WorldWideScience

Sample records for basidiomycete coprinus cinereus

  1. [Expression and characterization of Coprinus cinereus peroxidase].

    Science.gov (United States)

    Dong, Bingxue; Niu, Qiuhong; Zhang, Wei; Geng, Sanchun; Li, Peng; Yuan, Wanli; Gong, Yifeng; Liang, Kewei

    2015-03-04

    The aim of our study is to express Coprinus cinereus peroxidase (CIP) in Pichia Pastori efficiently. We synthesized CIP gene with P. pastori codon bias by our Gene Synthesis and site-specific mutagenesis platform, using DNAWorks 3.1 program to design and optimize primers. Then, we sequenced the PCR products, inserted the correct gene into expression vector pPICZαA and transformed the linearized pPICZαA-Cip DNA into P. pastori GS115. We integrated CIP gene into the genome of P. pastori, using the α-mating factor from Sacchoramyces cerevisiae as signal peptide to direct the secretion of the recombinant protein. To obtain transformants with high CIP activity, we checked transformants by nested PCR and stained 82 positive ones on YPD agar plate with 1000 mg/L Zeocin. Then, we got 6 transforments with high resistance to Zeocin and expressed them in small scale; the one exhibiting the highest activity was chosen as engineered strain and named CIP/Gs115. We purified CIP from culture medium after induction with ethanol, the maximum activity reached 487.5 U/mL on the 4th day. The purified CIP exhibited maximal activity at pH 5.0 and 25 degrees C with ABTS as substrate. The enzyme had 61.5% of the maximal activity at 45 degrees C and was stable below 40 degrees C. However, the stability was drastically reduced above 45 degrees C. The recombinant CIP remained stable between pH 4.5 and 6.5. We studied the substrate specificity on different substrates with the purified enzyme, and the optimal substrates were in the order of ABTS > 2, 6-Dimethoxyphenol > guaiacol > 2, 4-Dichlorophenol > phenol. The highly secretory expression of CIP and high special activity lay the good foundation for it' s industrial applications in waste water treatment, decolouration of dyestuffs.

  2. Cultivation of Tanzanian Coprinus cinereus (sisal compost mushroom)

    African Journals Online (AJOL)

    Coprinus cinereus is a Tanzanian wild edible mushroom whose cultivation in the laboratory was performed in solid-state fermentation bioreactors using sisal decortication wastes namely; sisal dusts, sisal fibres and sisal leaves as basal substrates supplemented with chicken manure at various rates. Bioreactors containing ...

  3. Use of molecular-genetically bred Coprinus cinereus strains for an efficient isolation of cellulose from rice straw.

    Science.gov (United States)

    Kikuchi, Madoka; Ogawa, Kei-ichiro; Yamazaki, Takashi; Kajiwara, Susumu; Shishido, Kazuo

    2002-01-01

    Molecular-bred Coprinus cinereus monokaryotic strains with high lignin- and xylan-degrading activities were mixed-cultured at 27 degrees C in the liquid medium containing 0.5% (w/v) cut rice straw and 0.025% MnCl2. After 3 weeks, the culture supernatant was extensively treated with crude cellulase, showing the presence in it of 9.3% of the total cellulose of rice straw. When rice straw treated with 0.1 N NaOH or cultured with Ganoderma applanatum were used, the recoveries of the cellulose increased up to 29%. The same experiments were done by using a non-bred control strain, showing the recoveries of the cellulose from the treated or cultured rice straw to be 8%.

  4. Studies in Coprinus IV — Coprinus section coprinus. Subdivision and revision of subsection Alachuani

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1997-01-01

    Coprinus section Coprinus is defined and delimited to comprise four subsections: Atramentarii, Coprinus, Lanatuli and Alachuani. A key to the subsections is given as well as a key to the species of subsection Alachuani known from the Netherlands or to be expected in the Netherlands on account of

  5. Type studies in Coprinus subsection Lanatuli

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    2001-01-01

    As a prelude to a monograph of the genus Coprinus, types were studied of a number of species said to belong to Coprinus subsection Lanatuli (Coprinus alnivorus. C. alutaceivelatus, C. ammophilae, C. arachnoideus, C. asterophoroides, C. brunneistragulatus, C. bubalinus, C. citrinovelatus, C.

  6. Screening of Coprinus species for the production of extracellular peroxidase and evaluation of its applicability to the treatment of aqueous phenol

    International Nuclear Information System (INIS)

    Ikehata, K.; Buchanan, I.D.

    2002-01-01

    Twenty-nine strains of Coprinus species comprising 16 strains from 12 identified species and 13 unidentified strains as well as one Arthromyces ramosus strain were screened for the production of extracellular peroxidase. Among the fungi examined, three strains of C. cinereus, UAMH 4103, UAMH 7907 and IFO 30116, as well as one Coprinus sp., UAMH 10067, which was isolated from urea treated soil, were shown to produce large amounts of extracellular peroxidase. The performance of crude peroxidase, obtained from liquid culture of C. cinereus, (CIP) on phenol removal from synthetic wastewater was evaluated and compared with that of purified horseradish peroxidase and A. ramosus peroxidase. Although crude CIP performed better than both purified enzymes, its superiority vanished in the presence of poly(ethylene glycol), a known protective agent of peroxidase. This suggests that the residual soluble substances present in crude CIP have protective effects similar to those of poly(ethylene glycol). (author)

  7. Studies in Coprinus III — Coprinus section Veliformes. Subdivision and revision of subsection Nivei emend

    NARCIS (Netherlands)

    Uljé, C.B.; Noordeloos, M.E.

    1993-01-01

    Coprinus section Veliformes is defined and delimited to comprise four subsections: subsection Micacei, subsection Domestici, subsection Nivei, and subsection Narcotici, subsection nov. A key to the subsections is given. Subsection Nivei is emended, including also most taxa of subsection Flocculosi

  8. Analysis of the Basidiomycete Coprinopsis cinerea reveals conservation of the core meiotic expression program over half a billion years of evolution.

    Directory of Open Access Journals (Sweden)

    Claire Burns

    2010-09-01

    Full Text Available Coprinopsis cinerea (also known as Coprinus cinereus is a multicellular basidiomycete mushroom particularly suited to the study of meiosis due to its synchronous meiotic development and prolonged prophase. We examined the 15-hour meiotic transcriptional program of C. cinerea, encompassing time points prior to haploid nuclear fusion though tetrad formation, using a 70-mer oligonucleotide microarray. As with other organisms, a large proportion (∼20% of genes are differentially regulated during this developmental process, with successive waves of transcription apparent in nine transcriptional clusters, including one enriched for meiotic functions. C. cinerea and the fungi Saccharomyces cerevisiae and Schizosaccharomyces pombe diverged ∼500-900 million years ago, permitting a comparison of transcriptional programs across a broad evolutionary time scale. Previous studies of S. cerevisiae and S. pombe compared genes that were induced upon entry into meiosis; inclusion of C. cinerea data indicates that meiotic genes are more conserved in their patterns of induction across species than genes not known to be meiotic. In addition, we found that meiotic genes are significantly more conserved in their transcript profiles than genes not known to be meiotic, which indicates a remarkable conservation of the meiotic process across evolutionarily distant organisms. Overall, meiotic function genes are more conserved in both induction and transcript profile than genes not known to be meiotic. However, of 50 meiotic function genes that were co-induced in all three species, 41 transcript profiles were well-correlated in at least two of the three species, but only a single gene (rad50 exhibited coordinated induction and well-correlated transcript profiles in all three species, indicating that co-induction does not necessarily predict correlated expression or vice versa. Differences may reflect differences in meiotic mechanisms or new roles for paralogs

  9. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  10. Studies on mushroom flavours 2. Flavour compounds in coprinus comatus.

    Science.gov (United States)

    Dijkstra, F Y; Wikén, T O

    1976-01-01

    In an aqueous extract of fruit bodies of Coprinus comatus 3-octanone, 3-octanol, 1-octen-3-ol, 1-octanol, 2-methyl-2-penten-4-olide, 1-dodecanol and caprylic acid were identified conclusively and n-butyric and isobutyric acids preliminarily. Amino-acids, nucleotides and sugars were also determined. A mixture of 37 compounds found in the extract had a stronger flavour than the natural extract. 3-Octanol, 1-octen-3-ol, 1-octanol and 2-methyl-2-penten-4-olide were the volatiles with the strongest flavour. Mass and IR spectra of 2-methyl-2-penten-4-olide are presented.

  11. [Antiviral properties of basidiomycetes metabolites].

    Science.gov (United States)

    Avtonomova, A V; Krasnopolskaya, L M

    2014-01-01

    The data on the antiviral action of the Ganoderma lucidum, Lentinus edodes, Grifola frondosa, Agaricus brasiliensis and other basidiomycetes metabolites are summurized. The metabolites of these species of basidiomycetes exhibit a direct antiviral effect on herpes simplex virus types I and II, human immunodeficiency virus (HIV), hepatitis B virus, vesicular stomatitis virus, influenza virus, Epstein-Barr virus, and others. Moreover, metabolites of basidiomycetes increased antiviral immunity.

  12. A new Coprinus from Papua New Guinea sporulating in pure culture

    NARCIS (Netherlands)

    Uljé, C.B.; Aptroot, A.; Iperen, van A.

    1998-01-01

    From Papua New Guinea a new Coprinus is described, which forms basidiocarps and basidiospores in pure culture. It was isolated from material collected on two collecting trips to the area, in 1992 and 1995.

  13. Relationship between deficiency of phosphoglucose isomerase in Coprinus macrorhizus and fruiting body formation.

    OpenAIRE

    Nyunoya, H; Ishikawa, T

    1980-01-01

    A mutant (pgi) of Coprinus macrorhizus deficient in phosphoglucose isomerase did not grow on fructose and grew poorly on glucose. The pgi mutation inhibited the formation of monokaryotic and dikaryotic fruiting bodies.

  14. Insights into evolution of multicellular fungi from the assembled chromosomes of the mushroom Coprinopsis cinerea (Coprinus cinereus)

    OpenAIRE

    Stajich, Jason E.; Wilke, Sarah K.; Ahrén, Dag; Au, Chun Hang; Birren, Bruce W.; Borodovsky, Mark; Burns, Claire; Canbäck, Björn; Casselton, Lorna A.; Cheng, C.K.; Deng, Jixin; Dietrich, Fred S.; Fargo, David C.; Farman, Mark L.; Gathman, Allen C.

    2010-01-01

    The mushroom Coprinopsis cinerea is a classic experimental model for multicellular development in fungi because it grows on defined media, completes its life cycle in 2 weeks, produces some 108 synchronized meiocytes, and can be manipulated at all stages in development by mutation and transformation. The 37-megabase genome of C. cinerea was sequenced and assembled into 13 chromosomes. Meiotic recombination rates vary greatly along the chromosomes, and retrotransposons are absent in large regi...

  15. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M.D.

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  16. Nutrients and non-nutrients composition and bioactivity of wild and cultivated Coprinus comatus (O.F.Müll.) Pers.

    NARCIS (Netherlands)

    Stojkovic, D.; Reis, F.S.; Barros, L.; Glamoclija, J.; Ciric, A.; Griensven, van L.J.L.D.; Sokovic, M.; Ferreira, I.C.F.R.

    2013-01-01

    Mushrooms have been reported as sources of biomolecules with various potential. Coprinus comatus was studied to obtain information about this species, comparing cultivated and wild samples. Free sugars, fatty acids, tocopherols, organic acids and phenolic acids were analyzed by chromatographic

  17. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  18. Disseminated coccidoidomycosis in a koala (Phascolarctos cinereus).

    Science.gov (United States)

    Burgdorf-Moisuk, Anne; Stalis, Ilse H; Pye, Geoffrey W

    2012-03-01

    A16-yr-old male koala (Phascolarctos cinereus) presented for nonspecific signs of illness and weight loss. Despite 2 mo of diagnostics and supportive care, the koala's health declined and euthanasia was elected. On histopathologic examination, lesions containing fungal organisms morphologically consistent with coccidioidomycosis were found in the lung, liver, spleen, kidney, lymph node, heart, eye, and bone marrow. Although disseminated infection was present, the koala was IgM and IgG seronegative for Coccidioides spp. 1 mo prior to euthanasia.

  19. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  20. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  1. Determination of some biological activities of Tricholoma terreum and Coprinus micaceus

    Directory of Open Access Journals (Sweden)

    Hasan Akgül

    2016-10-01

    Full Text Available The use of mushrooms as food also as medicine is increasing day by day. In this study, an edible mushrooms - Tricholoma terreum (Schaeff. P. Kumm. and Coprinus micaceus (Bull. Fr. – were used as materials. This study was aimed to determine the antioxidant and DNA protective activity of ethanol extract of mushrooms and determine and compare total antioxidant, oxidative stress index with oxidative levels and Fe, Mg, Zn, Cu, Na and Ca contents. The antioxidant activity of mushrooms were analyzed with using DPPH and total antioxidant and oxidative levels were analyzed with using Rel Assay Diagnostics kits. DNA protective activity was determined by using the supercoiled pBR322 DNA. Furthermore, element contents of the mushrooms were determined with wet decomposition method by using atomic absorption spectrophotometry. As a result of the study, antioxidant and DNA protective activities of ethanol extracts of both mushroom species were not showed any notable effect and total oxidant value was determined very high.

  2. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  3. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  4. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  5. Aggregations of masked shrews (Sorex cinereus): density related mating behavior?

    Science.gov (United States)

    Thomas J. Maier; Katherine L. Doyle

    2006-01-01

    Large aggregations of shrews have been reported and various explanations offered for this seemingly rare behavior; however, there has been little evidence to support any particular interpretation. We observed two small aggregations of highly active vocalizing Sorex cinereus while performing wildlife surveys in forested habitats in central...

  6. Electroretinography in the normal koala (Phascolarctos cinereus).

    Science.gov (United States)

    Liddle, Vicki L

    2015-01-01

    To perform electroretinography on normal anesthetized koalas (Phascolarctos cinereus). Six hospitalized koalas. The koalas were anesthetized using alfaxalone intramuscularly and isoflurane via face mask, then maintained on isoflurane after endotracheal intubation. After 20 min of dark adaptation, electroretinograms were obtained using a handheld electroretinography (ERG) machine using a single flash protocol at three light intensities: 10 mcd s/m(2) , 3000 mcd s/m(2) , and 10,000 mcd s/m(2) . At 10 mcd s/m(2) , the mean b-wave amplitude and implicit time were 49.5 μV (SD ± 33.1 and 95% CI 29.9-69.0) and 87.4 ms (SD ± 6.5 and 95% CI 83.6-91.2). At 3000 mcd s/m(2) , the mean a-wave amplitude and implicit time were 70.5 μV (SD ± 30.7 and 95% CI 52.3-88.7) and 20.6 ms (SD ± 3.1 and 95% CI 18.7-22.4), and the mean b-wave amplitude and implicit time were 122.8 μV (SD ± 49.3 and 95% CI 93.7-151.9) and 63.1 ms (SD ± 13.2 and 95% CI 55.3-71.0). At 10,000 mcd sm(2) , the mean a-wave amplitude and implicit time were 90.8 μV (SD ± 37.2 and 95% CI 68.8-112.8) and 16.1 ms (SD ± 3.1 and 95% CI 14.3-18.0), and the mean b-wave amplitude and implicit time were 148.3 μV (SD ± 54.9 and 95% CI 115.9-180.8) and 67.4 ms (SD ± 8.4 and 95% CI 62.5-72.3). Electroretinography in koalas is practical using a portable ERG system and a DTL thread electrode and allows for rapid assessment of retinal function. © 2013 American College of Veterinary Ophthalmologists.

  7. Larval distribution pattern of Muraenesox cinereus (Anguilliformes: Muraenesocidae) leptocephali in waters adjacent to Korea

    Science.gov (United States)

    Ji, Hwan-Sung; Kim, Jin-Koo; Oh, Taeg Yun; Choi, Kwang Ho; Choi, Jung Hwa; Seo, Young Il; Lee, Dong Woo

    2015-09-01

    To understand the transport and recruitment processes of the daggertooth pike conger, Muraenesox cinereus, in the marginal seas of East Asia, we investigated the distribution pattern, estimated spawning areas and periods, and recruitment mechanisms of M. cinereus, based on 51 individuals of leptocephali collected from Korean waters during 2010-2014. Back-calculated hatching dates, determined from the daily incremental growth rates of the otoliths, indicated that the spawning period for M. cinereus was during July-September. The size range of M. cinereus leptocephali collected offshore of Jeju Island and southeast of the Korea-Japan intermediate zone was 16.6-20.9 mm TL (age, 18-23 d). We hypothesize that one of the spawning grounds of M. cinereus is located offshore in the East China Sea. In Korean waters, the ages and body lengths of M. cinereus leptocephali increased northward from latitude 31°30'N to 34°40'N, with metamorphosis occurring at latitude 34°40'N. Therefore, we surmised that the hatched preleptocephali of M. cinereus were transported from offshore areas in the East China Sea to Jeju Island and the Korea Strait (KS) by the Kuroshio and Tsushima Warm Current.

  8. Nasal mass removal in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Gorow, April; Pye, Geoffrey W

    2012-12-01

    Nasal masses in the koala (Phascolarctos cinereus) are not uncommon and can be challenging to diagnose and treat. Differential diagnoses for nasal masses in the koala are cryptococcal granulomas, nasal polyps, nasal adenocarcinoma, and osteochondromatosis. This report describes successful surgical approaches for two adult koalas with nasal masses and includes photodocumentation and description of the anatomy of the koala nasal passages from the postmortem transverse sectioning of a normal koala head. Surgical removal of the nasal masses in these koalas resulted in a rapid resolution of clinical signs.

  9. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  10. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  11. ACTIVE PRODUCERS OF PEROXIDASE BASIDIOMYCETES STRAINS SCREENING

    Directory of Open Access Journals (Sweden)

    T. E. Voloshko

    2013-10-01

    Full Text Available The paper is devoted to the analysis of the research data peroxidase activity of the strains of xylotrophic basidiomycetes in the dynamics of the growth. The objects of study were 57 strains, 5 of which belongs to 5 species of the order Polyporales, and 52 of which belongs to 7 species of the order Agaricales. In order to search for active producers of peroxidase the strains were cultured by the surface method in a liquid glucosepeptone medium. The accumulation of oven-dry biomass was determined by the weight method. The content of soluble protein and peroxidase activity were determined by the spectrophotometry. The studies set the level of accumulation of oven-dry biomass and peroxidase activity of the strains in 9 and 12 days of growth. The results allowed selecting the strains, which are characterized by high levels of peroxidase activity in mycelium and in the culture filtrate, including Agrocybe cylindracea 167, Pleurotus ostreatus Р-кл, Agrocybe cylindracea 960 and 218. These strains which are active producers of peroxidase may be used in the enzyme preparations obtaining technology.

  12. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described.

  13. Pneumonia due to Chlamydia pecorum in a Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mackie, J T; Gillett, A K; Palmieri, C; Feng, T; Higgins, D P

    2016-11-01

    Chlamydiosis is a common infectious disease of koalas (Phascolarctos cinereus), but Chlamydia spp. have not yet been demonstrated to cause pneumonia in these animals. A juvenile male koala died following an episode of respiratory disease. At necropsy examination, the lung tissue was consolidated. Microscopical lesions in the lung included pyogranulomatous bronchopneumonia, proliferation of bronchiolar and alveolar epithelium and interstitial fibrosis. Hyperplastic bronchiolar epithelial cells contained aggregates of small basophilic punctate organisms, which were confirmed as chlamydiae by transmission electron microscopy and immunohistochemistry. Real-time polymerase chain reaction identified these as Chlamydia pecorum. This report provides the best evidence to date of chlamydial infection causing pneumonia in a koala, and the first evidence that C. pecorum is capable of infecting the bronchiolar epithelium of the koala. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Radiation preservation of white pomfret (Stromateus cinereus) in tomato sauce

    International Nuclear Information System (INIS)

    Doke, S.N.; Sherekar, S.V.; Ghadi, S.V.

    1991-01-01

    A method for the radiation preservation of white pomfret (Stromateus cinereus) in tomato sauce is described which enables the storage of fish at ambient temperature (28±3 deg C) for a period of six months. The product with low pH could be stabilized with a dose of 5 kGy. A batch of packed cans (consisting of cans of fish with tomato sauce and the control cans) were subjected to a dose in a Cobalt 60 Package Irradiator (Atomic Energy of Canada Ltd.) at a dose rate of 0.045 kGy min -1 . Biochemical and bacteriological evaluation confirmed the storage stability of the product. The process offers a safe and simple method to preserve white pomfret in a 'heat and serve' form. (author) 6 refs.; 5 tabs

  15. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  16. Coprinuslactone protects the edible mushroom Coprinus comatus against biofilm infections by blocking both quorum-sensing and MurA.

    Science.gov (United States)

    de Carvalho, Maira P; Gulotta, Giuseppe; do Amaral, Matheus W; Lünsdorf, Heinrich; Sasse, Florenz; Abraham, Wolf-Rainer

    2016-11-01

    Pathogens embedded in biofilms are involved in many infections and are very difficult to treat with antibiotics because of higher resistance compared with planktonic cells. Therefore, new approaches for their control are urgently needed. One way to search for biofilm dispersing compounds is to look at defense strategies of organisms exposed to wet environments, which makes them prone to biofilm infections. It is reasonable to assume that mushrooms have developed mechanisms to control biofilms on their sporocarps (fruiting bodies). A preliminary screening for biofilms on sporocarps revealed several species with few or no bacteria on their sporocarps. From the edible mushroom Coprinus comatus where no bacteria on the sporocarp could be detected (3R,4S)-2-methylene-3,4-dihydroxypentanoic acid 1,4-lactone, named coprinuslactone, was isolated. Coprinuslactone interfered with quorum-sensing and dispersed biofilms of Pseudomonas aeruginosa, where it also reduced the formation of the pathogenicity factors pyocyanin and rhamnolipid B. Coprinuslactone also damaged Staphylococcus aureus cells in biofilms at subtoxic concentrations. Furthermore, it inhibited UDP-N-acetylglucosamine enolpyruvyl transferase (MurA), essential for bacterial cell wall synthesis. These two modes of action ensure the inhibition of a broad spectrum of pathogens on the fruiting body but may also be useful for future clinical applications. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  18. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  19. Modeling the colonization of Hawaii by hoary bats (Lasiurus cinereus)

    Science.gov (United States)

    Bonaccorso, Frank J.; McGuire, Liam P.

    2013-01-01

    The Hawaiian archipelago, the most isolated cluster of islands on Earth, has been colonized successfully twice by bats. The putative “lava tube bat” of Hawaii is extinct, whereas the Hawaiian Hoary Bat, Lasiurus cinereus semotus, survives as an endangered species. We conducted a three-stage analysis to identify conditions under which hoary bats originally colonized Hawaii. We used FLIGHT to determine if stores of fat would provide the energy necessary to fly from the Farallon Islands (California) to Hawaii, a distance of 3,665 km. The Farallons are a known stopover and the closest landfall to Hawaii for hoary bats during migrations within North America. Our modeling variables included physiological, morphological, and behavioral data characterizing North American Hoary Bat populations. The second step of our modeling process investigated the potential limiting factor of water during flight. The third step in our modeling examines the role that prevailing trade winds may have played in colonization flights. Of our 36 modeling scenarios, 17 (47 %) require tailwind assistance within the range of observed wind speeds, and 7 of these scenarios required −1 tailwinds as regularly expected due to easterly trade winds. Therefore the climatic conditions needed for bats to colonize Hawaii may not occur infrequently either in contemporary times or since the end of the Pleistocene. Hawaii’s hoary bats have undergone divergence from mainland populations resulting in smaller body size and unique pelage color.

  20. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Tsangaras Kyriakos

    2012-10-01

    Full Text Available Abstract Background The koala (Phascolarctos cinereus is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in koala population size during the late 1800s and early 1900s. To examine the effects of these reductions in population size on koala genetic diversity, we sequenced part of the hypervariable region of mitochondrial DNA (mtDNA in koala museum specimens collected in the 19th and 20th centuries, hypothesizing that the historical samples would exhibit greater genetic diversity. Results The mtDNA haplotypes present in historical museum samples were identical to haplotypes found in modern koala populations, and no novel haplotypes were detected. Rarefaction analyses suggested that the mtDNA genetic diversity present in the museum samples was similar to that of modern koalas. Conclusions Low mtDNA diversity may have been present in koala populations prior to recent population declines. When considering management strategies, low genetic diversity of the mtDNA hypervariable region may not indicate recent inbreeding or founder events but may reflect an older historical pattern for koalas.

  1. Biosynthetic Machinery of Diterpene Pleuromutilin Isolated from Basidiomycete Fungi.

    Science.gov (United States)

    Yamane, Momoka; Minami, Atsushi; Liu, Chengwei; Ozaki, Taro; Takeuchi, Ichiro; Tsukagoshi, Tae; Tokiwano, Tetsuo; Gomi, Katsuya; Oikawa, Hideaki

    2017-12-05

    The diterpene pleuromutilin is a ribosome-targeting antibiotic isolated from basidiomycete fungi, such as Clitopilus pseudo-pinsitus. The functional characterization of all biosynthetic enzymes involved in pleuromutilin biosynthesis is reported and a biosynthetic pathway proposed. In vitro enzymatic reactions and mutational analysis revealed that a labdane-related diterpene synthase, Ple3, catalyzed two rounds of cyclization from geranylgeranyl diphosphate to premutilin possessing a characteristic 5-6-8-tricyclic carbon skeleton. Biotransformation experiments utilizing Aspergillus oryzae transformants possessing modification enzyme genes allowed the biosynthetic pathway from premutilin to pleuromutilin to be proposed. The present study sets the stage for the enzymatic synthesis of natural products isolated from basidiomycete fungi, which are a prolific source of structurally diverse and biologically active terpenoids. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Basin wildrye (Leymus cinereus) pooled tetraploid accessions for U.S. Intermountain rangeland reclamation

    Science.gov (United States)

    Stanford A. Young; Jason Vernon; Nancy Shaw

    2013-01-01

    Basin wildrye (Leymus cinereus [Scribn. & Merr.] A. Love) is an important perennial, hardy, long-lived, cool season C3 native grass of rangeland plant communities throughout much of western United States and Canada. All classes of livestock and wildlife, including large and small birds and mammals, utilise the grass year round for food and protection due to its 2-3...

