Agaricus blazei by RAPD

    Directory of Open Access Journals (Sweden)

    Colauto Nelson Barros

    2002-01-01

    Full Text Available The genetic divergence of five isolates of Agaricus blazei was determined based on RAPD data. Results indicate that there is little genetic variability among the commercialized strains and that RAPD is a feasible and low cost technique that can be used to characterize this fungus.

  7. Genetic characterization of isolates of the basidiomycete Agaricus blazei by RAPD

    OpenAIRE

    Colauto Nelson Barros; Dias Eustáquio Souza; Gimenes Marcos Aparecido; Eira Augusto Ferreira da

    2002-01-01

    The genetic divergence of five isolates of Agaricus blazei was determined based on RAPD data. Results indicate that there is little genetic variability among the commercialized strains and that RAPD is a feasible and low cost technique that can be used to characterize this fungus.

  8. Phallus indusiatus Vent. & Pers. (Basidiomycetes - a new generic record for Eastern Ghats of India

    Directory of Open Access Journals (Sweden)

    P.K. Dash

    2010-07-01

    Full Text Available A mushroom fungus Phallus indusiatus Vent. & Pers. (commonly called Long Net Stinkhorn belonging to the order Phallales in the fungal phylum Basidiomycotina was collected from a bamboo thicket near the foothills of the Kutrumali Hill range in Koraput District of Orissa, representing a new distributional record for the Eastern Ghats of India.

  9. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands

    OpenAIRE

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-01-01

    Background Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and s...

  10. Response of the Higher Basidiomycetic Ganoderma resinaceum to Sodium Chloride Stress

    OpenAIRE

    Mahmoud, Yehia A. G.; Mohamed, Eman H. F. A.; Abd Elzaher, E. H. F.

    2007-01-01

    Ganoderma resinaceum tolerated sodium chloride salt stress within a range of 0 mM till 300 mM. It responded to salt stress with fluctuation in proline formation at different NaCl concentrations. However,the mycelial dry weight,total protein contents and exopolysaccharides did not changed considerably. Increasing sodium chloride concentration led to morphological alteration in fungal mycelia with disappearance of fungal cell wall,plasmolysis,and vacuolation as indicated with electron microscop...

  11. Antioxidant Properties and Antioxidant Compounds of Various Extracts from the Edible Basidiomycete Grifola Frondosa (Maitake)

    OpenAIRE

    Kaun-Tzer Wu; Cheng-Fang Tsai; Li-Hui Hsieh; Jan-Ying Yeh

    2011-01-01

    Grifola frondosa is an edible mushroom currently available in Taiwan. Ethanolic, cold-water and hot-water extracts were prepared and their antioxidant properties were investigated. At 1 mg/mL, G. frondosa T1 and T2 cold-water extracts showed high reducing powers of 1.02 and 0.50, respectively. Chelating abilities on ferrous ions of G. frondosa T1 and T2 were higher for cold-water extracts than for ethanolic and hot-water extracts. For the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl (D...

  12. Antioxidant properties and antioxidant compounds of various extracts from the edible basidiomycete Grifola frondosa (Maitake).

    Science.gov (United States)

    Yeh, Jan-Ying; Hsieh, Li-Hui; Wu, Kaun-Tzer; Tsai, Cheng-Fang

    2011-01-01

    Grifola frondosa is an edible mushroom currently available in Taiwan. Ethanolic, cold-water and hot-water extracts were prepared and their antioxidant properties were investigated. At 1 mg/mL, G. frondosa T1 and T2 cold-water extracts showed high reducing powers of 1.02 and 0.50, respectively. Chelating abilities on ferrous ions of G. frondosa T1 and T2 were higher for cold-water extracts than for ethanolic and hot-water extracts. For the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical, G. frondosa T1 and T2 extracts were effective in the following order: ethanolic > hot-water > cold-water. The G. frondosa hot-water extract showed high scavenging ability on superoxide anions. Total phenols, flavonoids, ascorbic acid and α-tocopherol are the major antioxidant components found in the various G. frondosa extracts. Based on EC(50) values (<20 mg/mL) obtained, the various extracts from G. frondosa investigated in this study display potent antioxidative properties. PMID:21499220

  13. Antioxidant Properties and Antioxidant Compounds of Various Extracts from the Edible Basidiomycete Grifola Frondosa (Maitake

    Directory of Open Access Journals (Sweden)

    Kaun-Tzer Wu

    2011-04-01

    Full Text Available Grifola frondosa is an edible mushroom currently available in Taiwan. Ethanolic, cold-water and hot-water extracts were prepared and their antioxidant properties were investigated. At 1 mg/mL, G. frondosa T1 and T2 cold-water extracts showed high reducing powers of 1.02 and 0.50, respectively. Chelating abilities on ferrous ions of G. frondosa T1 and T2 were higher for cold-water extracts than for ethanolic and hot-water extracts. For the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl (DPPH radical, G. frondosa T1 and T2 extracts were effective in the following order: ethanolic > hot-water > cold-water. The G. frondosa hot-water extract showed high scavenging ability on superoxide anions. Total phenols, flavonoids, ascorbic acid and α-tocopherol are the major antioxidant components found in the various G. frondosa extracts. Based on EC50 values (

  14. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  15. Influence of cryopreservation on activities of ligninolytic enzymes in some white-rot basidiomycete strains

    Czech Academy of Sciences Publication Activity Database

    Stoychev, I.; Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    Praha: Mikrobiologický ústav AV ČR, 1997 - (Gabriel, J.; Novotný, Č.). s. 76-77 [Mini-Symposium on Biosorption and Microbial Degradations /5./. 24.11.1997-28.11.1997, Praha] R&D Projects: GA ČR GA206/97/0853

  16. Coconut lumber for wood decks (Cocos nucifera L.):decay resistance against Basidiomycetes fungi

    OpenAIRE

    Jourez, Benoît; Verheyen, Cécile; Van Acker, Joris

    2011-01-01

    Since a couple of years, manufactured products of coconut wood for outdoor uses like wood decks have been proposed on the European market. These are presented as an alternative for traditional tropical timbers. In the past, coconut wood was neglected and burned for sanitary reasons and lack of interest at industrial scale. Plantation coconut trees at end of production of copra constitute a renewable resource with high added value. In order to convince the markets, natural durability for outdo...

  17. Crystallization of selenomethionyl exo-β-1,3-galactanase from the basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Selenomethionyl exo-β-1,3-galactanase from P. chrysosporium K-3 produced in Pichia pastoris was crystallized. The crystals diffracted to a resolution of 1.8 Å and belonged to space group P21. Exo-β-1,3-galactanase from Phanerochaete chrysosporium (Pc1,3Gal43A) consists of a glycoside hydrolase family 43 catalytic domain and a substrate-binding domain that belongs to carbohydrate-binding module family 35. It catalyzes the hydrolysis of β-1,3-galactan, which is the backbone of the arabinogalactan proteins; the C-terminal carbohydrate-binding module family 35 domain increases the local concentration of the enzyme around β-1,3-galactan by its high affinity for the substrate. To enable phase determination using the multiwavelength anomalous dispersion method, selenomethionyl Pc1,3Gal43A was crystallized at 298 K using the hanging-drop vapour-diffusion method. The presence of selenium in the crystals was confirmed from the X-ray absorption spectrum. The crystals belonged to space group P21 and diffracted to 1.8 Å resolution

  18. Chemical constituents of Stereum subtomentosum and two other birch-associated basidiomycetes: An interspecies comparative study

    Czech Academy of Sciences Publication Activity Database

    Hybelbauerová, S.; Sejbal, J.; Dračínský, Martin; Hahnová, H.; Koutek, Bohumír

    2008-01-01

    Roč. 5, č. 5 (2008), s. 743-750. ISSN 1612-1872 Institutional research plan: CEZ:AV0Z40550506 Keywords : Stereum subtomentosum * Trametes versicolor * Piptoporus betulinus * steroids * saccharides Subject RIV: CC - Organic Chemistry Impact factor: 1.659, year: 2008

  19. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415. ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  20. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80. ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  1. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455. ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  2. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2,6-dichloroindophenol. While L. shimeji P2Ox is the least thermostable of these three enzymes (melting temperature Tm of 54.9°C; half-life time of activity τ1/2 of 0.12 at 50°C and pH 6.5, P. chrysosporium P2Ox showed remarkable thermostability with Tm of 75.4°C and τ1/2 of 96 h under identical conditions.

  3. Studies on ectomycorrhizal basidiomycete in pine forest on the Lithuania-Poland transboundary region

    Directory of Open Access Journals (Sweden)

    Danutė Stankovičienė

    2013-12-01

    Full Text Available The diversity of ectomycorrhizal fungi and sporocarps abundance were investigated in 2003-2005 at nine permanent study plots in a 50-year-old pine forest. Diversity of ectomycorrhizal fungi consisted of 53 taxa and the majority of them belonged to the genera Cortinarius, Russula, Amanita and Tricholoma. The most frequent species, whose fruit bodies were found in each study plot, were C. cibarius, L. necator L. rufus, P. involutus, R. aeruginea, T. saponaceum and the most abundant species which made the main part of total sporocarp yield were C. cibarius and P. involutus. The lowest species richness of ectomycorrhizal fungi was in study plots with the densest cover of grasses. Maximum of species over the fruiting period was characteristic for October and for September. It was noticed that some species virtually never occurred together at the same plot (eg. C. cibarius and H. aurantiaca, meanwhile others occurred together quite frequently (eg. H.aurantiaca and X. badius.

  4. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426. ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  5. Activity and spatial distribution of lignocellulose-degrading enzymes during forest soil colonization by saprotrophic basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Valášková, Vendula; Merhautová, Věra; Cajthaml, Tomáš; Baldrian, Petr

    2008-01-01

    Roč. 43, č. 2 (2008), s. 186-192. ISSN 0141-0229 R&D Projects: GA ČR GA526/05/0168; GA AV ČR KJB600200516 Institutional research plan: CEZ:AV0Z50200510 Keywords : lignocellulose * soil * litter Subject RIV: EE - Microbiology, Virology Impact factor: 2.375, year: 2008

  6. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90. ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  7. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  8. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials. PMID:24586250

  9. Photomonitoring of Delmarva Fox Squirrel (Sciurus niger cinereus, DFS) on the Prime Hook National Wildlife Refuge during the summer of 2008.

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The primary goal of this photomonitoring was to determine the status of the Prime Hook National Wildlife Refuge Delmarva Fox Squirrel population. The Photomonitor...

  10. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  11. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    .8-2.0 μm, with a distinct sympodial rachis of up to 70 μm long on which blastoconidia are formed, much like a bunch of grapes. Conidia 2.5-3.5 x 1.6-2.5 μm, one-celled, ellipsoidal to clavate-ellipsoidal, with a rather broad base, pale brownish; conidia...

  12. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660. ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  13. High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples

    OpenAIRE

    Toju, Hirokazu; Tanabe, Akifumi S; Yamamoto, Satoshi; Sato, Hirotoshi

    2012-01-01

    The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS) region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage ...

  14. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application. PMID:26854104

  15. Enhancement of Shelf Life of Button Mushroom, Agaricus bisporus (Higher Basidiomycetes) by Fumigant Application of Lippia alba Essential Oil.

    Science.gov (United States)

    Vishwakarma, Pratima; Pandey, Abhay K; Mishra, Priyanka; Singh, Pooja; Tripathi, N N

    2015-01-01

    Eleven essential oils isolated from higher plant species were assessed against the four isolates of Verticillium fungicola found on fruiting bodies of Agaricus bisporus. Eucalyptus citriodora and Lippia alba oils were more efficacious and completely inhibited the mycelial growth of fungal isolates. L. alba oil was fungistatic and fungicidal at 10- and 20-µL concentrations against all of the isolates, respectively, and was more potent than E. citriodora oil as well as some prevalent synthetic fungicides such as benomyl, ethylene dibromide, and phosphine. Eighty microliters of L. alba oil protected 500 g of fruiting bodies of A. bisporus for up to 7 d from infection of the fungus under in vivo conditions. The findings strengthen the possibility of L. alba oil as a plant-based protectant to enhance the shelf life of A. bisporus fruiting bodies. PMID:25746409

  16. Review on Chaga Medicinal Mushroom, Inonotus obliquus (Higher Basidiomycetes): Realm of Medicinal Applications and Approaches on Estimating its Resource Potential.

    Science.gov (United States)

    Balandaykin, Mikhail E; Zmitrovich, Ivan V

    2015-01-01

    This paper presents a review of the realm of medicinal applications of Inonotus obliquus raw materials, sterile conks I. obliquus, based on the bibliographies of chemical studies of the fungus. The experimental part of the paper is devoted to the presentation of methods of estimating the resource potential of this fungus based on data obtained in the comfort zone of ththis species. A new form, I. obliquus f. sterilis, is formally described. PMID:25746615

  17. Contrasting Diversity and Host Association of Ectomycorrhizal Basidiomycetes versus Root-Associated Ascomycetes in a Dipterocarp Rainforest

    OpenAIRE

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large...

  18. Chemical Composition and Medicinal Value of the New Ganoderma tsugae var. jannieae CBS-120304 Medicinal Higher Basidiomycete Mushroom.

    Science.gov (United States)

    Chan, Jannie Siew Lee; Asatiani, Mikheil D; Sharvit, Lital E; Trabelcy, Beny; Barseghyan, Gayane S; Wasser, Solomon P

    2015-01-01

    In this research, the chemical composition and anticancer and antioxidant activity of the new medicinal mushroom Ganoderma tsugae var. jannieae CBS-120304 were evaluated. The chemical composition assay includes amounts of total carbohydrates and proteins, amino acids, fatty acids, micro- and macroelements, and vitamins. The investigated medicinal mushroom seemed to be a rich source of nutritional components. Mycelium accumulated more than 2-fold more total protein compared with the fruiting body and reached 37% and 16% of dry weight, respectively. Carbohydrate content in the fruiting body seemed to be conspicuously higher than in the mycelium (50% of dry weight) and reached 80% of dry weight. Quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, and linoleic acid were the major fatty acids. Toxic elements, such as silver, arsenic, cadmium, and mercury, were found only in trace amounts in mycelium and were not detected in the fruiting body. Furthermore, the 1,1-diphenyl-2-picrylhydrazyl free radical scavenging assay was used to evaluate antioxidant activity. The highest radical scavenging activity was 9.0 mg/mL (65.9%) by ethanol extract. In addition, mycelial extracts were tested to inhibit MCF7 breast cancer cells. Ganoderma tsugae var. jannieae ethyl acetate extract (GTEAE) extract showed high potential by inhibiting reporter activity by more than 70%. Results demonstrated that GTEAE had a strong effect on inhibitory protein κΒα level in the higher concentration used (200 gg/mL), which could be compared with the effect of parthenolide. Furthermore, GTEAE demonstrated strong inhibition of IκΒα phosphorylation. PMID:26559860

  19. 吉林省担子菌补记(七)%Notes on Basidiomycetes of Jilin Province(Ⅶ)

    Institute of Scientific and Technical Information of China (English)

    范宇光; 图力古尔

    2006-01-01

    报道了吉林省新记录分布担子菌6种,即肉褐鳞环柄菇(Lepiota brunneoincarnata Chodat & C.Martín)、短柄銛囊蘑[Melanoleuca brevipes(Bull.)Pat]、紫皮丽蘑[Calocybe ionides(Bull.)Donk]、皮尔松湿伞(Hygrophorus persoonii Arnolds)、微黄拟锁瑚菌[Clavulinopsis helvola(Pers.)]和弹球菌(Sphaerobolus stellatus Tode).其中,弹球菌属为吉林省新记录属.凭证标本存放于吉林农业大学菌物标本馆(HMJAU).

  20. Complex Enzyme-Assisted Extraction, Purification, and Antioxidant Activity of Polysaccharides from the Button Mushroom, Agaricus bisporus (Higher Basidiomycetes).

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Zhou, Xinghai

    2015-01-01

    Agaricus bisporus polysaccharides (ABP) were extracted by complex enzyme-assisted extraction methodology. The following were optimal conditions for the extraction of crude ABP: complex enzyme amount, 2.2%; temperature, 62°C; time, 3 h; and pH, 4. Under these conditions, the experimental yield of crude ABP was 6.87%. The crude ABP was purified by diethylaminoethyl-cellulose 52 chromatography and Sephadex G-100 chromatography, and one fraction-namely, ABP-1-was produced. The ABP-1 contained 93.67% carbohydrate, 1.46% protein, and 0.62% uronic acid. The constituent monosaccharides were predominantly glucose, galactose, mannose, and xylose. The antioxidant activities of ABP-1 were investigated by measuring its scavenging ability on 2,2-diphenyl-1-picrylhydrazyl and hydroxyl radicals, its ferric-reducing activity power, and the reducing power assay. At a concentration of 1.2 mg/mL, ABP-1 seemed to possess good free radical scavenging activity, with a scavenging value of about 56%. The results indicate that ABP-1 has good antioxidant activity. PMID:26756190

  1. Submerged Culture of Grifola gargal and G. sordulenta (Higher Basidiomycetes) from Argentina as a Source of Mycelia with Antioxidant Activity.

    Science.gov (United States)

    Postemsky, Pablo Daniel; Curvetto, Néstor Raúl

    2015-01-01

    Submerged culture is an alternative mycelium source for Grifola gargal and G. sordulenta, two rare edible mushrooms related to Grifola frondosa. This work studies their mycelia as a source of antioxidants. The efficient concentrations of methanolic extracts in both radical scavenging (RS) and reducing power (RP) abilities in G. gargal and in G. sordulenta showed a high antioxidant activity. In the experimental design used, the antioxidant activity mainly depended on the culture conditions rather than on the media composition. Irrespective of the basal culture medium, mycelium methanolic extracts of G. sordulenta obtained from culture in Erlenmeyer flasks showed equivalents to ascorbic acid (EQ(AA)) RS-EQ(AA) and RP-EQ(AA) contents higher than the corresponding values obtained with jar cultures. Under stationary cultivation, G. sordulenta produced approximately 50% higher content in both RS-EQ(AA) and RP-EQ(AA) than the medicinal mushroom G. frondosa. Phenolics correlated with RS-EQ(AA) and RP-EQ(AA) in G. gargal and with RP-EQ(AA) in G. sordulenta; besides, thin-layer chromatography showed these compounds to be at least in part related to the RS capacity. It is concluded that G. gargal and G. sordulenta mycelia are excellent sources of antioxidant metabolites. PMID:25746407

  2. Purification and characterization of a novel small-molecule polysaccharide from the Maitake medicinal mushroom Grifola frondosa (higher Basidiomycetes).

    Science.gov (United States)

    Zhou, Changyan; Qiao, Yanru; Tang, Qingjiu; Jia, Wei; Liu, Yanfang; Wu, Aizhong

    2013-01-01

    A novel small-molecule polysaccharide with a molecular mass of 2.6 kDa, was isolated from the culinary-medicinal Maitake mushroom Grifola frondosa. GFPS is composed of fucose, rhamnose, galactose, glucose, and mannose; galactose, glucose, and mannose were the dominant monosaccharides. Absorption peaks at 1077 cm-1, 1024 cm-1, and 873 cm-1, as revealed by infrared spectrum, suggesting that GFPS consists of pyranoside. GFPS significantly enhanced the production of nitric oxide and secretion of cytokines (tumor necrosis factor-α, interleukin-1β, and interleukin-δ) from macrophages in vitro. These results indicate that this novel small-molecule polysaccharide might be beneficial for immune defense. PMID:23557366

  3. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos. PMID:27100524

  4. Precipitation diagram and optimization of crystallization conditions at low ionic strength for deglycosylated dye-decolorizing peroxidase from a basidiomycete

    International Nuclear Information System (INIS)

    Precipitation phase diagrams can be rapidly constructed using dispensing-robot technology. These diagrams provide information that assists in optimization of crystal growth. The growth of suitably sized protein crystals is essential for protein structure determination by X-ray crystallography. In general, crystals are grown using a trial-and-error method. However, these methods have been modified with the advent of microlitre dispensing-robot technology and of protocols that rapidly screen for crystal nucleation conditions. The use of one such automatic dispenser for mixing protein drops (1.3–2.0 µl in volume) of known concentration and pH with precipitating solutions (ejecting 2.0 µl droplets) containing salt is described here. The results of the experiments are relevant to a crystallization approach based on a two-step procedure: screening for the crystal nucleation step employing robotics followed by optimization of the crystallization conditions using incomplete factorial experimental design. Large crystals have successfully been obtained using quantities as small as 3.52 mg protein

  5. Species richness and abundance of ectomycorrhizal basidiomycete sporocarps on a moisture gradient in the Tsuga heterophylla zone

    Science.gov (United States)

    O'Dell, Thomas E.; Ammirati, Joseph F.; Schreiner, Edward G.

    1999-01-01

    Sporocarps of epigeous ectomycorrhizal fungi and vegetation data were collected from eight Tsuga heterophylla (Raf.) Sarg. - Pseudotsuga menziesii (Mirb.) Franco stands along a wet to dry gradient in Olympic National Park, Washington, U.S.A. One hundred and fifty species of ectomycorrhizal fungi were collected from a total sample area of 2.08 ha. Over 2 years, fungal species richness ranged from 19 to 67 taxa per stand. Sporocarp standing crop ranged from 0 to 3.8 kg/ha, averaging 0.58 kg/ha, 0.06 kg/ha in spring and 0.97 kg/ha in fall. Sporocarp standing crop and fungal species richness were correlated with precipitation. These results demonstrated that ectomycorrhizal fungal sporocarp abundance and species richness can be partly explained in terms of an environmental gradient.

  6. Protective Effects of Black Hoof Medicinal Mushroom from Korea, Phellinus linteus (Higher Basidiomycetes), on Osteoporosis In Vitro and In Vivo.

    Science.gov (United States)

    Kim, In-Ho; Chung, Min-Yu; Shin, Ji Young; Han, Daeseok

    2016-01-01

    The protective effect of Phellinus linteus (ethanol extract) against osteoporosis was investigated using the Saos-2 human osteoblast-like cell line and osteoclasts. A nontoxic concentration of Ph. linteus (10-2 to 10-8 mg mL-1) increased alkaline phosphatase (ALP) (EC 3.1.3.1) activity to a larger extent than soy did. Ph. linteus also attenuated the number and the activity of tartrate-resistant acid phosphatase-positive multinucleated osteoclasts. These results indicate that Ph. linteus likely regulated both osteoblasts and osteoclasts, contributing to the protection against osteoporosis. The protective effect of Ph. linteus was examined in ovariectomized (OVX) rats. Histological analysis indicates that Ph. linteus improved trabecular bone mass and reduced osteoclast frequency without affecting lipid droplet accumulation in the femur of OVX rats. A Ph. linteus supplementation for 12 weeks also significantly increased serum ALP activity and reduced urinary deoxypyridinoline level in OVX rats. Ultimately, we found that 12-week Ph. linteus supplementation increased the bone accumulation of minerals, including calcium, magnesium, and phosphorus. Collectively, Ph. linteus protected against osteoporosis by balancing the number of osteoblasts and osteoclasts, which was particularly associated with increased ALP activity in vitro and in vivo and mineral accumulation in bone. PMID:27279443

  7. Chemical Constituents of the Basidiomycetes Marasmius maximus Hongo%大皮伞化学成分研究

    Institute of Scientific and Technical Information of China (English)

    牛芸

    2013-01-01

    大皮伞(Marasmius maximus Hongo)是食用菌类,在我国各地均有分布,对其主要化学成分进行研究具有重要的意义.通过运用多种分离与分析方法(CC、TLC、prep.TLC、MPLC、HPLC等)以及波谱学技术(1D NMR、2D NMR、MS、HR-MS、UV/Vis等)并借助必要的化学手段对其发酵液进行化学成分的研究,共分离得到5个化合物.分别为:麦角甾-4,6,8 (14)22-四烯-3-酮、(22E,24R)-麦角甾-7,22-二烯-3β,5α,6β-三醇、邻苯二甲酸二异丁酯、三亚麻油酸甘油酯、5-Hydroxymethl-1-2-呋喃甲醛.

  8. Notes on Basidiomycetes of Jilin Province (Ⅳ)%吉林省担子菌补记(四)

    Institute of Scientific and Technical Information of China (English)

    图力古尔; 李玉

    2003-01-01

    报道了吉林省新分布担子菌6种,即刺孢蜡蘑Laccaria tortilis (Bolt.) S.F.Gray,大型皮伞Marasmius maximus Hongo,粗毛原迷孔菌Protodaedalea hispida Imazeki,巢孔菌 Poronidulus conchifer (Schw.) Murr.中华散尾菌Lysurus sinensis Lioyd和袋形地星Geastrum saccatum (Fr.) Fisch..其中,原迷孔菌属和巢孔菌属为吉林省新记录属.

  9. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  10. Gymnopilus tuxtlensis (Basidiomycetes, Agaricales), especie tropical conocida de México y América del Sur

    OpenAIRE

    Laura Guzm\\u00E1n-D\\u00E1valos; Mar\\u00EDa de Jes\\u00FAs Herrera; Beatriz E. Cardona; Yamill\\u00E9 Saldarriaga

    2006-01-01

    Gymnopilus tuxtlensis fue descrito a partir de ejemplares recolectados en la región de Los Tuxtlas, Veracruz, México. En este trabajo se estudiaron más de 20 materiales recolectados recientemente o depositados en herbarios, con lo que se amplía su distribución conocida en México al registrarla de Jalisco, y se cita por primera vez de América del Sur, con base en especímenes de Colombia y Venezuela. Esta especie crece en regiones tropicales y es muy característica por su basidio...

  11. Gymnopilus tuxtlensis (Basidiomycetes, Agaricales, especie tropical conocida de México y América del Sur

    Directory of Open Access Journals (Sweden)

    Laura Guzm\\u00E1n-D\\u00E1valos

    2006-01-01

    Full Text Available Gymnopilus tuxtlensis fue descrito a partir de ejemplares recolectados en la región de Los Tuxtlas, Veracruz, México. En este trabajo se estudiaron más de 20 materiales recolectados recientemente o depositados en herbarios, con lo que se amplía su distribución conocida en México al registrarla de Jalisco, y se cita por primera vez de América del Sur, con base en especímenes de Colombia y Venezuela. Esta especie crece en regiones tropicales y es muy característica por su basidioma pequeño, de color amarillo-mostaza, con una base estrigosa, por presentar pleurocistidios grandes y de forma característica, y queilocistidios más pequeños.

  12. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Science.gov (United States)

    Tsuji, Masaharu; Yokota, Yuji; Shimohara, Kodai; Kudoh, Sakae; Hoshino, Tamotsu

    2013-01-01

    Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6%) to Mrakia blollopis CBS8921(T) in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD) removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions. PMID:23516630

  13. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  14. An Application of Wastewater Treatment in a Cold Environment and Stable Lipase Production of Antarctic Basidiomycetous Yeast Mrakia blollopis

    OpenAIRE

    Tsuji, Masaharu; Yokota, Yuji; Shimohara, Kodai; Kudoh, Sakae; Hoshino, Tamotsu

    2013-01-01

    Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6%) to Mrakia blollopis CBS8921T in ITS and D1/D2 sequences and had two unique characteristics when ap...

  15. Isolation and Characterization of a Ubiquitin-Like Ribonuclease from the Cultured Deep Root Mushroom, Oudemansiella radicata (Higher Basidiomycetes).

    Science.gov (United States)

    Liu, Qin; Chen, Hao; Wang, Hexiang; Ng, Tzi Bun

    2015-01-01

    The isolation of a novel 13.5-kDa ribonuclease, displaying a ubiquitin-like inner peptide sequence, from dried fruiting bodies of the cultured mushroom Oudemansiella radicata (Relhan: Fr.) Singer (=Xerula radicata) is reported. The purification protocol deployed encompassed sequentially, cation/anion exchange chromatography on CM-cellulose, DEAE-cellulose and SP-Sepharose, and FPLC-gel filtration on a Superdex 75 column. The purified enzyme manifested optimum activity at 70 °C and pH 4.6, respectively. The activity of the RNase was inhibited by the majority of metal ions tested, especially Al3+, Hg2+, and Cd2+ ions, but was promoted by K+ ions. It exhibited the highest ribonucleolytic activity toward poly (C), lower activity toward poly (G), and negligible activity toward poly (U) and poly (A). Compared with mushroom ubiquitin-like RNases reported earlier, O. radicata RNase possesses a larger molecular mass, distinctive chromatographic behavior on DEAE-cellulose, a lower optimum pH, and a unique polyhomoribonucleotide specificity. PMID:26853958

  16. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants. PMID:17898510

  17. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids

    OpenAIRE

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  18. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis. PMID:24526638

  19. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. PMID:20564650

  20. Effects of vacuum and modified atmosphere packaging on shell life of salted pike eel (Muraenesox cinereus) fillets%气调和真空包装对腌制海鳗货架期的影响

    Institute of Scientific and Technical Information of China (English)

    章银良; 毛多斌

    2009-01-01

    The purpose of the study was to evaluate the shelf life of salted pike eel packaged with air, vacuum and modified atmosphere at 25℃. The samples were divided into four treatments: packaged with air(the controir, M1), vacuum(M2), CO2/N2(40%/60%, M3) and CO2(M4), which were monitored the indexs of Total Volatile Base Nitrogen(TVB-N), Trimethylamine (TMA), pH value, Thiobarbiturie Acid-Reactive Substances(TBARS) and Total Viable Counts (TVC). The shelf life of salted pike eel was found to be 20 days with Modified-Atmosphere Packaging(MAP), 19 days with vacuum packaging(VP), 16 days with air packaging. Bacteria grew most quickly in salted pike eel packaged with air (M1), and the lowest counts of bacteria were found in the sample with MAP(M4). The formation of TVB-N increased with time of storage. The change of TMA-N value was similar to that of TVB-N. The sensory quality of salted pike eel in MAP groups was significantly (P<0.05) higher than that of the control group. The MAP and VP were more effective package for preservation of salted pike eel than other treatments, especially packaging with 100% CO2.%该文主要考察25℃下气调和真空包装对腌制海鳗货架期的影响.4个样品分别是M1:空气包装(对照),M2:真空包装,M3:CO2/N2,40%/60%,M4:100%CO2,以挥发性盐基氮,三甲胺,pH值,硫代巴比妥酸值,菌落总数和感官为指标.结果表明,气调包装的货架期为20 d,真空包装为19 d,对照为16 d.对照组细菌增加很快,而M4增加最慢.挥发性盐基氮和三甲胺都随着储存时间延长而增加,在气调包装下的感官质量明显好于对照组.气调和真空包装,特别是100%CO2包装是保藏腌制海鳗的最有效方法.

  1. Litter degradation by the saprotrophic basidiomycete Hypholoma fasciculare and the changes of microbial community composition in fungus-colonized soil and wood

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Gunneviek, P. K.; do Boer, W.; Baldrian, Petr

    Manchester: BMS, 2007, s. 38-38. [Annual Scientific Meeting 2007. Manchester (GB), 09.09.2007-12.09.2007] R&D Projects: GA ČR GA303/06/0974; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : forest litter * microbial community * degradation Subject RIV: EE - Microbiology, Virology

  2. Cryptococcus randhawai sp. nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India.

    Science.gov (United States)

    Khan, Zia U; Ahmad, Suhail; Hagen, Ferry; Fell, Jack W; Kowshik, Tusharantak; Chandy, Rachel; Boekhout, Teun

    2010-03-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region sequences, the isolate belonged to the Cryptococcus albidus cluster (Filobasidiales, Tremellomycetes) and was closely related to Cryptococcus saitoi, Cryptococcus cerealis and Cryptococcus friedmannii with 98% sequence identity. Phenotypically, the species differed from C. saitoi with respect to growth temperature (up to 37degrees C), presence of a thin capsule, ability to grow in the absence of vitamins, and inability to assimilate citrate and ethylamine. With respect to C. friedmannii, it differed in growth temperature, ability to assimilate lactose, raffinose, L: -rhamnose, myo-inositol, and inability to utilize citrate. Furthermore, our isolate also differed from C. cerealis in growth temperature, presence of capsule and inability to assimilate L: -sorbose. In view of the above phenotypic differences and unique rDNA sequences, we consider that our isolate represents a new species of Cryptococcus, and therefore, a new species, Cryptococcus randhawai is proposed for this taxon. The type strain J11/2002 has been deposited in the culture collection of the Centraalbureau voor Schimmelcultures (CBS10160) and CABI Biosciences (IMI 393306). PMID:20091225

  3. Cryptococcus randhawai sp nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India

    NARCIS (Netherlands)

    Khan, Z.U.; Ahmad, S.; Hagen, F.; Fell, J.W.; Kowshik, T.; Chandy, R.; Boekhout, T.

    2010-01-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region seque

  4. EFFECT OF DIFFERENT CULTURE CONDITIONS AND INDUCERS ON PRODUCTION OF LACCASE BY A BASIDIOMYCETE FUNGAL ISOLATE PLEUROTUS OSTREATUS HP-1 UNDER SOLID STATE FERMENTATION

    Directory of Open Access Journals (Sweden)

    Hardik Patel

    2009-02-01

    Full Text Available The production of laccase by an indigenous strain of Pleurotus ostreatus HP-1 was studied on solid state fermentation. Culture parameters such as type and concentration of substrate, inoculum size, moisture content, pH, surfactant presence, temperature, and nitrogen source were optimized by conventional “one factor at a time” methodology. A maximum laccase yield of 3952 U g-1 of dry substrate optimized was obtained with wheat straw as substrate with five agar plugs as the inoculum, 60% moisture content, pH 5.0, surfactant concentration 0.015 gl-1, and nitrogen source (combination of L-asparagine and NH4NO3 at 10 mM concentration each at incubation temperature 28oC. Enhancement in laccase activity was achieved with the use of various aromatic inducers and copper sulphate. Highest laccase activity of 14189 U g-1 of dry substrate was achieved using 0.28 mM copper sulphate under optimized conditions. Thus, the indigenous isolate seems to be a potential producer of laccase using SSF and can be exploited for further biotechnological applications. The process also promises economic utilization and value addition of agro-residues.

  5. EFFECT OF DIFFERENT CULTURE CONDITIONS AND INDUCERS ON PRODUCTION OF LACCASE BY A BASIDIOMYCETE FUNGAL ISOLATE PLEUROTUS OSTREATUS HP-1 UNDER SOLID STATE FERMENTATION

    OpenAIRE

    Hardik Patel; Akshaya Gupte; Shilpa Gupte

    2009-01-01

    The production of laccase by an indigenous strain of Pleurotus ostreatus HP-1 was studied on solid state fermentation. Culture parameters such as type and concentration of substrate, inoculum size, moisture content, pH, surfactant presence, temperature, and nitrogen source were optimized by conventional “one factor at a time” methodology. A maximum laccase yield of 3952 U g-1 of dry substrate optimized was obtained with wheat straw as substrate with five agar plugs as the inoculum, 60% moist...

  6. Bioinformatic Identification of Potential MicroRNAs and Their Targets in the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes).

    Science.gov (United States)

    Mu, Da-Shuai; Li, Chenyang; Shi, Liang; Zhang, Xuchen; Ren, Ang; Zhao, Ming-Wen

    2015-01-01

    MicroRNAs (miRNAs) are a class of small, endogenous, noncoding RNA molecules that negatively regulate gene expression at the transcriptional or the post-transcriptional level. Although a large number of miRNAs have been identified in many species, especially model plants and animals, miRNAs in fungi remain largely unknown. In this study, based on a database of expressed sequence tags in Ganoderma lucidum, 89 potential miRNAs were identified using computational methods. Real-time polymerase chain reaction analysis of miRNA-like samples prepared from G. lucidum at different development stages revealed that miRNA-like RNAs were differentially expressed in different stages. Furthermore, a total of 28 potential targets were found based on near-perfect or perfect complementarity between the randomly selected 9 miRNA-like RNAs and the target sequences, and potential targets for G. lucidum miRNA-like RNAs were predicted. Finally, we studied the expression pattern of 4 target genes in 3 different development stages of G. lucidum to further understand the mechanism of interaction between miRNA-like RNAs and their target genes. Our analysis paves the way toward identifying fungal miRNA-like RNAs that might be involved in various physiological and cellular differentiation processes. PMID:26559864

  7. Phytochelatin synthase is required for tolerating metal toxicity in a basidiomycete yeast and is a conserved factor involved in metal homeostasis in fungi

    OpenAIRE

    Shine, Alaina M; Shakya, Viplendra PS; Idnurm, Alexander

    2015-01-01

    Background Phytochelatin synthase (PCS) is an enzyme that catalyzes the biosynthesis of phytochelatin from glutathione. Phytochelatins protect cells against the toxic effects of non-essential heavy metals, such as cadmium, and hence growth is restricted in the presence of these metals in mutants in PCS-encoding genes. PCS genes from fungi have been characterized in only two species in the Ascomycota, and these genes are considered sparsely distributed in the fungal kingdom. Results A gene enc...

  8. The physiology of basidiomycete linear organs. III. Uptake and translocation of radiocaesium within differentiated mycelia of Armillaris spp. growing in microcosms and in the field

    International Nuclear Information System (INIS)

    Autoradiography and quantitative image analysis were used to measure 137Cs distribution and translocation through mycelia of A. gallica Marxmuller & Romagn. and A. ostoyae (Romagn.) Herink growing in small microcosms in the laboratory. Rhizomorphs of A. gallica were labelled with 134Cs in the field, and the translocation of radiolabel measured after excavation and destructive harvesting. The flux of radiocaesium through rhizomorphs was estimated to be greater than through undifferentiated hyphae, and greater through rhizomorphs growing in the field than through rhizomorphs grown across homogeneous media in the laboratory. Differentiation within mycelia resulting in melanization or rhizomorph formation gave rise to increased heterogeneity in the 137Cs distribution through laboratory microcosms compared with that through microcosms containing undifferentiated mycelia. Radiocaesium leaked from undifferentiated hyphae into the surrounding medium, but melanized regions of the mycelium appeared to be conservative for radiocaesium. These findings provide further evidence for the importance of filamentous fungi in determining the distribution and rate of release of radiocaesium currently present in the environment as a result of weapons testing and the accident at the Chernobyl nuclear reactor

  9. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp. PMID:24941167

  10. Aqueous extract from a Chaga medicinal mushroom, Inonotus obliquus (higher Basidiomycetes), prevents herpes simplex virus entry through inhibition of viral-induced membrane fusion.

    Science.gov (United States)

    Pan, Hong-Hui; Yu, Xiong-Tao; Li, Ting; Wu, Hong-Ling; Jiao, Chun-Wei; Cai, Mian-Hua; Li, Xiang-Min; Xie, Yi-Zhen; Wang, Yi; Peng, Tao

    2013-01-01

    Chaga medicinal mushroom, Inonotus obliquus, a popular prescription in traditional medicine in Europe and Asia, was used to reduce inflammation in the nasopharynx and to facilitate breathing. The aqueous extract from I. obliquus (AEIO) exhibited marked decrease in herpes simplex virus (HSV) infection (the 50% inhibitory concentration was 3.82 μg/mL in the plaque reduction assay and 12.29 μg/mL in the HSV-1/blue assay) as well as safety in Vero cells (the 50% cellular cytotoxicity was > 1 mg/mL, and selection index was > 80). Using a time course assay, effective stage analysis, and fusion inhibition assay, the mechanism of anti-HSV activity was found against the early stage of viral infection through inhibition of viral-induced membrane fusion. Therefore, AEIO could effectively prevent HSV-1 entry by acting on viral glycoproteins, leading to the prevention of membrane fusion, which is different from nucleoside analog antiherpetics. PMID:23510282

  11. Hepatoprotective Activity of Water Extracts from Chaga Medicinal Mushroom, Inonotus obliquus (Higher Basidiomycetes) Against Tert-Butyl Hydroperoxide-Induced Oxidative Liver Injury in Primary Cultured Rat Hepatocytes.