  3. Habitat relationships of eastern red-backed salamanders (Plethodon cinereus) in Appalachian agroforestry and grazing systems

    Science.gov (United States)

    Breanna L. Riedel; Kevin R. Russell; W. Mark Ford; Katherine P. O' Neill; Harry W. Godwin

    2008-01-01

    Woodland salamander responses to either traditional grazing or silvopasture systems are virtually unknown. An information-theoretic modelling approach was used to evaluate responses of red-backed salamanders (Plethodon cinereus) to silvopasture and meadow conversions in southern West Virginia. Searches of area-constrained plots and artificial...

  4. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  5. Phorcotabanus cinereus (Wiedemann, 1821) (Diptera, Tabanidae), an ornithophilic species of Tabanid in Central Amazon, Brazil.

    Science.gov (United States)

    Limeira-de-Oliveira, Francisco; Rafael, José Albertino; Henriques, Augusto Loureiro

    2002-09-01

    In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann) was recorded attacking the native duck Cairina moschata (Linnaeus) (Anseriformes, Anatidae). The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  6. Detection of a second novel gammaherpesvirus in a free-ranging koala (Phascolarctos cinereus).

    Science.gov (United States)

    Vaz, Paola; Whiteley, Pam L; Wilks, Colin R; Browning, Glenn F; Gilkerson, James R; Ficorilli, Nino; Devlin, Joanne M

    2012-01-01

    A second novel gammaherpesvirus was detected in a free-ranging koala (Phascolarctos cinereus) shown previously to be infected with phascolarctid herpesvirus 1. Analysis of the DNA polymerase gene showed that the virus was genetically distinct from all known gammaherpesviruses. This is the first reported dual gammaherpesvirus infection in an Australian marsupial.

  7. Historically low mitochondrial DNA diversity in koalas (Phascolarctos cinereus)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Avila Arcos, Maria del Carmen; Ishida, Yasuko

    2012-01-01

    The koala (Phascolarctos cinereus) is an arboreal marsupial that was historically widespread across eastern Australia until the end of the 19th century when it suffered a steep population decline. Hunting for the fur trade, habitat conversion, and disease contributed to a precipitous reduction in...

  8. The influence of red-backed salamanders (Plethodon cinereus) on nutrient cycling in Appalachian hardwood forests

    Science.gov (United States)

    Eric B. Sucre; Jessica A. Homyack; Thomas R. Fox; Carola A. Haas

    2010-01-01

    The use of amphibians as biological indicators of ecosystem health has received considerable attention because of the increasing importance placed upon maintaining biodiversity in forested ecosystems. In this study, we imposed three different eastern red-backed salamander (Plethodon cinereus) treatments: 1) low (n = 4; added 0 salamanders to each...

  9. Another account of interspecific aggression involving a Hoary Bat (Lasiurus cinereus)

    Science.gov (United States)

    Alyson F Brokaw; Jeff Clerc; Ted Weller

    2016-01-01

    We observed an incident of interspecific aggression between a male Hoary Bat (Lasiurus cinereus) and a male Silver-haired Bat (Lasionycteris noctivagans). The Silver-haired Bat suffered few external injuries, the most conspicuous of which were a missing lower right canine and small...

  10. Volatile organic components from fresh non-edible Basidiomycetes fungi.

    Science.gov (United States)

    Piovano, Marisa; Garbarino, Juan A; Sánchez, Elizabeth; Young, Manuel E

    2009-12-01

    The compounds responsible for the characteristic odor of eight fresh non-edible Basidiomycetes fungi were evaluated. The volatile organic compounds from the fresh samples present in the headspace of a sealed vial were determined by solid-phase microextraction gas chromatography-mass spectrometry, using a PDMS/DVB fiber. A total of twenty-eight components were identified, the most frequent being 1-octen-3-ol and 3-octanone.

  11. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts.

    Science.gov (United States)

    Buzzini, Pietro; Romano, Sergio; Turchetti, Benedetta; Vaughan, Ann; Pagnoni, Ugo Maria; Davoli, Paolo

    2005-02-01

    Thirty-seven basidiomycetous yeasts belonging to 30 species of seven genera were grown on media containing l-cysteine or l-methionine as sole nitrogen sources with the objective of evaluating volatile organic sulfur compound (VOSC) production. The headspace of yeast cultures was analyzed by the solid-phase microextraction (SPME) sampling method, and volatile compounds were quantified and identified by GC-MS techniques. Ten strains assimilating L-methionine produced the following VOSCs: 3-(methylthio)-1-propanol, methanethiol, S-methyl thioacetate, dimethyl disulfide, dimethyl trisulfide, allyl methyl sulphide and 4,5-dihydro-3(2H)-thiophenone. Production was amyl alcohol) and esters (ethyl acetate, ethyl propionate, n-propyl acetate, isobutyl acetate, n-propyl propionate, n-butyl acetate, isoamyl acetate, amyl acetate, isoamyl propionate, amyl propionate and 2-phenylmethyl acetate) were also sporadically produced. This is the first report of VOSCs production by basidiomycetous yeasts. Consequently, basidiomycetous yeasts may be considered an interesting new group of microbial VOSCs producers for the flavor industry.

  12. Antimicrobial activity of submerged cultures of Chilean basidiomycetes.

    Science.gov (United States)

    Aqueveque, Pedro; Anke, Timm; Saéz, Katia; Silva, Mario; Becerra, José

    2010-10-01

    This study is part of a screening program aimed at searching for bioactive metabolites from Chilean basidiomycetes. Submerged cultivation of fungal mycelia in liquid media was evaluated for antimicrobial activity. A total of 148 strains were obtained in vitro. The extracts produced from submerged cultures were evaluated against bacteria and fungi. In the primary antimicrobial assay, approximately 60% of the extracts presented positive biological activity. The highest frequencies of active strains were from the orders Agaricales (31.0%), Polyporales (20.6%), Sterales (18.3%), Boletales (11.4%), and Cortinariales (9.1%). Antifungal activity was more pronounced than antibacterial activity. Twelve extracts that exhibited strong antimicrobial activity showed minimum inhibitory concentration (MIC) values of 50 µL/mL against Bacillus brevis and 25∼50 µL/mL against Penicillium notatum and Paecilomyces variotii. The biological activity of some strains did not vary considerably, regardless of the substrate or collection site whereas, for others, it showed marked variations. Differences in antimicrobial activities observed in the different fungal genera suggested that the ability to produce bioactive compounds is not homogenously distributed among basidiomycetes. The information obtained from this study reveals that Chilean basidiomycetes are able to generate small and/or large variations in the normal pathway of compounds production. Thus, it is necessary to evaluate this biological and chemical wealth, which could be an unsuspected reservoir of new and potentially useful molecules. © Georg Thieme Verlag KG Stuttgart · New York.

  13. Tremulane sesquiterpenes from cultures of the basidiomycete Irpex lacteus.

    Science.gov (United States)

    Ding, Jian-Hai; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2018-03-01

    Five new tremulane sesquiterpenes, named irlactins F-J (1-5), were isolated from cultures of the basidiomycete Irpex lacteus together with two known analogues (6 and 7). Structures and relative configurations of compounds 1-5 were elucidated by spectroscopic data analysis. Compund 4 exhibited moderate cytotoxicities on HL-60, SMMC-7721, A-549, MCF-7, and SW480 cells with IC 50 values of 16.23, 20.40, 25.55, 19.05, and 18.58μM, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Physical condition, sex, and age-class of eastern red-backed salamanders (Plethodon cinereus) in forested and open habitats of West Virginia, USA

    Science.gov (United States)

    Breanna L. Riedel; Kevin R. Russell; W. Mark. Ford

    2012-01-01

    Nonforested habitats such as open fields and pastures have been considered unsuitable for desiccation-prone woodland salamanders such as the Eastern Red-backed Salamander (Plethodon cinereus). Recent research has suggested that Plethodon cinereus may not only disperse across but also reside within open habitats including fields,...

  16. Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura

    Directory of Open Access Journals (Sweden)

    Carlos da Silva Lacaz

    1996-10-01

    Full Text Available The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum commune. Lesions of the buccal mucosa, brain abscesses, onychomycosis and endocarditis have been described, with a growing interest in this type of deep mycosis on the part of mycologists and infectologists. The present paper reports descriptions of mycetism as well as infectious processes caused by basidiomycetes, such as Schizophyllum commune, Ustilago maydis (= Ustilago zeae and Coprinus cinereusAs basidiomicoses, infecções fúngicas provocadas por basidiomicetos ou agáricos vêm sendo registradas cada vez com maior frequência na literatura médica, principalmente após o advento da AIDS/SIDA, em 1981. Os basidiosporos desses fungos, espalhados na atmosfera e veiculados através do vento ou de correntes aéreas, atingem por via nasal os seios maxilares, provocando quadros de sinusite crônica, na maioria das vezes. Do escarro também têm sido isolados basidiomicetos, principalmente o Schizophyllum commune. Lesões da mucosa da boca, abscessos cerebrais, onicomicoses e endocardites já foram descritas, aumentando o interesse dos micologistas e infectologistas para este tipo de micose profunda. O presente trabalho assinala, ao lado dos quadros dc micetismo, processos infecciosos provocados por basidiomicetos, a exemplo do Schizophyllum commune, Ustilago maydis (= Ustilago zeae e Coprinus cinereus.

  17. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  18. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM SCHIZOPHYLLUM COMMUNE

    Directory of Open Access Journals (Sweden)

    А.С. Бухало

    2012-10-01

    Full Text Available  The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes Schizophyllum commune in a surface and submerged culture. 21 strains of S. commune were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains on agar mediums were shown the following enzymes: amylase, caseinase, gelatinase, polygalacturonase, pectattranselyminase, urease, lipase, cellulase, laccase and peroxydase. The demonstration of oxidizing enzymes of laccase and peroxydase depended on composition of medium. The estimation of presence and level of activity of endo-1,4-b-glucanase, exoglucanase and monophenolmonooxygenase at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of strain 1760 S. commune.

  19. TOTAL ANTIOXIDANT ACTIVITY OF SOME BASIDIOMYCETES STRAINS IN GROWTH DYNAMIC

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2016-08-01

    Full Text Available The work is devoted to the study of total antioxidant activity (AOA in the growth dynamics of basidiomycetes strains in their periodic surface cultivation on glucose-peptone medium. Subjects of research are mycelium and culture filtrate (CF from 57 strains, 5 of which are belong to 5 types of Polyporales order, and 52 of which are belong to the 7 types of Agaricales order. In order to study the dynamics of growth used method for determining the weight of absolutely dry biomass accumulation (ADB. Total AOA of mycological material was evaluated by inhibition of lipid peroxidation products accumulation intensity in the model oxidation reaction of Tween-80 by air oxygen. It was found that the most productive in terms of the accumulation of ADB are strains F. velutipes F-610 and P. eryngii P-er. Lowest values of ADB accumulation recorded for strains P. ostreatus P-14 and P-192 and P. citrinopileatus P sіtr. Were selected the most productive strains of Basidiomycetes for the level of total AOA in mycelium and CF. There are strains P. eryngii P-er, P. citrinopileatus P sіtr, P. ostreatus P-035, F. hepatica Fh-08, A. cylindracea 960, P. ostreatus P-081, P-082, P-087, P. citrinopileatus P sіtr. Has not been established the dependence between the growth and the antioxidant activity of the 9- and 12-day fungal cultures. Selected producers of natural antioxidants may be used as biological agents in biotechnology.

  20. Biotransformation of coal derived humic acids by Basidiomycetes

    Science.gov (United States)

    Klein, O. I.; Kulikova, N. A.; Stepanova, E. V.; Koroleva, O. V.

    2009-04-01

    Introduction Low energetic coals and wastes of coal industry are promising sources for biologically active compounds including humic acids (HA). Aside from evident advantages of biocatalytic approaches for coal slime conversion such as environmental safety and cost efficiency they also could be used for the improving of HAs biological activity [1, 2]. The aim of the present study was to provide molecular characterization of the HAs formed during biotransformation of coal slime by Basidiomycetes under different cultivation conditions. Materials and methods Biotransformation of brown coal from Solncevskoe deposit (Sakhalin, Russia) was performed by liquid surface cultivation of pure culture Coriolus hirsutus 075 (Wulf. Ex. Fr.) Quel. with rich (contained glucose as a carbon source) and poor (without readily available carbon source) nutrition medium. After 30 days of cultivation coal HAs were separated by alkaline extraction followed by dialysis desalting and drying at 50C. HAs derived were characterized using size-exclusion chromatography, Fourier transformed infrared (FTIR) and 13C NMR spectroscopy. Results and discussion Molecular weight distribution of HA was not significantly affected by Basidiomycetes under all cultivation conditions studied in comparison to HAs extracted from non-conversed coal. FTIR spectra of HA obtained were typical for HAs. Biotransformation of coal did not result in appearance of new functional groups. The exception was observed under rich media conditions where absorbance at 1700 cm-1 was determined related to carbonyl groups of carboxyl and ketonic fragments. Therefore, the revealed phenomena could be explained with additional formation of the above carbonyl groups in the course of biotransformation process. Quantification of 13C NMR spectra revealed decrease of aromatic structures in HA extracted from coal after biotransformation under poor media conditions. Also a significant increase in carboxylic fragments content was observed. So

  1. Decolorization of synthetic dyes by crude and purified laccases from Coprinus comatus grown under different cultures: the role of major isoenzyme in dyes decolorization.

    Science.gov (United States)

    Jiang, Man; Ten, Zhen; Ding, Shaojun

    2013-01-01

    Coprinus comatus laccase isoenzyme induction and its effect on decolorization were investigated. The C/N ratio, together with aromatic compounds and copper, significantly influenced laccase isoenzyme profile and enzyme activity. This fungus produced six laccase isoenzymes in high-nitrogen low-carbon cultures but much less in low-nitrogen high-carbon (LNHC) cultures. The highest laccase level (3.25 IU/ml), equivalent to a 12.6-fold increase compared with unsupplemented controls (0.257 IU/ml), was recorded after 13 days in LNHC cultures supplemented with 2.0 mM 2-toluidine. Decolorization of twelve synthetic dyes belonging to anthraquinone, azo, and triphenylmethane dyes, by crude laccases with different proportion of isoenzymes produced under selected culture conditions, illustrated that the LacA is the key isoenzyme contributed to dyes decolorization especially in the presence of 1-hydroxybenzotriazol, which was further confirmed by dyes decolorization with purified LacA in the same condition. The crude laccase only was able to decolorize over 90 % of Reactive Brilliant Blue K-3R, Reactive Dark Blue KR, and Malachite Green, and higher decolorization for broader spectrum of synthetic dyes was obtained in presence of redox mediator, suggesting that C. comatus had high potential to decolorize various synthetic dyes as well as the recalcitrant azo dyes.

  2. Accumulation and tolerance to cadmium heavy metal ions and induction of 14-3-3 gene expression in response to cadmium exposure in Coprinus atramentarius.

    Science.gov (United States)

    Xie, Chengjian; Hu, Liujie; Yang, Yongzhu; Liao, Dunxiu; Yang, Xingyong

    2017-03-01

    Cadmium (Cd), one of the most toxic heavy-metal pollutants, has a strong and irreversible tendency to accumulate. Bioremediation is a promising technology to remedy and control heavy metal pollutants because of its low cost and ability to recycle heavy metals. Coprinus atramentarius is recognized as being able to accumulate heavy metal ions. In this work, C. atramentarius is cultivated on a solid medium containing Cd 2+ ions to analyze its ability to tolerate different concentrations of the heavy metal ion. It is found that the growth of C. atramentarius is not significantly inhibited when the concentration of Cd 2+ is less than 0.6mgL -1 . The accumulation capacity of C. atramentarius at different Cd 2+ concentrations also was determined. The results show that 76% of the Cd 2+ present can be accumulated even when the concentration of the Cd 2+ is 1mgL -1 . The different proteins of C. atramentarius exposed to Cd 2+ were further analyzed using gel electrophoresis. A 14-3-3 protein was identified and shown to be significantly up-regulated. In a further study, a full-length 14-3-3 gene was cloned containing a 759bp open reading frame encoding a polypeptide consisting of 252 amino acids and 3 introns. The gene expression work also showed that the 14-3-3 was significantly induced, and showed coordinated patterns of expression, with Cd 2+ exposure. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Preshipment testing success: resolution of a nasal sinus granuloma in a captive koala (Phascolarctos cinereus) caused by Cryptococcus gattii.

    Science.gov (United States)

    Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Pye, Geoffrey W; Meyer, Wieland; Sykes, Jane E

    2012-12-01

    A 3-yr-old female koala (Phascolarctos cinereus) was diagnosed with a nasal sinus granuloma caused by Cryptococcus gattii after a pre-shipment examination revealed a latex cryptococcal agglutination titer of 1:512. Successful medical and surgical treatment of the granuloma was monitored using serial latex cryptococcal agglutination titers, serum levels of antifungal drugs, and advanced imaging.

  4. A climate for speciation: rapid spatial diversification within the Sorex cinereus complex of shrews

    Science.gov (United States)

    Hope, Andrew G.; Speer, Kelly A.; Demboski, John R.; Talbot, Sandra L.; Cook, Joseph A.

    2012-01-01

    The cyclic climate regime of the late Quaternary caused dramatic environmental change at high latitudes. Although these events may have been brief in periodicity from an evolutionary standpoint, multiple episodes of allopatry and divergence have been implicated in rapid radiations of a number of organisms. Shrews of the Sorex cinereus complex have long challenged taxonomists due to similar morphology and parapatric geographic ranges. Here, multi-locus phylogenetic and demographic assessments using a coalescent framework were combined to investigate spatiotemporal evolution of 13 nominal species with a widespread distribution throughout North America and across Beringia into Siberia. For these species, we first test a hypothesis of recent differentiation in response to Pleistocene climate versus more ancient divergence that would coincide with pre-Pleistocene perturbations. We then investigate the processes driving diversification over multiple continents. Our genetic analyses highlight novel diversity within these morphologically conserved mammals and clarify relationships between geographic distribution and evolutionary history. Demography within and among species indicates both regional stability and rapid expansion. Ancestral ecological differentiation coincident with early cladogenesis within the complex enabled alternating and repeated episodes of allopatry and expansion where successive glacial and interglacial phases each promoted divergence. The Sorex cinereus complex constitutes a valuable model for future comparative assessments of evolution in response to cyclic environmental change.

  5. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  6. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  7. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  8. COMPARATIVE CHARACTERISTICS OF BASIDIOMYCETES — PRODUCERS OF CATALASE

    Directory of Open Access Journals (Sweden)

    T. E. Voloshko

    2013-06-01

    Full Text Available The dynamics of growth and catalase activity of 57 strains of basidiomycetes were investigated. Glucose-peptone medium was used for surface cultivation of fungi. The objects of study were 57 strains, 5 of which belongs to 5 species of the order Polyporales, and others do to 7 species of the order Agaricales. The weight measurement to estimate accumulation of absolutely dry biomass was used to study growth rates. The spectrophotometric methods were used for determination of catalase activity and protein content in mycelium and culture filtrate. The specific catalase activity was calculated based on this data. The levels of biomass accumulation and catalase activity of the strains on the 9-th and 12-th days of cultivation and ability of the most fungi to synthesize mainly extracellular catalase were determined. Individual variability of the strains was shown. The results allowed selecting the strains — active producers of catalase, including F. velutipes F-2 and P. ostreatus R-208, which are perspective for use in biotechnology of enzyme preparations.

  9. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  11. Skin test reactivity of allergic subjects to basidiomycetes' crude extracts in a tropical environment.

    Science.gov (United States)

    Rivera-Mariani, Félix E; Nazario-Jiménez, Sylvette; López-Malpica, Fernando; Bolaños-Rosero, Benjamín

    2011-11-01

    Fungal allergies can be detected by the skin prick test with extracts of the organisms, but not all fungi, including the basidiomycetes, are being examined. We determined the level of sensitization to basidiomycetes in allergic subjects and compared their reactivity to commercial extracts commonly used to detect allergies. Crude spore extracts of the basidiomycetes Ganoderma applanatum, Chlorophyllum molybdites, and Pleurotus ostreatus, which are known to release numerous spores, were examined along with commercial extracts on 33 subjects with asthma, allergic or non-allergic rhinitis. Overall, affected subjects showed the highest reactivity to mites (36%), followed by Ganoderma applanatum (30%), grass (27%) Chlorophyllum molybdites (12%) and Pleurotus ostreatus (12%). Allergic rhinitis patients were most reactive to mites (58%), grass (42%), Ganoderma applanatum (25%), Penicillium spp. (25%), and cat (17%). Those with asthma primarily responded to mites (44%), Ganoderma applanatum (44%), grass (33%), and Pleurotus ostreatus (22%). IgE levels correlated with positive basidiomycetes extracts. This finding, coupled with higher reactivity to basidiospores as compared to mitospores, and the similar sensitivities of patients to G. applanatum and mites, suggest that basidiomycetes are important allergen sources in the tropics.

  12. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  13. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  14. A New Subspecies Identification and Population Study of the Asian Small-Clawed Otter (Aonyx cinereus in Malay Peninsula and Southern Thailand Based on Fecal DNA Method

    Directory of Open Access Journals (Sweden)

    M. K. A. Rosli

    2014-01-01

    Full Text Available Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  15. A new subspecies identification and population study of the Asian small-clawed otter (Aonyx cinereus) in Malay Peninsula and southern Thailand based on fecal DNA method.

    Science.gov (United States)

    Rosli, M K A; Syed-Shabthar, S M F; Abdul-Patah, P; Abdul-Samad, Z; Abdul, S N; Burhanuddin, M N; Zulkifli, N A; Shukor, M N; Budsabong, K; Changtragoon, S; Sekiguchi, T; Sasaki, H; Md-Zain, B M

    2014-01-01

    Three species of otter can be found throughout Malay Peninsula: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata. In this study, we focused on the A. cinereus population that ranges from the southern and the east coast to the northern regions of Malay Peninsula up to southern Thailand to review the relationships between the populations based on the mitochondrial D-loop region. Forty-eight samples from six populations were recognized as Johor, Perak, Terengganu, Kelantan, Ranong, and Thale Noi. Among the 48 samples, 33 were identified as A. cinereus, seven as L. sumatrana, and eight as L. perspicillata. Phylogenetically, two subclades formed for A. cinereus. The first subclade grouped all Malay Peninsula samples except for samples from Kelantan, and the second subclade grouped Kelantan samples with Thai sample. Genetic distance analysis supported the close relationships between Thai and Kelantan samples compared to the samples from Terengganu and the other Malaysian states. A minimum-spanning network showed that Kelantan and Thailand formed a haplogroup distinct from the other populations. Our results show that Thai subspecies A. cinereus may have migrated to Kelantan from Thai mainland. We also suggest the classification of a new subspecies from Malay Peninsula, the small-clawed otter named A. cinereus kecilensis.

  16. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  17. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  18. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  19. Processive endoglucanase active in crystalline cellulose hydrolysis by the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2005-01-01

    Brown rot basidiomycetes have long been thought to lack the processive cellulases that release soluble sugars from crystalline cellulose. On the other hand, these fungi remove all of the cellulose, both crystalline and amorphous, from wood when they degrade it. To resolve this discrepancy, we grew Gloeophyllum trabeum on microcrystalline cellulose (Avicel) and purified...

  20. Significant levels of extracellular reactive oxygen species produced by brown rot basidiomycetes on cellulose

    Science.gov (United States)

    Roni Cohen; Kenneth A. Jensen; Carl J. Houtman; Kenneth E. Hammel

    2002-01-01

    It is often proposed that brown rot basidiomycetes use extracellular reactive oxygen species (ROS) to accomplish the initial depolymerization of cellulose in wood, but little evidence has been presented to show that the fungi produce these oxidants in physiologically relevant quantities. We used [14C]phenethyl polyacrylate as a radical trap to estimate extracellular...

  1. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  2. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  3. Occurrence of wood-and root- rot basidiomycetes on trees in Bayero ...

    African Journals Online (AJOL)

    Several death and decays or rots of tropical trees are as result of infection caused by wood and root rot 'parasitic basidiomycetes. In the present study, survey of parasitic homobasidiomycetes causing wood and root rot on woody trees in Bayero University, Kano (two campuses) was carried out between April – September ...

  4. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  5. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  6. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  7. A Highly Diastereoselective Oxidant Contributes to Ligninolysis by the White Rot Basidiomycete Ceriporiopsis subvermispora

    Science.gov (United States)

    Daniel J. Yelle; Alexander N. Kapich; Carl J. Houtman; Fachuang Lu; Vitaliy I. Timokhin; Raymond C. Fort Jr.; John Ralph; Kenneth E. Hammel

    2014-01-01

    The white rot basidiomycete Ceriporiopsis subvermispora delignifies wood selectively and has potential biotechnological applications. Its ability to remove lignin before the substrate porosity has increased enough to admit enzymes suggests that small diffusible oxidants contribute to delignification. A key question is whether these unidentified...