    Science.gov (United States)

    Hong, Ki Bae; Noh, Dong Ouk; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    We examined the hepatoprotective activity of Inonotus obliquus water extract (IO-W) against tert-butyl hydroperoxide (t-BHP)-induced oxidative liver injury in the primary cultured rat hepatocyte. The 50% radical scavenging concentrations (SC50s) of IO-W for radical-scavenging activity against 2,2'-azino-bis-(3-ethylbenzothi- azoline-6-sulfonic acid) (ABTS) and 1,1-diphenyl-2-picryl-hydrazyl (DPPH) were 5.19 mg/mL and 0.39 mg/mL, respectively. IO-W pretreatment to the primary cultured hepatocytes significantly (p100 µg/ mL). In conclusion, this study demonstrates that IO-W exhibited hepatoprotective activity against t-BHP-induced oxidative liver injury in the primary cultured hepatocyte probably via its abilities of quenching free radicals, inhibiting the leakage of ALT, AST, and LDH, and decreasing MDA formation. PMID:26853962

  12. Inhibitory effects of a polysaccharide extract from the Chaga medicinal mushroom, Inonotus obliquus (higher Basidiomycetes), on the proliferation of human neurogliocytoma cells.

    Science.gov (United States)

    Ning, Xianbin; Luo, Qi; Li, Chuang; Ding, Zhaoyi; Pang, Jinfeng; Zhao, Changfu

    2014-01-01

    This study aimed to investigate the inhibitory roles of a polysaccharide extract from Inonotus obliquus on U251 human neurogliocytoma cells cultured in vitro. After administering the polysaccharide extract from I. obliquus to U251 cells cultivated in vitro, methyl thiazolyl tetrazoliym assay was performed to measure the inhibitory effects of the extract on tumor cell proliferation. The expression of the apoptosis-related proteins Bcl-2 and caspase-3 were determined by Western blotting. Different concentrations of I. obliquus extract (25, 50, 100, 200, and 500 µg/mL) were added to U251 cells at 24, 48, and 72 hours. Methyl thiazolyl tetrazoliym assay showed that the inhibition ratio increased with increased extract concentration and prolonged treatment duration. The I. obliquus extract sharply decreased the expression of Bcl-2 but dramatically increased the expression of caspase-3. This function was gradually enhanced with increased drug concentration and prolonged treatment duration. The I. obliquus extract can inhibit the proliferation of tumor cells. This inhibition function is closely related to the downregulation of Bcl-2 and the upregulation of caspase-3. PMID:24940902

  13. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with degree of soil organic matter humification and available electrolytes

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Soukupová, Lucie; Gryndlerová, Hana; Baldrian, Petr; Hršelová, Hana

    2010-01-01

    Roč. 55, č. 5 (2010), s. 454-460. ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : mixed forest * fungi * community Subject RIV: EE - Microbiology, Virology Impact factor: 0.977, year: 2010

  14. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells.

    Science.gov (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan

    2015-01-01

    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells. PMID:25954906

  15. Hot Water Extracts of the Royal Sun Mushroom, Agaricus brasiliensis (Higher Basidiomycetes), Inhibit Platelet Activation via the P2Y1 Receptor.

    Science.gov (United States)

    Akahane, Katsuyuki; Satoh, Kaneo; Ohta, Masato; Ozaki, Yukio

    2015-01-01

    Hot water extracts of the medicinal mushroom Agaricus brasiliensis were investigated for their inhibition of platelet aggregation. The extracts significantly inhibited human platelet aggregation induced by adenosine 5'-diphosphate (ADP), but not by collagen or thrombin receptor-activating peptide. The extracts also had a significant inhibitory effect on shape change and intracellular calcium mobilization induced by ADP via inhibition of ADP binding to the P2Y1 receptor. In addition, oral administration of the extracts resulted in prolonged tail bleeding time in mice. The marked antiplatelet activity of the mushroom extracts involving the P2Y1 receptor suggests their potential therapeutic use against vascular disorders. PMID:26559862

  16. Immunomodulating activities of cultivated maitake medicinal mushroom Grifola frondosa (Dicks.: Fr.) S.F. Gray (higher Basidiomycetes) on peripheral blood mononuclear cells.

    Science.gov (United States)

    Svagelj, Mirjan; Berovic, Marin; Gregori, Andrej; Wraber, Branka; Simcic, Sasa; Boh, Bojana

    2012-01-01

    Grifola frondosa is a culinary-medicinal mushroom that contains several physiologically active compounds, of which polysaccharides, specifically β-glucans, are known to possess immunomodulating properties. Its extracts are studied for application as adjuncts for chemotherapy, and experiments in animal models support the use of this mushroom for cancer treatment. The effect of extracts obtained from mushrooms cultivated on different substrates and their capacity of inducing the secretion of cytokines from human peripheral blood mononuclear cells were studied. The activity of extracts at concentrations 12.5, 100, and 200 μg/mL on induction of TNF-α, IFN-γ, and IL-12 was screened. Two extracts from substrates fortified with olive oil press cakes showed appreciable activity and induced the secretion of TNF-α, IL-12, and INF-γ. The extracts differed from the others in the amount of sugar, protein, and β-glucans, which can explain their higher activity. Present results show that different substrates and different source materials can reasonably modify the bioactivity of cultivated G. frondosa. PMID:23510175

  17. Submerged-Culture Mycelia and Broth of the Maitake Medicinal Mushroom Grifola frondosa (Higher Basidiomycetes) Alleviate Type 2 Diabetes-Induced Alterations in Immunocytic Function.

    Science.gov (United States)

    Chen, Ya-Hui; Lee, Chien-Hsing; Hsu, Tai-Hao; Lo, Hui-Chen

    2015-01-01

    Type 2 Diabetes mellitus (T2DM), a disease with impaired glucose, protein and lipid metabolism, low-grade chronic inflammation, and immune dysfunction, is a global public health crisis. We previously demonstrated that Grifola frondosa has bioactivities in improving glycemic responses in diabetic rats. Herein, we investigated the immunomodulatory effects of the submerged-culture mycelia and broth of G. frondosa on the peripheral blood cells (PBL) and splenocytes. Male Wistar rats were administered with saline (normal rats) or streptozotocin plus nicotinamide (T2DM rats) and were intragastrically administered with placebo, fermented mycelia, broth, or mycelia plus broth (1 g kg-1 day-1) for two weeks. In normal rats, ingestion of mycelia significantly decreased monocytes and ingestion of mycelia and broth significantly decreased the productions of interferon (IFN)-γ and interleukin (IL)-4 from the PBL and splenocytes. In T2DM rats, ingestion of mycelia, broth, and mycelia plus broth significantly alleviated the increases in 2 h postprandial blood glucose and the productions of IFN-γ from the T-leukocytes, IL-4, and IL-6 from the monocytes and IL-4 from the T-splenocytes, as well as significantly improved the productions of tumor-necrosis factor-α from the macrophages. In conclusion, submerged-culture mycelia and broth of G. frondosa may decrease cell-medicated immunity in normal rats and improve hyperglycemia and diabetes-induced alterations in cell-medicated and innate immunities in T2DM rats. PMID:26349512

  18. Effect of Introns and AT-Rich Sequences on Expression of the Bacterial Hygromycin B Resistance Gene in the Basidiomycete Schizophyllum commune

    OpenAIRE

    Scholtmeijer, K.; Wosten, H.A.B.; Springer, J.; Wessels, J.G.H.

    2001-01-01

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation and truncation of transcripts are two independent events that both affect expression of the bacterial hygromycin B resistance gene in S. commune.

  19. Antiviral activity of Basidiomycete mycelia against influenza type A(serotype H1N1) and herpes simplex virus type 2 in cell culture

    Institute of Scientific and Technical Information of China (English)

    Tetiana; Krupodorova; Svetlana; Rybalko; Victor; Barshteyn

    2014-01-01

    In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A(serotype H1N1) and herpes simplex virus type 2(HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47(H1N1) in MDCK cells reducing the infectious titer by 2.0–6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species—Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes—this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index(324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes(amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems.

  20. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav

    2012-01-01

    Roč. 355, č. 1-2 (2012), s. 341-352. ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  1. Heterologous expression, crystallization and preliminary X-ray characterization of CcCel6C, a glycoside hydrolase family 6 enzyme from the basidiomycete Coprinopsis cinerea

    International Nuclear Information System (INIS)

    Crystallization of CcCel6C was carried out by the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.6 Å resolution from the crystal. CcCel6C is a gene that encodes a glycoside hydrolase family 6 (GH6) enzyme in the Coprinopsis cinerea genome. In the evolutionary tree of GH6 enzymes, the encoded enzyme was closely related to Cel6B from Humicola insolens, previously called endoglucanase VI, while its amino-acid sequence revealed a region corresponding to the C-terminal active-site-enclosing loop typical of cellobiohydrolase II. Here, the crystallization of CcCel6C produced in Escherichia coli is reported. The square prismatic crystal belonged to the triclinic space group P1, with unit-cell parameters a = 44.04, b = 45.11, c = 48.90 Å, α = 77.81, β = 87.34, γ = 68.79°. Diffraction data were collected to 1.6 Å resolution

  2. Blue Light Signaling Inactivates the Mating Type Genes-Mediated Repression of Asexual Spore Production in the Higher Basidiomycete Coprinopsis cinerea

    Directory of Open Access Journals (Sweden)

    Prayook Srivilai

    2009-01-01

    Full Text Available Monokaryotic mycelia of several wild-type strains of the homobasidiomycete Coprinopsis cinerea form abundant numbers of oidia both in the light and dark due to the regulation of oidia production by the A and B mating type genes. Nevertheless, little is known about whether and how the mating type loci and light signal regulate the oidiation in C. cinerea. Herein, the experimental results demonstrated that the self-compatible homokaryon AmutBmut strain, the mycelia whose nuclei carry mutations in both the A and B loci, can produce only a few oidia in the dark, whereas the formation of numerous numbers of oidia is induced by the light. The semi-compatible homokaryon AmutB, but not ABmut, has the production and behavior of oidia formation similar to those of AmutBmut. These findings indicated that in AmutBmut strain the mutation at the A locus results in repression of oidiation in the dark and the blue light alleviates this effect, whereas the mutated B genes function has no effects. Since, the oidia production relies on both A and light signal, it is possible that A locus might be linked to the blue light receptor genes. The present results demonstrated for the first time that the secondary hyphal knot formation(skn1, fruiting body maturation (mat and basidiospore formation (bad genes which are essential in the C. cinerea fruiting pathway are not involved in the regulation of asexual sporulation. In addition, the positive light effect on oidiation could also occur in C. cinerea dikaryons.

  3. Cell-based bioreporter assay coupled to HPLC micro-fractionation in the evaluation of antimicrobial properties of the basidiomycete fungus Pycnoporus cinnabarinus.

    Science.gov (United States)

    Järvinen, Päivi; Nybond, Susanna; Marcourt, Laurence; Ferreira Queiroz, Emerson; Wolfender, Jean-Luc; Mettälä, Aila; Karp, Matti; Vuorela, Heikki; Vuorela, Pia; Hatakka, Annele; Tammela, Päivi

    2016-06-01

    Context Identification of bioactive components from complex natural product extracts can be a tedious process that aggravates the use of natural products in drug discovery campaigns. Objective This study presents a new approach for screening antimicrobial potential of natural product extracts by employing a bioreporter assay amenable to HPLC-based activity profiling. Materials and methods A library of 116 crude extracts was prepared from fungal culture filtrates by liquid-liquid extraction with ethyl acetate, lyophilised, and screened against Escherichia coli using TLC bioautography. Active extracts were studied further with a broth microdilution assay, which was, however, too insensitive for identifying the active microfractions after HPLC separation. Therefore, an assay based on bioluminescent E. coli K-12 (pTetLux1) strain was coupled with HPLC micro-fractionation. Results Preliminary screening yielded six fungal extracts with potential antimicrobial activity. A crude extract from a culture filtrate of the wood-rotting fungus, Pycnoporus cinnabarinus (Jacq.) P. Karst. (Polyporaceae), was selected for evaluating the functionality of the bioreporter assay in HPLC-based activity profiling. In the bioreporter assay, the IC50 value for the crude extract was 0.10 mg/mL. By integrating the bioreporter assay with HPLC micro-fractionation, the antimicrobial activity was linked to LC-UV peak of a compound in the chromatogram of the extract. This compound was isolated and identified as a fungal pigment phlebiarubrone. Discussion and conclusion HPLC-based activity profiling using the bioreporter-based approach is a valuable tool for identifying antimicrobial compound(s) from complex crude extracts, and offers improved sensitivity and speed compared with traditional antimicrobial assays, such as the turbidimetric measurement. PMID:26808592

  4. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs. PMID:18083152

  5. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast. PMID:20146402

  6. Neuroregenerative potential of lion's mane mushroom, Hericium erinaceus (Bull.: Fr.) Pers. (higher Basidiomycetes), in the treatment of peripheral nerve injury (review).

    Science.gov (United States)

    Wong, Kah-Hui; Naidu, Murali; David, Rosie Pamela; Bakar, Robiah; Sabaratnam, Vikineswary

    2012-01-01

    We present a model case study of the activity of aqueous extract of Hericium erinaceus fresh fruit bodies in promoting functional recovery following crush injury to the peroneal nerve in adult female Sprague-Dawley rats. The aim was to explore the possible use of this mushroom in nerve repair. The activities of aqueous extract were compared to activities exhibited by mecobalamin (vitamin B12), which has been widely used in the treatment of peripheral nerve disorders. Analysis of walking track indicated that return of hind limb function and normal toe spreading occurred earlier in treated groups than in the negative control (non-treated) group. Regeneration of axons and reinnervation of motor endplates/neuromuscular junction in extensor digitorum longus muscle of rats in treated groups developed better than in the negative control group. Further, immunofluorescence studies also showed that dorsal root ganglia neurons ipsilateral to the crush injury in rats of treated groups expressed higher immunoreactivities for Akt and MAPK signaling pathways as well as c-Jun and c-Fos genes compared to the negative control group. Akt cascade plays a major role in mediating neurotrophin-promoted cell survival, while MAPK cascade is involved in mediating neurite outgrowth. Immediate early gene expression was also involved in the cascade of events leading to regeneration. Local axonal protein synthetic machinery was also enhanced in the distal segments of crushed nerves in treated groups. Therefore, daily oral administration of H. erinaceus could promote the regeneration of injured rat peroneal nerve in the early stage of recovery. PMID:23510212

  7. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  8. FINE GENETIC MAPPING OF RHIZOME QTLS IN PERENNIAL LEYMUS WILDRYES

    Science.gov (United States)

    Rhizomes and tillers grow from underground axillary meristems, which are important determinants of perennial growth habit and architecture in grasses. Leymus cinereus grows from intravaginal axillary meristems (tillers), forming a compact tussock year after year. Conversely, L. triticoides grow fr...

  9. Survival and Abundance of Delmarva Fox Squirrels at Blackwater National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Delmarva fox squirrel (DFS; Sciurus niger cinereus) is a subspecies of the Eastern fox squirrel. The DFS once ranged from southeastern Pennsylvania (Poole,...

  10. Cutaneous Bacteria of the Redback Salamander Prevent Morbidity Associated with a Lethal Disease

    OpenAIRE

    Matthew H Becker; Harris, Reid N.

    2010-01-01

    Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is an infectious disease that causes population declines of many amphibians. Cutaneous bacteria isolated from redback salamanders, Plethodon cinereus, and mountain yellow-legged frogs, Rana muscosa, inhibit the growth of Bd in vitro. In this study, the bacterial community present on the skin of P. cinereus individuals was investigated to determine if it provides protection to salamanders from the lethal and s...

  11. A metagenomics-based approach to the top-down effect on the detritivore food web: a salamanders influence on fungal communities within a deciduous forest

    OpenAIRE

    Walker, Donald M.; Lawrence, Brandy R; Esterline, Dakota; Graham, Sean P.; Edelbrock, Michael A.; Wooten, Jessica A

    2014-01-01

    The flow of energy within an ecosystem can be considered either top-down, where predators influence consumers, or bottom-up, where producers influence consumers. Plethodon cinereus (Red-backed Salamander) is a terrestrial keystone predator who feeds on invertebrates within the ecosystem. We investigated the impact of the removal of P. cinereus on the detritivore food web in an upland deciduous forest in northwest Ohio, U.S.A. A total of eight aluminum enclosures, each containing a single P. c...

  12. Pro- and antioxidative properties of medicinal mushroom extracts

    NARCIS (Netherlands)

    Song, W.; Griensven, van L.J.L.D.

    2008-01-01

    Hot water extracts of 2 groups of medicinal mushrooms have been tested from the genera Agaricus, Antrodia, Auricularia, Coprinus, Cordyceps, Hericium, Grifola, Ganoderma, Lentinus, Phellinus, and Trametes for ROS-generating activity in human cells and for DPPH-TEAC antioxidant activity. Group 1 comp

  13. Myxomycetes of the rotting cherry wood

    Directory of Open Access Journals (Sweden)

    Wanda Stojanowska

    2014-08-01

    Full Text Available During the years 1974-1975 on rotting cherry wood development of some Myxomycetes was observed. In that time 6 species of slime molds were noted: Arcyria denudata, Comatricha typhoides, Dyctidium cancellatum, Lycogala epidendrum, Physarum cinereum, Stemonitis ferruginea. In the decomposition of organic compounds apart from Myxomycetes other organism (Coprinus dessiminafus also take part.

  14. Screening of lignocellulose-degrading superior mushroom strains and determination of their CMCase and laccase activity.

    Science.gov (United States)

    Fen, Li; Xuwei, Zhu; Nanyi, Li; Puyu, Zhang; Shuang, Zhang; Xue, Zhao; Pengju, Li; Qichao, Zhu; Haiping, Lin

    2014-01-01

    In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola) were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase). The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P < 0.01) higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels. PMID:24693246

  15. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  16. Optimization of the Yield of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes), Cultivated on a Sunflower Seed Hull Substrate Produced in Argentina: Effect of Olive Oil and Copper.

    Science.gov (United States)

    Bidegain, Maximiliano A; Cubitto, Maria Amelia; Curvetto, Nestor Raul

    2015-01-01

    Sunflower seed hulls were used as the main component of a solid substrate for the cultivation of the lingzhi or reishi medicinal mushroom Ganoderma lucidum. This study evaluated the effects of supplementing the substrate with olive oil and copper (II) on the mushroom production (MP) parameters and fruiting body total triterpenoid content. The addition of 1.5% olive oil increased total MP by 21.7% (dry basis) in 3 flushes. Copper (60 ppm) increased the daily productivity of the first flush (MP per day) by both reducing the time needed to harvest the crop and increasing the MP. However, the MP at the second and third flushes was reduced. When both supplements were combined, the MP at the first flush was 43% higher than with control treatment. No significant change in mushroom total triterpenoid content was observed by the addition of supplements to the substrate. An increase of 145-155% in the mushroom copper content was obtained by the addition of 60 ppm copper to the substrate. It is thus recommended to use substrate formulations containing both olive oil and copper (II) and harvest just the first flush. PMID:26853965

  17. Simple and Reproducible Two-Stage Agitation Speed Control Strategy for Enhanced Triterpene Production by Lingzhi or Reishi Medicinal Mushrooms, Ganoderma lucidum ACCC G0119 (Higher Basidiomycetes) Based on Submerged Liquid Fermentation.