  8. The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus

    Directory of Open Access Journals (Sweden)

    Niewiarowski Peter H

    2006-07-01

    Full Text Available Abstract Background In eastern North America two common colour morphs exist in most populations of redback salamanders (Plethodon cinereus. Previous studies have indicated that the different morphs may be adapted to different thermal niches and the morphological variation has been linked to standard metabolic rate at 15°C in one population of P. cinereus. It has therefore been hypothesized that a correlated response to selection on metabolic rate across thermal niches maintains the colour polymorphism in P. cinereus. This study tests that hypothesis. Results We found that the two colour morphs do sometimes differ in their maintenance metabolic rate (MMR profiles, but that the pattern is not consistent across populations or seasons. We also found that when MMR profiles differ between morphs those differences do not indicate that distinct niches exist. Field censuses showed that the two colour morphs are sometimes found at different substrate temperatures and that this difference is also dependent on census location and season. Conclusion While these morphs sometimes differ in their maintenance energy expenditures, the differences in MMR profile in this study are not consistent with maintenance of the polymorphism via a simple correlated response to selection across multiple niches. When present, differences in MMR profile do not indicate the existence of multiple thermal niches that consistently mirror colour polymorphism. We suggest that while a relationship between colour morph and thermal niche selection appears to exist it is neither simple nor consistent.

  9. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  10. Screening of medicinal higher Basidiomycetes mushrooms from Turkey for lovastatin production.

    Science.gov (United States)

    Atli, Burcu; Yamac, Mustafa

    2012-01-01

    As a first attempt, a study was carried out to test for lovastatin production ability in local higher Basidiomycetes mushroom isolates from Turkey. An extended screening was performed for lovastatin production in yeast lactose agar medium, among a total of 136 macrofungi isolates from the Basidiomycetes Culture Collection of Eskisehir Osmangazi University. Lovastatin production was evaluated by disc diffusion method and was also confirmed by TLC and HPLC. Only six isolates were found to be lovastatin producers. The highest production of lovastatin was obtained from the extracts from Omphalotus olearius OBCC 2002 and Pleurotus ostreatus OBCC 1031. The lovastatin amount produced by commercial strains, Aspergillus terreus NRRL 255 (7.0 mg/L) and Penicillium citrinum NRRL 1841 (7.0 mg/L), was nearly comparable to the amount produced by Pleurotus ostreatus OBCC 1031 (5.8 mg/L) and Omphalotus olearius OBCC 2002 (4 mg/L).

  11. Food habits of the hoary bat (LASIURUS CINEREUS) during spring migration through new mexico

    Science.gov (United States)

    Valdez, E.W.; Cryan, P.M.

    2009-01-01

    Hoary bats (Lasiums cinernis) exhibit continental patterns of migration that are unique to bats, but details about their behaviors during migration are lacking. We captured 177 hoary bats in spring and early summer 2002 as individuals migrated through the Sandia Mountains of north-central New Mexico. Our results support earlier observations of asynchronous timing of migration between sexes of L. cinernis during spring, with females preceding males by ca. 1 month. We provide the first evidence that hoary bats may travel in dispersed groups, fly below the tree canopy along streams, and feed while migrating during spring. Analysis of guano revealed that diet of L. cinereus consisted mostly of moths, with more than one-half of samples identified as Noctuidae and Geometridae. We observed a late-spring decline in consumption of moths that might be related to seasonal changes in abundance of prey, differential selection of prey by bats, or sampling bias. We suspect that spring migration of L. cinernis through New Mexico temporally coincides with the seasonal abundance of moths.

  12. Investigation of the koala (Phascolarctos cinereus) hindgut microbiome via 16S pyrosequencing.

    Science.gov (United States)

    Barker, Christopher J; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2013-12-27

    As a dietary source, the foliage of Eucalyptus spp. is low in available protein and carbohydrate while containing polyphenolic compounds that interfere with enzymatic digestion. To overcome this, the koala (Phascolarctos cinereus) has evolved a range of anatomical and physiological adaptations to assist with digestion and absorption of nutrients from this food source. Microbial fermentation of partially digested eucalyptus leaves is thought to be critical in this process, however, little is known about the composition and diversity of microorganisms that are associated with digestive health in this native species. In this study, we performed 16S rRNA gene pyrosequencing of caecum, colon and faecal pellet samples from two wild, free ranging, Queensland koalas. Our results reveal a highly complex and diverse ecosystem with considerable intra-individual variation. Although samples were dominated by sequences from the Bacteroidetes and Firmicutes phyla there was considerable variation at the genus level. This study is the first non-culture based microbiota analysis, using 454-amplicon pyrosequencing, and provides preliminary data to expand our understanding of the koala hindgut. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. MHC class II diversity of koala (Phascolarctos cinereus) populations across their range.

    Science.gov (United States)

    Lau, Q; Jaratlerdsiri, W; Griffith, J E; Gongora, J; Higgins, D P

    2014-10-01

    Major histocompatibility complex class II (MHCII) genes code for proteins that bind and present antigenic peptides and trigger the adaptive immune response. We present a broad geographical study of MHCII DA β1 (DAB) and DB β1 (DBB) variants of the koala (Phascolarctos cinereus; n=191) from 12 populations across eastern Australia, with a total of 13 DAB and 7 DBB variants found. We identified greater MHCII variation and, possibly, additional gene copies in koala populations in the north (Queensland and New South Wales) relative to the south (Victoria), confirmed by STRUCTURE analyses and genetic differentiation using analysis of molecular variance. The higher MHCII diversity in the north relative to south could potentially be attributed to (i) significant founder effect in Victorian populations linked to historical translocation of bottlenecked koala populations and (ii) increased pathogen-driven balancing selection and/or local genetic drift in the north. Low MHCII genetic diversity in koalas from the south could reduce their potential response to disease, although the three DAB variants found in the south had substantial sequence divergence between variants. This study assessing MHCII diversity in the koala with historical translocations in some populations contributes to understanding the effects of population translocations on functional genetic diversity.

  14. Cloning and expression of koala (Phascolarctos cinereus) liver cytochrome P450 reductase.

    Science.gov (United States)

    Kong, Sandra; Ngo, Suong N T; McKinnon, Ross A; Stupans, Ieva

    2009-07-01

    The cloning, expression and characterization of hepatic NADPH-cytochrome P450 reductase (CPR) from koala (Phascolarctos cinereus) is described. Two 2059 bp koala liver CPR cDNAs, designated CPR1 and CPR2, were cloned by reverse transcription-polymerase chain reaction and rapid amplification of cDNA ends. The koala CPR cDNAs encode proteins of 678 amino acids and share 85% amino acid sequence identity to human CPR. Transfection of the koala CPR cDNAs into Cos-7 cells resulted in the expression of proteins, which were recognized by a goat-antihuman CPR antibody. The koala CPR1 and 2 cDNA-expressed enzymes catalysed cytochrome c reductase at the rates of 4.9 +/- 0.5 and 2.6 +/- 0.4 nmol/min/mg protein (mean +/- SD, n = 3), respectively which were comparable to that of rat CPR cDNA-expressed enzyme. The apparent Km value for CPR activity in koala liver microsomes was 11.61 +/- 6.01 microM, which is consistent with that reported for rat CPR enzyme. Northern analysis detected a CPR mRNA band of approximately 2.6 kb. Southern analysis suggested a single PCR gene across species. The present study provides primary molecular data regarding koala CPR1 and CPR2 genes in this unique marsupial species.

  15. The koala (Phascolarctos cinereus): a case study in the development of reproductive technology in a marsupial.

    Science.gov (United States)

    Johnston, Stephen D; Holt, William V

    2014-01-01

    The successful development and application of an assisted breeding program in any animal relies primarily on a thorough understanding of the fundamental reproductive biology (anatomy, physiology and behaviour) of the species in question. Surely, the ultimate goal and greatest hallmark of such a program is the efficacious establishment of a series of reliable techniques that facilitate the reproductive and genetic management of fragmented populations, both in captivity and in the wild. Such an achievement is all the more challenging when the reproductive biology of that species is essentially rudimentary and without adequate reproductive models to compare to. Using the koala (Phascolarctos cinereus) as a case study, this chapter provides some personal insights into the evolution of a concept that began as a small undergraduate student project but that subsequently evolved into the first-ever successful artificial insemination of a marsupial. Apart from this historical perspective, we also provide a brief review of the current reproductive biology of the koala, discuss technical elements of current assisted breeding technology of this species, its potential application to the wombat, and the future role it might play in helping to conserve wild koala populations. There is little doubt that the unique reproductive biology and tractability of the koala has in this case been a benefit rather than a hindrance to the success of artificial breeding in this species.

  16. Foraging range movements of the endangered Hawaiian hoary bat, Lasiurus cinereus semotus (Chiroptera: Vespertilionidae)

    Science.gov (United States)

    Bonaccorso, Frank J.; Todd, Christopher M.; Miles, Adam C.; Gorresen, P. Marcos

    2015-01-01

    We documented nightly movements of Hawaiian hoary bats (Lasiurus cinereus semotus) on the island of Hawai’i. Based on data from 28 radiotagged individuals mean foraging range (FR) was 230.7±72.3 ha, core-use area (CUA) was 25.5±6.9 ha (or 11.1% of mean FR), and the mean long axis (LAX) across the FR was 3,390.8±754.3 m. There was almost no overlap in CUAs among 4 adult males having overlapping foraging areas and tracked simultaneously or within a 90-day window of each other. CUAs of subadults partially overlapped with multiple adult males or with one other subadult. High variance in FRs, cores use areas, and LAX across the FR perhaps reflect localized stochastic variables such as weather, habitat, and food resources. Hawaiian hoary bats use moderately large FRs among insectivorous bats studied with comparable methodologies; however, foraging activity indicated by documentation of acoustic feeding buzzes is concentrated within one or a few disjunct areas cumulatively forming the 50% fixed kernel of CUA. The concentration of feeding activity, low values of individual overlap, and agonistic chasing behavior within CUAs all demonstrate a structured use of individual space by Hawaiian hoary bats.

  17. Herbivorous and parasitic insect guilds associated with Great Basin wild rye (Elymus cinereus) in southern Idaho

    Energy Technology Data Exchange (ETDEWEB)

    Youtie, B.A.; Stafford, M.; Johnson, J.B.

    1987-10-31

    Insects inhabiting Great Basin wild rye (elymus cinereus Scribn. and Merr.) were surveyed at two sites on the Snake River Plain in southern Idaho during 1982 and 1983. Forty-six species of phytophagous insects were observed. In addition, eight parasitoid species were reared from insect hosts in the plant culms and identified. Life stage, abundance, plant part utilized, and study site were recorded for each insect species collected. Insect guilds at the two sites were compared based on species presence utilizing Sorensen's similarity index. Overall, 26 insect species were common to both sites, yielding a moderate similarity index of 0.62. The majority of the species that constitute the wild rye herbivore guilds were oligophagous (restricted to grasses). Many of these insects feed on grain crops as well as other native and introduced grasses. The relatively high diversity of phytophages on wild rye may be due to its tall, bunchgrass growth form, its abundance within its habitat, its broad geographic range, and the large number of related species of grasses in the region.

  18. Genetic variation in natural and translocated populations of the endangered Delmarva fox squirrel (Sciurus niger cinereus)

    Science.gov (United States)

    Lance, S.L.; Maldonado, J.E.; Bocetti, Carol I.; Pattee, O.H.; Ballou, J.D.; Fleischer, R.C.

    2003-01-01

    The Delmarva fox squirrel, Sciurus niger cinereus, is a federally listed endangered subspecies whose range has been reduced by 90%. In an attempt to increase both population size and range, translocation sites were established beginning in the 1960's by moving squirrels from the natural range to sites outside the current range. Although translocations have served as the primary component of the DFS recovery program, there has been very little post-release examination of the genetics of the translocation sites. In this study, we developed ten microsatellite loci, screened the three polymorphic loci, and sequenced a 330 bp fragment of the mitochondrial control region in order to assess levels of genetic variation in natural and translocated regions of Delmarva fox squirrels and to compare them to Southeastern fox squirrels (S. n. niger). Although we found low levels of microsatellite polymorphism, there were no differences in heterozygosity between natural and translocated regions, or between Delmarva and Southeastern fox squirrels. We found high levels of polymorphism in the mitochondrial control region. Our patterns of haplotype diversity suggest incomplete lineage sorting of the two subspecies. In general, our data suggest that the current levels of genetic variation in the translocated sites are representative of those found in the natural population, and we encourage the continued use of translocations as a major component of Delmarva fox squirrel recovery.

  19. Insect prey eaten by Hoary Bats (Lasiurus cinereus) prior to fatal collisions with wind turbines

    Science.gov (United States)

    Valdez, Ernest W.; Cryan, Paul M.

    2013-01-01

    Wind turbines are being deployed all across the world to meet the growing demand for energy, and in many areas, these turbines are causing the deaths of insectivorous migratory bats. One of the hypothesized causes of bat susceptibility is that bats are attracted to insects on or near the turbines. We examined insect remains in the stomachs and intestines of hoary bats (Lasiurus cinereus) found dead beneath wind turbines in New York and Texas to evaluate the hypothesis that bats die while feeding at turbines. Most of the bats we examined had full stomachs, indicating that they fed in the minutes to hours leading up to their deaths. However, we did not find prey in the mouths or throats of any bats that would indicate the bats died while capturing prey. Hoary bats fed mostly on moths, but we also detected the regular presence of beetles, true bugs, and crickets. Presence of terrestrial insects in stomachs indicates that bats may have gleaned them from the ground or the turbine surfaces, yet aerial capture of winged insect stages cannot be ruled out. Our findings confirm earlier studies that indicate hoary bats feed during migration and eat mostly moths. Future studies on bat behaviors and insect presence at wind turbines could help determine whether feeding at turbines is a major fatality risk for bats.

  20. Four new spiroaxane sesquiterpenes and one new rosenonolactone derivative from cultures of Basidiomycete Trametes versicolor.

    Science.gov (United States)

    Wang, Su-Rui; Zhang, Ling; Chen, He-Ping; Li, Zheng-Hui; Dong, Ze-Jun; Wei, Kun; Liu, Ji-Kai

    2015-09-01

    Four new spiroaxane sesquiterpenes, tramspiroins A-D (1-4), one new rosenonolactone 15,16-acetonide (5), and the known drimane sesquiterpenes isodrimenediol (6) and funatrol D (7) have been isolated from the cultures of Basidiomycete Trametes versicolor. The structures of new compounds were elucidated by means of spectroscopic methods. Compounds 1-7 were investigated for their cytotoxicities against five human cancer cell lines. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Identification of a Gene Cluster for Biosynthesis of Mannosylerythritol Lipids in the Basidiomycetous Fungus Ustilago maydis

    OpenAIRE

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A.; Kämper, Jörg; Bölker, Michael

    2006-01-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose exp...

  2. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  3. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2014-03-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose. Keywords: Basidiomycetes, mycelium, culture filtrate, polyphenols, carotenoids

  4. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  5. Non-dermatophyte moulds as skin and nail foot mycosis agents: Phoma herbarum, Chaetomium globosum and Microascus cinereus.

    Science.gov (United States)

    Tullio, Vivian; Banche, Giuliana; Allizond, Valeria; Roana, Janira; Mandras, Narcisa; Scalas, Daniela; Panzone, Michele; Cervetti, Ornella; Valle, Sergio; Carlone, Nicola; Cuffini, Anna Maria

    2010-04-01

    The increased prevalence of dermatomycoses along with the wide range of organisms now recognized as potential pathogens needs accurate laboratory isolation and identification of the aetiological agents. In this report three cases of foot dermatomycoses due to filamentous fungi commonly present in the environment with ubiquitous distribution are described in immunocompetent subjects. Skin and nail samples were collected, suspended in 20% KOH solution, examined under a light microscope and cultured in Mycobiotic agar and Sabouraud dextrose agar containing chloramphenicol to detect fungal growth. Phoma herbarum, Chaetomium globosum, and Microascus cinereus were isolated and identified. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  6. Perivertebral B-cell lymphoma in a Queensland koala (Phascolarctos cinereus adustus) with paralytic symptoms in the hind limbs.

    Science.gov (United States)

    Kido, Nobuhide; Edamura, Kazuya; Inoue, Naomi; Shibuya, Hisashi; Sato, Tsuneo; Kondo, Masako; Shindo, Izumi

    2012-08-01

    A male Queensland koala (Phascolarctos cinereus adustus) at Kanazawa Zoological Gardens (Kanagawa, Japan) exhibited paralytic symptoms in the hind limbs. Computed tomography and magnetic resonance imaging revealed a mass on the left ventral side of the 11th to 13th thoracic vertebrae, and the presence of myelitis or edema in the spinal cord. The koala was under anesthesia during the examination and suddenly developed ventricular fibrillation and died. Necropsy revealed a firm flat ovoid hemorrhagic mass on the vertebrae. Following a microscopic examination including immunohistochemistry, the perivertebral mass was diagnosed as B cell lymphoma. Therefore, neoplastic cell infiltration into the spinal cord may cause paralytic symptoms in the hind limbs.

  7. Treatment of Chlamydia-associated ocular disease via a recombinant protein based vaccine in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Waugh, Courtney; Austin, Ray; Polkinghorne, Adam; Timms, Peter

    2016-11-01

    Koalas (Phascolarctos cinereus) are affected by debilitating chlamydial disease that can lead to blindness, infertility, and death. The causative agent is the intracellular bacterium Chlamydia pecorum. While antibiotics can be used to treat koala chlamydial infection, they are often ineffective or cause severe dysbiosis to the animal's unique gut flora. Recent work has progressed on the development of a protective vaccine for Chlamydia in the koala. This study demonstrates that the use of a vaccine can have a positive effect in koalas already with clinical signs of ocular disease, suggesting a possible therapeutic effect and an alternative to antibiotic therapy. Copyright © 2016 International Alliance for Biological Standardization. All rights reserved.

  8. ATYPICAL PRESENTATION OF CRYPTOCOCCUS NEOFORMANS IN A KOALA (PHASCOLARCTOS CINEREUS): A MAGNETIC RESONANCE IMAGING AND COMPUTED TOMOGRAPHY STUDY.

    Science.gov (United States)

    Martínez-Nevado, Eva; Alonso-Alegre, Elisa González; Martínez, M Ángeles Jiménez; Rodríguez-Álvaro, Alfonso; de Merlo, Elena Martínez; García, Juncal García; Real, Isabel García

    2017-03-01

    Cryptococcosis is a worldwide and potentially fatal mycosis documented in wild and captive koalas ( Phascolarctos cinereus ) caused by Cryptococcus neoformans . Though mainly a subclinical disease, when the nasal cavity is affected, epistaxis, mucopurulent nasal discharge, dyspnea, and facial distortion may occur. This report describes a case of cryptococcosis in a koala where unilateral exophthalmos was the only evident clinical sign and magnetic resonance imaging and computed tomography findings are described. Both advanced imaging techniques should be considered as standard and complementary techniques for nasal cavity evaluation in koalas.

  9. Accumulation of Methylmercury in Invertebrates and Masked Shrews (Sorex cinereus) at an Upland Forest-Peatland Interface in Northern Minnesota, USA.

    Science.gov (United States)

    Tavshunsky, Ilana; Eggert, Susan L; Mitchell, Carl P J

    2017-12-01

    Mercury (Hg) methylation is often elevated at the terrestrial-peatland interface, but methylmercury (MeHg) production at this "hot spot" has not been linked with in situ biotic accumulation. We examined total Hg and MeHg levels in peat, invertebrates and tissues of the insectivore Sorex cinereus (masked shrew), inhabiting a terrestrial-peatland ecotone in northern Minnesota, USA. Mean MeHg concentrations in S. cinereus (71 ng g -1 ) fell between concentrations measured in spiders (mean 70-140 ng g -1 ), and ground beetles and millipedes (mean 29-42 ng g -1 ). Methylmercury concentrations in S. cinereus increased with age and differed among tissues, with highest concentrations in kidneys and muscle, followed by liver and brain. Nearly all Hg in S. cinereus was in the methylated form. Overall, the high proportional accumulation of MeHg in peat at the site (3.5% total Hg as MeHg) did not lead to particularly elevated concentrations in invertebrates or shrews, which are below values considered a toxicological risk.

  10. Serum Antibody Response to Koala Retrovirus Antigens Varies in Free-Ranging Koalas ( Phascolarctos cinereus ) in Australia: Implications for Vaccine Design.

    Science.gov (United States)

    Waugh, Courtney; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2016-04-28

    Little is known about the immune response in the koala ( Phascolarctos cinereus ) to its retroviruses. Koala retroviruses (KoRVs) have been linked to neoplasia in wild and captive koalas, but there is no treatment available. We tested the KoRV-specific serum immunoglobulin G antibody response in nonimmunized and immunized koalas.

  11. Koalas (Phascolarctos cinereus) From Queensland Are Genetically Distinct From 2 Populations in Victoria.

    Science.gov (United States)

    Ruiz-Rodriguez, Christina T; Ishida, Yasuko; Murray, Neil D; O'Brien, Stephen J; Graves, Jennifer A M; Greenwood, Alex D; Roca, Alfred L

    2016-01-01

    The koala (Phascolarctos cinereus) suffered population declines and local extirpation due to hunting in the early 20th century, especially in southern Australia. Koalas were subsequently reintroduced to the Brisbane Ranges (BR) and Stony Rises (SR) by translocating individuals from a population on French Island descended from a small number of founders. To examine genetic diversity and north-south differentiation, we genotyped 13 microsatellite markers in 46 wild koalas from the BR and SR, and 27 Queensland koalas kept at the US zoos. The Queensland koalas displayed much higher heterozygosity (H O = 0.73) than the 2 southern Australian koala populations examined: H O = 0.49 in the BR, whereas H O = 0.41 in the SR. This is consistent with the historical accounts of bottlenecks and founder events affecting the southern populations and contrasts with reports of high genetic diversity in some southern populations. The 2 southern Australian koala populations were genetically similar (F ST = 0.018, P = 0.052). By contrast, northern and southern Australian koalas were highly differentiated (F ST = 0.27, P < 0.001), thereby suggesting that geographic structuring should be considered in the conservation management of koalas. Sequencing of 648bp of the mtDNA control region in Queensland koalas found 8 distinct haplotypes, one of which had not been previously detected among koalas. Queensland koalas displayed high mitochondrial haplotype diversity (H = 0.753) and nucleotide diversity (π = 0.0072), indicating along with the microsatellite data that North American zoos have maintained high levels of genetic diversity among their Queensland koalas. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Epidemiology of chlamydial infection and disease in a free-ranging koala (Phascolarctos cinereus population.

    Directory of Open Access Journals (Sweden)

    Sharon Nyari

    Full Text Available Chlamydial disease continues to be one of the main factors threatening the long-term survival of the koala (Phascolarctos cinereus. Despite this, large epidemiological studies of chlamydial infection and disease in wild koala populations are lacking. A better understanding of the prevalence, transmission and pathogenesis is needed to improve control measures, such as the development of vaccines. We investigated the prevalence of Chlamydia pecorum infection and disease in 160 koalas in a peri-urban wild population in Queensland, Australia and found that 31% of koalas were Chlamydia PCR positive and 28% had clinically detectable chlamydial disease. Most infections were at the urogenital site (27%; both males and females with only 14% at the ocular site. Interestingly, we found that 27% (4/15 of koalas considered to be sexually immature (9-13 months were already infected with C. pecorum, suggesting that a significant percentage of animals are infected directly from their mother. Ocular infection levels were less prevalent with increasing age (8% in koalas older than 4 years, whereas the prevalence of urogenital tract infections remained high into older age (26% in koalas older than 4 years, suggesting that, after mother-to-young transmission, C. pecorum is predominantly a sexually transmitted infection. While 28% of koalas in this population had clinically detectable chlamydial disease (primarily urogenital tract disease, many PCR positive koalas had no detectable disease and importantly, not all diseased animals were PCR positive. We also observed higher chlamydial loads in koalas who were C. pecorum infected without clinical disease than in koalas who were C. pecorum infected with clinical disease. These results shed light on the potential mechanisms of transmission of C. pecorum in koalas and also guide future control measures, such as vaccination.

  13. Potential 'ecological traps' of restored landscapes: koalas Phascolarctos cinereus re-occupy a rehabilitated mine site.

    Directory of Open Access Journals (Sweden)

    Romane H Cristescu

    Full Text Available With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community

  14. Characterization of shifts of koala (Phascolarctos cinereus intestinal microbial communities associated with antibiotic treatment

    Directory of Open Access Journals (Sweden)

    Katherine E. Dahlhausen

    2018-03-01

    Full Text Available Koalas (Phascolarctos cinereus are arboreal marsupials native to Australia that eat a specialized diet of almost exclusively eucalyptus leaves. Microbes in koala intestines are known to break down otherwise toxic compounds, such as tannins, in eucalyptus leaves. Infections by Chlamydia, obligate intracellular bacterial pathogens, are highly prevalent in koala populations. If animals with Chlamydia infections are received by wildlife hospitals, a range of antibiotics can be used to treat them. However, previous studies suggested that koalas can suffer adverse side effects during antibiotic treatment. This study aimed to use 16S rRNA gene sequences derived from koala feces to characterize the intestinal microbiome of koalas throughout antibiotic treatment and identify specific taxa associated with koala health after treatment. Although differences in the alpha diversity were observed in the intestinal flora between treated and untreated koalas and between koalas treated with different antibiotics, these differences were not statistically significant. The alpha diversity of microbial communities from koalas that lived through antibiotic treatment versus those who did not was significantly greater, however. Beta diversity analysis largely confirmed the latter observation, revealing that the overall communities were different between koalas on antibiotics that died versus those that survived or never received antibiotics. Using both machine learning and OTU (operational taxonomic unit co-occurrence network analyses, we found that OTUs that are very closely related to Lonepinella koalarum, a known tannin degrader found by culture-based methods to be present in koala intestines, was correlated with a koala’s health status. This is the first study to characterize the time course of effects of antibiotics on koala intestinal microbiomes. Our results suggest it may be useful to pursue alternative treatments for Chlamydia infections without the use of

  15. Epidemiology of chlamydial infection and disease in a free-ranging koala (Phascolarctos cinereus) population.

    Science.gov (United States)

    Nyari, Sharon; Waugh, Courtney A; Dong, Jianbao; Quigley, Bonnie L; Hanger, Jonathan; Loader, Joanne; Polkinghorne, Adam; Timms, Peter

    2017-01-01

    Chlamydial disease continues to be one of the main factors threatening the long-term survival of the koala (Phascolarctos cinereus). Despite this, large epidemiological studies of chlamydial infection and disease in wild koala populations are lacking. A better understanding of the prevalence, transmission and pathogenesis is needed to improve control measures, such as the development of vaccines. We investigated the prevalence of Chlamydia pecorum infection and disease in 160 koalas in a peri-urban wild population in Queensland, Australia and found that 31% of koalas were Chlamydia PCR positive and 28% had clinically detectable chlamydial disease. Most infections were at the urogenital site (27%; both males and females) with only 14% at the ocular site. Interestingly, we found that 27% (4/15) of koalas considered to be sexually immature (9-13 months) were already infected with C. pecorum, suggesting that a significant percentage of animals are infected directly from their mother. Ocular infection levels were less prevalent with increasing age (8% in koalas older than 4 years), whereas the prevalence of urogenital tract infections remained high into older age (26% in koalas older than 4 years), suggesting that, after mother-to-young transmission, C. pecorum is predominantly a sexually transmitted infection. While 28% of koalas in this population had clinically detectable chlamydial disease (primarily urogenital tract disease), many PCR positive koalas had no detectable disease and importantly, not all diseased animals were PCR positive. We also observed higher chlamydial loads in koalas who were C. pecorum infected without clinical disease than in koalas who were C. pecorum infected with clinical disease. These results shed light on the potential mechanisms of transmission of C. pecorum in koalas and also guide future control measures, such as vaccination.