    Science.gov (United States)

    Feng, Jie; Feng, Na; Yang, Yan; Liu, Fang; Zhang, Jingsong; Jia, Wei; Lin, Chi-Chung

    2015-01-01

    Triterpenes are important anticancer agents produced by batch submerged liquid fermentation, with the medicinal mushroom Ganoderma lucidum ACCC G0119, which was investigated under various dissolved oxygen levels by varying agitation speeds. Three kinetic parameters were analyzed: specific mycelial growth rate (μsmg), specific glucose consumption rate (qsgc), and specific triterpene production rate (qstp). High concentration, yield, and productivity of triterpenes were achieved by developing a simple and reproducible two-stage agitation speed control strategy. At the first 40 h, agitation speed was controlled at 150 rpm to obtain the quickest peak qstp for triterpene production, subsequently agitation speed was controlled at 100 rpm to maintain high qstp for high triterpene accumulation. The maximum concentration of triterpenes reached 0.086 g/l with the yield of 6.072 g/kg and the productivity of 6.532 × 10-4 g/(l·h), which were 39.61%, 36.48%, and 49.22%, respectively, better than the best results controlled by fixed agitation speeds. Conceivably, such a triterpene fermentation production strategy would be useful for industrial large-scale production of triterpenes with G. lucidum. PMID:26854102

  18. Study of the combined effect of temperature, pH and water activity on the radial growth rate of the white-rot basidiomycete Physisporinus vitreus by using a hyphal growth model

    CERN Document Server

    Fuhr, M J; Schubert, M; Schwarze, F W M R; Herrmann, H J

    2011-01-01

    The present work investigates environmental effects on the growth of fungal colonies of P. vitreus by using a lattice-free discrete modelling approach called FGM (Fuhr et al. (2010), arXiv:1101.1747), in which hyphae and nutrients are considered as discrete structures. A discrete modelling approach allows studying the underlying mechanistic rule concerning the basic architecture and dynamic of fungal networks on the scale of a single colony. By comparing simulations of the FGM with laboratory experiments of growing fungal colonies on malt extract agar we show that combined effect of temperature, pH and water activity on the radial growth rate of a fungal colony on a macroscopic scale may be explained by a power law for the growth costs of hyphal expansion on a microscopic scale. The information about the response of the fungal mycelium on a microscopic scale to environmental conditions is essential to simulate its behavior in complex structure substrates such as wood, where the impact of the fungus to the woo...

  19. Open-Label Study of the Influence of Food Containing the Royal Sun Mushroom, Agaricus brasiliensis KA21 (Higher Basidiomycetes), on the Quality of Life of Healthy Human Volunteers.

    Science.gov (United States)

    Motoi, Masuro; Motoi, Akitomo; Yamanaka, Daisuke; Ohno, Naohito

    2015-01-01

    We conducted an open-label study in which food containing Agaricus brasiliensis KA21 was consumed continuously for 12 weeks. A questionnaire for subjective evaluation of the efficacy of this food (hereafter, subjective evaluation questionnaire) revealed significant improvements compared with before its intake; there were improvements in the scores of the amounts of hair loss and gray hair, fatigue and general malaise, eye strain, shoulder stiffness, coldness of extremities, difficulty staying awake during the day, and ease of getting out of bed. These findings suggest that intake of food containing A. brasiliensis KA21 results in the above-mentioned subjectively evaluated improvements, and the possibility that A. brasiliensis KA21 improves the body's immunity. Moreover, no issues regarding the safety of the test food were found. PMID:26756293

  20. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  1. Cultivated basidiomycetes as a source of new products: In vitro cultivation development, selection of strains resistant to Trichoderma viride, search for new active compounds, factors influencing plasticity in Grifola frondosa

    OpenAIRE

    Schiff Giovannini, Isabelle; Job, Daniel

    2006-01-01

    Les champignons supérieurs sont une source encore peu explorée et exploitée de nouveaux produits naturels. Ils attirent toujours plus l’intérêt des milieux scientifiques et industriels. Dans ce contexte, nous voulions explorer le potentiel de champignons cultivés dans la recherche de nouveaux composés actifs. Nous avons obtenus les fructifications de 14 espèces de Basidiomycètes selon des techniques développées auparavant dans le laboratoire. De plus, nous avons testé la capacité à fructifier...

  2. Funga Nordica

    DEFF Research Database (Denmark)

    A funga of +3000 basidiomycetes from the Nordic countries, with descriptive keys to all levels from order to species, and notes on ecology and distribution......A funga of +3000 basidiomycetes from the Nordic countries, with descriptive keys to all levels from order to species, and notes on ecology and distribution...

  3. Perception and response to gravity in higher fungi--a critical appraisal.

    Science.gov (United States)

    Moore, D

    1991-01-01

    hymenophore (gill, tube or tooth) is positively gravitropic and responds independently of the stem. Bracket polypores do not show tropisms but exhibit gravimorphogenetic responses such that gross disturbance leads to renewal of growth to produce and entirely new fruiting structure suitably reoriented to the new spatial position. One experiment performed on an orbiting space station suggests that, in the absence of a light stimulus, gravity may be required for initiation of fruiting in Polyporus brumalis. Otherwise, the indications from both clinostat and space-borne experiments are that the basic form of the mushroom (overall tissue arrangement of stem, cap, gills, hymenium, veil) in agaric and polypore alike is established independently of the gravity vector. Abnormal stem growth has been observed in clinostat cultures of Panus (= Lentinus) tigrinus and Polyporus brumalis, but the morphogenetic event which seems most dependent on gravity is sporulation (in the broadest sense). Cultures of P. brumalis on orbiting space craft fail to produce the poroid hymenophore and in clinostat experiments on the ground even karyogamy was rare in similar cultures. Coprinus cinereus grown on the clinostat was able to produce apparently normal fruit body primordia which failed to produce spores and then aborted, forming a new flush of primordia on the old. Taken together with the clear association between observation of gravitropism and the onset of sporulation, the implication is that commitment to the meiosis-sporulation pathway both requires the gravity vector and couples it in some way to fruit-body growth. There is no convincing evidence for a graviperception mechanism in fungi. There is no evidence for any organised means of communicating the gravitropic stimulus once it has been perceived. Reports of three different experimental studies reveal the authors' conviction that the apparently coordinated expression of gravitropic response is in truth a common, but independent, response by

  4. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    OpenAIRE

    2014-01-01

    In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola) were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase). The results showed that the ratio of transparent circle to my...

  5. Studies in Coprinus—II. Subsection Setulosi of section Pseudocoprinus

    OpenAIRE

    Ujlé, C.B.; Bas, C.

    1991-01-01

    A key is given to the Netherlands’ species of subsect. Setulosi J. Lange of Coprinus sect. Pseudocoprinus (Kühn.) P.D. Orton & Watling. Some additional species are also included. All species dealt with are concisely described and fully discussed. A few probably new species are described ad interim. Type-material has been examined of C. bisporiger, C. eurysporus, C. fallax, C. subpurpureus, and C. subimpatiens.

  6. Bats of the Colorado oil shale region

    Energy Technology Data Exchange (ETDEWEB)

    Finley, R.B. Jr.; Caire, W.; Wilhelm, D.E.

    1984-10-31

    New records for Myotis californicus, M. evotis, M. leibii, M. lucifugus, M. thysanodes, M. volans, M. yumanensis, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Lasiurus cinereus, Plecotus townsendii, and Antrozous pallidus and their habitat occurrence in northwestern Colorado are reported. Mortality of 27 bats of six species trapped in an oil sludge pit is described. 7 references.

  7. 75 FR 68821 - Endangered and Threatened Wildlife and Plants; Permit; Construction and Operation of Kaheawa II...

    Science.gov (United States)

    2010-11-09

    ...) surveys to document the distribution and abundance of the Hawaiian hoary bat; and (5) habitat management... n ) (Branta sandvicensis), endangered Hawaiian hoary bat (Lasiurus cinereus semotus), and the..., Hawaiian goose, and Hawaiian hoary bat are known to have collided with wind turbine structures....

  8. 78 FR 73877 - Endangered Species; Marine Mammals; Receipt of Applications for Permit

    Science.gov (United States)

    2013-12-09

    ... Departments and Agencies of January 21, 2009--Transparency and Open Government (74 FR 4685; January 26, 2009... comment on an application for a permit to photograph polar bears (Ursus maritimus) (78 FR 70067). We cited...: Koala (Phascolarctos cinereus) Applicant: Florida Tortoise and Iguana Breeders, S.W. Ranches, FL;...

  9. Evaluation of Leymus LG3a Rhizome QTLs in Four Advanced Backcross Populations and Alignment of Leymus LG3 EST Markers and Oryza Chromosome 1

    Science.gov (United States)

    The genus Leymus comprises about 30 long-lived perennial Triticeae species, including the largest native grasses in the western U.S., distributed throughout cold and/or semiarid growing environments of North and South America, Europe, and Asia. Leymus cinereus and L. triticoides display divergent g...

  10. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571. ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  11. Further observations on Sporotrichum and some similar fungi

    NARCIS (Netherlands)

    Arx, von J.A.

    1973-01-01

    Sporotrichum azureum Wright & v. Arx, isolated from wood in Argentina, is described and illustrated. The relationship of the genus Sporotrichum with Ptychogaster is discussed, both may represent conidial states of basidiomycetes ( Tyromyces, Oligoporus).

  12. Optimized protein extraction methods for proteomic analysis of Rhizoctonia solani

    Science.gov (United States)

    Rhizoctonia solani (Teleomorph: Thanatephorus cucumeris) is a basidiomycetous fungus which includes important plant pathogens, saprophytes and mycorrhizae. R. solani displays several hyphal anastomosis groups (AGs) with distinct host plant specializations. In order to facilitate studies on its biol...

  13. Some endophytes of Juncus trifidus from Tatra Mts. in Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Chlebicki

    2013-12-01

    Full Text Available This is a first part of work devoted highland rush endophytes: Penicillium expansum, Cladosporium oxysporum, Arthrinium state of Apiospora montagnei and Aureobasidium pullulans. The basidiomycete strain, possibly Lagarobasidium detriticum was also isolated.

  14. Mass spectrometry looks into the structure of beta-N-acetylhexosaminidase

    Czech Academy of Sciences Publication Activity Database

    Pompach, Petr; Man, Petr; Plíhal, Ondřej; Sklenář, Jan; Ettrich, R.; Bezouška, Karel; Havlíček, Vladimír

    Edinburgh, 2003, s. -. [International Mass Spectrometry Conference /16./. Edinburgh (GB), 31.08.2003-05.09.2003] Institutional research plan: CEZ:AV0Z5020903; CEZ:MSM 113100001 Keywords : glcnac * chitin * basidiomycetes Subject RIV: EE - Microbiology, Virology

  15. Molecular characterization of Cryptococcus gattii genotype AFLP6/VGII isolated from woody debris of divi-divi (Caesalpinia coriaria), Bonaire, Dutch Caribbean

    NARCIS (Netherlands)

    Hagen, F.; Chowdhary, A.; Prakash, A.; Yntema, J.B.; Meis, J.F.G.M.

    2014-01-01

    BACKGROUND: The basidiomycetous yeast Cryptococcus gattii is an emerging and primary pathogen. There is a lack of information about its environmental spread outside outbreak regions in Mediterranean Europe, North and South America. Environmental sampling for C. gattii and molecular characterization

  16. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J;

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  17. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  18. Galeropsidaceae, A New Family for the Mycobiota of Turkey

    OpenAIRE

    HATAT, Gürsel; PEKŞEN, Aysun

    2000-01-01

    The Galeropsidaceae, an interesting basidiomycete family is reported for the first time from Turkey. Galeropsis lateritia (Watling) Moreno, Heykoop & Illana belonging to this family was found in the Samsun province.

  19. The higher fungi of Amchitka and Adak Islands, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Fruiting body collections of higher fungi, basidiomycetes and ascomycetes, were made during a twelve day field study on two of Alaska's Aleutian Islands, Amchitka...

  20. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Science.gov (United States)

    Cryan, Paul M; Jameson, Joel W; Baerwald, Erin F; Willis, Craig K R; Barclay, Robert M R; Snider, E Apple; Crichton, Elizabeth G

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines. PMID:23094065

  1. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Directory of Open Access Journals (Sweden)

    Paul M Cryan

    Full Text Available Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus, eastern red bats (L. borealis, and silver-haired bats (Lasionycteris noctivagans found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  2. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines

    Science.gov (United States)

    Cryan, P.M.; Jameson, J.W.; Baerwald, E.F.; Willis, C.K.R.; Barclay, R.M.R.; Snider, E.A.; Crichton, E.G.

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  3. Bandoniozyma gen. nov., a Genus of Fermentative and Non-Fermentative Tremellaceous Yeast Species

    OpenAIRE

    Valente, Patricia; Boekhout, Teun; Landell, Melissa Fontes; Crestani, Juliana; Pagnocca, Fernando Carlos; Sette, Lara Durães; Passarini, Michel Rodrigo Zambrano; Rosa, Carlos Augusto; Luciana R Brandão; Pimenta, Raphael S.; Ribeiro, José Roberto; Garcia, Karina Marques; Lee, Ching-Fu; Suh, Sung-Oui; Péter, Gábor

    2012-01-01

    Background Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. Methodology/Principal Findings The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. Con...

  4. The role of natural chlorinated hydroquinone metabolites in ligninolytic fungi

    OpenAIRE

    Teunissen, P.J.M.

    1999-01-01

    Ligninolytic Basidiomycetes have been reported to produce a wide variety of chloroaromatic compounds as secondary metabolites, which are structurally similar to environmental pollutants. Among these are chlorinated hydroquinone metabolites (CHM), such as 2-chloro-1,4-dimethoxybenzene (2Cl-14DMB), 2,6-dichloro-1,4-dimethoxybenzene (26DCl-14DMB), tetrachloro-1,4-dimethoxybenzene and tetrachloro-4-methoxyphenol, which are synthesized by 11 genera of Basidiomycetes.The biosynthesis of these chlor...

  5. Análisis de las reacciones de hipersensibilidad tipo I a los basidiomicetes en una población alérgica costarricense, durante 2009 Analysis of the reactions of type I hypersensitivity to the Basidiomycetes in a Costa Rican allergic population during 2009

    OpenAIRE

    Daniela Jaikel-Víquez; Olman Riggioni-Cordero

    2012-01-01

    Justificación y objetivos: Costa Rica es un país tropical en donde se ha encontrado una alta concentración de basidiosporas aéreas, las cuales miden alrededor de 4-13µm de diámetro, y son por definición aerobiológicas, capaces de penetrar a tracto respiratorio inferior, irrespetando la barrera nasal. El presente estudio tiene como objetivos encontrar posibles fuentes de contaminación ambiental por basidiomicetes y determinar si en Costa Rica sería necesario analizar, de forma rutinaria, la re...

  6. A study of bat populations at Los Alamos National Laboratory and Bandelier National Monument, Jemez Mountains, New Mexico: FY95--97 report to Los Alamos National Laboratory and Bandelier National Monument

    Energy Technology Data Exchange (ETDEWEB)

    Bogan, M.A.; O`Shea, T.J.; Cryan, P.M.; Ditto, A.M.; Schaedla, W.H.; Valdez, E.W.; Castle, K.T.; Ellison, L. [Univ. of New Mexico, Albuquerque, NM (United States)

    1998-12-31

    In 1995, a three-year study was initiated to assess the current status of bat species of concern, elucidate distribution and relative abundance, and obtain information on roosting sites of bats. The authors captured and released 1532 bats of 15 species (Myotis californicus, M. ciliolabrum, M. evotis, M. thysanodes, M. volans, M. yumanensis, Lasiurus cinereus, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Euderma maculatum, Corynorhinus townsendii, Antrozous pallidus, Tadarida brasiliensis, and Nyctinomops macrotis) and followed 32 bats of eight species (M. evotis, M. thysanodes, M. volans, E. fuscus, E. maculatum, C. townsendii, A. pallidus, and N. macrotis) to 51 active diurnal roosts. The most abundant species were L. noctivagans, E. fuscus, L. cinereus, M. evotis, M. volans, and M. ciliolabrum. Most of these species are typical inhabitants of ponderosa pine-mixed coniferous forests.

  7. Brain Mass and Cranial Nerve Size in Shrews and Moles

    OpenAIRE

    Leitch, Duncan B.; Sarko, Diana K.; Catania, Kenneth C.

    2014-01-01

    We investigated the relationship between body size, brain size, and fibers in selected cranial nerves in shrews and moles. Species include tiny masked shrews (S. cinereus) weighing only a few grams and much larger mole species weighing up to 90 grams. It also includes closely related species with very different sensory specializations – such as the star-nosed mole and the common, eastern mole. We found that moles and shrews have tiny optic nerves with fiber counts not correlated with body or ...

  8. Tree-hugging koalas demonstrate a novel thermoregulatory mechanism for arboreal mammals

    OpenAIRE

    Briscoe, Natalie J; Handasyde, Kathrine A.; Griffiths, Stephen R.; Porter, Warren P.; Krockenberger, Andrew; Kearney, Michael R.

    2014-01-01

    How climate impacts organisms depends not only on their physiology, but also whether they can buffer themselves against climate variability via their behaviour. One of the way species can withstand hot temperatures is by seeking out cool microclimates, but only if their habitat provides such refugia. Here, we describe a novel thermoregulatory strategy in an arboreal mammal, the koala Phascolarctos cinereus. During hot weather, koalas enhanced conductive heat loss by seeking out and resting ag...

  9. Prevalence and Clinical Significance of Herpesvirus Infection in Populations of Australian Marsupials

    OpenAIRE

    Stalder, Kathryn; Vaz, Paola K.; Gilkerson, James R.; Baker, Rupert; Whiteley, Pam; Ficorilli, Nino; Tatarczuch, Liliana; Portas, Timothy; Skogvold, Kim; Anderson, Garry A.; Devlin, Joanne M

    2015-01-01

    Herpesviruses have been reported in several marsupial species, but molecular classification has been limited to four herpesviruses in macropodids, a gammaherpesvirus in two antechinus species (Antechinus flavipes and Antechinus agilis), a gammaherpesvirus in a potoroid, the eastern bettong (Bettongia gaimardi) and two gammaherpesviruses in koalas (Phascolarctos cinereus). In this study we examined a range of Australian marsupials for the presence of herpesviruses using molecular and serologic...

  10. Masticatory Motor Patterns in Six Herbivorous Australian Marsupials

    OpenAIRE

    Crompton, Alfred; Skinner, John; Lieberman, Daniel; Owerkovicz, Tomasz

    2007-01-01

    Electomyograms of the adductor muscles of the hairy-nosed wombat (Lasiorhinus latifrons), red kangaroo (Macropus rufus), Tammar wallaby (M. eugenii), koala (Phascolarctos cinereus), potoroo (Potorous tridactylus) and the brush-tailed possum (Trichosurus vulpecula) were analyzed and compared with those of placental herbivores. Marsupials have developed several different and distinct masticatory motor patterns that are all fundamentally different from those of placental herbivores where jaw mov...

  11. What Is The Proximate Cause Of Begging Behaviour In A Group Of Captive Asian Short-Clawed Otters?

    OpenAIRE

    Gothard Nicola

    2007-01-01

    The study aimed to ascertain the proximate cause of ‘begging’ behaviour in a group of captive Asian short-clawed otters (Aonyx cinereus). Two alternative hypotheses were tested by manipulating aspects of husbandry in three experimental conditions. Condition 1 served as a baseline for comparison. In Condition 2 meal worms and crickets were provided every hour to stimulate natural foraging and hunting behaviour and alleviate boredom. During Condition 3 the food allowance was increased by 7.5% o...

  12. Salida de campo a Traspinedo (Valladolid) el 4 de septiembre de 1952

    OpenAIRE

    Valverde Gómez, José Antonio, 1926-2003

    2008-01-01

    Salida de campo a Traspinedo (Valladolid) el 4 de septiembre de 1952, de la que se anotaron observaciones sobre Pseudochondrostoma sp. (Boga), sapos (posiblemente, el Sapo común, Bufo bufo), los siguientes reptiles: Blanus cinereus (Culebrilla ciega, también llamado Eslabon), Lagartija (sin identificar la especie), Natrix maura (Culebra viperina, llamada Tropidonotus viperinus por el autor) y Vipera sp. (Víbora)los siguientes mamíferos: Ardilla (pudiendo ser Sciurus vulgaris o Atlantoxerus ge...

  13. Evidence of Late-Summer Mating Readiness and Early Sexual Maturation in Migratory Tree-Roosting Bats Found Dead at Wind Turbines

    OpenAIRE

    Cryan, Paul M.; Jameson, Joel W.; Baerwald, Erin F.; Willis, Craig K. R.; Barclay, Robert M. R.; Snider, E. Apple; Crichton, Elizabeth G.

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and...

  14. Seasonally-Dynamic Presence-Only Species Distribution Models for a Cryptic Migratory Bat Impacted by Wind Energy Development

    OpenAIRE

    Hayes, Mark A.; Cryan, Paul M.; Wunder, Michael B.

    2015-01-01

    Understanding seasonal distribution and movement patterns of animals that migrate long distances is an essential part of monitoring and conserving their populations. Compared to migratory birds and other more conspicuous migrants, we know very little about the movement patterns of many migratory bats. Hoary bats (Lasiurus cinereus), a cryptic, wide-ranging, long-distance migrant, comprise a substantial proportion of the tens to hundreds of thousands of bat fatalities estimated to occur each y...

  15. Tracks and Other Signs of Otters in Rice Fields in Padang Pariaman, West Sumatra: a Preliminary Study

    Directory of Open Access Journals (Sweden)

    Aadrean

    2010-01-01

    Full Text Available We identified otters based on tracks and other signs in a West Sumatran rice field. Field surveys were conducted from July to December 2008 at Padang Pariaman, West Sumatra, Indonesia. We identified one species, Aonyx cinereus (Illiger, 1815 based on the size and form of 8 fore and 17 hind footprints. Further, we describe three types of spraint site, sliding sites and other evidence of otter existence in this area.

  16. Ecological features of rare actinomycetes genera in soils of Azerbaijan

    OpenAIRE

    A. R. Abushova; S. A. Gasanova; M. A. Kasimzade

    2010-01-01

    The results of the research of rare species of actinomycetes in some soils of Azerbaijan were studied. On the selective media the representatives of Streptomyces, Streptosporangium, Micromonospora, Actinomadura, Microbispora, Saccharopolyspora and Saccharomonospora were revealed. Species of Streptomyces and Micromonospora dominate in mountain-wood ecosystems (60 %.). It was established that among streptomyces species of Cinereus section of Violaceus series; Helvolo-Flavus sections of Helvolus...

  17. Comparison of trace element content in marine organisms collected from the La Maddalena archipelago and other Mediterranean and Pacific ocean sites

    International Nuclear Information System (INIS)

    As, Sb, Zn, Hg, Fe, Co and Cs were analysed by instrumental neutron activation analysis in four fish species (Mullus surmuletus, Scorpaena porcus, Crenilabus cinereus, and Serranus scriba) and one gesteropod (Sepia officinalis). The results were compared with those obtained by other authors for fish collected both in the Mediterranean and the Pacific. The difficulty of comparing results obtained by different authors was stressed and some suggestions to overcome this difficulty were given

  18. Distribution and occurrence of mosquito species in the municipal areas of Imo State, Nigeria

    OpenAIRE

    Ifeyinwa Celestina MGBEMENA; Tochi EBE

    2012-01-01

    A study of the ecology of drainage - breeding mosquito vectors was conducted in the three urban centers (Owerri, Orlu and Okigwe) of Imo State, Nigeria. Four drainage sites located around markets, residential, stream and hotel premises were selected in each urban centre. Dipping method of sampling was employed and a total of 8,820 mosquitoes comprising eight species namely; Aedes aegypti, Aedes vittatus, Culex quinquefasciatus, Culex tigripes, Culex horridus, Culex cinereus, Culex annuliorus ...

  19. Seizure Of Live Otters In Bangkok Airport, Thailand

    OpenAIRE

    Shepherd, Chris R.; Panjit Tansom

    2013-01-01

    On 22 January, 2013, TRAFFIC reported that the Royal Thai Customs officers working at the Wildlife Checkpoint of Bangkok’s Suvarnabhumi International Airport discovered 11 live otters when they scanned a bag that had been left at the oversized luggage area of the airport. The otters, six Smooth Otters Lutrogale perspicllata and five Oriental Small-clawed Otters Aonyx cinereus were all juveniles and are suspected to have been smuggled out of Thailand, bound for Japan to be sold as exotic pets....

  20. Cutaneous bacteria of the redback salamander prevent morbidity associated with a lethal disease.

    Directory of Open Access Journals (Sweden)

    Matthew H Becker

    Full Text Available Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd, is an infectious disease that causes population declines of many amphibians. Cutaneous bacteria isolated from redback salamanders, Plethodon cinereus, and mountain yellow-legged frogs, Rana muscosa, inhibit the growth of Bd in vitro. In this study, the bacterial community present on the skin of P. cinereus individuals was investigated to determine if it provides protection to salamanders from the lethal and sub-lethal effects of chytridiomycosis. When the cutaneous bacterial community was reduced prior to Bd exposure, salamanders experienced a significantly greater decrease in body mass, which is a symptom of the disease, when compared to infected individuals with a normal bacterial community. In addition, a greater proportion of infected individuals with a reduced bacterial community experienced limb-lifting, a behavior seen only in infected individuals. Overall, these results demonstrate that the cutaneous bacterial community of P. cinereus provides protection to the salamander from Bd and that alteration of this community can change disease resistance. Therefore, symbiotic microbes associated with this species appear to be an important component of its innate skin defenses.

  1. Cutaneous bacteria of the redback salamander prevent morbidity associated with a lethal disease.

    Science.gov (United States)

    Becker, Matthew H; Harris, Reid N

    2010-01-01

    Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is an infectious disease that causes population declines of many amphibians. Cutaneous bacteria isolated from redback salamanders, Plethodon cinereus, and mountain yellow-legged frogs, Rana muscosa, inhibit the growth of Bd in vitro. In this study, the bacterial community present on the skin of P. cinereus individuals was investigated to determine if it provides protection to salamanders from the lethal and sub-lethal effects of chytridiomycosis. When the cutaneous bacterial community was reduced prior to Bd exposure, salamanders experienced a significantly greater decrease in body mass, which is a symptom of the disease, when compared to infected individuals with a normal bacterial community. In addition, a greater proportion of infected individuals with a reduced bacterial community experienced limb-lifting, a behavior seen only in infected individuals. Overall, these results demonstrate that the cutaneous bacterial community of P. cinereus provides protection to the salamander from Bd and that alteration of this community can change disease resistance. Therefore, symbiotic microbes associated with this species appear to be an important component of its innate skin defenses. PMID:20532032

  2. Habitat and food resources of otters (Mustelidae) in Peninsular Malaysia

    Science.gov (United States)

    Abdul-Patah, P.; Nur-Syuhada, N.; Md-Nor, S.; Sasaki, H.; Md-Zain, B. M.

    2014-09-01

    Habitat and food resources of otters were studied in several locations in Peninsular Malaysia. A total of 210 fecal samples were collected from April 2010 to March 2011 believed to be of otter's were analyzed for their diet composition and their habitat preferences. The DNA testing conducted revealed that only 126 samples were identified as Lultrogale perspicillata and Aonyx cinereus with 105 and 21 samples, respectively. Habitat analyses revealed that these two species preferred paddy fields and mangroves as their main habitats but L. perspicillata preferred to hunt near habitat with large water bodies, such as mangroves, rivers, ponds, and lakes. A. cinereus on the other hand, were mainly found near land-based habitat, such as paddy fields, casuarinas forest and oil palms near mangroves. Habitats chosen were influenced by their food preferences where L. perspicillata consumed a variety of fish species with a supplementary diet of prawns, small mammals, and amphibians, compared to A. cinereus which consumed less fish and more non-fish food items, such as insects, crabs, and snails. Since, the most of the otter habitats in this study are not located within the protected areas, conservation effort involving administrations, landowners, private organizations and public are necessary.

  3. Structural and functional properties of actinomycetal communities in chernozems and saline soils of Ukraine

    Science.gov (United States)

    Grishko, V. N.; Syshchikova, O. V.

    2010-02-01

    In the profiles of ordinary and southern chernozems, the total numbers of amylolytic microorganisms and actinomycetes decreased with the depth by 2.4-4.2 and 3.4 times, respectively; in the profiles of solonetz and solonchak soils, by 4.2-5.3 and 4.8 times, respectively. In the genetic horizons of the ordinary and southern chernozems, the share of actinomycetes amounted to 29-30% of the total population of microorganisms; in the saline soils, it increases with the depth from 23 to 43%. In the chernozems, Streptomyces violaceomaculatus (Roseus section), St. sporoherbeus (Azureus), St. aerionidulus (Cinereus), St. enduracidicus (Cinereus), and St. grisinus (Cinereus) predominated; in the saline soils, St. violaceomaculatus and St. aerionidulus prevailed. In the ordinary chernozem, the Berger-Parker index was 1.5 times higher than in the southern chernozem. High similarity was found between the streptomycete communities in the chernozems (the Sorensen coefficient was 0.78). In the solonetzes, the species richness of the streptomycetes was higher by 1.7 times than in the solonchaks. In the chernozems, the similarity of the streptomycete communities was higher than in the solonchaks (0.78 and 0.60, respectively).

  4. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. PMID:26367180

  5. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O’Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  6. Social-insect fungus farming

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Boomsma, Jacobus Jan

    2006-01-01

    Which social insects rear their own food? Growing fungi for food has evolved twice in social insects: once in new-world ants about 50 million years ago; and once in old-world termites between 24 and 34 million years ago [1] and [2] . The termites domesticated a single fungal lineage - the extant...... basidiomycete genus Termitomyces - whereas the ants are associated with a larger diversity of fungal lineages (all basidiomycetes). The ants and termites forage for plant material to provision their fungus gardens. Their crops convert this carbon-rich plant material into nitrogen-rich fungal biomass to provide...

  7. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  8. Functional expression of a blood tolerant laccase in Pichia pastoris

    OpenAIRE

    Mate, Diana M.; Gonzalez-Perez, David; Kittl, Roman; Ludwig, Roland; Alcalde, Miguel

    2013-01-01

    Abstract Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suite...

  9. Pyrone and pyridone compounds in the liquid culture of Physisporinus sanguinolentus.

    Science.gov (United States)

    Svensson, M; Lundgren, L N; Woods, C; Fatehi, J; Stenlid, J

    2001-04-01

    Chromatographic separation of the liquid culture filtrate of the basidiomycete fungus Physisporinus sanguinolentus has yielded three new compounds viz., 2-methyl-4-pyrone, 2-methyl-5,6-dihydro-4-pyrone and the pyridone form of 4-hydroxy-2-methylpyridine, together with the known triacetic acid lactone, the sesquiterpene dialdehyde merulidial and a derivative of merulidial. Their structures were elucidated by spectroscopic analysis and by comparison to literature data and a synthetic sample. One of the compounds, merulidial, was shown to inhibit the germination of spores and the hyphal growth of the wood-rotting basidiomycete Heterobasidion annosum and the saprophytic mould Cladosporium cucumerinum. PMID:11314963

  10. Fungal ligninolytic enzymes in the forest soil environment: occurrence, distribution and role in soil organic matter transformation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Šnajdr, Jaroslav; Valášková, Vendula

    Cairns: Verlag, 2006, s. 275-275. [International Mycological Congress /8/. Cairns (AU), 20.08.2006-25.08.2006] R&D Projects: GA ČR GA526/05/0168; GA AV ČR KJB600200516 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * forest soil * saprotrophic fungi Subject RIV: EE - Microbiology, Virology

  11. Oak (Quercus petraea) leaf litter degradation by litter-decomposing fungi

    Czech Academy of Sciences Publication Activity Database

    Steffen, K.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    Cairns: Verlag, 2006, s. 368-368. [International Mycological Congress /8/. Cairns (AU), 20.08.2006-25.08.2006] R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * forest soil * saprotrophic fungi Subject RIV: EE - Microbiology, Virology

  12. The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.

    2013-01-01

    Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median eff

  13. Improving ruminal degradability of oil palm fronds using white rot fungi

    NARCIS (Netherlands)

    Rahman, M.M.; Lourenco, M.; Hassim, H.A.; Baars, J.J.P.; Sonnenberg, A.S.M.; Cone, J.W.; Boever, de J.L.; Fievez, V.

    2011-01-01

    The use of oil palm fronds (OPF) in livestock production is limited as up to 0.20 of their dry biomass is lignin. White rot fungi (WRF) are very effective basidiomycetes for biological pre-treatment as they degrade lignin extensively. Ten WRF were screened for their potential to increase OPF digesti

  14. Molecular systematics of the cotton root rot pathogen, Phymatotrichopsis omnivora

    OpenAIRE

    Marek, S.M.; Hansen, K; Romanish, M.; Thorn, R. G.

    2009-01-01

    Cotton root rot is an important soilborne disease of cotton and numerous dicot plants in the south-western United States and Mexico. The causal organism, Phymatotrichopsis omnivora (= Phymatotrichum omnivorum), is known only as an asexual, holoanamorphic (mitosporic) fungus, and produces conidia resembling those of Botrytis. Although the corticoid basidiomycetes Phanerochaete omnivora (Polyporales) and Sistotrema brinkmannii (Cantharellales; both Agaricomycetes) have been suggested as teleomo...

  15. Short read sequencing for Genomic Analysis of the brown rot fungus Fibroporia radiculosa

    Science.gov (United States)

    The practical capability of short read sequencing for whole genome gene prediction was investigated for Fibroporia radiculosa, a copper-tolerant basidiomycete fungus that causes brown rot decay of wood. Illumina GAIIX reads from a single run of a paired-end library (75 nt read length, 300 bp insert...

  16. Ekologický význam saprofytických hub, rozkládajících lignocelulózu v lesních půdách

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 16, 3-4 (2008), s. 4-5. ISSN 1210-6402 R&D Projects: GA ČR GA526/05/0168 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * saprotrophic fungi * microflora Subject RIV: EE - Microbiology, Virology

  17. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter;

    2010-01-01

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  18. Secondary metabolites from marine Penicillium brevicompactum

    OpenAIRE

    2006-01-01

    In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.

  19. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

    OpenAIRE

    Potočnik Ivana; Stepanović Miloš; Rekanović Emil; Todorović Biljana; Milijašević-Marčić Svetlana

    2015-01-01

    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  20. Conservative ecological and evolutionary patterns in liverwort-fungal symbioses.

    Science.gov (United States)

    Bidartondo, Martin I; Duckett, Jeffrey G

    2010-02-01

    Liverworts, the most ancient group of land plants, form a range of intimate associations with fungi that may be analogous to the mycorrhizas of vascular plants. Most thalloid liverworts contain arbuscular mycorrhizal glomeromycete fungi similar to most vascular plants. In contrast, a range of leafy liverwort genera and one simple thalloid liverwort family (the Aneuraceae) have switched to basidiomycete fungi. These liverwort switches away from glomeromycete fungi may be expected to parallel switches undergone by vascular plants that target diverse lineages of basidiomycete fungi to form ectomycorrhizas. To test this hypothesis, we used a cultivation-independent approach to examine the basidiomycete fungi associated with liverworts in varied worldwide locations by generating fungal DNA sequence data from over 200 field collections of over 30 species. Here we show that eight leafy liverwort genera predominantly and consistently associate with members of the Sebacina vermifera species complex and that Aneuraceae thalloid liverworts associate nearly exclusively with Tulasnella species. Furthermore, within sites where multiple liverwort species co-occur, they almost never share the same fungi. Our analyses reveal a strikingly conservative ecological and evolutionary pattern of liverwort symbioses with basidiomycete fungi that is unlike that of vascular plant mycorrhizas. PMID:19812075

  1. Application of lignocellulolytic fungi for bioethanol production from renewable biomass

    OpenAIRE

    Jović Jelena M.; Pejin Jelena; Kocić-Tanackov Sunčica; Mojović Ljiljana

    2015-01-01

    Pretreatment is a necessary step in the process of conversion of lignocellulosic biomass to ethanol; by changing the structure of lignocellulose, enhances enzymatic hydrolysis, but, often, it consumes large amounts of energy and/or needs an application of expensive and toxic chemicals, which makes the process economically and ecologically unfavourable. Application of lignocellulolytic fungi (from the class Ascomycetes, Basidiomycetes and Deuteromycetes) is ...

  2. Drug: D06763 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D06763 Crude, Drug Polyporus sclerotium (JP16); Powdered polyporus sclerotium (JP16...510 Crude drugs 5100 Crude drugs D06763 Polyporus sclerotium (JP16); Powdered pol...iuretic drugs D06763 Polyporus sclerotium; Powdered polyporus sclerotium; Chuling Crude drugs [BR:br08305] Fungi Basidiomycetes D06763 Polyporus sclerotium PubChem: 47208414 ...

  3. Identification of Sugar Beet Germplasm EL51 as a Source of Resistance to Post-Emergence Rhizoctonia Damping-Off

    Science.gov (United States)

    The basidiomycete Rhizoctonia solani is a major agent of seedling stand declines in Michigan sugar beet production. Disease progress, starting from 2-week-old sugar beet seedlings, was scored daily over the following ca. two weeks in a controlled environment, using two AG-2-2 isolates and two AG-4 i...

  4. Comparative analysis of putative pathogenesis-related gene expression in two Rhizoctonia solani pathosystems

    Science.gov (United States)

    Rhizoctonia solani, teleomorph Thanatephoris cucumeris, is a polyphagous nectrotrophic plant pathogen of the Basidiomycete order that is split into fourteen different anastomosis groups (AGs) based on hyphal interactions and host range. Currently, little is known about the methods by which R. solan...

  5. Production of (+)-Globulol Needle Crystals on the Surface Mycelium of Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Šulc, Miroslav; Císařová, I.; Novák, Petr; Kolařík, Miroslav; Flieger, Miroslav

    2008-01-01

    Roč. 53, č. 1 (2008), s. 15-22. ISSN 0015-5632 R&D Projects: GA ČR GP203/05/P575 Institutional research plan: CEZ:AV0Z50200510 Keywords : quambalaria cyanescens * basidiomycete * mass spectrometry Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  6. Generic concepts in the Crepidotaceae as inferred from nuclear large subunit ribosomal DNA sequences, morphology, and basidiospore dormancy patterns

    OpenAIRE

    Aime, Mary Catherine

    1998-01-01

    The Crepidotaceae (Imai) Singer (Basidiomycetes: Agaricales) represents a proposed family of saprophytic fungi containing five agaricoid (Crepidotus, Tubaria, Melanomphalia, Simocybe, Pleurotellus) and four cyphelloid (Episphaeria, Phaeosolenia, Pellidiscus, Chromocyphella) genera. Several contemporary classification systems exist that delegate some or all of these genera to other agaric families. Phylogenetic relationships for the most prevalent genera in the Crepidotaceae were investigated ...

  7. The yeast flora of the coast redwood, Sequoia sempervirens

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2003-01-01

    Only four yeast species could be isolated from young and perannual shoots of the coast redwood tree, Sequoia sempervirens, and from soil beneath the trees, viz. both varieties of Debaryomyces hansenii, Trichosporon pullulans, T. porosum and an unidentified red basidiomycetous yeast.

  8. Cryopreservation of Filamentous Micromycetes and Yeasts Using Perlite

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Kubátová, A.; Váňová, M.; Janderová, B.; Nerud, František

    2007-01-01

    Roč. 51, č. 2 (2007), s. 153-157. ISSN 0015-5632 R&D Projects: GA MŠk(CZ) 0021620828 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje Keywords : cryopreservation * perlite * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  9. Genome and secretome analysis of the hemibiotrophic fungal pathogen, Moniliophthora roreri, which causes frosty pod rot disease of cacao: mechanisms of the biotrophic and necrotrophic phases

    Science.gov (United States)

    Background: Moniliophthora roreri is the causal agent of Frosty pod rot (FPR) disease of Theobroma cacao, the source of chocolate and is one of the most destructive diseases of cacao in the Americas. This Basidiomycete only infects cacao pods and has an extended biotrophic phase lasting up to sixty ...