  16. Phylogeography of the Koala, (Phascolarctos cinereus), and Harmonising Data to Inform Conservation.

    Science.gov (United States)

    Neaves, Linda E; Frankham, Greta J; Dennison, Siobhan; FitzGibbon, Sean; Flannagan, Cheyne; Gillett, Amber; Hynes, Emily; Handasyde, Kathrine; Helgen, Kristofer M; Tsangaras, Kyriakos; Greenwood, Alex D; Eldridge, Mark D B; Johnson, Rebecca N

    2016-01-01

    The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus), one of Australia's most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA) Control Region (CR) was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study). The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context.

  17. Phylogeography of the Koala, (Phascolarctos cinereus, and Harmonising Data to Inform Conservation.

    Directory of Open Access Journals (Sweden)

    Linda E Neaves

    Full Text Available The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus, one of Australia's most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA Control Region (CR was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study. The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context.

  18. Phylogeography of the Koala, (Phascolarctos cinereus), and Harmonising Data to Inform Conservation

    Science.gov (United States)

    Neaves, Linda E.; Frankham, Greta J.; Dennison, Siobhan; FitzGibbon, Sean; Flannagan, Cheyne; Gillett, Amber; Hynes, Emily; Handasyde, Kathrine; Helgen, Kristofer M.; Tsangaras, Kyriakos; Greenwood, Alex D.; Eldridge, Mark D. B.; Johnson, Rebecca N.

    2016-01-01

    The Australian continent exhibits complex biogeographic patterns but studies of the impacts of Pleistocene climatic oscillation on the mesic environments of the Southern Hemisphere are limited. The koala (Phascolarctos cinereus), one of Australia’s most iconic species, was historically widely distributed throughout much of eastern Australia but currently represents a complex conservation challenge. To better understand the challenges to koala genetic health, we assessed the phylogeographic history of the koala. Variation in the maternally inherited mitochondrial DNA (mtDNA) Control Region (CR) was examined in 662 koalas sampled throughout their distribution. In addition, koala CR haplotypes accessioned to Genbank were evaluated and consolidated. A total of 53 unique CR haplotypes have been isolated from koalas to date (including 15 haplotypes novel to this study). The relationships among koala CR haplotypes were indicative of a single Evolutionary Significant Unit and do not support the recognition of subspecies, but were separated into four weakly differentiated lineages which correspond to three geographic clusters: a central lineage, a southern lineage and two northern lineages co-occurring north of Brisbane. The three geographic clusters were separated by known Pleistocene biogeographic barriers: the Brisbane River Valley and Clarence River Valley, although there was evidence of mixing amongst clusters. While there is evidence for historical connectivity, current koala populations exhibit greater structure, suggesting habitat fragmentation may have restricted female-mediated gene flow. Since mtDNA data informs conservation planning, we provide a summary of existing CR haplotypes, standardise nomenclature and make recommendations for future studies to harmonise existing datasets. This holistic approach is critical to ensuring management is effective and small scale local population studies can be integrated into a wider species context. PMID:27588685

  19. Habitat Characteristics of Small-clawed Otter (Aonyx cinereus in Ujong Nga, Samatiga,West Aceh

    Directory of Open Access Journals (Sweden)

    Abdullah Abdullah

    2015-09-01

    Full Text Available Small-clawed otter (Aonyx cinereus is the smallest among the sub-family Lutrinae, today occurs population decrease of small-clawed otter caused by human activity, depletion of prey species, and exploitation. This research is done to learn physically and biologically of the habitat characteristic of small-clawed otter. Retrieval of data was held on 1-14 in April 2014. The parameters which used are the amount of tracks found in habitat that is used by the small-clawed otter in Ujong Nga village. The data is collected on small-clawed otter habitat in Ujong Nga and sample used are plot with measure of 30x30m and then  divided into 8 plots. The result showed that the small-clawed otter selecting habitat unit with criteria (a the type of habitat are field, swamp, thatch forest, and riverside; (b the availabilty of many feed (1,33 tracks per plot, rare (0,33 tracks per plot, less (0,17 tracks per plot; (c the tracks distance to the nest 0-25 m (1,66 tracks per plot, 25-50 m (1 tracks per plot, > 50 m (0,5 tracks per plot; (d the tracks distance to water source 0-25 m (2,16 tracks per plot, 25-50 m (0,5 tracks per plot, and for distance to > 50 m track is not found; and(e the tracks distance to toilet site0-25 m (1,16 tracks per plot, 25-50 m (0,5 tracks per plot, and> 50 m (0,17 tracks per plot. The conclusion of this research habitat characteristic ofAonyx cinereusare fieldwithavailability of many feed, close to water source, clost to nest, and close to toilet site.

  20. Phylogenetic relationships of the endangered Shenandoah salamander (Plethodon shenandoah) and other salamanders of the Plethodon cinereus group (Caudata : Plethodontidae)

    Science.gov (United States)

    Sites, J.W.; Morando, M.; Highton, R.; Huber, F.; Jung, R.E.

    2004-01-01

    The Shenandoah salamander (Plethodon shenandoah), known from isolated talus slopes on three of the highest mountains in Shenandoah National Park, is listed as state-endangered in Virginia and federally endangered under the U.S. Endangered Species Act. A 1999 paper by G. R. Thurow described P. shenandoah-like salamanders from three localities further south in the Blue Ridge Physiographic Province, which, if confirmed, would represent a range extension for P. shenandoah of approximately 90 km from its nearest known locality. Samples collected from two of these three localities were included in a molecular phylogenetic study of the known populations of P. shenandoah, and all other recognized species in the Plethodon cinereus group, using a 792 bp region of the mitochondrial cytochrome-b gene. Phylogenetic estimates were based on Bayesian, maximum likelihood, and maximum parsimony methods and topologies examined for placement of the new P. shenandoah-like samples relative to all others. All topologies recovered all haplotypes of the P. shenandoah-like animals nested within P. cinereus, and a statistical comparison of the best likelihood tree topology with one with an enforced (Thurow + Shenandoah P. shenandoah) clade revealed that the unconstrained tree had a significantly lower -In L score (P < 0.05, using the Shimodaira-Hasegawa test) than the constraint tree. This result and other anecdotal information give us no solid reason to consider the Thurow report valid. The current recovery program for P. shenandoah should remain focused on populations in Shenandoah National Park.

  1. Clinical significance and molecular characterization of nonsporulating molds isolated from the respiratory tracts of bronchopulmonary mycosis patients with special reference to basidiomycetes.

    Science.gov (United States)

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F; Chowdhary, Anuradha

    2013-10-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger subunit (LSU) of 52 NSMs isolated from respiratory specimens. The basidiomycetes were the predominant NSMs, of which Schizophyllum commune was the most common agent in allergic bronchopulmonary mycosis (ABPM), followed by Ceriporia lacerata in invasive fungal disease. Porostereum spadiceum, Phanaerochaete stereoides, Neosartorya fischeri, and Marasmiellus palmivorus were the other molds observed. Application of ITS and LSU region sequencing identified 92% of the isolates. The antifungal susceptibility data revealed that all basidiomycetes tested were susceptible to amphotericin B and resistant to caspofungin, fluconazole, and flucytosine. Except for 3 isolates of S. commune and a solitary isolate of M. palmivorus, all basidiomycetes had low MICs for itraconazole, posaconazole, and voriconazole. Basidiomycetes were isolated from patients with ABPM, invasive pulmonary mycosis/pneumonia, or fungal balls. In addition, the majority of the basidiomycetes were isolated from patients with chronic respiratory disorders who were sensitized to one of the basidiomycetous fungi and demonstrated precipitating antibodies against the incriminating fungi, indicating an indolent tissue reaction. Thus, isolation of basidiomycetes from the lower respiratory tract could be significant, and it is important to monitor these patients in order to prevent subsequent lung damage.

  2. Two cases of atopic cough successfully treated by oral cleansing with amphotericin B: Relationship with Basidiomycetes detected from pharyngeal swab

    Directory of Open Access Journals (Sweden)

    Haruhiko Ogawa

    2004-01-01

    Full Text Available We report herein two cases of atopic cough in which Basidiomycetes was detected from pharyngeal swabs and in which gargling with amphotericin B was efficacious. One case is a 38-year-old woman and the other is a 54-year-old woman. Both patients visited Ishikawa ken Saiseikai Kanazawa Hospital for the diagnosis and treatment of isolated severe non-productive cough. They did not have bronchial hyperresponsiveness to methacholine or heightened bronchomotor tone. Bronchodilator therapy was not effective for their coughing. Basidiomycetes was isolated from pharyngeal swabs in both cases. Oral cleansing with amphotericin B at 300 mg/day for approximately 2 weeks was effective in treating the severe coughs. This is the first report concerning the effectiveness of oral cleansing with amphotericin B for atopic cough, in which Basidiomycetes was detected from pharyngeal swabs.

  3. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. EFFECTS OF MICROELEMENTS ON THE CAROTENOID SYNTHESIS BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-08-01

    Full Text Available The effect of microelements on growth and accumulation of carotenoids highly productive strains of basidiomycetes at surface cultivation on glucose-peptone medium was investigated. The objects of research are 3 wood destroying strain. There are Laetiporus sulphureus (Bull. Murrill Ls-08, Fomes fomentarius (L. Fr. Ff-1201 from the order Polyporales and Fistulina hepatica (Schaeff. Sibth Fh-18 from the order Agaricales. Research materials are strains mycelium and culture filtrate (CF. Absolutely dry biomass (ADB mycelium was determined by the gravimetric method, the content of carotenoids was determined by spectrophotometric method in acetone extracts of the Vetshteyn formula. Established individual influence of microelements on the accumulation of biomass and carotenoids of basidiomycetes strains. The possibility of the regulation of these processes by introducing into the glucose-peptone medium of various Fe, Cu, Zn, Ni and Mn sulphate. So, the best to increase the intensity of the growth processes and the accumulation of carotenoids strain of L. sulphureus Ls-08 is an experimental environment which includes Zn sulfate in a concentration of 8 mmol/L. To induce the accumulation of ADB and carotenoids in the mycelium and CF of strain F fomentarius Ff-1201 making in is expedient Mn sulfate in a concentration of 1.6 mmol/L. To improve carotenogenesis of F. hepatica Fh-18 strain expedient entry in GPM Mn sulphate at concentration of 8 mmol/L. These allow to optimize the concentration of microelements in nutrient medium for the cultivation of carotenoids high-producing strains of Basidiomycetes.

  5. Unexpected diversity of basidiomycetous endophytes in sapwood and leaves of Hevea.

    Science.gov (United States)

    Martin, Rachael; Gazis, Romina; Skaltsas, Demetra; Chaverri, Priscila; Hibbett, David

    2015-01-01

    Research on fungal endophytes has expanded dramatically in recent years, but little is known about the diversity and ecological roles of endophytic basidiomycetes. Here we report the analysis of 310 basidiomycetous endophytes isolated from wild and planted populations of the rubber tree genus, Hevea. Species accumulation curves were nonasymptotic, as in the majority of endophyte surveys, indicating that more sampling is needed to recover the true diversity of the community. One hundred eighteen OTUs were delimited, representing nine orders of Basidiomycota (Agaricales, Atheliales, Auriculariales, Cantharellales, Hymenochaetales, Polyporales, Russulales, Septobasidiales, Tremellales). The diversity of basidiomycetous endophytes found inhabiting wild populations of Hevea was comparable to that present in plantations. However, when samples were segregated by tissue type, sapwood of wild populations was found to contain a higher number of species than sapwood of planted trees. Seventy-five percent of isolates were members of the Polyporales, the majority in the phlebioid clade. Most of the species belong to clades known to cause a white-rot type of wood decay. Two species in the insect-associated genus Septobasidium were isolated. The most frequently isolated genera included Bjerkandera, Ceriporia, Phanerochaete, Phlebia, Rigidoporus, Tinctoporellus, Trametes (Polyporales), Peniophora, Stereum (Russulales) and Coprinellus (Agaricales), all of which have been reported as endophytes from a variety of hosts, across wide geographic locations. Literature records on the geographic distribution and host association of these genera revealed that their distribution and substrate affinity could be extended if the endophytic niche was investigated as part of fungal biodiversity surveys. © 2015 by The Mycological Society of America.

  6. [A new species of psychrophilic basidiomycetes yeast Leucosporidium fasciculatum sp. Nov].

    Science.gov (United States)

    Bab'eva, I P; Lisichkina, G A

    2000-01-01

    A psychrophilic yeast with a basidiomycetous developmental cycle and properties corresponding to the genus Leucosporidium Fell et al. was isolated from the fruiting body of the edible spring mushroom Gyromitra esculenta Pers. picked near Moscow. However, the isolate differed from all Leucosporidium species described to date in a number of characteristics. The results of the study of the developmental cycle and of the cultural, morphological, physiological, and biochemical properties of the new isolate, strain KBP Y-3696, allow it to be assigned to a new species of the genus Leucosporidium.

  7. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  8. Fragmentation of human IgG by a new protease isolated from the basidiomycete Armillaria mellea.

    Science.gov (United States)

    Hunneyball, I M; Stanworth, D R

    1975-01-01

    Digestion of human IgG by a new lysine-specific protease, isolated from the basidiomycete Armillaria mellea, produced Fc and Fab fragments similar to those produced by papain digestion of the same molecule. Digestion appeared to be restricted to a single cleavage point within the hinge region of the IgG molecule. Myeloma proteins of IgG1, IgG3 and IgG4 subclasses were found to be digested at an extremely rapid rate whereas IgG2 myeloma proteins appeared to be resistant to digestion by this enzyme. Images FIG. 2 FIG. 6 PMID:1201861

  9. Aethiopinolones A–E, New Pregnenolone Type Steroids from the East African Basidiomycete Fomitiporia aethiopica

    Directory of Open Access Journals (Sweden)

    Clara Chepkirui

    2018-02-01

    Full Text Available A mycelial culture of the Kenyan basidiomycete Fomitiporia aethiopica was fermented on rice and the cultures were extracted with methanol. Subsequent HPLC profiling and preparative chromatography of its crude extract led to the isolation of five previously undescribed pregnenolone type triterpenes 1–5, for which we propose the trivial name aethiopinolones A–E. The chemical structures of the aethiopinolones were determined by extensive 1D- and 2D-NMR, and HRMS data analysis. The compounds exhibited moderate cytotoxic effects against various human cancer cell lines, but they were found devoid of significant nematicidal and antimicrobial activities.

  10. Role of plants in the vegetative and reproductive growth of saprobic basidiomycetous ground fungi.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2008-11-01

    Non-symbiotic microorganisms engineered or expensively selected to degrade xenobiotic hydrocarbons or modify heavy-metal uptake of plants in soil remediations die back after their introduction into the target soils. Mycelia of saprobic basidiomycetes were therefore inoculated into soil samples of 1 l in glass vessels to record mycelial growth and reproduction in the immediate rhizosphere of up to 11 herbaceous plant species, or to study their responses to the separate volatiles from whole plant swards or their root balls whose emanations had been collected in 1.5-l plastic bags fixed to the glass vessels. Excess CO2 was controlled with NaOH solution. Volatiles from root balls of parsley and pea but not wheat, from unplanted soils, from the fungus-permeated, unplanted substrate soil itself, and from the rooting soil of whole wheat sward increased mycelial densities in Clitocybe sp. more than in Agaricus macrocarpus and indicated thus a higher nutrient state of the mycelia. Organic volatiles proved therefore to be a significant carbon source for certain basidiomycetes in poor natural soils. The contemporary decline in the number of basidiocarp initials to 0 to 36% in both fungi relative to the unplanted and aerated controls was caused by volatiles from rooted and unplanted soil and pointed thus to their ecological role as antibiotics, fumigants, toxins, and hormonal compounds. Aqueous extracts from root balls of wheat stimulated mycelial density and fruiting in A. macrocarpus contemporarily because of their contents in soil-derived macronutrients. They suppressed once more fruiting in the more sensitive Clitocybe sp. by active agents in the aqueous phase. Within plant rhizospheres, densities of Clitocybe sp. mycelia were stimulated in the presence of alfalfa, carrot, red clover, ryegrass, and spinach, whereas those of A. macrocarpus were halved by 7 of 10 plant species including alfalfa, red clover, ryegrass, and spinach. Mycelia of A. macrocarpus may thereby have

  11. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  12. A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity.

    Science.gov (United States)

    Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J; Eldridge, Mark D B; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N; Timms, Peter

    2014-09-11

    The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. RNA-Seq data was generated from a range of tissues from one male and one female koala and assembled de novo into transcripts using Velvet-Oases. Transcript abundance in each tissue was estimated. Transcripts were searched for likely protein-coding regions and a non-redundant set of 117,563 putative protein sequences was produced. In similarity searches there were 84,907 (72%) sequences that aligned to at least one sequence in the NCBI nr protein database. The best alignments were to sequences from other marsupials. After applying a reciprocal best hit requirement of koala sequences to those from tammar wallaby, Tasmanian devil and the gray short-tailed opossum, we estimate that our transcriptome dataset represents approximately 15,000 koala genes. The marsupial alignment information was used to look for potential gene duplications and we report evidence for copy number expansion of the alpha amylase gene, and of an aldehyde reductase gene.Koala retrovirus (KoRV) transcripts were detected in the transcriptomes. These were analysed in detail and the structure of the spliced envelope gene transcript was determined. There was appreciable sequence diversity within KoRV, with 233 sites in the KoRV genome showing small insertions/deletions or single nucleotide polymorphisms. Both koalas had sequences from the KoRV-A subtype, but the male koala transcriptome has, in addition, sequences more closely related to the KoRV-B subtype. This is the first report of a KoRV-B-like sequence in a wild population. This transcriptomic

  13. Non-invasive evaluation of physiological stress in an iconic Australian marsupial: the Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Narayan, Edward J; Webster, Koa; Nicolson, Vere; Mucci, Al; Hero, Jean-Marc

    2013-06-15

    Koalas (Phascolarctos cinereus) are the only extant representatives of Australia's unique marsupial family Phascolarctidae and were listed as nationally Vulnerable in 2012. Causes of mortality are diverse, although the disease chlamydiosis, dog attacks, collisions with cars, and loss of habitat represent the principal reasons for the continued species decline. Koala breeding facilities in Queensland and New South Wales, Australia have been established for conservation and tourism. Non-invasive monitoring of physiological stress is important for determining the sub-lethal effects of environmental stressors on the well-being, reproduction and survival of Koalas in Zoos and also in the wild. In this study, we developed a faecal cortisol metabolite (FCM) enzyme-immunoassay (EIA) for monitoring physiological stress in Koalas from two established Zoos in Australia and also within a free-living sub-population from Queensland. Biological validation of the FCM EIA was done using an adrenocorticotropic hormone (ACTH) challenge. We discovered excretory lag-times of FCM of 24 h in females (n=2) and 48 h in male (n=2) Koalas in response to the ACTH challenge. FCM levels showed an episodic and delayed peak response lasting up to 9 days post ACTH challenge. This finding should be taken into consideration when designing future experiments to study the impacts of short-term (acute) and chronic stressors on the Koalas. Laboratory validations were done using parallelism and recovery checks (extraction efficiency) of the cortisol standard against pooled Koala faecal extracts. Greater than 99% recovery of the cortisol standard was obtained as well as a parallel displacement curve against Koala faecal extracts. FCM levels of the captive Koalas (n=10 males and 13 females) significantly differed by sex, reproductive condition (lactating versus non-lactating Koalas) and the handling groups. Handled male Koalas had 200% higher FCM levels than their non-handled counterparts, while females

  14. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  15. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  16. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  17. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2014-04-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose.

  18. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions.

  19. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol.

  20. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  1. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  2. Sex differences in the thermoregulation and evaporative water loss of a heterothermic bat, Lasiurus cinereus, during its spring migration

    Science.gov (United States)

    Cryan, P.M.; Wolf, B. O.

    2003-01-01

    This study quantifies sex differences in thermoregulation and water loss of a small (20-35 g) insectivorous heterothermic mammal, the hoary bat Lasiurus cinereus, during its spring migration. We measured body temperature, metabolic rate and evaporative water loss, and calculated wet thermal conductance, for bats exposed to air temperatures ranging from 0 to 40°C for periods of 2-5 h. Pregnant females maintained normothermic body temperatures (35.7±0.7°C; mean ± s.e.m.) independent of air temperature. In contrast, males became torpid during the majority (68%) of exposures to air temperatures thermal neutral zone (TNZ) ranged between approximately 30°C and 34°C in both sexes and, within the TNZ, females had lower mass-specific metabolic rates (6.1±0.2 mW g-1) than males (9.0±0.9 mW g-1). Wet thermal conductance values in torpid bats (0.7±0.5 mW g-1 deg.-1) were lower than those of normothermic individuals (1.1±0.3 mW g-1 deg.-1). Mass-specific rates of evaporative water loss in males were consistently higher than in females at most air temperatures and rates of water loss in torpid bats were 63±6% of normothermic values. These results suggest that male and pregnant female L. cinereus employ different thermoregulatory strategies during their spring migration. Females defend normothermic body temperatures, presumably to expedite embryonic growth, while males use torpor, presumably to minimize energy and water deficits. These variable thermoregulatory strategies may reflect continental differences in the summer distribution of the sexes.

  3. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  4. Cloning and expression of koala (Phascolarctos cinereus) liver cytochrome P450 CYP4A15.

    Science.gov (United States)

    Ngo, Suong Ngoc Thi; McKinnon, Ross Allan; Stupans, Ieva

    2006-07-05

    In the present study, the cloning, expression and characterization of hepatic cytochrome P450 (CYP) CYP4A from koala (Phascolarctos cinereus), an obligate eucalyptus feeder, is described. It has been previously reported that microsomal lauric acid hydroxylase activity (a CYP4A marker) and CYP content were higher in koala liver in comparison to that in human, rat or wallaby, species that do not ingest eucalyptus leaves as food [Ngo, S., Kong, S., Kirlich, A., Mckinnon, R.A., Stupans, I., 2000. Cytochrome P450 4A, peroxisomal enzymes and nicotinamide cofactors in koala liver. Comp. Biochem. Physiol., C 127, 327-334]. A 1544 bp koala liver CYP4A cDNA, designated CYP4A15, was cloned by reverse transcription-polymerase chain reaction and rapid amplification of cDNA ends. The koala CYP4A15 cDNA encodes a protein of 500 amino acids and shares 69% nucleotide and 65% amino acid sequence identity to human CYP4A11. Transfection of the koala CYP4A15 cDNA into Cos-7 cells resulted in the expression of a protein with lauric acid hydroxylase activity. The koala CYP4A15 cDNA-expressed enzyme catalysed lauric acid hydroxylation at the rates of 0.45+/-0.18 nmol/min/mg protein and 4.79+/-1.91 nmol/min/nmol CYP (mean+/-SD, n=3), which were comparable to that of rat CYP4A subfamilies. Total CYP content for koala CYP4A15-expressed protein in Cos-7 cells was 0.094+/-0.001 nmol/mg protein (mean+/-SD, n=3) with negligible CYP content in untransfected Cos-7 cells lysate. Immunoblot analysis, using a sheep anti-rat CYP4A polyclonal antibody, detected multiple CYP4A immunoreactive bands in the liver from all species studied. The koala bands were found to be fainter and less confined but appeared much broader as compared to rat, human and wallaby. Northern blot analysis, utilising the koala CYP4A15 cDNA 417 bp probe, detected a mRNA species of approximately 2.6 kb in the koala liver and a mRNA species of approximately 2.4 kb in other species studied. Relative to the intensity of the beta

  5. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  6. Miscellaneous lanostane triterpenoids with cytotoxicities from fruiting bodies of the basidiomycete Stereum sp.