  10. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

    2015-01-01

    Roč. 119, č. 12 (2015), s. 1345-1353. ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  11. Arsenic accumulation in some higher fungi

    NARCIS (Netherlands)

    Stijve, T.; Vellinga, Else C.; Herrmann, A.

    1990-01-01

    The high arsenic concentrations reported in literature for Laccaria amethystina were amply confirmed. In addition, it was demonstrated that Laccaria fraterna also accumulates the element, whereas in other species of Laccaria the phenomenon was far less outspoken. Few other basidiomycetes proved to h

  12. Macrofungi Flora of Bozkır District (Konya)

    OpenAIRE

    AKTAŞ, Sinan; ÖZTÜRK, Celâleddin; KAŞIK, Gıyasettin; SABAHLAR, Şükrü

    2003-01-01

    The macrofungi specimens were collected from different localities of the Bozkır (Konya) district in 2000-2001, particularly during autumn and spring. As a result of these field and laboratory studies, 74 species belonging to 23 families were identified. Of these, seven belong to Ascomycetes and 67 belong to Basidiomycetes.

  13. Fungal and chemical decolorization of synthetic dyes

    Czech Academy of Sciences Publication Activity Database

    Nerud, František; Baldrian, Petr; Eichlerová, Ivana; Merhautová, Věra; Homolka, Ladislav; Gabriel, Jiří; Beneš, Milan J.; Hrubý, Martin

    Chania : Verlag, 2006, s. 287-288. [Protection and Restoration of the Environment VIII. Chania (GR), 03.07.2006-07.07.2006] R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z40500505 Keywords : basidiomycetes * synthetic dyes * decolorization Subject RIV: EE - Microbiology, Virology

  14. Decolorization of textile dyes by whole cultures of Ischnoderma resinosum and by purified laccase and Mn-peroxidase

    Czech Academy of Sciences Publication Activity Database

    Kokol, V.; Doliška, A.; Eichlerová, Ivana; Baldrian, Petr; Nerud, František

    2007-01-01

    Roč. 40, č. 7 (2007), s. 1673-1677. ISSN 0141-0229 R&D Projects: GA MŠk ME 873 Institutional research plan: CEZ:AV0Z50200510 Keywords : ischnoderma resinosum * basidiomycetes * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 1.969, year: 2007

  15. Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 25, č. 1 (2004), s. 49-55. ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004

  16. Environ: E00815 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00815 Maitake Medicinal herb 1,3-beta-D-Glucan [CPD:C00965], Protein [CPD:C00017],...-beta-D-Glucan [CPD:C00965] Medicinal herbs [BR:br08322] Fungi Basidiomycetes E00815 Maitake ...

  17. Enzyme activities of fungi associated with Picea abies needles

    Czech Academy of Sciences Publication Activity Database

    Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 427-436. ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  18. Tyrosinase activity discovered in Trametes spp

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 20, - (2004), s. 529-530. ISSN 0959-3993 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * enzymatic activity * trametes Subject RIV: EE - Microbiology, Virology Impact factor: 0.478, year: 2004

  19. Biodiversity and biogeography of the cacao (Theobroma cacao L.) pathogen Moniliophthora roreri in tropical America

    Science.gov (United States)

    Moniliophthora roreri is the causal agent of frosty pod rot, which occurs on the neotropical rainforest genera Theobroma and Herrania. While this basidiomycete has had devastating effects on the commercially important cacao tree (T. cacao) in tropical America, where it is confined, little is known ...

  20. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

    2015-01-01

    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  1. Draft Genome Sequence of the Yeast Pseudozyma antarctica Type Strain JCM10317, a Producer of the Glycolipid Biosurfactants, Mannosylerythritol Lipids.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Hori, Tomoyuki; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai; Morita, Tomotake

    2014-01-01

    The basidiomycetous yeast Pseudozyma antarctica is known as a producer of industrial enzymes and the extracellular glycolipids, mannosylerythritol lipids. Here, we report the draft genome sequence of the type strain JCM10317. The draft genome assembly has a size of 18.1 Mb and a G+C content of 60.9%, and it consists of 197 scaffolds. PMID:25291760

  2. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.;

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are...

  3. Strobilurin M, tetrachloropyrocatechol and tetrachloropyrocatechol methyl ether: new antibiotics from a Mycena species.

    Science.gov (United States)

    Daferner, M; Anke, T; Hellwig, V; Steglich, W; Sterner, O

    1998-09-01

    The antifungal and cytostatic compound strobilurin M (1) is a new variant of the strobilurins produced by Mycena sp. 96097, a tropical basidiomycete. The same fungus was found to produce tetrachloropyrocatechol (3a) and tetrachloropyrocatechol methyl ether (3b), new natural products, which exhibit antifungal, antibacterial and cytotoxic activities. PMID:9820231

  4. Heterogeneity in electrophoretic karyotype within and between anastomosis groups of Rhizoctonia solani

    NARCIS (Netherlands)

    Keijer, J.; Houterman, P.M.; Dullemans, A.M.; Korsman, M.G.

    1996-01-01

    Isolates of the soil borne basidiomycete Rhizoctonia solani vary in cultural appearance, in growth characteristics and in pathogenicity towards plants. Isolates of R. solani can be divided into anastomosis groups (AGs) and this division accommodates part of the observed diversity. However, a clear l

  5. The role of natural chlorinated hydroquinone metabolites in ligninolytic fungi

    NARCIS (Netherlands)

    Teunissen, P.J.M.

    1999-01-01

    Ligninolytic Basidiomycetes have been reported to produce a wide variety of chloroaromatic compounds as secondary metabolites, which are structurally similar to environmental pollutants. Among these are chlorinated hydroquinone metabolites (CHM), such as 2-chloro-1,4-dimethoxybenzene (2Cl-14DMB), 2,

  6. Crystallization and preliminary structure analysis of the blue laccase from the ligninolytic fungus Panus tigrinus

    International Nuclear Information System (INIS)

    Blue laccase from the white-rot basidiomycete P. tigrinus, an enzyme involved in lignin biodegradation, has been crystallized. The crystals obtained give diffraction data at 1.4 Å, the best resolution to date for this class of enzymes, which may assist in further elucidation of the catalytic mechanism of multicopper oxidases

  7. Taxonomy and systematic position of tremellaceous fungi

    OpenAIRE

    Władysław Wojewoda

    2014-01-01

    The taxonomy of fungi from the orders Tremellales, Auriculariales. Septobasidiales and related groups (Tulasnellales, Dacrymycetales, Exobasidiales, Sporobolomycetaceae) and the taxonomic position of these fungi within class Basidiomycetes is discussed. The author also presents ideas on the origin, evolution and age of tremellaceous fungi.

  8. Comparative studies of Remazol Brillant Blue removal by immobilized organisms; investigation of metabolites by GC/MS and FTIR spectrometry.

    Science.gov (United States)

    Akdogan, Hatice Ardag; Topuz, Merve Canpolat

    2015-01-01

    Reactive dyes are important chemical pollutants from textile industries. Treatment of effluents from dye-based industries poses a major problem, and biotreatment with white rot fungi seems to be a viable option. The biological treatment of synthetic dyes at a low cost and in the shortest possible time is used especially in dye and textile industries and leads to pollution in the wastewater dumped into the environment by these industries. For this study, decolorization of the recalcitrant dye Remazol Brilliant Blue R by immobilized Pleurotus ostreatus and Coprinus plicatilis was investigated. This dye was removed 100% (dye concentration: 10.0 mg/L) by both immobilized organisms. Extracellular ligninolytic enzyme activities were also measured during the decolorization. There was an attempt to identify metabolites with FTIR spectrometry and GC/MS at the end of the decolorization. These results indicated that the samples did not include any detectable metabolite. PMID:25905752

  9. The level of elements and antioxidant activity of commercial dietary supplement formulations based on edible mushrooms.

    Science.gov (United States)

    Stilinović, Nebojša; Škrbić, Biljana; Živančev, Jelena; Mrmoš, Nataša; Pavlović, Nebojša; Vukmirović, Saša

    2014-12-01

    Commercial preparations of Cordyceps sinensis, Ganoderma lucidum and Coprinus comatus mushroom marketed as healthy food supplements in Serbia were analyzed by atomic absorption spectrometry with a graphite furnace (GFAAS) for their element content. Antioxidant activity potential and total phenolics of the same mushrooms were determined. The element content of mushroom samples was in the range of 0.130-0.360 mg kg(-1) for lead (Pb), sinensis showed the best properties. The same was seen for the analysis of selected phenolic compounds; C. sinensis was found to have the highest content. Commercial preparations of C. sinensis and C. comatus can be considered to be safe and suitable food supplements included in well-balanced diets. PMID:25294630

  10. Comparison of Remazol Brillant Blue Removal from Wastewater by Two Different Organisms and Analysis of Metabolites by GC/MS.

    Science.gov (United States)

    Akdogan, Hatice Ardag; Canpolat, Merve

    2014-01-01

    White rot fungus participates in biological degradation of many organic environmental pollutants. Also, white rot fungus contains a variety of extracellular enzymes, and these enzymes are used for biological degradation of organic matter. We investigated the biological treatment of synthetic dyes, at a low cost and in the shortest possible time, that are used especially in the dye and textile industries and are important polluting agents in the wastewater discharged into the environment by these industries. For this purpose, removal of Remazol Brillant Blue by Pleurotus ostreatus and Coprinus plicatilis was studied. This dye was removed 100% (dye concentration, 10.0 mg/L) by both organisms. Laccase and manganese peroxidase enzyme activities were also monitored. There was an attempt to identify metabolites via GC/MS at the end of the decolorization. No detectable metabolite was found. PMID:25902993

  11. Silver content of wild-grown mushrooms from northern Poland.

    Science.gov (United States)

    Falandysz, J; Bona, H; Danisiewicz, D

    1994-09-01

    Wild-grown and mostly edible species of higher mushrooms collected in 1989-1992 from the districts of Gdańsk, Elblag and Piła (northern part of Poland) have been investigated with regard to their silver content. In total, 527 samples including 25 mushroom species of six families (Agaricaceae, Boletaceae, Cantharellaceae, Hygrophoraceae, Coprinaceae and Russulaceae) were examined. Among the fungi examined only Agaricus campestris and A. augustus were heavy bioaccumulating species and showed the highest concentrations of 35 mg Ag/kg dry weight (1.1-150) and 2.0-6.9 mg/kg, respectively. Silver concentrations exceeding 1.0 mg/kg dry weight were noted in Boletus aestivalis, Lepista nuda, L. personata, and in some specimens of B. edulis, Leccinum scrabum, L. vulpinum, Cantharellus cibarius and Coprinus comatus. PMID:7975911

  12. Invasive Asian Earthworms Negatively Impact Keystone Terrestrial Salamanders

    Science.gov (United States)

    Ziemba, Julie L.

    2016-01-01

    Asian pheretimoid earthworms (e.g. Amynthas and Metaphire spp.) are invading North American forests and consuming the vital detrital layer that forest floor biota [including the keystone species Plethodon cinereus (Eastern Red-backed Salamander)], rely on for protection, food, and habitat. Plethodon cinereus population declines have been associated with leaf litter loss following the invasion of several exotic earthworm species, but there have been few studies on the specific interactions between pheretimoid earthworms and P. cinereus. Since some species of large and active pheretimoids spatially overlap with salamanders beneath natural cover objects and in detritus, they may distinctively compound the negative consequences of earthworm-mediated resource degradation by physically disturbing important salamander activities (foraging, mating, and egg brooding). We predicted that earthworms would exclude salamanders from high quality microhabitat, reduce foraging efficiency, and negatively affect salamander fitness. In laboratory trials, salamanders used lower quality microhabitat and consumed fewer flies in the presence of earthworms. In a natural field experiment, conducted on salamander populations from “non-invaded” and “pheretimoid invaded” sites in Ohio, salamanders and earthworms shared cover objects ~60% less than expected. Earthworm abundance was negatively associated with juvenile and male salamander abundance, but had no relationship with female salamander abundance. There was no effect of pheretimoid invasion on salamander body condition. Juvenile and non-resident male salamanders do not hold stable territories centered beneath cover objects such as rocks or logs, which results in reduced access to prey, greater risk of desiccation, and dispersal pressure. Habitat degradation and physical exclusion of salamanders from cover objects may hinder juvenile and male salamander performance, ultimately reducing recruitment and salamander abundance

  13. Distribution and occurrence of mosquito species in the municipal areas of Imo State, Nigeria

    Directory of Open Access Journals (Sweden)

    Ifeyinwa Celestina MGBEMENA

    2012-05-01

    Full Text Available A study of the ecology of drainage - breeding mosquito vectors was conducted in the three urban centers (Owerri, Orlu and Okigwe of Imo State, Nigeria. Four drainage sites located around markets, residential, stream and hotel premises were selected in each urban centre. Dipping method of sampling was employed and a total of 8,820 mosquitoes comprising eight species namely; Aedes aegypti, Aedes vittatus, Culex quinquefasciatus, Culex tigripes, Culex horridus, Culex cinereus, Culex annuliorus and Anopheles gambiae were encountered; in Owerri and Orlu with Cx. cinereus being completely absent in Okigwe. Cx. quinquefasciatus was predominantly present in all drainage sites with the highest occurrence of 4,474(50.74% followed by Aedes aegypti 1814 (20.57%, An .gambiae 945(10.71%, Cx. tigripes 484 (5.48% Ae. vittatus 420 (4.76%, Cx. horridus 264 (02.99%, Cx. cinereus 261 (2.96%, Cx. annuliorus 159 (1.88%. Of all sites sampled, market drainages had the highest abundance of mosquitoes which was significantly higher than (ANOVA, P≤ 0.05 those found in the residential, streams and hotel premises. Residential drainages recorded the second highest density followed by stream/vegetation drainages and hotel drainages which had the least. The abundance and distribution of mosquitoes in Owerri (130.06 the State Capital was significantly higher (ANOVA, P≤ 0.05 than those for Orlu (93.44 and Okigwe (52.13. The mosquito species identified in this study are of public health importance and there is an urgent need to desilt and clean up these drainages for free flow of water. This will not only rid these species of breeding sites but also free the State of the diseases associated with these organisms.

  14. Salida de campo por Peralejos de las Truchas y Checa, en Guadalajara, el 19 y 20 de julio de 1952

    OpenAIRE

    Valverde Gómez, José Antonio, 1926-2003

    2008-01-01

    Salida de campo del autor y Francisco Bernis por Peralejos de las Truchas y Checa, en Guadalajara, el 19 y 20 de julio de 1952, de la que se anotaron observaciones sobre sapos y ranas, los siguientes reptiles: Anguis fragilis (Lución), Blanus cinereus (Culebrilla ciega, también llamado Eslabon), Lacerta agilis (Lagarto ágil), Malpolon monspessulanus (Culebra bastarda, llamada Coleopeltis mouspessulanus por el autor) y Vipera sp. (Víbora), los siguientes mamíferos: Martes foina (Garduña), Mele...

  15. Salida de campo al pinar de Laguna de Duero (Valladolid) el 25 de marzo de 1952

    OpenAIRE

    Valverde Gómez, José Antonio, 1926-2003

    2008-01-01

    Salida de campo al pinar de Laguna de Duero (Valladolid) el 25 de marzo de 1952, de la que se anotaron observaciones sobre "Lymneidos", la Rana Común (Pelophylax perezi), saltamontes y mariposas, los siguientes mamíferos: Arvicola sapidus (Rata de agua) y Erizo (pudiendo ser Erinaceus europaeus o Atelerix algirus), los siguientes reptiles: Blanus cinereus (Culebrilla ciega), Chalcides sp. (Eslizón) y lagartijas (sin identificar especies), y las siguientes aves: Accipiter nisus (Gavilán común,...

  16. Salida de campo a Fuensaldaña (Valladolid) el 19 de septiembre de 1952

    OpenAIRE

    Valverde Gómez, José Antonio, 1926-2003

    2008-01-01

    Salida de campo a Fuensaldaña (Valladolid) el 19 de septiembre de 1952, de la que se anotaron observaciones sobre los siguientes anfibios: Tritones o salamandras (no se concreta la especie; llamados erróneamente salamanquesas por el autor), Ranas (pudiendo ser Hyla sp.), Renacuajos (sin concretar la especie) y Sapos (sin concretar la especie), los siguientes reptiles: Blanus cinereus (Culebrilla ciega, también llamado Eslabon), Chalcides sp. (Eslizón, también llamado Eliso por el autor), Cule...

  17. The fur of mammals in exposed environments; do crypsis and thermal needs necessarily conflict? The polar bear and marsupial koala compared.

    Science.gov (United States)

    Dawson, Terence J; Webster, Koa N; Maloney, Shane K

    2014-02-01

    The furs of mammals have varied and complex functions. Other than for thermoregulation, fur is involved in physical protection, sensory input, waterproofing and colouration, the latter being important for crypsis or camouflage. Some of these diverse functions potentially conflict. We have investigated how variation in cryptic colouration and thermal features may interact in the coats of mammals and influence potential heat inflows from solar radiation, much of which is outside the visible spectral range. The coats of the polar bear (Ursus maritimus) and the marsupial koala (Phascolarctus cinereus) have insulative similarities but, while they feature cryptic colouration, they are of contrasting colour, i.e. whitish and dark grey. The reflectance of solar radiation by coats was measured across the full solar spectrum using a spectroradiometer. The modulation of incident solar radiation and resultant heat flows in these coats were determined at a range of wind speeds by mounting them on a heat flux transducer/temperature-controlled plate apparatus in a wind tunnel. A lamp with a spectral distribution of radiation similar to the solar spectrum was used as a proxy for the sun. Crypsis by colour matching was apparent within the visible spectrum for the two species, U. maritimus being matched against snow and P. cinereus against Eucalyptus forest foliage. While reflectances across the full solar spectrum differed markedly, that of U. maritimus being 66 % as opposed to 10 % for P. cinereus, the heat influxes from solar radiation reaching the skin were similar. For both coats at low wind speed (1 m s(-1)), 19 % of incident solar radiation impacted as heat at the skin surface; at higher wind speed (10 m s(-1)) this decreased to approximately 10 %. Ursus maritimus and P. cinereus have high and comparable levels of fur insulation and although the patterns of reflectance and depths of penetrance of solar radiation differ for the coats, the considerable insulation limited the

  18. Salida de campo a Fuensaldaña (Valladolid) el 31 de mayo de 1953

    OpenAIRE

    Valverde Gómez, José Antonio, 1926-2003

    2008-01-01

    Salida de campo de el autor y Félix Rodríguez de la Fuente a Fuensaldaña, Valladolid, la tarde del 31 de mayo de 1953, de la que se anotaron observaciones sobre los reptiles Blanus cinereus (Culebrilla ciega, también llamado Eslabon) y Rhinechis scalaris (Culebra de escalera, llamada Elaphe scalaris o Coluber scalaris por el autor), y las siguientes aves: Falco naumanni (Cernícalo primilla), Falco peregrinus (Halcón peregrino, también llamado Alcotán palomero), Melanocorypha calandra (Caland...

  19. Ecology and Geography of Transmission of Two Bat-Borne Rabies Lineages in Chile

    OpenAIRE

    Luis E. Escobar; A. Townsend Peterson; Myriam Favi; Verónica Yung; Pons, Daniel J.; Gonzalo Medina-Vogel

    2013-01-01

    Rabies was known to humans as a disease thousands of years ago. In America, insectivorous bats are natural reservoirs of rabies virus. The bat species Tadarida brasiliensis and Lasiurus cinereus, with their respective, host-specific rabies virus variants AgV4 and AgV6, are the principal rabies reservoirs in Chile. However, little is known about the roles of bat species in the ecology and geographic distribution of the virus. This contribution aims to address a series of questions regarding th...