    Science.gov (United States)

    Yao, Jian-Neng; Chen, Lin; Chen, He-Ping; Zhao, Zhen-Zhu; Zhang, Shuai-Bing; Huang, Ying; Tang, Yang; Isaka, Masahiko; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2018-03-01

    Ten new highly oxygenated lanostane triterpenoids, stereinones A-J (1-10), were isolated from the fruiting bodies of the basidiomycete Stereum sp. Compounds 3 and 4 are structurally characterized as intact lanostane-type triterpenoids containing unusual 1,2-diketone functionality at C-11 and C-12, while compound 10 is a 24-methylene-lanostane. The structures of these new compounds were established based on detailed 1D and 2D NMR spectroscopic analyses, along with quantum chemical NMR calculations. All isolates were evaluated for their in vitro cytotoxicities against five human tumor cell lines (including HL-60, A-549, SMMC-7721, MCF-7, and SW480 cell lines). Compound 4 showed moderate cytotoxic activities against tumor cell lines SMMC-7721 and SW480 with IC 50 values of 9.1 and 9.8μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Cloning and Sequence Analysis of the Cellobiohydrolase I Genes from Some Basidiomycetes

    Science.gov (United States)

    Maharachchikumbura, Sajeewa S. N.; Wongkham, Shannaphimon; Sysouphanthong, Phongeun; Phookamsak, Rungtiwa; Hyde, Kevin D.

    2012-01-01

    Genes encoding the cellobiohydrolase enzyme (CBHI), designated as cbhI, were isolated from the basidiomycetes Auricularia fuscosuccinea, Pleurotus giganteus, P. eryngii, P. ostreatus, and P. sajor-caju. Initially, the fungal genomic DNA was extracted using a modified cetyltrimethyl ammonium bromide (CTAB) protocol and used as a DNA template. The cbhI genes were then amplified and cloned using the pGEM-T Easy Vector Systems. The sizes of these PCR amplicons were between 700~800 bp. The DNA sequences obtained were similar showing high identity to the cbhI gene family. These cbhI genes were partial consisting of three coding regions and two introns. The deduced amino acid sequences exhibited significant similarity to those of fungal CBHI enzymes belonging to glycosyl hydrolase family 7. PMID:22870052

  8. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  9. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  10. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  11. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  12. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  13. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    OpenAIRE

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2006-01-01

    Applied and Environmental Microbiology, Vol. 73, No.4 Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with ...

  14. Leaf extracts of Casearia sylvestris and Casearia decandra affect growth and production of ligninolytic enzymes in wood decay basidiomycetes

    OpenAIRE

    Bento, Thiara Siqueira; Torres, Luce Maria Brandão; Fialho, Mauricio Batista; Bononi, Vera Lúcia Ramos

    2016-01-01

    ABSTRACT White-rot basidiomycetes are able to deteriorate wood products and be pathogenic to living trees, requiring, thus requiring control. The tropical flora is an important source of eco-friendly antifungal compounds; however, the knowledge on how leaf extracts affect the fungal physiology is limited. Therefore, in the present work we investigated the influence of ethanolic leaf extracts of Casearia sylvestris and C. decandra at 0.1 mg mL-1 on the production of ligninolytic enzymes by Tra...

  15. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids

    OpenAIRE

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P.?antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P.?antarctica for industri...

  16. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-04-04

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications.

  17. VOLATILE COMPOUNDS IN THE AROMA OF THREE SPECIES OF WOOD-ROTTING BASIDIOMYCETES AND THEIR ANTIFUNGAL POTENTIAL

    OpenAIRE

    Cristiana Virginia PETRE; Alin Constantin DÎRȚU; Marius NICULAUA; Cătălin TĂNASE

    2017-01-01

    This study aims to determine the volatile organic compounds synthesized by three species of wood-rotting basidiomycetes: Coriolopsis gallica, Megacollybia platyphylla and Lentinus arcularius and test their antifungal potential. The species were cultivated on liquid media and kept for 25 days at 25 °C. The surface cultures were then homogenized, filtrated and extracted using solid-phase extraction and analyzed by GC-MS. The volatile compounds identified were mainly alcohols, ketones, aldehydes...

  18. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  19. Is the modern koala ( Phascolarctos cinereus) a derived dwarf of a Pleistocene giant? Implications for testing megafauna extinction hypotheses

    Science.gov (United States)

    Price, Gilbert J.

    2008-12-01

    The modern Australian koala ( Phascolarctos cinereus) is commonly regarded as a dwarf descendent of a Late Pleistocene giant koala ( Ph. stirtoni). The implication of that hypothesis is that the giant koala survived the Late Pleistocene megafaunal extinction "event", albeit as a smaller body-sized form. It is important to be able to constrain rates of Late Pleistocene faunal turnover, an aspect reliant on having accurate taxonomic information of extinct species. The koala dwarfing hypothesis is tested here by using a temporally-constrained biogeographical record of fossil koalas, and a morphological character analysis. The contemporary occurrence of both taxa in pre-Late Pleistocene deposits and significant differences in dental morphologies between those forms suggests that the modern koala is not a derived dwarf of the Pleistocene giant koala. Thus, the giant-form was among a number of other giant mammals, lizards and birds that suffered extinction sometime during the Late Pleistocene. The potential phenomenon of dwarfing of other Late Pleistocene and Recent faunas, such as grey kangaroos, is commonly used as a test for or against various megafaunal extinction hypotheses. However, the results of this study also demonstrate that the dwarfing hypothesis has not been adequately tested for a suite of other taxa. Thus, until the dwarfing hypothesis can be more fully tested, a clear understanding of the fate of Late Pleistocene faunas that apparently survived the extinction "event", and the origins of many extant forms will remain elusive.

  20. Hepatic cytochrome P450 enzymes belonging to the CYP2C subfamily from an Australian marsupial, the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Jones, Brett R; El-Merhibi, Adaweyah; Ngo, Suong N T; Stupans, Ieva; McKinnon, Ross A

    2008-09-01

    Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of xenobiotics and endogenous substrates. We have previously reported that the obligate Eucalyptus feeder koala (Phascolarctos cinereus) exhibits a higher hepatic CYP2C activity as compared to non-Eucalyptus feeders human or rat, with stimulation of CYP2C activity by cineole. In the present study, we examine CYP2C expression by immunohistochemistry and describe the identification and cloning of koala CYP2Cs. Utilising anti-rat CYP2C6 antibody, the expression of CYP2C was found to be uniform across the hepatic sections, being consistent with that observed in human and rat. Two 1647 and 1638 bp koala liver CYP2C complete cDNAs, designated CYP2C47 and CYP2C48 respectively, were cloned by cDNA library screening. The koala CYP2C cDNAs encode a protein of 495 amino acids. Three additional partial CYP2C sequences were also identified from the koala, indicating the multiplicity of the CYP2C subfamily in this unique marsupial species. The results of this study demonstrate the presence of koala hepatic CYP2Cs that share several common features with other published CYP2Cs; however CYP2C47 and CYP2C48 contain four extra amino acid residues at the NH2-terminal, a transmembrane anchor which was reported being a fundamentally conserved structure core of all eukaryote CYP enzymes.

  1. Auditory sensitivity of Hawaiian moths (Lepidoptera: Noctuidae) and selective predation by the Hawaiian hoary bat (Chiroptera: Lasiurus cinereus semotus).

    Science.gov (United States)

    Fullard, J. H.

    2001-01-01

    The islands of Hawai'i offer a unique opportunity for studying the auditory ecology of moths and bats since this habitat has a single species of bat, the Hawaiian hoary bat (Lasiurus cinereus semotus), which exerts the entire predatory selection pressure on the ears of sympatric moths. I compared the moth wings discarded by foraging bats with the number of surviving moths on the island of Kaua'i and concluded that the endemic noctuid Haliophyle euclidias is more heavily preyed upon than similar-sized endemic (e.g. Agrotis diplosticta) and adventive (Agrotis ipsilon and Pseudaletia unipuncta) species. Electrophysiological examinations indicated that, compared with species less preyed upon, H. euclidias has lower auditory sensitivities to the bat's social and echolocation calls, which will result in shorter detection distances of the bat. The poor ears of H. euclidias suggest that this moth coevolved with the bat using non-auditory defences that resulted in auditory degeneration. This moth now suffers higher predation because it is drawn away from its normal habitat by the man-made lights that are exploited by the bat. PMID:11429137

  2. Dim ultraviolet light as a means of deterring activity by the Hawaiian hoary bat Lasiurus cinereus semotus

    Science.gov (United States)

    Gorresen, P. Marcos; Cryan, Paul M.; Dalton, David C.; Wolf, Sandy; Johnson, Jessica A.; Todd, Christopher M.; Bonaccorso, Frank J.

    2015-01-01

    Widespread bat fatalities at industrial wind turbines are a conservation issue with the potential to inhibit efficient use of an abundant source of energy. Bat fatalities can be reduced by altering turbine operations, but such curtailment decreases turbine efficiency. If additional ways of reducing bat fatalities at wind turbines were available such tradeoffs might not be needed. Based on the facts that bats perceive distant objects primarily through vision and can see in very dim lighting conditions, and the possibility that bats might interact with turbines after approaching them as they would trees, we propose a novel method of reducing bat activity at wind turbines: illumination of the structure with dim light. As a first step toward assessing this approach, we illuminated trees with dim flickering ultraviolet (UV) light in areas frequented by Hawaiian hoary bats Lasiurus cinereus semotus, an endangered subspecies affected by wind turbines. We used a repeated-measures design to quantify bat activity near trees with acoustic detectors and thermal video cameras in the presence and absence of UV illumination, while concurrently monitoring insect numbers. Results indicate that dim UV reduces bat activity despite an increase in insect numbers. Experimental treatment did not completely inhibit bat activity near trees, nor did all measures of bat activity show statistically significant differences due to high variance in bat activity among sites. However, the observed decreases in bat activity with dim UV illumination justify further testing of this method as a means to reduce bat fatalities at wind turbines.

  3. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  4. Kojic acid-mediated damage responses induce mycelial regeneration in the basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available Mechanical damage can induce fruiting body production in fungi. In this study, the antioxidant kojic acid (KA was found to enhance injured mycelial regeneration and increase fruiting body production in Hypsizygus marmoreus. KA reduced the level of reactive oxygen species (ROS, which are harmful to mycelia when excessively generated by mechanical damage. Moreover, KA increased catalase and superoxide dismutase activities and glutathione and ascorbic acid contents by up-regulating antioxidant gene expression. These results suggest that KA promotes mycelial regeneration in response to damage by activating a "stress signal" and enhances the ability of H. marmoreus to resist oxidative damage by invoking the antioxidant system. In addition, KA increased the content of extracellular ATP, which serves as a "stress signal" in response to injury, and modulated ROS signaling, decreasing NADPH oxidase gene expression and ROS levels in the mycelial-regeneration stage. KA treatment also up-regulated the MAPK, Ca2+ and oxylipin pathways, suggesting their involvement in the damage response. Furthermore, laccase and cellulase activities were stimulated by KA at different developmental stages. These results demonstrate that KA regulates gene expression and activates pathways for mycelial wound healing, regeneration of damaged mycelia and reproductive structure formation in the basidiomycete H. marmoreus.

  5. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively.

  6. Veratryl alcohol oxidases from the lignin-degrading basidiomycete Pleurotus sajor-caju.

    Science.gov (United States)

    Bourbonnais, R; Paice, M G

    1988-01-01

    The basidiomycete Pleurotus sajor-caju mineralizes ring-14C-labelled lignin (dehydrogenative polymer) when grown in mycological broth. Under these conditions, two veratryl alcohol oxidase (VAO) enzymes were found in the culture medium. They oxidized a number of aromatic alcohols to aldehydes and reduced O2 to H2O2. The enzymes were purified by ion-exchange and gel-permeation chromatography. The final step of purification on Mono Q resolved the activity into two peaks (VAO I and VAO II). Both enzymes had the same Mr, approx. 71,000, but their isoelectric points differed slightly, 3.8 for VAO I and 4.0 for VAO II. Their amino acid compositions were similar except for aspartic acid/asparagine and glycine. Both enzymes are glycoproteins and contain flavin prosthetic groups. Their pH optima were around 5, and kinetic constants and specificities were similar. 4-Methoxybenzyl alcohol was oxidized the most rapidly, followed by veratryl alcohol. Not all aromatic alcohols were oxidized, neither were non-aromatic alcohols. Cinnamyl alcohol was oxidized at the gamma position. The VAO enzymes thus represent a significantly different route for veratryl alcohol oxidation from that catalysed by the previously found lignin peroxidases from Phanerochaete chrysosporium. The role of the oxidases in biodegradation might be to produce H2O2 during oxidation of lignin fragments. Images Fig. 3. PMID:3060110

  7. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site.

  8. Therapeutic effects of substances occurring in higher Basidiomycetes mushrooms: a modern perspective.

    Science.gov (United States)

    Wasser, S P; Weis, A L

    1999-01-01

    This review highlights some of the recently isolated and identified substances of higher Basidiomycetes mushrooms origin that express promising antitumor, immune modulating, cardiovascular and hypercholesterolemia, antiviral, antibacterial, and antiparasitic effects. Medicinal mushrooms have a long history of use in folk medicine. In particular, mushrooms useful against cancers of the stomach, esophagus, lungs, etc. are known in China, Russia, Japan, Korea, as well as the U.S.A. and Canada. There are about 200 species of mushrooms that have been found to markedly inhibit the growth of different kinds of tumors. Searching for new antitumor and other medicinal substances from mushrooms and to study the medicinal value of these mushrooms have become a matter of great significance. However, most of the mushroom origin antitumor substances have not been clearly defined. Several antitumor polysaccharides such as hetero-beta-glucans and their protein complexes (e.g., xyloglucans and acidic beta-glucan-containing uronic acid), as well as dietary fibers, lectins, and terpenoids have been isolated from medicinal mushrooms. In Japan, Russia, China, and the U.S.A. several different polysaccharide antitumor agents have been developed from the fruiting body, mycelia, and culture medium of various medicinal mushrooms (Lentinus edodes, Ganoderma lucidum, Schizophyllum commune, Trametes versicolor, Inonotus obliquus, and Flammulina velutipes). Both cellular components and secondary metabolites of a large number of mushrooms have been shown to effect the immune system of the host and therefore could be used to treat a variety of disease states.

  9. Indole-3-acetic acid biosynthetic pathways in the basidiomycetous yeast Rhodosporidium paludigenum.

    Science.gov (United States)

    Nutaratat, Pumin; Srisuk, Nantana; Arunrattiyakorn, Panarat; Limtong, Savitree

    2016-07-01

    Microorganisms produce plant growth regulators, such as auxins, cytokinins and gibberellins, to promote plant growth. Auxins are a group of compounds with an indole ring that have a positive effect on plant growth. Indole-3-acetic acid (IAA) is a plant growth hormone classified as an indole derivative of the auxin family. IAA biosynthesis pathways have been reported and widely studied in several groups of bacteria. Only a few studies on IAA biosynthesis pathways have been conducted in yeast. This study aimed to investigate IAA biosynthesis pathways in a basidiomycetous yeast (Rhodosporidium paludigenum DMKU-RP301). Investigations were performed both with and without a tryptophan supplement. Indole compound intermediates were detected by gas chromatography-mass spectrometry. Indole-3-lactic acid and indole-3-ethanol were found as a result of the enzymatic reduction of indole-3-pyruvic acid and indole-3-acetaldehyde, in IAA biosynthesis via an indole-3-pyruvic acid pathway. In addition, we also found indole-3-pyruvic acid in culture supernatants determined by high-performance liquid chromatography. Identification of tryptophan aminotransferase activity supports indole-3-pyruvic acid-routed IAA biosynthesis in R. paludigenum DMKU-RP301. We hence concluded that R. paludigenum DMKU-RP301 produces IAA through an indole-3-pyruvic acid pathway.

  10. Genetic diversity of ectomycorrhizal Basidiomycetes from African and Indian tropical rain forests.

    Science.gov (United States)

    Riviere, Taiana; Diedhiou, Abdallah G; Diabate, Moussa; Senthilarasu, G; Natarajan, K; Verbeken, Annemieke; Buyck, Bart; Dreyfus, Bernard; Bena, Gilles; Ba, Amadou M

    2007-07-01

    Ectomycorrhizal (ECM) fungi have a worldwide distribution. However, the ecology of tropical ECM fungi is poorly documented, limiting our understanding of the symbiotic associations between tropical plants and fungi. ECM Basidiomycete diversity was investigated for the first time in two tropical rain forests in Africa (Western Upper Guinea) and in Asia (Western Ghats, India), using a fragment of the mitochondrial large subunit rRNA gene to type 140 sporocarps and 54 ectomycorrhizas. To evaluate taxonomic diversity, phylogenetic analyses were performed, and 40 sequences included from identified European specimens were used as taxonomic benchmarks. Five clades were recovered corresponding to six taxonomic groups: boletoids, sclerodermatoids, russuloids, thelephoroids, and a clade grouping the Amanitaceae and Tricholomataceae families. Our results revealed that the Russulaceae species display a great diversity with several putative new species, especially in Guinea. Other taxonomic issues at family/section levels are also briefly discussed. This study provides preliminary insights into taxonomic diversity, ECM status, and biogeographic patterns of ECM fungi in tropical two rain forest ecosystems, which appear to be as diverse as in temperate and boreal forests.

  11. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. Copyright © 2012 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  12. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  13. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  14. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs.

  15. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis.

  16. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  17. Potential citric acid exposure and toxicity to Hawaiian hoary bats (Lasiurus cinereus semotus) associated with Eleutherodactylus frog control.

    Science.gov (United States)

    Pitt, William C; Witmer, Gary W; Jojola, Susan M; Sin, Hans

    2014-04-01

    We examined potential exposure of Hawaiian hoary bats (Lasiurus cinereus semotus) to citric acid, a minimum risk pesticide registered for control of invasive Eleutherodactylus frog populations. Hoary bats are nocturnal insectivores that roost solitarily in foliage, federally listed as endangered, and are endemic to Hawaii. Oral ingestion during grooming of contaminated fur appears to be the principal route by which these bats might be exposed to citric acid. We made assessments of oral toxicity, citric acid consumption, retention of material on fur, and grooming using big brown bats (Eptesicus fuscus) as a surrogate species. We evaluated both ground application and aerial application of 16 % solutions of citric acid during frog control operations. Absorbent bat effigies exposed to ground and aerial operational spray applications retained means of 1.54 and 0.02 g, respectively, of dry citric acid, although retention by the effigies was much higher than bat carcasses drenched in citric acid solutions. A high dose delivered orally (2,811 mg/kg) was toxic to the big brown bats and emesis occurred in 1 bat dosed as low as the 759 mg/kg level. No effect was observed with the lower doses examined (≤ 542 mg/kg). Bats sprayed with 5 ml of 16 % (w/w) citric acid solution showed no evidence of intoxication. In field situations, it is unlikely that bats would be sprayed directly or ingest much citric acid retained by fur. Based on our observations, we believe Hawaiian hoary bats to be at very low risk from harmful exposure to a toxic dose of citric acid during frog control operations.

  18. Preliminary characterisation of tumor necrosis factor alpha and interleukin-10 responses to Chlamydia pecorum infection in the koala (Phascolarctos cinereus.

    Directory of Open Access Journals (Sweden)

    Marina Mathew

    Full Text Available Debilitating infectious diseases caused by Chlamydia are major contributors to the decline of Australia's iconic native marsupial species, the koala (Phascolarctos cinereus. An understanding of koala chlamydial disease pathogenesis and the development of effective strategies to control infections continue to be hindered by an almost complete lack of species-specific immunological reagents. The cell-mediated immune response has been shown to play an influential role in the response to chlamydial infection in other hosts. The objective of this study, hence, was to provide preliminary data on the role of two key cytokines, pro-inflammatory tumour necrosis factor alpha (TNFα and anti-inflammatory interleukin 10 (IL10, in the koala Chlamydia pecorum response. Utilising sequence homology between the cytokine sequences obtained from several recently sequenced marsupial genomes, this report describes the first mRNA sequences of any koala cytokine and the development of koala specific TNFα and IL10 real-time PCR assays to measure the expression of these genes from koala samples. In preliminary studies comparing wild koalas with overt chlamydial disease, previous evidence of C. pecorum infection or no signs of C. pecorum infection, we revealed strong but variable expression of TNFα and IL10 in wild koalas with current signs of chlamydiosis. The description of these assays and the preliminary data on the cell-mediated immune response of koalas to chlamydial infection paves the way for future studies characterising the koala immune response to a range of its pathogens while providing reagents to assist with measuring the efficacy of ongoing attempts to develop a koala chlamydial vaccine.

  19. Preliminary characterisation of tumor necrosis factor alpha and interleukin-10 responses to Chlamydia pecorum infection in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mathew, Marina; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-01-01

    Debilitating infectious diseases caused by Chlamydia are major contributors to the decline of Australia's iconic native marsupial species, the koala (Phascolarctos cinereus). An understanding of koala chlamydial disease pathogenesis and the development of effective strategies to control infections continue to be hindered by an almost complete lack of species-specific immunological reagents. The cell-mediated immune response has been shown to play an influential role in the response to chlamydial infection in other hosts. The objective of this study, hence, was to provide preliminary data on the role of two key cytokines, pro-inflammatory tumour necrosis factor alpha (TNFα) and anti-inflammatory interleukin 10 (IL10), in the koala Chlamydia pecorum response. Utilising sequence homology between the cytokine sequences obtained from several recently sequenced marsupial genomes, this report describes the first mRNA sequences of any koala cytokine and the development of koala specific TNFα and IL10 real-time PCR assays to measure the expression of these genes from koala samples. In preliminary studies comparing wild koalas with overt chlamydial disease, previous evidence of C. pecorum infection or no signs of C. pecorum infection, we revealed strong but variable expression of TNFα and IL10 in wild koalas with current signs of chlamydiosis. The description of these assays and the preliminary data on the cell-mediated immune response of koalas to chlamydial infection paves the way for future studies characterising the koala immune response to a range of its pathogens while providing reagents to assist with measuring the efficacy of ongoing attempts to develop a koala chlamydial vaccine.

  20. Interleukin 17A is an immune marker for chlamydial disease severity and pathogenesis in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Mathew, Marina; Waugh, Courtney; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2014-10-01

    The koala (Phascolarctos cinereus) is an iconic Australian marsupial species that is facing many threats to its survival. Chlamydia pecorum infections are a significant contributor to this ongoing decline. A major limiting factor in our ability to manage and control chlamydial disease in koalas is a limited understanding of the koala's cell-mediated immune response to infections by this bacterial pathogen. To identify immunological markers associated with chlamydial infection and disease in koalas, we used koala-specific Quantitative Real Time PCR (qrtPCR) assays to profile the cytokine responses of Peripheral Blood Mononuclear Cells (PBMCs) collected from 41 koalas with different stages of chlamydial disease. Target cytokines included the principal Th1 (Interferon gamma; IFNγ), Th2 (Interleukin 10; IL10), and pro-inflammatory cytokines (Tumor Necrosis Factor alpha; TNFα). A novel koala-specific IL17A qrtPCR assay was also developed as part of this study to quantitate the gene expression of this Th17 cytokine in koalas. A statistically significant higher IL17A gene expression was observed in animals with current chlamydial disease compared to animals with asymptomatic chlamydial infection. A modest up-regulation of pro-inflammatory cytokines, such as TNFα and IFNγ, was also observed in these animals with signs of current chlamydial disease. IL10 gene expression was not evident in the majority of animals from both groups. Future longitudinal studies are now required to confirm the role played by cytokines in pathology and/or protection against C. pecorum infection in the koala. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Potential ‘Ecological Traps’ of Restored Landscapes: Koalas Phascolarctos cinereus Re-Occupy a Rehabilitated Mine Site

    Science.gov (United States)

    Cristescu, Romane H.; Banks, Peter B.; Carrick, Frank N.; Frère, Céline

    2013-01-01

    With progressively increasing anthropogenic habitat disturbances, restoration of impacted landscapes is becoming a critical element of biodiversity conservation. Evaluation of success in restoration ecology rarely includes faunal components, usually only encompassing abiotic and floral components of the ecosystems. Even when fauna is explicitly included, it is usually only species presence/absence criteria that are considered. If restoration is to have a positive outcome, however, populations in restored habitats should exhibit comparable survival and reproductive rates to populations found in undisturbed surroundings. If a species recolonises restored areas but later experiences decreased fitness, restored areas could become ecological sinks or traps. We investigated this possibility in a case study of koalas Phascolarctos cinereus occupying rehabilitated mining areas on North Stradbroke Island, Australia. Our holistic approach compared rehabilitated and undisturbed areas on the basis of their vegetation characteristics, of koalas' body condition, roosting trees, diet, as well as predator index. Koalas using rehabilitated areas appeared to be able to access an adequate supply of roosting and fodder trees, were in good condition and had high reproductive output. We did not find any significant differences in predator density between rehabilitated areas and undisturbed surroundings. The results presented in this study showed there was no evidence that the post-mining rehabilitated areas constitute ecological sinks or traps. However, to reach a definitive conclusion as to whether areas rehabilitated post-mining provide at least equivalent habitat to undisturbed locations, additional research could be undertaken to assess foliar nutrient/water/toxin differences and predation risk in rehabilitated areas compared with undisturbed areas. More generally, the evaluation of whether restoration successfully produces a functional ecological community should include criteria

  2. Winter distribution and use of high elevation caves as foraging sites by the endangered Hawaiian hoary bat, Lasiurus cinereus semotus

    Science.gov (United States)

    Bonaccorso, Frank; Montoya-Aiona, Kristina; Pinzari, Corinna A.; Todd, Christopher M.

    2016-01-01

    We examine altitudinal movements involving unusual use of caves by Hawaiian hoary bats, Lasiurus cinereus semotus, during winter and spring in the Mauna Loa Forest Reserve (MLFR), Hawai‘i Island. Acoustic detection of hoary bat vocalizations, were recorded with regularity outside 13 lava tube cave entrances situated between 2,200 to 3,600 m asl from November 2012 to April 2013. Vocalizations were most numerous in November and December with the number of call events and echolocation pulses decreasing through the following months. Bat activity was positively correlated with air temperature and negatively correlated with wind speed. Visual searches found no evidence of hibernacula nor do Hawaiian hoary bats appear to shelter by day in these caves. Nevertheless, bats fly deep into caves as evidenced by numerous carcasses found in cave interiors. The occurrence of feeding buzzes around cave entrances and visual observations of bats flying in acrobatic fashion in cave interiors point to the use of these spaces as foraging sites. Peridroma moth species (Noctuidae), the only abundant nocturnal, flying insect sheltering in large numbers in rock rubble and on cave walls in the MLFR, apparently serve as the principal prey attracting hoary bats during winter to lava tube caves in the upper MLFR. Caves above 3,000 m on Mauna Loa harbor temperatures suitable for Pseudogymnoascus destructansfungi, the causative agent of White-nose Syndrome that is highly lethal to some species of North American cave-dwelling bats. We discuss the potential for White-nose Syndrome to establish and affect Hawaiian hoary bats.

  3. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  4. Condition of the prooxidant-antioxidant system of some strains of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2017-02-01

    Full Text Available The article deals with the calculation and comparison indications of the condition of the prooxidant-antioxidant system (PAS of strains of Basidiomycetes under periodic surface cultivation on a glucose-peptone medium. The research material consisted of the mycelium and culture filtrate (CF from 57 strains, 52 of them belonging to 7 species of the order Agaricales and 5 belonging to 5 species of the order Polyporales. The intensity of the processes of lipid peroxidation was determined by a modified spectrophotometric method for contents of active products to thiobarbituric acid. Total antioxidant activity (АОА of the mycological material was evaluated by intensity of inhibition from accumulated products of lipid peroxide oxidation (LPO in a model reaction of oxidation by Twin-80 oxygen of the air. From the data obtained, indicators of prooxidant activity (POA, indicators of reserve of substrate peroxidation (SPO and the balance coefficient of the prooxidant-antioxidant system (CbPАS were calculated. It was established that strains of Basidiomycetes are characterized by significant predominance of prooxidant activity characteristic of PAS in the culture filtrate in comparison with the mycelium indicator. The highest values of POA in the Culture Filtrate were observed on the 12-th day of cultivation for the strain Р-089 genus Pleurotus and strain Gl-2 genus Ganoderma, and for the mycelium on the 9-th day of cultivation for the strains Р-сіtr, Р-089, Р-er and Р-082 of the genus Pleurotus. There is a direct dependence between the indicators of POA in the CF and mycelium for each strain, this dependence and level of indication do not reflect their systematic placement. We distinguished a more significant prevalence of indicators of reserve of substrates peroxidation of mycelium for most strains, than for such indicators with CF The highest value of reserve SPO of mycelium was recorded for strains Р-447, Р-998, Р-039, Р-94, Р-2175,

  5. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  6. A minimal growth medium for the basidiomycetePleurotus sapidusfor metabolic flux analysis.

    Science.gov (United States)

    Fraatz, Marco A; Naeve, Stefanie; Hausherr, Vanessa; Zorn, Holger; Blank, Lars M

    2014-01-01

    Pleurotus sapidus secretes a huge enzymatic repertoire including hydrolytic and oxidative enzymes and is an example for higher basidiomycetes being interesting for biotechnology. The complex growth media used for submerged cultivation limit basic physiological analyses of this group of organisms. Using undefined growth media, only little insights into the operation of central carbon metabolism and biomass formation, i.e. , the interplay of catabolic and anabolic pathways, can be gained. The development of a chemically defined growth medium allowed rapid growth of P. sapidus in submerged cultures. As P. sapidus grew extremely slow in salt medium, the co-utilization of amino acids using 13 C-labelled glucose was investigated by gas chromatography-mass spectrometry (GC-MS) analysis. While some amino acids were synthesized up to 90% in vivo from glucose ( e.g., alanine), asparagine and/or aspartate were predominantly taken up from the medium. With this information in hand, a defined yeast free salt medium containing aspartate and ammonium nitrate as a nitrogen source was developed. The observed growth rates of P. sapidus were well comparable with those previously published for complex media. Importantly, fast growth could be observed for 4 days at least, up to cell wet weights (CWW) of 400 g L -1 . The chemically defined medium was used to carry out a 13 C-based metabolic flux analysis, and the in vivo reactions rates in the central carbon metabolism of P. sapidus were investigated. The results revealed a highly respiratory metabolism with high fluxes through the pentose phosphate pathway and TCA cycle. The presented chemically defined growth medium enables researchers to study the metabolism of P. sapidus , significantly enlarging the analytical capabilities. Detailed studies on the production of extracellular enzymes and of secondary metabolites of P. sapidus may be designed based on the reported data.

  7. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  8. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  9. The production and analysis of carotenoid preparations from some strains of xylotrophic Basidiomycetes

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-07-01

    Full Text Available The aim of the study was selection of optimal conditions for obtaining carotenoid drugs of mycelium origin from the basidiomycete strains Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18 and the study of antibacterial and total antioxidant activity of these compounds. The strains were surface grown on a glucose-peptone medium modified for each producer. The homogenized pigments of the mycelium strains were extracted with ethanol and the solvent was separated under vacuum at 60 ºC. The absorption spectra of the carotenoid drugs were recorded for alcoholic solutions at 350–500 nm. The antibacterial activity of the carotenoids was determined by the agar diffusion method, and the total antioxidant activity was determined by the DPPH-method. It was found that the optimum temperature for carotenoid extraction is 60 °C. The absorption spectra of carotenoid drugs showed three peaks in 420, 450 and 470 nm. These results respond to the β-carotene absorption spectra. The highest antioxidant activity was noted for carotenoid drugs from F. hepatica Fh-18 and L. sulphureus Ls-08 strains obtained at an extraction temperature of 40 and 60 °C respectively. The antibacterial activity of carotenoid drugs against the test cultures was not species dependent. Carotenoid drugs with a 20% concentrate obtained from the L. sulphureus Ls-08 strain had the highest antibacterial activity against the test cultures Staphylococcus aureus and Escherichia coli. Carotenoids from the mycelium of F. hepatica Fh-18 had the highest antibacterial activity against the test culture Candida albicans. Extraction temperature of 60 °C is optimal for mycelial yield of carotenoids from the studied strains. All preparations of carotenoids exhibited antibacterial activity against the test microorganism cultures. The carotenoid drugs obtained at 40 and 60 °C from the strains F. hepatica Fh-18 and L. sulphureus Ls-08 respectively showed the highest

  10. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  11. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  12. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  13. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  14. Three-dimensional organization of three-domain copper oxidases: A review

    Science.gov (United States)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  15. Three-dimensional organization of three-domain copper oxidases: A review

    International Nuclear Information System (INIS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-01

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms

  16. Do you hear what I see? Vocalization relative to visual detection rates of Hawaiian hoary bats (Lasiurus cinereus semotus)

    Science.gov (United States)

    Gorresen, Paulo Marcos; Cryan, Paul; Montoya-Aiona, Kristina; Bonaccorso, Frank

    2017-01-01

    Bats vocalize during flight as part of the sensory modality called echolocation, but very little is known about whether flying bats consistently call. Occasional vocal silence during flight when bats approach prey or conspecifics has been documented for relatively few species and situations. Bats flying alone in clutter-free airspace are not known to forgo vocalization, yet prior observations suggested possible silent behavior in certain, unexpected situations. Determining when, why, and where silent behavior occurs in bats will help evaluate major assumptions of a primary monitoring method for bats used in ecological research, management, and conservation. In this study, we recorded flight activity of Hawaiian hoary bats (Lasiurus cinereus semotus) under seminatural conditions using both thermal video cameras and acoustic detectors. Simultaneous video and audio recordings from 20 nights of observation at 10 sites were analyzed for correspondence between detection methods, with a focus on video observations in three distance categories for which accompanying vocalizations were detected. Comparison of video and audio detections revealed that a high proportion of Hawaiian hoary bats “seen” on video were not simultaneously “heard.” On average, only about one in three visual detections within a night had an accompanying call detection, but this varied greatly among nights. Bats flying on curved flight paths and individuals nearer the cameras were more likely to be detected by both methods. Feeding and social calls were detected, but no clear pattern emerged from the small number of observations involving closely interacting bats. These results may indicate that flying Hawaiian hoary bats often forgo echolocation, or do not always vocalize in a way that is detectable with common sampling and monitoring methods. Possible reasons for the low correspondence between visual and acoustic detections range from methodological to biological and include a number of biases

  17. Effects of structural complexity enhancement on eastern red-backed salamander (Plethodon cinereus) populations in northern hardwood forests

    Science.gov (United States)

    McKenny, H.C.; Keeton, W.S.; Donovan, T.M.

    2006-01-01

    Managing for stand structural complexity in northern hardwood forests has been proposed as a method for promoting microhabitat characteristics important to eastern red-backed salamanders (Plethodon cinereus). We evaluated the effects of alternate, structure-based silvicultural systems on red-backed salamander populations at two research sites in northwestern Vermont. Treatments included two uneven-aged approaches (single-tree selection and group-selection) and one unconventional approach, termed "structural complexity enhancement" (SCE), that promotes development of late-successional structure, including elevated levels of coarse woody debris (CWD). Treatments were applied to 2 ha units and were replicated two to four times depending on treatment. We surveyed red-backed salamanders with a natural cover search method of transects nested within vegetation plots 1 year after logging. Abundance estimates corrected for detection probability were calculated from survey data with a binomial mixture model. Abundance estimates differed between study areas and were influenced by forest structural characteristics. Model selection was conducted using Akaike Information Criteria, corrected for over-dispersed data and small sample size (QAICc). We found no difference in abundance as a response to treatment as a whole, suggesting that all of the uneven-aged silvicultural systems evaluated can maintain salamander populations after harvest. However, abundance was tied to specific structural habitat attributes associated with study plots within treatments. The most parsimonious model of habitat covariates included site, relative density of overstory trees, and density of more-decayed and less-decayed downed CWD. Abundance responded positively to the density of downed, well-decayed CWD and negatively to the density of poorly decayed CWD and to overstory relative density. CWD volume was not a strong predictor of salamander abundance. We conclude that structural complexity enhancement

  18. The seminiferous epithelial cycle and microanatomy of the koala (Phascolarctos cinereus) and southern hairy-nosed wombat (Lasiorhinus latifrons) testis.

    Science.gov (United States)

    Oishi, Motoharu; Takahashi, Mei; Amasaki, Hajime; Janssen, Tina; Johnston, Stephen D

    2013-03-01

    The koala (Phascolarctos cinereus) and southern hairy-nosed wombat (Lasiorhinus latifrons) are iconic Australian fauna that share a close phylogenetic relationship but there are currently no comparative studies of the seminiferous epithelial cell or testicular microanatomy of either species. Koala and wombat spermatozoa are unusual for marsupials as they possess a curved stream-lined head and lateral neck insertion that superficially is similar to murid spermatozoa; the koala also contains Sertoli cells with crystalloid inclusions that closely resemble the Charcot-Bottcher crystalloids described in human Sertoli cells. Eighteen sexually mature koalas and four sexually mature southern hairy-nosed (SHN) wombats were examined to establish base-line data on quantitative testicular histology. Dynamics of the seminiferous epithelial cycle in the both species consisted of eight stages of cellular association similar to that described in other marsupials. Both species possessed a high proportion of the pre-meiotic (stages VIII, I - III; koala - 62.2 ± 1.7% and SHN wombat - 66.6 ± 2.4%) when compared with post-meiotic stages of the seminiferous cycle. The mean diameters of the seminiferous tubules found in the koalas and the SHN wombats were 227.8 ± 6.1 and 243.5 ± 3.9 μm, respectively. There were differences in testicular histology between the species including the koala possessing (i) a greater proportion of Leydig cells, (ii) larger Sertoli cell nuclei, (iii) crystalloids in the Sertoli cell cytoplasm, (iv) a distinctive acrosomal granule during spermiogenesis and (v) a highly eosinophilic acrosome. An understanding of the seminiferous epithelial cycle and microanatomy of testis is fundamental for documenting normal spermatogenesis and testicular architecture; recent evidence of orchitis and epididymitis associated with natural chlamydial infection in the koala suggest that this species might be useful as an experimental model for understanding Chlamydia

  19. Characterisation of CD4 T cells in healthy and diseased koalas (Phascolarctos cinereus) using cell-type-specific monoclonal antibodies.

    Science.gov (United States)

    Mangar, Chandan; Armitage, Charles W; Timms, Peter; Corcoran, Lynn M; Beagley, Kenneth W

    2016-07-01

    The koala (Phascolarctos cinereus) is an arboreal herbivorous marsupial that is an Australian icon. Koalas in many parts of Australia are under multiple threats including habitat destruction, dog attacks, vehicular accidents, and infectious diseases such as Chlamydia spp. and the koala retrovirus (KoRV), which may contribute to the incidence of lymphoma and leukaemia in this species. Due to a lack of koala-specific immune reagents and assays there is currently no way to adequately analyse the immune response in healthy, diseased or vaccinated animals. This paper reports the production and characterisation of the first anti-koala CD4 monoclonal antibody (mAb). The koala CD4 gene was identified and used to develop recombinant proteins for mAb production. Fluorochrome-conjugated anti-CD4 mAb was used to measure the levels of CD4(+) lymphocytes collected from koala spleens (41.1%, range 20-45.1%) lymph nodes (36.3%, range 19-55.9%) and peripheral blood (23.8%, range 17.3-35%) by flow cytometry. Biotin-conjugated anti-CD4 mAb was used for western blot to determine an approximate size of 52 kDa for the koala CD4 molecule and used in immunohistochemistry to identify CD4(+) cells in the paracortical region and germinal centres of spleen and lymph nodes. Using the anti-CD4 mab we showed that CD4 cells from vaccinated, but not control, koalas proliferated following in vitro stimulation with UV-inactivated Chlamydia pecorum and recombinant chlamydial antigens. Since CD4(+) T cells have been shown to play a pivotal role in clearing chlamydial infection in both human and mouse infections, using this novel antibody will help determine the role CD4(+) T cells play in protection against chlamydial infection in koalas and also enhance our knowledge of how KoRV affects the koala immune system. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  1. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta

    Science.gov (United States)

    Dongsheng Wei; Carl J. Houtman; Alexander N. Kapich; Christopher G. Hunt; Daniel Cullen; Kenneth E. Hammel

    2010-01-01

    Brown rot basidiomycetes initiate wood decay by producing extracellular reactive oxygen species that depolymerize the structural polysaccharides of lignocellulose. Secreted fungal hydroquinones are considered one contributor because they have been shown to reduce Fe3+, thus generating perhydroxyl radicals and Fe2+, which...

  2. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-06-27

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence.

  3. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids

    OpenAIRE

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence.

  4. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  5. Purification and Characterization of a Trehalose Synthase from the Basidiomycete Grifola frondosa

    Science.gov (United States)

    Saito, Koki; Kase, Toshiya; Takahashi, Eiichi; Takahashi, Eisaku; Horinouchi, Sueharu

    1998-01-01

    A trehalose synthase (TSase) that catalyzes the synthesis of trehalose from d-glucose and α-d-glucose 1-phosphate (α-d-glucose 1-P) was detected in a basidiomycete, Grifola frondosa. TSase was purified 106-fold to homogeneity with 36% recovery by ammonium sulfate precipitation and several steps of column chromatography. The native enzyme appears to be a dimer since it has apparent molecular masses of 120 kDa, as determined by gel filtration column chromatography, and 60 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Although TSase catalyzed the phosphorolysis of trehalose to d-glucose and α-d-glucose 1-P, in addition to the synthesis of trehalose from the two substrates, the TSase equilibrium strongly favors trehalose synthesis. The optimum temperatures for phosphorolysis and synthesis of trehalose were 32.5 to 35°C and 35 to 37.5°C, respectively. The optimum pHs for these reactions were 6.5 and 6.5 to 6.8, respectively. The substrate specificity of TSase was very strict: among eight disaccharides examined, only trehalose was phosphorolyzed, and only α-d-glucose 1-P served as a donor substrate with d-glucose as the acceptor in trehalose synthesis. Two efficient enzymatic systems for the synthesis of trehalose from sucrose were identified. In system I, the α-d-glucose 1-P liberated by 1.05 U of sucrose phosphorylase was linked with d-glucose by 1.05 U of TSase, generating trehalose at the initial synthesis rate of 18 mmol/h in a final yield of 90 mol% under optimum conditions (300 mM each sucrose and glucose, 20 mM inorganic phosphate, 37.5°C, and pH 6.5). In system II, we added 1.05 U of glucose isomerase and 20 mM MgSO4 to the reaction mixture of system I to convert fructose, a by-product of the sucrose phosphorylase reaction, into glucose. This system generated trehalose at the synthesis rate of 4.5 mmol/h in the same final yield. PMID:9797287

  6. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  7. Cultivation of three types of indigenous wild edible mushrooms ...

    African Journals Online (AJOL)

    The periods for spawn running, pinhead and fruit body formation, number of flushes, yield and biological efficiency of the three Tanzanian wild edible mushrooms, Coprinus cinereus, Pleurotus flabellatus and Volvariella volvocea, grown on composted sisal decortications residue were studied. Results revealed that the ...

  8. The effect of the interaction of varying chicken manure supplement ...

    African Journals Online (AJOL)

    user

    2011-02-14

    Feb 14, 2011 ... 10, 15, 20 and 25% using solid-state fermentation bioreactors. The results .... MATERIALS AND METHODS. Origin of materials. Coprinus cinereus (Schaeff) S. Gray s.lat and sisal decortications wastes and chicken manure. Although C. .... split-split plot design with three replicates comprised of sisal waste.

  9. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  10. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  11. Cryptococcus yokohamensis sp. nov., a basidiomycetous yeast isolated from trees and a Queensland koala kept in a Japanese zoological park.

    Science.gov (United States)

    Alshahni, Mohamed Mahdi; Makimura, Koichi; Satoh, Kazuo; Nishiyama, Yayoi; Kido, Nobuhide; Sawada, Takuo

    2011-12-01

    Three strains were isolated from the nostrils of a koala and the surrounding environment in a Japanese zoological park. Sequence analysis of the nuclear rDNA internal transcribed spacer (ITS) region and the large subunit rDNA D1/D2 domains in addition to physiological and morphological studies indicated that the isolates represent a single novel species belonging to the basidiomycetous genus Cryptococcus (Tremellales, Tremellomycetes, Agaricomycotina). Phylogenetic analysis based on D1/D2 and ITS regions revealed that the novel species belongs to the Fuciformis clade. The name Cryptococcus yokohamensis sp. nov. is proposed to accommodate these isolates with strain JCM 16989(T) (=TIMM 10001(T)=CBS 11776(T)=DSM 23671(T)) as the type strain.

  12. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  13. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  14. De novo transcriptome sequencing and comprehensive analysis of the heat stress response genes in the basidiomycetes fungus Ganoderma lucidum.

    Science.gov (United States)

    Tan, Xiaoyan; Sun, Junshe; Ning, Huijuan; Qin, Zifang; Miao, Yuxin; Sun, Tian; Zhang, Xiuqing

    2018-03-29

    Ganoderma lucidum is a valuable basidiomycete with numerous pharmacological compounds, which is widely consumed throughout China. We previously found that the polysaccharide content of Ganoderma lucidum fruiting bodies could be significantly improved by 45.63% with treatment of 42 °C heat stress (HS) for 2 h. To further investigate genes involved in HS response and explore the mechanisms of HS regulating the carbohydrate metabolism in Ganoderma lucidum, high-throughput RNA-Seq was conducted to analyse the difference between control and heat-treated mycelia at transcriptome level. We sequenced six cDNA libraries with three from control group (mycelia cultivated at 28 °C) and three from heat-treated group (mycelia subjected to 42 °C for 2 h). A total of 99,899 transcripts were generated using Trinity method and 59,136 unigenes were annotated by seven public databases. Among them, 2790 genes were identified to be differential expressed genes (DEGs) under HS condition, which included 1991 up-regulated and 799 down-regulated. 176 DEGs were then manually classified into five main responsive-related categories according to their putative functions and possible metabolic pathways. These groups include stress resistance-related factors; protein assembly, transportation and degradation; signal transduction; carbohydrate metabolism and energy provision-related process; other related functions, suggesting that a series of metabolic pathways in Ganoderma lucidum are activated by HS and the response mechanism involves a complex molecular network which needs further study. Remarkably, 48 DEGs were found to regulate carbohydrate metabolism, both in carbohydrate hydrolysis for energy provision and polysaccharide synthesis. In summary, this comprehensive transcriptome analysis will provide enlarged resource for further investigation into the molecular mechanisms of basidiomycete under HS condition. Copyright © 2017. Published by Elsevier B.V.

  15. Stone-Eating Fungi: Mechanisms in Bioweathering and the Potential Role of Laccases in Black Slate Degradation With the Basidiomycete Schizophyllum commune.

    Science.gov (United States)

    Kirtzel, Julia; Siegel, Daniela; Krause, Katrin; Kothe, Erika

    2017-01-01

    Many enzymes, such as laccases, are involved in the saprotrophic lifestyle of fungi and the effects of those may be linked to enhanced bioweathering on stone surfaces. To test this hypothesis, we studied the decomposition of kerogen-enriched lithologies, especially with black slate containing up to 20% of C org . Indeed, a formation of ditches with attached hyphal material could be observed. To address enzymes involved, proteomics was performed and one group of enzymes, the multicopper oxidase family members of laccases, was specifically investigated. A role in bioweathering of rocks containing high contents of organic carbon in the form of kerogen could be shown using the basidiomycete Schizophyllum commune, a white rot fungus that has been used as a model organism to study the role of filamentous basidiomycete fungi in bioweathering of black slate. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  17. Variation in the microbiome of the urogenital tract of Chlamydia-free female koalas (Phascolarctos cinereus) with and without ‘wet bottom’

    Science.gov (United States)

    Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R.; Sansom, Fiona M.; Devlin, Joanne M.

    2018-01-01

    Koalas (Phascolarctos cinereus) are iconic Australian marsupials currently threatened by several processes, including infectious diseases and ecological disruption. Infection with Chlamydia pecorum, is considered a key driver of population decline. The clinical sign of ‘wet bottom’, a staining of the rump associated with urinary incontinence, is often caused by chlamydial urinary tract infections. However, wet bottom has been recorded in koalas free of C. pecorum, suggesting other causative agents in those individuals. We used 16S rRNA diversity profiling to investigate the microbiome of the urogenital tract of ten female koalas in order to identify potential causative agents of wet bottom, other than C. pecorum. Five urogenital samples were processed from koalas presenting with wet bottom and five were clinically normal. All koalas were negative for C. pecorum infection. We detected thirteen phyla across the ten samples, with Firmicutes occurring at the highest relative abundance (77.6%). The order Lactobacillales, within the Firmicutes, comprised 70.3% of the reads from all samples. After normalising reads using DESeq2 and testing for significant differences (P infection. This is of clinical relevance as wet bottom is often assumed to be caused by C. pecorum and treated accordingly. Our research highlights that other organisms may be causing wet bottom, and these potential aetiological agents need to be further investigated to fully address the problems this species faces. PMID:29579080

  18. Variation in the microbiome of the urogenital tract of Chlamydia-free female koalas (Phascolarctos cinereus) with and without 'wet bottom'.

    Science.gov (United States)

    Legione, Alistair R; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Sansom, Fiona M; Devlin, Joanne M

    2018-01-01

    Koalas (Phascolarctos cinereus) are iconic Australian marsupials currently threatened by several processes, including infectious diseases and ecological disruption. Infection with Chlamydia pecorum, is considered a key driver of population decline. The clinical sign of 'wet bottom', a staining of the rump associated with urinary incontinence, is often caused by chlamydial urinary tract infections. However, wet bottom has been recorded in koalas free of C. pecorum, suggesting other causative agents in those individuals. We used 16S rRNA diversity profiling to investigate the microbiome of the urogenital tract of ten female koalas in order to identify potential causative agents of wet bottom, other than C. pecorum. Five urogenital samples were processed from koalas presenting with wet bottom and five were clinically normal. All koalas were negative for C. pecorum infection. We detected thirteen phyla across the ten samples, with Firmicutes occurring at the highest relative abundance (77.6%). The order Lactobacillales, within the Firmicutes, comprised 70.3% of the reads from all samples. After normalising reads using DESeq2 and testing for significant differences (P infection. This is of clinical relevance as wet bottom is often assumed to be caused by C. pecorum and treated accordingly. Our research highlights that other organisms may be causing wet bottom, and these potential aetiological agents need to be further investigated to fully address the problems this species faces.

  19. Response of Red-Backed Salamanders (Plethodon Cinereus to Changes in Hemlock Forest Soil Driven by Invasive Hemlock Woolly Adelgid (Adelges Tsugae

    Directory of Open Access Journals (Sweden)

    Alison Ochs

    2017-01-01

    Full Text Available Hemlock forests of the northeastern United States are declining due to the invasive hemlock woolly adelgid (HWA (Adelges tsugae. Hardwood species replace these forests, which affects soil properties that may influence other communities, such as red-backed salamanders (red-backs (Plethodon cinereus. This study examined the effects of HWA invasion on soil properties and how this affects red-backs at the Hemlock Removal Experiment at Harvard Forest, which consists of eight 0.8 ha plots treated with girdling to simulate HWA invasion, logging to simulate common management practices, or hemlock- or hardwood-dominated controls. Coverboard surveys were used to determine the relative abundance of red-backs between plots during June and July 2014 and soil cores were collected from which the bulk density, moisture, pH, temperature, leaf litter, and carbon-nitrogen ratio were measured. Ordination provided a soil quality index based on temperature, pH, and carbon-to-nitrogen ratio, which was significantly different between plot treatments (p < 0.05 and showed a significant negative correlation with the red-back relative abundance (p < 0.05. The findings support the hypothesis that red-backs are affected by soil quality, which is affected by plot treatment and thus HWA invasion. Further studies should explore how salamanders react in the long term towards changing environments and consider the use of red-backs as indicator species.