  20. THE DISTRIBUTION OF BATS OF GENUS LASIURUS (VESPERTILIONIDAE IN COLOMBIA, WITH NOTES ON TAXONOMY, MORPHOLOGY AND ECOLOGY

    Directory of Open Access Journals (Sweden)

    DARWIN M. MORALES-MARTÍNEZ

    2015-01-01

    Full Text Available In order to clarify the distribution of bats of the genus Lasiurus in Colombia, we performed a morphological study of 49 specimens from four Colombian collections. Our review confirms the presence of three species in Colombia (L. blossevillii, L. cinereus, and L. ega with distribution in all natural regions that include six of the nine biogeographic provinces. These species can be easily differentiated based on external and cranial characters. Lasiurus cinereus is the largest species (forearm length > 52 mm and L. blossevillii is the smallest (forearm < 42 mm; L. ega has a distinctive skull shape with a developed sagittal crest. While previous literature make claims that L. egregius and L. castaneus occur in Colombia, our analysis found no support for this and even contradicts the evidence cited for their presence in the country. We demonstrate that one specimen attributed to L. egregius in literature corresponds to a misidentified L. blossevillii. Furthermore, we found that there are not any specimens of L. castaneus from the Department of Cundinamarca despite several reports in the literature. The status of subspecies in Colombia remains controversial and more specimens are needed to determine whether there are clear distinctions between forms in any geographical region. Most of the specimens examined were males and in some cases, were collected opportunistically from dead individuals found in cities in the Andean region.

  1. Utilization of agro-resources by radiation treatment -production of animal feed and mushroom from oil palm wastes

    International Nuclear Information System (INIS)

    The production of animal feeds and mushrooms from oil palm cellulosic wastes by radiation and fermentation has been investigated in order to utilize the agro-resources and to reduce the smoke pollution. The process is as follows: decontamination of microorganisms in fermentation media of empty fruit bunch of oil palm (EBF) by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 25 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus and P. sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased to 13% and the crude fiber content decreased to 20% after 30 days of incubation with C. cinereus at 30oC in solid state fermentation. P. sajor-caju was suitable for the mushroom production on EFB with rice bran. (author)

  2. Salamanders increase their feeding activity when infected with the pathogenic chytrid fungus Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Hess, Alexandra; McAllister, Caroline; DeMarchi, Joseph; Zidek, Makenzie; Murone, Julie; Venesky, Matthew D

    2015-10-27

    Immune function is a costly line of defense against parasitism. When infected with a parasite, hosts frequently lose mass due to these costs. However, some infected hosts (e.g. highly resistant individuals) can clear infections with seemingly little fitness losses, but few studies have tested how resistant hosts mitigate these costly immune defenses. We explored this topic using eastern red-backed salamanders Plethodon cinereus and the fungal pathogen Batrachochytrium dendrobatidis (Bd). Bd is generally lethal for amphibians, and stereotypical symptoms of infection include loss in mass and deficits in feeding. However, individuals of P. cinereus can clear their Bd infections with seemingly few fitness costs. We conducted an experiment in which we repeatedly observed the feeding activity of Bd-infected and non-infected salamanders. We found that Bd-infected salamanders generally increased their feeding activity compared to non-infected salamanders. The fact that we did not observe any differences in mass change between the treatments suggests that increased feeding might help Bd-infected salamanders minimize the costs of an effective immune response. PMID:26503775

  3. Two Lactarius species associated with a relict Fagus grandifolia var. mexicana population in a Mexican montane cloud forest.

    Science.gov (United States)

    Montoya, L; Haug, I; Bandala, V M

    2010-01-01

    Ectomycorrhizal (EM) fleshy fungi are being monitored in a population of Fagus grandifolia var. mexicana persisting in a montane cloud forest refuge on a volcano in a subtropical region of central Veracruz (eastern Mexico). The population of Fagus studied represents one of the 10 recognized forest fragments still housing this tree genus in Mexico. This is the first attempt to document EM fungi associated with this tree species in Mexico. We present evidence of the ectomycorrhizal symbiosis for Lactarius badiopallescens and L. cinereus with this endemic tree. Species identification of Lactarius on Fagus grandifolia var. mexicana was based on the comparison of DNAsequences (ITS rDNA) of spatiotemporally co-occurring basidiomes and EM root tips. The host of the EM tips was identified by comparison of the large subunit of the ribulose-bisphosphate carboxylase gene (rbcL). The occurrence of Lactarius badiopallescens and L. cinereus populations in the area of study represent the southernmost record known to date of these two species in North America and are new for the Neotropical Lactarius mycota. Descriptions coupled with illustrations of macro- and micromorphological features of basidiomes as well as photographs of ectomycorrhizas are presented. PMID:20120238

  4. Individual heterogeneity in growth and age at sexual maturity: a gamma process analysis of capture–mark–recapture data

    Science.gov (United States)

    Link, William; Hesed, Kyle Miller

    2015-01-01

    Knowledge of organisms’ growth rates and ages at sexual maturity is important for conservation efforts and a wide variety of studies in ecology and evolutionary biology. However, these life history parameters may be difficult to obtain from natural populations: individuals encountered may be of unknown age, information on age at sexual maturity may be uncertain and interval-censored, and growth data may include both individual heterogeneity and measurement errors. We analyzed mark–recapture data for Red-backed Salamanders (Plethodon cinereus) to compare sex-specific growth rates and ages at sexual maturity. Aging of individuals was made possible by the use of a von Bertalanffy model of growth, complemented with models for interval-censored and imperfect observations at sexual maturation. Individual heterogeneity in growth was modeled through the use of Gamma processes. Our analysis indicates that female P. cinereus mature earlier and grow more quickly than males, growing to nearly identical asymptotic size distributions as males.

  5. Upgrading of oil palm wastes to animal feeds by radiation and fermentation treatment

    International Nuclear Information System (INIS)

    Upgrading of oil palm cellulosic wastes to animal feeds by radiation and fermentation treatment has been investigated in order to recycle the agro-resources and to reduce the smoke pollution. The process is as follows; decontamination of microorganisms in fermentation media using oil palm wastes by irradiation, inoculation of useful microorganisms, and subsequent microbial digestion of cellulosic materials as well as production of proteins. The dose of 25 kGy was required to sterilize the contaminated bacteria whereas the dose of 5 - 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus was selected as the most suitable seed microorganism for the fermentation of EFB (Empty Fruit Bunch of oil palm). The protein content increased to 13 % and the crude fiber content decreased to 20 % after 30 days incubation with C. cinereus at 30degC in solid state fermentation. It is considered that these fermented products can be used for the ruminant animal feeds. (author)

  6. Utilization of agro-resources by radiation treatment -production of animal feed and mushroom from oil palm wastes

    Science.gov (United States)

    Kume, Tamikazu; Matsuhashi, Shinpei; Hashimoto, Shoji; Awang, Mat Rasol; Hamdini, Hassan; Saitoh, Hideharu

    1993-10-01

    The production of animal feeds and mushrooms from oil palm cellulosic wasres by radiation and fermentation has been investigated in order to utilize the agro-resources and to reduce the smoke pollution. The process is as follows: decontamination of microorganisms in fermentation media of empty fruit bunch of oil palm (EFB) by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 25 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus and P. sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased to 13 % and the crude fiber content decreased to 20% after 30 days of incubation with C. cinereus at 30°C in solid state fermentation. P. sajor-caju was suitable for the mushroom production on EFB with rice bran.

  7. Interoceanic occurrence of species of Aristocleidus Mueller, 1936 (Monogenoidea: Dactylogyridae) parasitizing the gills of gerreid fishes in the Neotropics.

    Science.gov (United States)

    Mendoza Franco, Edgar F; Violante-González, Juan; Roche, Dominique G

    2009-09-01

    During investigations of fish parasites in the Neotropics (including the state of Veracruz and the Yucatán Peninsula in the Gulf of Mexico, the Chautengo Lagoon on the Pacific coast of the state of Guerrero in Mexico, and Lake Gatun in the Panama Canal), three monogenoidean (Dactylogyridae) species were found parasitizing the gills of gerreids (Gerreidae): Aristocleidus hastatus Mueller, 1936, was recovered from Eugerres plumieri (Cuvier) and Diapterus auratus Ranzani in Veracruz, from D. auratus and Diapterus rhombeus (Cuvier) in Yucatán, from Eugerres brasilianus (Cuvier) in Panama (all new hosts and geographical records), and from D. peruvianus (Cuvier) and Gerres cinereus (Walbaum) in Guerrero; Aristocleidus lamothei Kritsky and Mendoza-Franco, 2008, was recovered from E. plumieri in Veracruz and from D. rhombeus in Yucatan (new hosts and geographical records), and Aristocleidus sp. was recovered from G. cinereus in Guerrero. Results from this study suggest that species of Aristocleidus exhibit wide host specificity within gerreid fishes and that geminate species within this parasite genus may have originated with the formation of the Isthmus of Panama (3.1 to 3.5 ma). Evidence is also presented suggesting the potential role of the Panama Canal as a passageway allowing the interoceanic dispersal of Aristocleidus species across the isthmus. PMID:19415330

  8. Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

    Directory of Open Access Journals (Sweden)

    D Tagu

    2009-12-01

    Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.

  9. Carotene-degrading activities from Bjerkandera adusta possess an application in detergent industries.

    Science.gov (United States)

    Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G

    2015-06-01

    Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning. PMID:25614450

  10. Ecologia microbiana de uvas afectadas por podridão ácida e sua influência na qualidade quimica e sensorial do vinho

    OpenAIRE

    Barata, André Bernardo Antunes dos Santos Neves

    2011-01-01

    The grape berry microbiota is deeply influenced by the sanitary status of grapes. In sound grapes the most frequent yeast species were basidiomycetes, Aureobasidium pullulans, Candida zemplinina and Hanseniaspora uvarum. Sour rotten grapes were mostly colonised by C. zemplinina, H. uvarum, Issatchenkia spp. and Zygoascus hellenicus. The presence of minoritary populations of Zygosaccharomyces bailii was only found in damaged grapes. The acetic acid bacteria Gluconobacter spp. and Gluconoacetob...

  11. A Preliminary Note on Yeasts Associated With Fecal Pellets of Rodents and Marsupials of Atlantic Forest Fragments in Rio de Janeiro, Brazil

    OpenAIRE

    Jacqueline Abranches; Hilda N. Nóbrega; Patrícia Valente; Leda C. Mendonça-Hagler; Allen N. Hagler

    1998-01-01

    Yeasts had mean counts of above 106 CFU/g in the fecal pellets of small mammals from tropical forest fragments. Most of the 55 species isolated were fermentative ascomycetes, with the most frequent being Debaryomyces hansenii, Pichia membranifaciens and Issatchenkia orientalis, whereas Rhodotorula mucilaginosa was the most frequent yeast of basidiomycetous affinity.Leveduras em pelotas fecais de pequenos mamíferos provenientes de fragmentos de Mata Atlântica tiveram contagem média acima de 10...

  12. Book reviews

    OpenAIRE

    NN

    2003-01-01

    The mycoflora of Nepal, a remote and not easily accessible country, has been poorly known so far. This book offers a welcome compilation of current knowledge, brought together by the author, and supplemented with his extensive own research. Introductory chapters deal with the phytogeography and climate, followed by an overview of the history of mycology in Nepal so far. The main part of the book is devoted to an annotated list of Ascomycetes and Basidiomycetes found in Nepal, giving details o...

  13. Optimal parameters for laccase-mediated destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels

    OpenAIRE

    Yang, Jie; Yang, Xiaodan; Ye, Xiuyun; Lin, Juan

    2016-01-01

    The data presented in this article are related to the research article entitled “Destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels with fungal laccase” [1]. Laccase is a class of multicopper oxidases that can catalyze oxidation of recalcitrant dyestuffs. This article describes optimal parameters for destaining of polyacrylamide gels, stained with Coomassie Brilliant Blue R-250, with laccase from basidiomycete Cerrena sp. strain HYB07. Effects of laccase activity, mediat...

  14. Origin of laccase gene structural diversity in edible mushrooms

    OpenAIRE

    Billette, Christophe; Gibard, Thierry; Foulongne Oriol, Marie; Savoie, Jean-Michel

    2011-01-01

    Laccase genes have been found in fungi, plants, insects and bacteria. In Basidiomycetes, the number of laccase genes ranges from 0 to 17. The role of these genes is not well known. It seems to be important in fungal interaction, development, melanine synthesis, human and plant pathogenesis, [ectomycorrhizal association and nutrition of the fungi]. Their role as ligninmodifying enzymes is controversial. Laccase phylogeny already published is not congruent with species phylogeny. Phylogeny of g...

  15. Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

    OpenAIRE

    Tagu, D.; Marmeisse, R.; Y Baillet; S Rivière; B Palin; Bernardini, F.; A Méreau; Gay, G.; R. Balestrini; P. Bonfante; Martin, F

    2009-01-01

    Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosp...

  16. Macrofungi of Kemaliye district (Erzincan)

    OpenAIRE

    ALLI, Hakan

    2011-01-01

    The material of this study comprises macrofungi specimens collected from different localities in Kemaliye district (Erzincan, Turkey) in 2006 and 2007. As a result of field and laboratory studies, 106 taxa under 35 families belonging to the classes Ascomycetes and Basidiomycetes are described: 3 of them, namely Psathyrella panaeoloides (Maire) Arnolds, Galerina stylifera var. stylifera (G.F.Atk.) A.H.Sm. & Singer, and Inocybe amblyspora Kühner, are new records for Turkey.

  17. Comparative genome analysis across a kingdom of eukaryotic organisms: Specialization and diversification in the Fungi

    OpenAIRE

    Cornell, Michael J.; Alam, Intikhab; Soanes, Darren M.; Wong, Han Min; Hedeler, Cornelia; Paton, Norman W; Rattray, Magnus; Hubbard, Simon J; Talbot, Nicholas J.; Oliver, Stephen G

    2007-01-01

    The recent proliferation of genome sequencing in diverse fungal species has provided the first opportunity for comparative genome analysis across a eukaryotic kingdom. Here, we report a comparative study of 34 complete fungal genome sequences, representing a broad diversity of Ascomycete, Basidiomycete, and Zygomycete species. We have clustered all predicted protein-encoding gene sequences from these species to provide a means of investigating gene innovations, gene family expansions, protein...

  18. Ferrochelatase is a conserved downstream target of the blue light-sensing White collar complex in fungi

    OpenAIRE

    Idnurm, Alexander; Heitman, Joseph

    2010-01-01

    Light is a universal signal perceived by organisms, including fungi, in which light regulates common and unique biological processes depending on the species. Previous research has established that conserved proteins, originally called White collar 1 and 2 from the ascomycete Neurospora crassa, regulate UV/blue light sensing. Homologous proteins function in distant relatives of N. crassa, including the basidiomycetes and zygomycetes, which diverged as long as a billion years ago. Here we cond...

  19. Atmospheric N Deposition Increases Bacterial Laccase-Like Multicopper Oxidases: Implications for Organic Matter Decay

    OpenAIRE

    Freedman, Zachary; Zak, Donald R.

    2014-01-01

    Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi...

  20. Lack of Cryptococcus gattii from Eucalyptus in Ahvaz

    OpenAIRE

    Zahra Salehei; Ali Zarei Mahmoudabadi; Majid Zarrin

    2015-01-01

    The basidiomycetous yeast genus Cryptococcus contains two medically important pathogens, Cryptococcus neoformans and C. gattii [1-3]. C. neoformans is one of the common pathogens in acquired immunodeficiency syndrome (AIDS), whereas the most cases of diseases due to C. gattii happened in the healthy individuals [2, 4]. C. gattii has a tendency to affect the respiratory and nervous systems of the humans and domestic animals such as, dogs, cats, and horses [5]. C. gattii is more geographically ...

  1. VANILLIN PRODUCTION BY PHANEROCHAETE CHRYSOSPORIUM GROWN ON GREEN COCONUT AGRO-INDUSTRIAL HUSK IN SOLID STATE FERMENTATION

    OpenAIRE

    Elisabete dos Santos Barbosa; Daniel Perrone; Ana Lúcia do Amaral Vendramini; Selma Gomes Ferreira Leite

    2008-01-01

    Agro-industrial residues have become an important source for the production of chemical compounds using biological pathways, contributing to preservation of the environment and making the overall process economically supportable. Vanillin is a very important aromatic compound for the food, beverage, and pharmaceutical industries. The aim of the present study was to evaluate the vanillin production by solid-state fermentation on green coconut residue using the basidiomycete Phanerochaete chrys...

  2. Natural Protection of Wood with Antagonism Fungi

    Directory of Open Access Journals (Sweden)

    Alba ZAREMSKI

    2011-03-01

    Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.

  3. Hydrophobins from Pleurotus ostreatus: self-assembling proteins for nanobiotechnological applications

    OpenAIRE

    Longobardi, Sara

    2011-01-01

    Hydrophobins are a large family of small proteins (about 100 aminoacids), produced by filamentous fungi at different developmental stages, self-assembling at hydrophobic/hydrophilic interfaces into amphipathic biofilm. A hydrophobin secreted by the basidiomycete fungus Pleurotus ostreatus, identified as Vmh2, has been purified both from cultural broth and mycelia. Vmh2 extracted from cultural broth (5-10 mg L-1) was found complexed with glucans, identified as cyclodextrins. After separatio...

  4. White rot fungi in bioremediation – Ecology in the soil environment

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    Chania: Technical University of Crete, 2008, s. 1-4. ISBN 978-960-8475-12-0. [European Bioremediation Conference /4./. Chania (GR), 03.09.2008-06.09.2008] R&D Projects: GA MŠk OC 155; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * bioremediation * forest soil Subject RIV: EE - Microbiology, Virology

  5. Preliminary studies of fungi in the Biebrza National Park. Part IV. Macromycetes – new data and the synthesis

    OpenAIRE

    Anna Kujawa; Błażej Gierczyk; Grażyna Domian; Marta Wrzosek; Małgorzata Stasińska; Jarosław Szkodzik; Tomasz Leski; Leszek Karliński; Marcin Pietras; Maria Dynowska; Agnieszka Henel; Dominika Ślusarczyk; Dariusz Kubiak

    2016-01-01

    The paper presents the last part of the results of the short-term inventory of fungi species in the Biebrza National Park and synthesises all the data gathered during two surveys, including the information published by other authors. The main body of research is focused on a survey of macrofungi identified with morphology-based methods. In case of some specimens molecular technics have been applied. In total 346 macrofungal taxa (21 belonging to ascomycetes and 325 to basidiomycetes) were fou...

  6. Medicinal properties of macrofungi

    OpenAIRE

    Hilszczańska, Dorota

    2012-01-01

    This review highlights the importance to people of some types of wild fungi considered in the context of non-wood forest products. Macrofungi are used both for food and medicine proposes. Substances isolated from the higher Basidiomycetes and Ascomycetes mushrooms express promising immune modulating, antitumor, antiviral, antibacterial and antidiabetic properties. They have been, and are presently, used against cancer in some countries in Far East as well as in the United States of America...

  7. Conservation of the mycelia of the medicinal mushroom Humphreya coffeata (Berk.) Stey. in sterile distilled water

    OpenAIRE

    Monserrat García-García; Leticia Rocha-Zavaleta; Valdez-Cruz, Norma A.; Trujillo-Roldán, Mauricio A

    2014-01-01

    Currently, there is a growing interest in obtaining and studying the biologically active compounds from higher basidiomycetes, such as Ganoderma lucidum, Lentinus edodes and Inonotus obliquus [1], but the techniques for safe long-term storage are time-consuming, susceptible to contamination, and do not prevent genetic and physiological changes during long-term maintenance [2]. A recent strategy for obtaining biologically active compounds is using mycelia submerged cultures of these mushrooms,...

  8. A Brief Chronicle of the Genus Cordyceps Fr., the Oldest Valid Genus in Cordycipitaceae (Hypocreales, Ascomycota)

    OpenAIRE

    Shrestha, Bhushan; Tanaka, Eiji; Han, Jae-Gu; Oh, Junsang; Han, Sang-Kuk; Lee, Kang-Hyo; Sung, Gi-Ho

    2014-01-01

    The earliest pre-Linnaean fungal genera are briefly discussed here with special emphasis on the nomenclatural connection with the genus Cordyceps Fr. Since its valid publication under the basidiomycetous genus Clavaria Vaill. ex L. (Clavaria militaris L. Sp. Pl. 2:1182, 1753), the genus Cordyceps has undergone nomenclatural changes in the post-Linnaean era, but has stood firmly for approximately 200 years. Synonyms of Cordyceps were collected from different literature sources and analyzed bas...