  20. Characterization of the antimicrobial peptide family defensins in the Tasmanian devil (Sarcophilus harrisii), koala (Phascolarctos cinereus), and tammar wallaby (Macropus eugenii).

    Science.gov (United States)

    Jones, Elizabeth A; Cheng, Yuanyuan; O'Meally, Denis; Belov, Katherine

    2017-03-01

    Defensins comprise a family of cysteine-rich antimicrobial peptides with important roles in innate and adaptive immune defense in vertebrates. We characterized alpha and beta defensin genes in three Australian marsupials: the Tasmanian devil (Sarcophilus harrisii), koala (Phascolarctos cinereus), and tammar wallaby (Macropus eugenii) and identified 48, 34, and 39 defensins, respectively. One hundred and twelve have the classical antimicrobial peptides characteristics required for pathogen membrane targeting, including cationic charge (between 1+ and 15+) and a high proportion of hydrophobic residues (>30%). Phylogenetic analysis shows that gene duplication has driven unique and species-specific expansions of devil, koala, and tammar wallaby beta defensins and devil alpha defensins. Defensin genes are arranged in three genomic clusters in marsupials, whereas further duplications and translocations have occurred in eutherians resulting in four and five gene clusters in mice and humans, respectively. Marsupial defensins are generally under purifying selection, particularly residues essential for defensin structural stability. Certain hydrophobic or positively charged sites, predominantly found in the defensin loop, are positively selected, which may have functional significance in defensin-target interaction and membrane insertion.

  1. Computed tomography and magnetic resonance for the advanced imaging of the normal nasal cavity and paranasal sinuses of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Alexander, Kate; Gorow, April; Pye, Geoffrey W

    2014-12-01

    The objective of this study is to describe computed tomography (CT) and magnetic resonance (MR) for the cross-sectional imaging of the normal anatomy of the nasal cavity and paranasal sinuses of the koala (Phascolarctos cinereus), to provide reference figures for gross anatomy with corresponding CT and MR images and to compare the features of the nasal cavity and paranasal sinuses of the normal koala with that reported in other domestic species. Advanced imaging can be used to aid in diagnosis, to plan surgical intervention, and to monitor therapeutic responses to diseases of the nasal passages in koalas. One clinically normal koala was anesthetized twice for the separate acquisition of dorsal CT scan images and transverse, dorsal, and sagittal MR images of its nasal cavity and paranasal sinuses. Sagittal and transverse CT planes were reformatted. Three fresh koala skulls were also transected in one of each transverse, sagittal, and dorsal planes and photographed. The CT and MR images obtained were matched with corresponding gross anatomic images and the normal bone, tissues and airway passages were identified. All anatomic structures were readily identifiable on CT, magnetic resonance imaging (MRI), and gross images. CT and MRI are both valuable diagnostic tools for imaging the nasal cavities and paranasal sinuses of koalas. Images obtained from this project can be used as baseline references for future comparison with diseased koalas to help with diagnosis, surgical intervention, and response to therapy.

  2. Fatty acid profiles of polar and neutral lipids of ten species of higher basidiomycetes indigenous to eastern Canada.

    Science.gov (United States)

    Pedneault, Karine; Angers, Paul; Gosselin, André; Tweddell, Russell J

    2008-12-01

    Neutral and polar lipid contents of ten species of edible mushrooms indigenous to Eastern Canada belonging to the families Agaricaceae, Amanitaceae, Boletaceae, Coprinaceae, Ganodermataceae, and Lycoperdaceae were analysed. The total lipid content of the species analysed ranged from 3.1% (Ganoderma applanatum) to 16% (w/w) d.w. (Amanita vaginata) and averaged 8.6% (w/w) d.w. Polar lipids accounted for more than 50% of the total lipids in most species and differences were observed between neutral and polar lipid contents according to the species analysed. In both lipid fractions, high proportions of unsaturated fatty acids (FAs) ranging from 62.7 to 82.3% (polar lipids) and 59.8 to 82.5% (neutral lipids) of the total FAs were observed. Analysis of FA profiles showed that both neutral and polar lipids were mainly composed of linoleic (18:2 Delta9c,12c), oleic (18:1 Delta9c), and palmitic (16:0) acids. Significant differences (P<0.05) in the contents of specific FAs were observed between mushroom species. Among the 44 FAs detected in the species analysed, the occurrence of cis-11-heptadecenoic (17:1 Delta11c) acid is reported for the first time in basidiomycetes, while elaidic acid (18:1 Delta9t) is reported for the first time in fungi.

  3. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  4. Degradation of C60 Fullerol by White-Rot Basidiomycete Fungi: Implications for Environmental Release of Nanomaterials

    Science.gov (United States)

    Schreiner, K. M.; Filley, T. R.; Bolskar, R. D.; Blanchette, R. A.

    2008-12-01

    Industrially produced carbon-based nanomaterials, including fullerenes and fullerols, will be introduced into the environment in increasing amounts over the next century. Oxygenated fullerenes are likely to be produced in the environment through both biotic and abiotic weathering, and yet the environmental fate of compounds like hydroxylated fullerenes are almost unknown. This study examines the ability of two white rot basidiomycete fungi (Phlebia tremellosa and Trametes versicolor) to metabolize and degrade 13C-labeled C60 fullerol. Both of these fungi were shown to degrade fullerol to CO2 both in the presence of wood tissue and without, and incorporate trace amounts of the carbon into fungal biomass. Absorbance data also indicate that a significant portion of the original fullerol was broken down into small molecular weight metabolites. Phlebia tremellosa proved to be, in general, more aggressive towards fullerol degradation than Trametes versicolor. These findings represent the report of fungal degradation of this important nanomaterial and also provide valuable information about the possible environmental fates of this compound.

  5. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  6. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  7. VOLATILE COMPOUNDS IN THE AROMA OF THREE SPECIES OF WOOD-ROTTING BASIDIOMYCETES AND THEIR ANTIFUNGAL POTENTIAL

    Directory of Open Access Journals (Sweden)

    Cristiana Virginia PETRE

    2017-12-01

    Full Text Available This study aims to determine the volatile organic compounds synthesized by three species of wood-rotting basidiomycetes: Coriolopsis gallica, Megacollybia platyphylla and Lentinus arcularius and test their antifungal potential. The species were cultivated on liquid media and kept for 25 days at 25 °C. The surface cultures were then homogenized, filtrated and extracted using solid-phase extraction and analyzed by GC-MS. The volatile compounds identified were mainly alcohols, ketones, aldehydes and terpenes. The most common volatiles identified in the experiment are: 1-octen-3-ol, 3-hexanol, 3-methyl-1-butanol, 3-octanone, 2-hexanone, benzaldehyde, and limonene. The volatiles metabolites of these species were tested for their antifungal activity using the bi-compartmented Petri dishes method against two species of plant pathogenic fungi: Fusarium solani and Sclerotinia sclerotiorum, on three media. The volatiles produced by Coriolopsis gallica showed the highest antifungal potential against the phytopathogens. The results revealed the importance of media composition in the synthesis of antifungal volatile compounds.

  8. Spatial mapping of extracellular oxidant production by a white rot basidiomycete on wood reveals details of ligninolytic mechanism.

    Science.gov (United States)

    Hunt, Christopher G; Houtman, Carl J; Jones, Don C; Kitin, Peter; Korripally, Premsagar; Hammel, Kenneth E

    2013-03-01

    Oxidative cleavage of the recalcitrant plant polymer lignin is a crucial step in global carbon cycling, and is accomplished most efficiently by fungi that cause white rot of wood. These basidiomycetes secrete many enzymes and metabolites with proposed ligninolytic roles, and it is not clear whether all of these agents are physiologically important during attack on natural lignocellulosic substrates. One new approach to this problem is to infer properties of ligninolytic oxidants from their spatial distribution relative to the fungus on the lignocellulose. We grew Phanerochaete chrysosporium on wood sections in the presence of oxidant-sensing beads based on the ratiometric fluorescent dye BODIPY 581/591. The beads, having fixed locations relative to the fungal hyphae, enabled spatial mapping of cumulative extracellular oxidant distributions by confocal fluorescence microscopy. The results showed that oxidation gradients occurred around the hyphae, and data analysis using a mathematical reaction-diffusion model indicated that the dominant oxidant during incipient white rot had a half-life under 0.1 s. The best available hypothesis is that this oxidant is the cation radical of the secreted P. chrysosporium metabolite veratryl alcohol. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  9. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  10. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  11. Development and characterization of 21 polymorphic microsatellite markers for the barren-ground shrew, Sorex ugyunak (Mammalia: Sorcidae), through next-generation sequencing, and cross-species amplification in the masked shrew, S. cinereus

    Science.gov (United States)

    Sonsthagen, S.A.; Sage, G.K.; Fowler, M.; Hope, A.G.; Cook, J.A.; Talbot, S.L.

    2013-01-01

    We used next generation shotgun sequencing to develop 21 novel microsatellite markers for the barren-ground shrew (Sorex ugyunak), which were polymorphic among individuals from northern Alaska. The loci displayed moderate allelic diversity (averaging 6.81 alleles per locus) and heterozygosity (averaging 70 %). Two loci deviated from Hardy–Weinberg equilibrium (HWE) due to heterozygote deficiency. While the population did not deviate from HWE overall, it showed significant linkage disequilibrium suggesting this population is not in mutation-drift equilibrium. Nineteen of 21 loci were polymorphic in masked shrews (S. cinereus) from interior Alaska and exhibited linkage equilibrium and HWE overall. All loci yielded sufficient variability for use in population studies.

  12. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  13. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  14. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-01-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework. PMID:17189439

  15. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-02-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework.

  16. Purification, characterization and cDNA cloning of an endo-exonuclease from the basidiomycete fungus Armillaria mellea.

    Science.gov (United States)

    Healy, V; Doonan, S; McCarthy, T V

    1999-01-01

    We have purified an endo-exonuclease from the fruiting body of the basidiomycete fungus Armillaria mellea by using an ethanol fractionation step, followed by two rounds of column chromatography. The enzyme had an apparent molecular mass of 17500 Da and was shown to exist as a monomer by gel-filtration analysis. The nuclease was active on both double-stranded and single-stranded DNA but not on RNA. It was optimally active at pH8.5 and also exhibited a significant degree of thermostability. Three bivalent metal ions, Mg2+, Co2+ and Mn2+, acted as cofactors in the catalysis. It was also inhibited by high salt concentrations: activity was completely abolished at 150 mM NaCl. The nuclease possessed both endonuclease activity on supercoiled DNA and a 3'-5' (but not a 5'-3') exonuclease activity. It generated 5'-phosphomonoesters on its products that, after a prolonged incubation, were hydrolysed to a mixture of free mononucleotides and small oligonucleotides ranging in size from two to eight bases. Elucidation of its N-terminal amino acid sequence permitted the cDNA cloning of the A. mellea nuclease via a PCR-based approach. Peptide mapping of the purified enzyme generated patterns consistent with the amino acid sequence coded for by the cloned cDNA. A BLAST search of the SwissProt database revealed that A. mellea nuclease shared significant amino acid similarity with two nucleases from Bacillus subtilis, suggesting that the three might constitute a distinct class of nucleolytic enzymes. PMID:10215611

  17. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  18. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  19. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  20. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus) and their ticks identified using next-generation sequencing (NGS)

    Science.gov (United States)

    Gofton, Alexander W.; Paparini, Andrea; Codello, Annachiara; Greay, Telleasha; Gillett, Amber; Warren, Kristin; Irwin, Peter; Ryan, Una

    2017-01-01

    Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus), particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS)-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani) removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2–39.8%) were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2–39.8%), T. gilletti (25%, 95% CI: 18.7–32.3%), T. copemani (27.4%, 95% CI: 20.8–34.8%) and T. vegrandis (10.1%, 95% CI: 6.0–15.7%). Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0–3.3%), and a novel species (Trypanosoma sp. AB-2017) was identified at a prevalence of 4.8% (95% CI: 2.1–9.2%). Mixed infections with up to five species were present in 27.4% (95% CI: 21–35%) of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2–9%). Overall, a considerably higher proportion (79.7%) of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS) within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides

  1. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus and their ticks identified using next-generation sequencing (NGS.

    Directory of Open Access Journals (Sweden)

    Amanda D Barbosa

    Full Text Available Infections with Trypanosoma spp. have been associated with poor health and decreased survival of koalas (Phascolarctos cinereus, particularly in the presence of concurrent pathogens such as Chlamydia and koala retrovirus. The present study describes the application of a next-generation sequencing (NGS-based assay to characterise the prevalence and genetic diversity of trypanosome communities in koalas and two native species of ticks (Ixodes holocyclus and I. tasmani removed from koala hosts. Among 168 koalas tested, 32.2% (95% CI: 25.2-39.8% were positive for at least one Trypanosoma sp. Previously described Trypanosoma spp. from koalas were identified, including T. irwini (32.1%, 95% CI: 25.2-39.8%, T. gilletti (25%, 95% CI: 18.7-32.3%, T. copemani (27.4%, 95% CI: 20.8-34.8% and T. vegrandis (10.1%, 95% CI: 6.0-15.7%. Trypanosoma noyesi was detected for the first time in koalas, although at a low prevalence (0.6% 95% CI: 0-3.3%, and a novel species (Trypanosoma sp. AB-2017 was identified at a prevalence of 4.8% (95% CI: 2.1-9.2%. Mixed infections with up to five species were present in 27.4% (95% CI: 21-35% of the koalas, which was significantly higher than the prevalence of single infections 4.8% (95% CI: 2-9%. Overall, a considerably higher proportion (79.7% of the Trypanosoma sequences isolated from koala blood samples were identified as T. irwini, suggesting this is the dominant species. Co-infections involving T. gilletti, T. irwini, T. copemani, T. vegrandis and Trypanosoma sp. AB-2017 were also detected in ticks, with T. gilletti and T. copemani being the dominant species within the invertebrate hosts. Direct Sanger sequencing of Trypanosoma 18S rRNA gene amplicons was also performed and results revealed that this method was only able to identify the genotypes with greater amount of reads (according to NGS within koala samples, which highlights the advantages of NGS in detecting mixed infections. The present study provides new insights

  2. Cytochrome P450 CYP3A in marsupials: cloning and characterisation of the second identified CYP3A subfamily member, isoform 3A78 from koala (Phascolarctos cinereus).

    Science.gov (United States)

    El-Merhibi, Adaweyah; Ngo, Suong N T; Crittenden, Tamara A; Marchant, Ceilidh L; Stupans, Ieva; McKinnon, Ross A

    2011-11-01

    Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of xenobiotics and endogenous substrates. Previously, we cloned and characterised the CYP2C, CYP4A, and CYP4B gene subfamilies from marsupials and demonstrated important species-differences in both activity and tissue expression of these CYP enzymes. Recently, we isolated the Eastern grey kangaroo CYP3A70. Here we have cloned and characterised the second identified member of marsupial CYP3A gene subfamily, CYP3A78 from the koala (Phascolarctos cinereus). In addition, we have examined the gender-differences in microsomal erythromycin N-demethylation activity (a CYP3A marker) and CYP3A protein expression across test marsupial species. Significant differences in hepatic erythromycin N-demethylation activity were observed between male and female koalas, with the activity detected in female koalas being 2.5-fold higher compared to that in male koalas (pkoala, tammar wallaby, and Eastern grey kangaroo, with no gender-differences detected across test marsupials. A 1610 bp koala hepatic CYP3A complete cDNA, designated CYP3A78, was cloned by reverse transcription-polymerase chain reaction approaches. It displays 64% nucleotide and 57% amino acid sequence identity to the Eastern grey kangaroo CYP3A70. The CYP3A78 cDNA encodes a protein of 515 amino acids, shares approximately 68% nucleotide and 56% amino acid sequence identity to human CYP3A4, and displays high sequence similarity to other published mammalian CYP3As from human, monkey, cow, pig, dog, rat, rabbit, mouse, hamster, and guinea pig. Collectively, this study provides primary molecular data regarding koala hepatic CYP3A78 gene and enables further functional analyses of CYP3A enzymes in marsupials. Given the significant role that CYP3A enzymes play in the metabolism of both endogenous and exogenous compounds, the clone provides an important step in elucidating the metabolic capacity of marsupials. Copyright © 2011

  3. Surveys on the distribution and abundance of the Hawaiian hoary bat (Lasiurus cinereus semotus) in the vicinity of proposed geothermal project subzones in the District of Puna, Hawaii. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Reynolds, M.; Ritchotte, G.; Dwyer, J.; Viggiano, A.; Nielsen, B.; Jacobi, J.D. [Fish and Wildlife Service, Hawaii National Park, HI (United States). Hawaii Research Station

    1994-08-01

    In 1993 the US Fish and Wildlife Service (USFWS) entered into an interagency agreement with the Department of Energy (DOE) to conduct wildlife surveys relative to identifying potential impacts of geothermal resource development on the native biota of the east rift zone of Kilauea volcano in the Puna district on the island of Hawaii. This report presents data on the endangered Hawaiian hoary bat (Hawaiian bat), or opeapea (Lasiurus cinereus semotus), within the proposed Hawaii geothermal subzones. Potential effects of geothermal development on Hawaiian bat populations are also discussed. Surveys were conducted to determine the distribution and abundance of bats throughout the District of Puna. Baseline information was collected to evaluate the status of bats within the study area and to identify important foraging habitats. Little specific data exists in the published literature on the population status and potential limiting factors affecting the Hawaiian bat. A USFWS recovery plan does not exist for this endangered species.

  4. Ectomycorrhizas in vitro between Tricholoma matsutake, a basidiomycete that associates with Pinaceae, and Betula platyphylla var. japonica, an early-successional birch species, in cool-temperate forests.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Maruyama, Tsuyoshi; Neda, Hitoshi

    2015-04-01

    Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates with Pinaceae in the Northern Hemisphere and produces prized "matsutake" mushrooms. We questioned whether the symbiont could associate with a birch that is an early-successional species in boreal, cool-temperate, or subalpine forests. In the present study, we demonstrated that T. matsutake can form typical ectomycorrhizas with Betula platyphylla var. japonica; the associations included a Hartig net and a thin but distinct fungal sheath, as well as the rhizospheric mycelial aggregate "shiro" that is required for fruiting in nature. The in vitro shiro also emitted a characteristic aroma. This is the first report of an ectomycorrhizal formation between T. matsutake and a deciduous broad-leaved tree in the boreal or cool-temperate zones that T. matsutake naturally inhabits.

  5. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  6. Traceability of Asian Matsutake, Specialty Mushrooms Produced by the Ectomycorrhizal Basidiomycete Tricholoma matsutake, on the Basis of Retroelement-Based DNA Markers▿

    Science.gov (United States)

    Murata, Hitoshi; Babasaki, Katsuhiko; Saegusa, Tomoki; Takemoto, Kenji; Yamada, Akiyoshi; Ohta, Akira

    2008-01-01

    The ectomycorrhizal basidiomycete Tricholoma matsutake produces commercially valuable fruit bodies, matsutake, in forests. Here we report a PCR system targeting retroelement integration sites to differentiate among individual Asian isolates of T. matsutake based on their geographical origins, such as Japan, the area of South Korea through North Korea, the northeastern provinces of China, and the area of the southwestern provinces of China through Bhutan. The overall misjudgment rate of the analytical system was approximately 5% based on 95 samples of T. matsutake examined including those from cultures and from commodities. We also provide evidence that T. matsutake isolates grown throughout the Far East, including the northeastern provinces of China, are closely related to each other while distinct from those in the area of the southwestern provinces of China through Bhutan. The method allows us to trace back geographical origins of Asian matsutake, thus contributing to food safety, appropriate tariffs, and proper price setting. PMID:18281433

  7. The relationship between sperm morphology and chromatin integrity in the koala (Phascolarctos cinereus) as assessed by the Sperm Chromatin Dispersion test (SCDt).

    Science.gov (United States)

    Johnston, Stephen D; López-Fernández, Carmen; Gosálbez, Altea; Zee, Yengpeng; Holt, William V; Allen, Camryn; Gosálvez, Jaime

    2007-01-01

    Koala (Phascolarctos cinereus) sperm nuclei show a tendency to swell after cryopreservation, but it is uncertain whether this phenomenon is associated with DNA fragmentation. In this study, we validated a modified version of the sperm chromatin dispersion test (SCDt) for use with koala spermatozoa, which is the first use of the test for a marsupial. Cryopreserved spermatozoa (multiple straws) from a single koala were used to explore the relationship between sperm morphology, viability, chromatin dispersion, and DNA fragmentation. A SCDt prototype kit (Sperm Halomax) was specifically developed for koala spermatozoa with the use of a lysing solution that did not contain dithiothreitol. DNA fragmentation of lysed and nonlysed spermatozoa was examined in microgel slides and validated by means of in situ nick translation (ISNT). The SCDt was then applied to the analysis of extended and frozen-thawed semen samples of 3 different koalas. Spermatozoa were classified into 3 distinct koala sperm morphotypes (KSMs) after the SCDt: 1) KSM-1, rod-shaped cells with no halo of DNA; 2) KSM-2, rounded nuclei with various degrees of halo formation about a dense chromatin core; and 3) KSM-3, rod-shaped or rounded nuclei consisting of an inner chromatin core but with large dispersed halos of stellar chromatin. Although ISNT after the SCDt did not label KSM-1, both KSM-2 and KSM-3 stained positively for DNA fragmentation. ISNT was not able to differentiate between KSM-2 and KSM-3. Although application of the SCDt to the spermatozoa of another 3 koalas showed no difference in the percentage of the 3 sperm morphotypes found between extended and frozen-thawed semen, thawed spermatozoa incubated at 35 degrees C for 2 hours showed an increase in the incidence of KSM-3 and a corresponding decrease in KSM-2. We propose that KSM-1 and KSM-2 represent nuclei that show either no, or only limited, sperm DNA fragmentation, respectively. It is likely that the halos formed around KSM-2 are from DNA

  8. Behavior of the Hawaiian Hawaiian Hoary Bat (Lasiurus cinereus semotus) at wind turbines and its distribution across the North Ko'olau Mountains, O'ahu

    Science.gov (United States)

    Gorresen, P.M.; Cryan, Paul M.; Huso, Manuela M.P.; Hein, Cris D.; Schirmacher, Michael; Johnson, Jessica H.; Montoya-Aiona, Kristina; Brinck, Kevin W.; Bonaccorso, Frank

    2015-01-01

    We studied the landscape distribution of endemic Hawaiian hoary bats (Lasiurus cinereus semotus) on the north Ko‘olau Mountains of O‘ahu, Hawai‘i, from May 2013 to May 2014, while simultaneously studying their behavior at wind turbines within the broader landscape. This research aimed to assess the risk that wind turbines pose to bats on the island and integrated a variety of methods, including acoustic monitoring, thermal videography, and fatality searches.Our findings indicate that hoary bats were acoustically cryptic and occurred sparsely in the region. Overall site occupancy rate was 55% during the 1-year period of acoustic monitoring at 23 sites, and there was only an 8% chance of acoustically detecting a bat on a given night if it was present. We detected bats less frequently in windward northern parts of the study area and at windy, lower-elevation sites with rough terrain. Bats were detected more frequently in leeward southern parts of the study area and at wind-sheltered, higher-elevation sites with flat ridgetops. Acoustic detections were consistently low from October through February and increased at most sites to peak in April through August. However, meteorological conditions were not found to be associated with the acoustic prevalence of bats on a night-to-night basis. We observed more than three thousand events involving bats during six months of nightly video surveillance at four wind turbines. Video monitoring revealed several links to weather at the local scale, despite acoustic detections not clearly relating to weather in our broader landscape analysis. Video demonstrated bats occurring near turbines more often on nights with little rain, warmer temperatures, moderate wind speeds, low humidity, and the low but rising barometric pressures indicative of fair weather and improved foraging conditions. Video monitoring also demonstrated that the presence of bats near turbines strongly correlates with insect presence. We detected bats on video

  9. Immunochemotherapy of transplanted KMT-17 tumor in WKA rats by combination of cyclophosphamide and immunostimulatory protein-bound polysaccharide isolated from basidiomycetes.

    Science.gov (United States)

    Akiyama, J; Kawamura, T; Gotohda, E; Yamada, Y; Hosokawa, M; Kodama, T; Kobayashi, H

    1977-09-01

    Protein-bound polysaccharide Kureha (PS-K) isolated from Basidiomycetes was used in combination with cyclophosphamide (CY) for the treatment of a 3-methylcholanthrene- induced KMT-17 fibrosarcoma in WKA/Mk rats. A single administration of PS-K exhibited no inhibitory effect on the growth of s.c.-inoculated KMT-17 tumor at any timing and dose. However, PS-K exhibited a marked antitumor effect when it was combined with CY. The effect of PS-K dependend on the combination timing of PS-K and CY; a marked antitumor effect was observed when PS-K was administered before CY but not if it was given after CY or before tumor inoculation. When PS-K was administered on Day 1 followed by CY on Day 3, the highest survival rate of 78.5% (11 of 14) was obtained. Delayed hypersensitivity response of rats to KMT-17 was investigat ed by radioisotopic footpad assay. On Day 12, the hypersensitivity response in rats treated with PS-K on Day 1 and CY on Day 3 was significantly higher than that in nontreated rats, indicating an enhanced specific immunity to KMT-17 possibly resulting in a marked antitumor effect.