  9. Laccase‐catalysed oxidations of naturally occurring phenols: from in vivo biosynthetic pathways to green synthetic applications

    OpenAIRE

    Jeon, Jong‐Rok; Baldrian, Petr; Murugesan, Kumarasamy; Chang, Yoon‐Seok

    2012-01-01

    Summary Laccases are oxidases that contain several copper atoms, and catalyse single‐electron oxidations of phenolic compounds with concomitant reduction of oxygen to water. The enzymes are particularly widespread in ligninolytic basidiomycetes, but also occur in certain prokaryotes, insects and plants. Depending on the species, laccases are involved in various biosynthetic processes contributing to carbon recycling in land ecosystems and the morphogenesis of biomatrices, wherein low‐molecula...

  10. A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity

    OpenAIRE

    Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

    2003-01-01

    Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. O...

  11. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    OpenAIRE

    Wynhoven Brian; Mayo Michael; Munro Sarah; Banks Travis; Anikster Yehoshua; Eilam Tamar; Donaldson Michael E; Joly David L; Antonov Ivan; Zhu Wenhan; Dickinson Matthew; Fellers John; Linning Rob; Xu Junhuan; Ali Johar

    2011-01-01

    Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support ...

  12. The Population Structure of Antibiotic-Producing Bacterial Symbionts of Apterostigma dentigerum Ants: Impacts of Coevolution and Multipartite Symbiosis

    OpenAIRE

    Caldera, Eric J.; Currie, Cameron R

    2012-01-01

    Fungus-growing ants (Attini) are part of a complex symbiosis with Basidiomycetous fungi, which the ants cultivate for food, Ascomycetous fungal pathogens (Escovopsis), which parasitize cultivars, and Actinobacteria, which produce antibiotic compounds that suppress pathogen growth. Earlier studies that have characterized the association between attine ants and their bacterial symbionts have employed broad phylogenetic approaches, with conclusions ranging from a diffuse coevolved mutualism to n...

  13. Diversity of fungi associated with Rhododendron argyrophyllum and R. floribundum hair roots in Sichuan, China

    OpenAIRE

    Yu Zheng; Bo Gao; Lifu Sun; Yanhong Bing; Kequan Pei

    2010-01-01

    We investigated the fungal associates of Rhododendron argyrophyllum and R. floribundum in Sichuan Province. A total of 41 fungal taxa were identified from hair roots based on ITS sequence analyses belonging to the following orders: Helotiales, Eurotiales, Pezizales, and Pleosporales in Ascomycetes, Sebacinales and Agaricales, Erythrobasidiales, and Filobasidiales in Basidiomycetes. Fungal diversity was rich, including ericoid mycorrhizal (ERM), ectomycorrhizal (ECM) and other root-associated ...

  14. The radiation sensitizing effect of PSK in the treatment for the cervical cancer patients

    International Nuclear Information System (INIS)

    PSK is the protein-bound polysaccharide isolated from Coriolus versicolor (strain CM-101) belonging to Basidiomycetes. It has been widely used as antitumor agent by oral route in Japan for cancer of digestive organs, lung cancer, breast cancer and so on. In this paper, clinical data for the radiation sensitizing effect of PSK in the treatment for the cervical cancer patients is reported. The action mechanism of PSK is still unclear. (Auth.)

  15. Conservative ecological and evolutionary patterns in liverwort–fungal symbioses

    OpenAIRE

    Bidartondo, Martin I.; Duckett, Jeffrey G.

    2009-01-01

    Liverworts, the most ancient group of land plants, form a range of intimate associations with fungi that may be analogous to the mycorrhizas of vascular plants. Most thalloid liverworts contain arbuscular mycorrhizal glomeromycete fungi similar to most vascular plants. In contrast, a range of leafy liverwort genera and one simple thalloid liverwort family (the Aneuraceae) have switched to basidiomycete fungi. These liverwort switches away from glomeromycete fungi may be expected to parallel s...

  16. Recent advances in exploring physiology and biodiversity of ectomycorrhizas highlight the functioning of these symbioses in ecosystems

    OpenAIRE

    Buscot, François; Munch, J.C.; Charcosset, Jean-Yves; Gardes, Monique; Nehls, U.; Hampp, R.

    2000-01-01

    Ectomycorrhizas, the dominating mycorrhizal symbiosis in boreal, temperate and some tropical forests, are formed by 5000-6000 species of the asco- and basidiomycetes. This high diversity of fungal partners allows optimal foraging and mobilisation of various nitrogen and phosphorus forms from organic soil layers. In this review, two approaches to study the functioning of this multitude of symbiotic associations are presented. On selected culture models, physiological and molecular investigatio...

  17. No Significant Contribution of Arbuscular Mycorrhizal Fungi to Transfer of Radiocesium from Soil to Plants

    OpenAIRE

    Joner, E. J.; Roos, P.; Jansa, J.; Frossard, E.; Leyval, C.; I. Jakobsen

    2004-01-01

    The diffuse pollution by fission and activation products following nuclear accidents and weapons testing is of major public concern. Among the nuclides that pose a serious risk if they enter the human food chain are the cesium isotopes 137Cs and 134Cs (with half-lives of 30 and 2 years, respectively). The biogeochemical cycling of these isotopes in forest ecosystems is strongly affected by their preferential absorption in a range of ectomycorrhiza-forming basidiomycetes. An even more widely d...

  18. Macrofungi of Tarsus District and ectomycorrhizas

    OpenAIRE

    Tüfekçi, Sedat

    2012-01-01

    The study was carried out to determine the macrofungi specimens and mycorrhizal fungi of ones which are spread in the forest ecosystems in Tarsus and Çamlıyayla districts. As a result of field and laboratory studies, 53 species belonging to 33 genus and 27 families in Ascomycetes and Basidiomycetes were identified. The distribution, habitat, whether mycorrhizal, altitude, collection date and number of the identified species are recorded. 5 species of Russula genus; 4 species of Amanita specie...

  19. Signalling process during the early contact of ectomycorrhizal fungi Pisolithus tinctorius with Castanea sativa roots

    OpenAIRE

    Baptista, Paula; Martins, Anabela; Tavares, Rui Manuel; Lino-Neto, Teresa

    2006-01-01

    Ectomycorrhizas (ECM) are symbiotic associations between roots of higher plants, mainly trees (e.g. Pinacea and Fagaceae), and soil fungi (asco- and basidiomycetes). The establishment of this symbiotic association requires a sequence of highly regulated and coordinated events, initiated by an exchange of specific signalling compounds between both partners. The triggering mechanisms and the progression of the colonization process are still not well understood. The present work focus on the sig...

  20. Inonotus Rickii (Pat.) Reid: um importante basidiomiceta lenhicola em arvores urbanas

    OpenAIRE

    Ramos, Ana Paula; Caetano, Maria Filomena; Melo, Ireneia

    2008-01-01

    Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of he...

  1. Antitumorska aktivnost egzopolisaharida iz gljive Grifola frondosa, dobivenih submerznim uzgojem uz dodatak melase šećerne trske i soje kao izvora ugljika

    OpenAIRE

    Chimilovski, Jacqueline Sugitani; Habu, Sascha; Teixeira, Richard Fhillipy Bosqui; Thomaz-Soccol, Vanete; Noseda, Miguel Daniel; Medeiros, Adriane Bianchi Pedroni; Pandey, Ashok; Soccol, Carlos Ricardo

    2011-01-01

    Grifola frondosa, jestiva gljiva iz razreda Basidiomycetes, izlučuje egzopolisaharide dokazane antitumorske aktivnosti. Svrha je ovoga rada bila submerznim uzgojem, uz dodatak alternativnih izvora ugljika (melase šećerne trske i soje), proizvesti egzopolisaharide i procijeniti njihov antiproliferativni učinak na stanice tumora. Egzopolisaharidi su izdvojeni pomoću etanola, zatim je ispitan njihov utjecaj na tumorske stanice miševa, te je plinskom kromatografijom određen njihov sastav. Budući ...

  2. Fungal photobiology: a synopsis

    OpenAIRE

    Corrochano, Luis M.

    2011-01-01

    Fungi respond and adapt to many environmental signals including light. The photobiology of fungi has been extensively investigated, but in recent years the identification of the first fungal photoreceptor, WC-1 in the ascomycete Neurospora crassa, and the discovery that similar photoreceptors are required for photoreception in other ascomycete, basidiomycete and zygomycete fungi has allowed the molecular characterization of light reception and the early steps of signal transduction in a numbe...

  3. Fungal bioremediation of the creosote-contaminated soil: Influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study

    Czech Academy of Sciences Publication Activity Database

    Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr

    2008-01-01

    Roč. 2008, č. 73 (2008), s. 1518-1523. ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008

  4. Cytotoxicity and genotoxicity of Agaricus blazei methanolic extract fractions assessed using gene and chromosomal mutation assays

    OpenAIRE

    Marilanda Ferreira Bellini; Leonardo Neves Cabrioti; Ana Paula Terezan; Berenice Quinzani Jordão; Lúcia Regina Ribeiro; Mário Sérgio Mantovani

    2008-01-01

    Functional food investigations have demonstrated the presence of substances that could be beneficial to human health when consumed. However, the toxic effects of some substances contained in foods have been determined. Reported medicinal and nutritive properties have led to the extensive commercialization of the basidiomycete fungi Agaricus blazei Murrill (sensu Heinemann), also known as Agaricus brasiliensis Wasser et al., Agaricus subrufescens Peck or the Brazilian medical mushroom (BMM). D...

  5. Agaricus section Brunneopicti: a phylogenetic reconstruction with descriptions of four new taxa

    OpenAIRE

    Chen, Jie; Zhao, Rui-Lin; Parra, Luis A.; Guelly, Atsu K; De Kesel, André; Kevin D. Hyde; Rapior, Sylvie; Chukeatirote, Ekachai; Callac, Philippe

    2015-01-01

    Agaricus is a genus of saprobic basidiomycetes including species of nutritional and medicinal interest. Historically the temperate species have been grouped into eight classical sections. Recent phylogenetic analyses however, revealed that two-thirds of the tropical taxa do not cluster in these sections, but form exclusively tropical clades. Seven (TR I to TR VII) strongly supported tropical clades have been revealed and it was hypothesized that clade TR I might represent Agaricus section Bru...

  6. Pyranose Dehydrogenase from Agaricus campestris and Agaricus xanthoderma: Characterization and Applications in Carbohydrate Conversions

    OpenAIRE

    Clemens K Peterbauer; Dietmar Haltrich; Petra Staudigl; Iris Krondorfer

    2013-01-01

    Pyranose dehydrogenase (PDH) is a flavin-dependent sugar oxidoreductase that is limited to a rather small group of litter-degrading basidiomycetes. The enzyme is unable to utilize oxygen as an electron acceptor, using substituted benzoquinones and (organo) metal ions instead. PDH displays a broad substrate specificity and intriguing variations in regioselectivity, depending on substrate, enzyme source and reaction conditions. In contrast to the related enzyme pyranose 2-oxidase (POx), PDHs fr...

  7. The Medicinal Values of Culinary-Medicinal Royal Sun Mushroom (Agaricus blazei Murrill)

    OpenAIRE

    Hang Wang; Zhiming Fu; Chunchao Han

    2013-01-01

    Agaricus blazei Murrill (ABM), a mushroom native to Brazil, is a basidiomycete brown fungus, which is popularly known as “Cogumelo do Sol” in Brazil or “Himematsutake” in Japan, and there has been a prominent increase in the use of ABM for therapeutic and medicinal purposes. ABM is useful against a variety of diseases like cancer, tumor, chronic hepatitis, diabetes, atherosclerosis, hypercholesterolemia, and so on. In this review, we demonstrated various pharmacological effects of ABM, so tha...

  8. Antineoplasic activity of Agaricus brasiliensis basidiocarps on different maturation phases

    OpenAIRE

    Mourão, Francielly; Linde, Giani Andrea; Messa, Valdeci; da Cunha Júnior, Paulo Luiz; da Silva, Aristeu Vieira; da Eira, Augusto Ferreira; Colauto, Nelson Barros

    2009-01-01

    The fungus Agaricus brasiliensis is a Basidiomycete studied because of its immunomodulation and/or antitumor substances. The objective of this study was to verify the Agaricus brasiliensis antineoplasic activity in vivo on different basidiocarp maturation phases on Sarcoma 180 cells implanted in mice. Sarcoma cells were implanted in mice and after seven days mice were divided in three groups. The first group was treated with saline solution, the second group was treated with closed basidiocar...

  9. Polysaccharides from Agaricus bisporus and Agaricus brasiliensis show similarities in their structures and their immunomodulatory effects on human monocytic THP-1 cells

    OpenAIRE

    Wichers Harry J; Iacomini Marcello; Chanput Wasaporn; van Arkel Jeroen; Ruthes Andrea C; Smiderle Fhernanda R; van Griensven Leo JLD

    2011-01-01

    Abstract Background Mushroom polysaccharides have traditionally been used for the prevention and treatment of a multitude of disorders like infectious illnesses, cancers and various autoimmune diseases. Crude mushroom extracts have been tested without detailed chemical analyses of its polysaccharide content. For the present study we decided to chemically determine the carbohydrate composition of semi-purified extracts from 2 closely related and well known basidiomycete species, i.e. Agaricus ...

  10. Identification and functional characterization of the CYP51 gene from the yeast Xanthophyllomyces dendrorhous that is involved in ergosterol biosynthesis

    OpenAIRE

    Leiva, Kritsye; Werner, Nicole; Sepúlveda, Dionisia; Barahona, Salvador; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2015-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that synthesizes astaxanthin, a carotenoid with great biotechnological impact. The ergosterol and carotenoid synthetic pathways derive from the mevalonate pathway and involve cytochrome P450 enzymes. Among these enzymes, the CYP51 family, which is involved in ergosterol biosynthesis, is one of the most remarkable that has C14-demethylase activity. Results In this study, the CYP51 gene from X. dendrorhous was isolated and its ...

  11. Agaricus blazei Murill - immunomodulatory properties and health benefits

    OpenAIRE

    Biedron R; Tangen JM; Maresz K; Hetland G

    2012-01-01

    AbstractThe Agaricus blazei Murill (AbM), also known as Agaricus brasiliensis L. due to its origin in Brazilian rain forest, is an edible mushroom of the Basidiomycetes family, which also comprises medicinal mushrooms such as Hericium erinaceus and Grifola frondosa. AbM has been used in traditional medicine locally and also recently as a health food worldwide. Since it has been found to possess immunomodulatory properties, its biological and health-related effects, as well as its isolated ac...

  12. Overproduction of ligninolytic enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  13. Loosenin, a novel protein with cellulose-disrupting activity from Bjerkandera adusta

    OpenAIRE

    Segovia Lorenzo; Cuervo-Soto Laura I; Martínez-Anaya Claudia; Quiroz-Castañeda Rosa E; Folch-Mallol Jorge L

    2011-01-01

    Abstract Background Expansins and expansin-like proteins loosen cellulose microfibrils, possibly through the rupture of intramolecular hydrogen bonds. Together with the use of lignocellulolytic enzymes, these proteins are potential molecular tools to treat plant biomass to improve saccharification yields. Results Here we describe a new type of expansin-related fungal protein that we have called loosenin. Its corresponding gene, loos1, from the basidiomycete Bjerkandera adusta, was cloned and ...

  14. A functional study on the multilateral symbiosis of the fungal order Sebacinales with plant hosts and bacteria

    OpenAIRE

    Sharma, Monica

    2008-01-01

    The order Sebacinales is the most basal order of Hymenomycetes (Basidiomycetes) which contains an amazing diversity of mycorrhiza. Frequent detection of Sebacinales in ecological studies using various molecular techniques suggests their possible role in shaping plant communities. The root-colonizing mutualistic fungus Piriformospora indica is axenically cultivable and represent the model organism for symbiotic species of the order Sebacinales. In the present work, axenic cultures of seven iso...

  15. Unisexual Reproduction Reverses Muller’s Ratchet

    OpenAIRE

    Roach, Kevin C.; Heitman, Joseph

    2014-01-01

    Cryptococcus neoformans is a pathogenic basidiomycetous fungus that engages in outcrossing, inbreeding, and selfing forms of unisexual reproduction as well as canonical sexual reproduction between opposite mating types. Long thought to be clonal, >99% of sampled environmental and clinical isolates of C. neoformans are MATα, limiting the frequency of opposite mating-type sexual reproduction. Sexual reproduction allows eukaryotic organisms to exchange genetic information and shuffle their genom...

  16. Increase in the astaxanthin synthase gene (crtS) dose by in vivo DNA fragment assembly in Xanthophyllomyces dendrorhous

    OpenAIRE

    Contreras, Gabriela; Barahona, Salvador; Rojas, María Cecilia; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2013-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that is relevant to biotechnology, as it can synthesize the carotenoid astaxanthin. However, the astaxanthin levels produced by wild-type strains are low. Although different approaches for promoting increased astaxanthin production have been attempted, no commercially competitive results have been obtained thus far. A promising alternative to facilitate the production of carotenoids in this yeast involves the use of genetic m...

  17. Protein profile and protein interaction network of Moniliophthora perniciosa basidiospores

    OpenAIRE

    Mares, Joise Hander; Gramacho, Karina Peres; dos Santos, Everton Cruz; Santiago, André da Silva; Silva, Edson Mário de Andrade; Alvim, Fátima Cerqueira; Pirovani, Carlos Priminho

    2016-01-01

    Background Witches’ broom, a disease caused by the basidiomycete Moniliophthora perniciosa, is considered to be the most important disease of the cocoa crop in Bahia, an area in the Brazilian Amazon, and also in the other countries where it is found. M. perniciosa germ tubes may penetrate into the host through intact or natural openings in the cuticle surface, in epidermis cell junctions, at the base of trichomes, or through the stomata. Despite its relevance to the fungal life cycle, basidio...

  18. Occurrence of fungi in combs of fungus-growing termites (Isoptera: Termitidae, Macrotermitinae)

    OpenAIRE

    Guedegbe, Herbert; Miambi, Edouard; Pando, Anne; Roman, Jocelyne; Houngnandan, P.; Rouland Lefèvre, Corinne

    2009-01-01

    Fungus-growing termites cultivate their mutualistic basidiomycete Termitomyces species on a substrate called a fungal comb. Here, the Suicide Polymerase Endonuclease Restriction (SuPER) method was adapted for the first time to a fungal study to determine the entire fungal community of fungal combs and to test whether fungi other than the symbiotic cultivar interact with termite hosts. Our molecular analyses show that although active combs are dominated by Termitomyces fungi isolated with dire...

  19. Basidioascus undulatus: genome, origins, and sexuality

    OpenAIRE

    Nguyen, Hai D. T.; Chabot, Denise; Hirooka, Yuuri; Roberson, Robert W.; Seifert, Keith A.

    2015-01-01

    Basidioascus undulatus is a soil basidiomycete belonging to the order Geminibasidiales. The taxonomic status of the order was unclear as originally it was only tentatively classified in the class Wallemiomycetes. The fungi in Geminibasidiales have an ambiguously defined sexual cycle. In this study, we sequenced the genome of B. undulatus to gain insights into its sexuality and evolutionary origins. The assembled genome draft was approximately 32 Mb in size, had a median nucleotide coverage of...

  20. Fungi from marine habitats: Application in bioremediation

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.

    . Enzyme and Microbial Technology 12: 846–853. Bartlett, R. E. (1971) Public Health Engineering-design in Metric Waste-water Treatment. Applied Science Publishers, London. Cooney, J. J., Doolittle, M. M., Wuertz, S., Miller, M. E. & Balden, C. (1992... Microbial Ecology 15: 153–163. Raghukumar, C., D’Souza, T. M., Thorn, R. G. & Reddy, C. A. (1999) Lignin- modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment. Applied and Environmental Microbiology 65: 2103...