  10. Enhancement of Ganoderic Acid Accumulation by Overexpression of an N-Terminally Truncated 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene in the Basidiomycete Ganoderma lucidum

    Science.gov (United States)

    Xu, Jun-Wei; Xu, Yi-Ning

    2012-01-01

    Ganoderic acids produced by Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, exhibit antitumor and antimetastasis activities. Genetic modification of G. lucidum is difficult but critical for the enhancement of cellular accumulation of ganoderic acids. In this study, a homologous genetic transformation system for G. lucidum was developed for the first time using mutated sdhB, encoding the iron-sulfur protein subunit of succinate dehydrogenase, as a selection marker. The truncated G. lucidum gene encoding the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) was overexpressed by using the Agrobacterium tumefaciens-mediated transformation system. The results showed that the mutated sdhB successfully conferred carboxin resistance upon transformation. Most of the integrated transfer DNA (T-DNA) appeared as a single copy in the genome. Moreover, deregulated constitutive overexpression of the HMGR gene led to a 2-fold increase in ganoderic acid content. It also increased the accumulation of intermediates (squalene and lanosterol) and the upregulation of downstream genes such as those of farnesyl pyrophosphate synthase, squalene synthase, and lanosterol synthase. This study demonstrates that transgenic basidiomycete G. lucidum is a promising system to achieve metabolic engineering of the ganoderic acid pathway. PMID:22941092

  11. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  12. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    OpenAIRE

    García Torres Angélica María; Torres Sáe Rodrigo Gonzalo

    2003-01-01

    La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de ést...

  13. Enhanced production of a diastereomer type of mannosylerythritol lipid-B by the basidiomycetous yeast Pseudozyma tsukubaensis expressing lipase genes from Pseudozyma antarctica.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2017-12-01

    Basidiomycetous yeasts in the genus Pseudozyma are known to produce extracellular glycolipids called mannosylerythritol lipids (MELs). Pseudozyma tsukubaensis produces a large amount of MEL-B using olive oil as the sole carbon source (> 70 g/L production). The MEL-B produced by P. tsukubaensis is a diastereomer type of MEL-B, which consists of 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol as a sugar moiety, in contrast to the conventional type of MELs produced by P. antarctica, which contain 4-O-β-D mannopyranosyl-(2S,3R)-erythritol. In this study, we attempted to increase the production of the diastereomer type of MEL-B in P. tsukubaensis 1E5 by introducing the genes encoding two lipases, PaLIPAp (PaLIPA) and PaLIPBp (PaLIPB) from P. antarctica T-34. Strain 1E5 expressing PaLIPA exhibited higher lipase activity than the strain possessing an empty vector, which was used as a negative control. Strains of 1E5 expressing PaLIPA or PaLIPB showed 1.9- and 1.6-fold higher MEL-B production than the negative control strain, respectively, and oil consumption was also accelerated by the introduction of these lipase genes. MEL-B production was estimated using time course analysis in the recombinant strains. Strain 1E5 expressing PaLIPA produced 37.0 ± 1.2 g/L of MEL-B within 4 days of cultivation, whereas the strain expressing an empty vector produced 22.1 ± 7.5 g/L in this time. Overexpression of PaLIPA increased MEL-B production by P. tsukubaensis strain 1E5 from olive oil as carbon source by more than 1.7-fold.

  14. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta.

    Science.gov (United States)

    Wei, Dongsheng; Houtman, Carl J; Kapich, Alexander N; Hunt, Christopher G; Cullen, Daniel; Hammel, Kenneth E

    2010-04-01

    Brown rot basidiomycetes initiate wood decay by producing extracellular reactive oxygen species that depolymerize the structural polysaccharides of lignocellulose. Secreted fungal hydroquinones are considered one contributor because they have been shown to reduce Fe(3+), thus generating perhydroxyl radicals and Fe(2+), which subsequently react further to produce biodegradative hydroxyl radicals. However, many brown rot fungi also secrete high levels of oxalate, which chelates Fe(3+) tightly, making it unreactive with hydroquinones. For hydroquinone-driven hydroxyl radical production to contribute in this environment, an alternative mechanism to oxidize hydroquinones is required. We show here that aspen wood undergoing decay by the oxalate producer Postia placenta contained both 2,5-dimethoxyhydroquinone and laccase activity. Mass spectrometric analysis of proteins extracted from the wood identified a putative laccase (Joint Genome Institute P. placenta protein identification number 111314), and heterologous expression of the corresponding gene confirmed this assignment. Ultrafiltration experiments with liquid pressed from the biodegrading wood showed that a high-molecular-weight component was required for it to oxidize 2,5-dimethoxyhydroquinone rapidly and that this component was replaceable by P. placenta laccase. The purified laccase oxidized 2,5-dimethoxyhydroquinone with a second-order rate constant near 10(4) M(-1) s(-1), and measurements of the H(2)O(2) produced indicated that approximately one perhydroxyl radical was generated per hydroquinone supplied. Using these values and a previously developed computer model, we estimate that the quantity of reactive oxygen species produced by P. placenta laccase in wood is large enough that it likely contributes to incipient decay.

  15. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants.

  16. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  17. Fruiting Body Formation in Basidiomycetes

    NARCIS (Netherlands)

    Pelkmans, J.F.; Lugones, L.G.; Wosten, H.A.B.

    2016-01-01

    Establishment of the dikaryotic mycelium and formation of fruiting bodies are highly complex developmental programmes that are activated by a combination of environmental cues. A wide variety of proteins are expected to regulate and coordinate these programmes or to fulfil enzymatic conversions or

  18. Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologues, Lim15/Dmc1, but does not stimulate its strand transfer activity

    International Nuclear Information System (INIS)

    Hamada, Fumika N.; Koshiyama, Akiyo; Namekawa, Satoshi H.; Ishii, Satomi; Iwabata, Kazuki; Sugawara, Hiroko; Nara, Takayuki Y.; Sakaguchi, Kengo; Sawado, Tomoyuki

    2007-01-01

    PCNA is a multi-functional protein that is involved in various nuclear events. Here we show that PCNA participates in events occurring during early meiotic prophase. Analysis of protein-protein interactions using surface plasmon resonance indicates that Coprinus cinereus PCNA (CoPCNA) specifically interacts with a meiotic specific RecA-like factor, C. cinereus Lim15/Dmc1 (CoLim15) in vitro. The binding efficiency increases with addition of Mg 2+ ions, while ATP inhibits the interaction. Co-immunoprecipitation experiments indicate that the CoLim15 protein interacts with the CoPCNA protein in vitro and in the cell extracts. Despite the interaction between these two factors, no enhancement of CoLim15-dependent strand transfer activity by CoPCNA was found in vitro. We propose that the interaction between Lim15/Dmc1 and PCNA mediates the recombination-associated DNA synthesis during meiosis

  19. Immunomics of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Abts, Kendra C; Ivy, Jamie A; DeWoody, J Andrew

    2015-06-01

    The study of the koala transcriptome has the potential to advance our understanding of its immunome--immunological reaction of a given host to foreign antigens--and to help combat infectious diseases (e.g., chlamydiosis) that impede ongoing conservation efforts. We used Illumina sequencing of cDNA to characterize genes expressed in two different koala tissues of immunological importance, blood and spleen. We generated nearly 600 million raw sequence reads, and about 285 million of these were subsequently assembled and condensed into ~70,000 subcomponents that represent putative transcripts. We annotated ~16% of these subcomponents and identified those related to infection and the immune response, including Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), major histocompatibility complex (MHC) genes, and koala retrovirus (KoRV). Using phylogenetic analyses, we identified 29 koala genes in these target categories and report their concordance with currently accepted gene groups. By mapping multiple sequencing reads to transcripts, we identified 56 putative SNPs in genes of interest. The distribution of these SNPs indicates that MHC genes (34 SNPs) are more diverse than KoRV (12 SNPs), TLRs (8 SNPs), or RLRs (2 SNPs). Our sequence data also indicate that KoRV sequences are highly expressed in the transcriptome. Our efforts have produced full-length sequences for potentially important immune genes in koala, which should serve as targets for future investigations that aim to conserve koala populations.

  20. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  1. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  2. Basidiomycete allergens: comparison of three Ganoderma species.

    Science.gov (United States)

    Horner, W E; Helbling, A; Lehrer, S B

    1993-02-01

    High atmospheric concentrations of basidiospores occur in various parts of the world. Ganoderma basidiospores are distinctive, easily identifiable in aeroallergen surveys, and widely abundant. Previous studies showed that Ganoderma basidiospores caused respiratory allergies. Thus, we investigated various extracts (spore, cap, and/or mycelial) of G. meredithae, G. lucidum, and G. applanatum for allergen components. Analyses included radioallergosorbent test (RAST) inhibition and IgE blots from isoelectric focusing (IEF) and SDS-PAGE. RAST inhibition with spores and caps of G. meredithae and G. lucidum showed that spores inhibited caps better than caps inhibited spores. Species differences were minor. Coomassie blue (CB) staining of IEF gels detected at least 23 protein bands (pI 3.6-6.6) in caps of G. meredithae and G. lucidum. G. meredithae spore extracts contained 17 of these (pI 3.6-5.0, 6.6). Spores and caps of G. meredithae contained 13 and 11 allergen bands, respectively, on IEF blots. SDS-PAGE of G. meredithae spore and cap showed one and four bands, respectively, by CB staining, but IgE blots showed 13 bands in cap and 17 in spore. Culture mycelia of G. lucidum and G. applanatum attained significant and essentially constant RAST activity by day 4. Activity was also present in culture supernatant by day 4. Blots of mycelium and supernatant detected a single allergen in day-8 mycelia and subsequently six allergen bands in day-16 mycelia and eight in day-16 supernatant (one appeared as a doublet). These data show that Ganoderma extracts contain a complex mixture of allergens. Differences among species were minor; spores and mycelia are apparently better sources of allergens than caps.

  3. Adiciones al catálogo micológico de Madeira (Portugal). II. Registro de 23 especies nuevas.

    OpenAIRE

    Diego Calonge, Francisco de; Menezes de Sequeira, Miguel; Aguiar, G.; Rocha, E.

    2008-01-01

    [EN] 23 species of fungi are mentioned and commented, collected in Madeira island, which are new for the catalogue. These are the following: 5 Ascomycota: Chlorosplenium aeruginascens, Coccomyces delta, Gyromitra esculenta, Leotia atrovirens, Otidea anotica and 18 Basidiomycota: Agrocybe arvalis, Chroogomphus rutilis, Clitocybe phyllophila, Conocybe brunneola, Coprinus angulatus, Coprinus disseminatus, Coprinus lagopus, Coprinus radiatus, Coprinus romagnesianus, Entoloma nidorosum, Gamundia s...

  4. Diversification of fungal specific class a glutathione transferases in saprotrophic fungi.

    Science.gov (United States)

    Mathieu, Yann; Prosper, Pascalita; Favier, Frédérique; Harvengt, Luc; Didierjean, Claude; Jacquot, Jean-Pierre; Morel-Rouhier, Mélanie; Gelhaye, Eric

    2013-01-01

    Glutathione transferases (GSTs) form a superfamily of multifunctional proteins with essential roles in cellular detoxification processes and endogenous metabolism. The distribution of fungal-specific class A GSTs was investigated in saprotrophic fungi revealing a recent diversification within this class. Biochemical characterization of eight GSTFuA isoforms from Phanerochaete chrysosporium and Coprinus cinereus demonstrated functional diversity in saprotrophic fungi. The three-dimensional structures of three P. chrysosporium isoforms feature structural differences explaining the functional diversity of these enzymes. Competition experiments between fluorescent probes, and various molecules, showed that these GSTs function as ligandins with various small aromatic compounds, derived from lignin degradation or not, at a L-site overlapping the glutathione binding pocket. By combining genomic data with structural and biochemical determinations, we propose that this class of GST has evolved in response to environmental constraints induced by wood chemistry.

  5. Diversification of fungal specific class a glutathione transferases in saprotrophic fungi.

    Directory of Open Access Journals (Sweden)

    Yann Mathieu

    Full Text Available Glutathione transferases (GSTs form a superfamily of multifunctional proteins with essential roles in cellular detoxification processes and endogenous metabolism. The distribution of fungal-specific class A GSTs was investigated in saprotrophic fungi revealing a recent diversification within this class. Biochemical characterization of eight GSTFuA isoforms from Phanerochaete chrysosporium and Coprinus cinereus demonstrated functional diversity in saprotrophic fungi. The three-dimensional structures of three P. chrysosporium isoforms feature structural differences explaining the functional diversity of these enzymes. Competition experiments between fluorescent probes, and various molecules, showed that these GSTs function as ligandins with various small aromatic compounds, derived from lignin degradation or not, at a L-site overlapping the glutathione binding pocket. By combining genomic data with structural and biochemical determinations, we propose that this class of GST has evolved in response to environmental constraints induced by wood chemistry.

  6. Notas sobre Afiloforales colombianos (Basidiomycetes: Aphyllophoralles Notas sobre Afiloforales colombianos (Basidiomycetes: Aphyllophoralles

    Directory of Open Access Journals (Sweden)

    Henao Luis Guillermo

    1989-09-01

    Full Text Available Some notes and a brief diagnostic description are provided for 19 species of Aphyllophorales. The following 15 species are new reports for the Colombian mycota: Thelephora palmata, Coltricia perennis, C. cinnamomea. Cyclomyces tabacinus, Phellinus rimosus, Dentinum repandum, Clavaria laeticolor, C. zollingeri, Polyporus dictyopus, Trametes membranaceus, T scabrosa, T. villosa, Trichaptum nebularis, Tyromyces duracinus and T. stipticus. Se proporcionan algunas notas y una descripción diagnóstica de 19 especies de Afiloforales colombianos. Las siguientes 15 especies se registran por primera vez en la micota colombiana: Thelephora pelmata, Coltricia perennis, C. cinnamomea, Cyclomyces tabacinus, Phellinus rimosus, Dentinum repandum, Clavaria laeticolor, C. zollingeri, Polyporus dictyopus, Trametes membranaceus, T. scabrosa, T villosa, Trichaptum nebuleris, Tyromyces duracinus y T stipticus.

  7. Chemical characterization of milk oligosaccharides of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Urashima, Tadasu; Taufik, Epi; Fukuda, Rino; Nakamura, Tadashi; Fukuda, Kenji; Saito, Tadao; Messer, Michael

    2013-11-01

    Previous structural characterizations of marsupial milk oligosaccharides had been performed in only two macropod species, the tammar wallaby and the red kangaroo. To clarify the homology and heterogeneity of milk oligosaccharides among marsupial species, which could provide information on their evolution, the oligosaccharides of the koala milk carbohydrate fraction were characterized in this study. Neutral and acidic oligosaccharides were separated from the carbohydrate fraction of milk of the koala, a non-macropod marsupial, and characterized by (1)H-nuclear magnetic resonance spectroscopy. The structures of the neutral saccharides were found to be Gal(β1-4)Glc (lactose), Gal(β1-3)Gal(β1-4)Glc (3'-galactosyllactose), Gal(β1-3)Gal(β1-3)Gal(β1-4)Glc (3',3″-digalactosyllactose), Gal(β1-3)[Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (lacto-N-novopentaose I) and Gal(β1-3){Gal(β1-4)[Fuc(α1-3)]GlcNAc(β1-6)}Gal(β1-4)Glc (fucosyl lacto-N-novopentaose I), while those of the acidic saccharides were Neu5Ac(α2-3)Gal(β1-4)Glc (3'-SL), Neu5Ac(α2-3)Gal(β1-3)Gal(β1-4)Gal (sialyl 3'-galactosyllactose), Neu5Ac(α2-3)Gal(β1-3)[Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose a), Gal(β1-3)[Neu5Ac(α2-6)Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose b), Gal(β1-3)[Neu5Ac(α2-3)Gal(β1-4)GlcNAc(β1-6)]Gal(β1-4)Glc (sialyl lacto-N-novopentaose c), and Neu5Ac(α2-3)Gal(β1-3){Gal(β1-4)[Fuc(α1-3)]GlcNAc(β1-6)}Gal(β1-4)Glc (fucosyl sialyl lacto-N-novopentaose a). The neutral oligosaccharides, other than fucosyl lacto-N-novopentaose I, a novel hexasaccharide, had been found in milk of the tammar wallaby, a macropod marsupial, while the acidic oligosaccharides, other than fucosyl sialyl lacto-N-novopentaose a had been identified in milk carbohydrate of the red kangaroo. The presence of fucosyl oligosaccharides is a significant feature of koala milk, in which it differs from milk of the tammar wallaby and the red kangaroo.

  8. Coprinuslactone protects the edible mushroom Coprinus comatus against biofilm infections by blocking both quorum-sensing and MurA.

    OpenAIRE

    de Carvalho, Maira P; Gulotta, Giuseppe; do Amaral, Matheus W; Lünsdorf, Heinrich; Sasse, Florenz; Abraham, Wolf-Rainer

    2016-01-01

    Pathogens embedded in biofilms are involved in many infections and are very difficult to treat with antibiotics because of higher resistance compared to planktonic cells. Therefore, new approaches for their control are urgently needed. One way to search for biofilm dispersing compounds is to look at defense strategies of organisms exposed to wet environments, which makes them prone to biofilm infections. It is reasonable to assume that mushrooms have developed mechanisms to control biofilms o...

  9. Production of antibacterial peptide from bee venom via a new strategy for heterologous expression.

    Science.gov (United States)

    Hou, Chunsheng; Guo, Liqiong; Lin, Junfang; You, Linfeng; Wu, Wuhua

    2014-12-01

    Honey bee is important economic insect that not only pollinates fruits and crops but also provides products with various physiological activities. Bee venom is a functional agent that is widely applied in clinical treatment and pharmacy. Secapin is one of these agents that have a significant role in therapy. The functions of secapin from the bee venom have been documented, but little information is known about its heterologous expression under natural condition. Moreover, few scholars verified experimentally the functions of secapin from bee venom in vitro. In this study, we successfully constructed a heterologous expression vector, which is different from conventional expression system. A transgenic approach was established for transformation of secapin gene from the venom of Apis mellifera carnica (Ac-sec) into the edible fungi, Coprinus cinereus. Ac-sec was encoded by a 234 bp nucleotide that contained a signal peptide domain and two potential phosphorylation sites. The sequence exhibited highly homology with various secapins characterized from honey bee and related species. Southern blot data indicated that Ac-sec was present as single or multiple copy loci in the C. cinereus genome. By co-transformation and double-layer active assay, Ac-sec was expressed successfully in C. cinereus and the antibacterial activity of the recombinants was identified, showing notable antibacterial activities on different bacteria. Although Ac-sec is from the venom of Apidae, phylogenetic analysis demonstrated that Ac-sec was more closely related to that of Vespid than to bee species from Apidae. The molecular characteristics of Ac-sec and the potential roles of small peptides in biology were discussed.

  10. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  11. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  12. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  13. Lanostane triterpenoids from the Sri Lankan basidiomycete Ganoderma applanatum.

    Science.gov (United States)

    de Silva, E Dilip; van der Sar, Sonia A; Santha, R G Lalith; Wijesundera, Ravi L C; Cole, Anthony L J; Blunt, John W; Munro, Murray H G

    2006-08-01

    Two new lanostane-type triterpenoids, 3alpha,16alpha-dihydroxylanosta-7,9(11),24-trien-21-oic acid (1) and 3alpha,16alpha,26-trihydroxylanosta-7,9(11),24-trien-21-oic acid (2), along with three known lanostanoids, 16alpha-hydroxy-3-oxolanosta-7,9(11),24-trien-21-oic acid (3), 3alpha-carboxyacetoxy-24-methylen-23-oxolanost-8-en-26-oic acid (4), and 3alpha-carboxyacetoxy-24-methyl-23-oxolanost-8-en-26-oic acid (5), have been isolated from the EtOAc extract of the fruiting body of Ganoderma applanatum. The structures of 1, 2, and 3 were determined directly by the interpretation of spectroscopic data, while the structures of 4 and 5 were assigned by comparison of spectroscopic data against literature values.

  14. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  15. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  16. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.

    2009-01-01

    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  17. Removal of cadmium by pleurotus sajor-caju basidiomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Cihangir, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Science; Saglam, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Education

    1999-11-01

    The bioaccumulation of cadmium by the white rot fungus Pleurotus sajor-caju onto dry biomass was investigated using aqueous media with concentrations in the range of 0.125 mM-1.0 mM. The highest cadmium uptake (between 88.9 and 91.8%) was observed with aerobic fungal biomass from the exponential growth phase. Up to 1.0 mM cadmium gradually inhibited mycelium development, but never blocked it completely. Freeze-dried, oven-dried and non-metabolizing live Pleurotus sajor-caju biomass types were tested for their capacity to adsorb the test ion Cd{sup 2+} within the pH range of 4.5 to 6.0. Freeze-dried biomass proved to be the most efficient biomass type for Cd{sup 2+} metal adsorption. Therefore, Pleurotus sajor-caju may be used for heavy metal removal and bioremediation. (orig.)

  18. Sorption of heavy metals by four basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dey, S. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Rao, P.R.N. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India); Bhattacharyya, B.C. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Bandyopadhyay, M. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India)

    1995-04-01

    Biosorptions of Pb{sup 2+}, Cr{sup 6+}, Cd{sup 2+} and Ni{sup 2+} were investigated, with special emphasis on the first one, using live and dead fungal mycelia. Of the four fungi, namely Polyporus ostreiformis, Volvariella volvacea, Pleurotus sajor-caju and Phanerochaete chrysosporium, the last one was found to be most effective in Pb{sup 2+} removal. Total biosorption was effected in 6 days up to the Pb{sup 2+} concentration of 6 mg/l, with a specific uptake of 1.33 mg Pb{sup 2+}/g dry cell mass. The removal of other three metals varied between 28.8-73.3% from a medium containing 4 mg/l of each of the metals. (orig.)

  19. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

    Science.gov (United States)

    Yitzhak Hadar; Daniel Cullen

    2013-01-01

    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  20. Revision of the genus Xerula Maire (Basidiomycetes, Agaricales in Poland

    Directory of Open Access Journals (Sweden)

    Anna Ronikier

    2011-01-01

    Full Text Available Data concerning morphology, ecology and distribution of Polish representatives of the genus Xerula Maire are discussed in the paper. All available specimens of X. pudens and X. melanotricha from Polish herbaria were reexamined to verify their identity and geographical distribution. Several new localities of X. melanotricha in the country are provided. A key to European taxa of the genus is proposed.

  1. A new species of Pleurocollybia (Tricholomataceae; Agaricales; Basidiomycetes) from Belize

    Science.gov (United States)

    T.J. Baroni; N. Bocsusis; D.J. Lodge; D.L. Lindner

    2008-01-01

    A new species, Pleurocollybia imbricata, is described from the Maya Mountains of Belize and a new combination in Pleurocollybia is proposed. A key to the known species of Pleurocollybia is also provided.

  2. Flagelloscypha minutissima (Basidiomycetes, a new for Poland minute cyphellaceous fungus

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2011-01-01

    Full Text Available The first records of Flagelloscypha minutissima (Burt Donk are reported from Poland, being easternmost on the European continent. A brief description and illustration of the species based on Polish specimens are given and its ecology, distribution, and taxonomy are surveyed.

  3. New taxa of Entoloma (Basidiomycetes, Agaricales) from Estonia and Karelia

    NARCIS (Netherlands)

    Noordeloos, Machiel E.; Liiv, Vello

    1992-01-01

    Nine new species of Entoloma are described from the Islands of Saaremaa and Vormsi, Estonia, viz. E. conocybecystis, E. leochromus, E. mutabilipes, E. ochromicaceum, E. politoflavipes, E. rhynchocystidiatum, E. roseotinctum, E. viiduense, and E. violaceozonatum. Entoloma lactarioides is described as

  4. Microsatellite markers for the diploid Basidiomycete fungus, Armillaria mellea

    Science.gov (United States)

    We isolated and characterized 13 microsatellite markers for two North American populations (California and Pennsylvania) of Armillaria mellea, a fungal root pathogen responsible for Armillaria root disease of numerous horticultural crops and forest trees. The frequency of alleles ranged from two to...

  5. Prevalence of transcription factors in ascomycete and basidiomycete fungi

    NARCIS (Netherlands)

    Todd, Richard B; Zhou, M.; Ohm, Robin A; Leeggangers, Hendrika A C F; Visser, Loek; de Vries, Ronald P; van den Brink, J.

    2014-01-01

    BACKGROUND: Gene regulation underlies fungal physiology and therefore is a major factor in fungal biodiversity. Analysis of genome sequences has revealed a large number of putative transcription factors in most fungal genomes. The presence of fungal orthologs for individual regulators has been

  6. Prevalence of transcription factors in ascomycete and basidiomycete fungi

    NARCIS (Netherlands)

    Todd, Richard B.; Zhou, Miaomiao; Ohm, Robin A.; Leeggangers, Melissa; Visser, Loek; Vries, De Ronald P.

    2014-01-01

    Gene regulation underlies fungal physiology and therefore is a major factor in fungal biodiversity. Analysis of genome sequences has revealed a large number of putative transcription factors in most fungal genomes. The presence of fungal orthologs for individual regulators has been analysed and

  7. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    pollution. Most of these dyes are stable to light, temperature, and highly resistant to degradation (O’Neill et al. 1999). Several physico-chemical methods such as adsorption, pre- cipitation, chemical oxidation, photodegradation, or membrane filtration have...), which are toxic, mutagenic, and possibly carcinogenic (Pinheiro et al. 2004). Several actinomycetes have been reported to decolor- ize reactive dyes, including anthraquinone, phthalo- cyanine, and azo dyes, through adsorption of the dyes to the cellular...

  8. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  9. Use of Fungi in Biodegradation of Basidiomycetes Textile Effluents

    OpenAIRE

    Souza, Aline Francisca; Universidade Estadual de Londrina; Rosado, Fábio Rogério; Cesumar

    2009-01-01

    Textile industries have contributed significantly to environmental contamination, due to the production of waste with low levels of degradation, including colors from the dyeing steps, effluent being discarded with intense color. This type of effluent has a very variable composition, due to the diversity of colors used daily. There are physical and chemical treatments for these wastes, however the biological treatments have been highlighting for being natural, not requiring the use of chemica...

  10. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  11. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  12. Improving production of laccase from novel basidiomycete with ...

    African Journals Online (AJOL)

    Three variables (sucrose, MgSO4 and CuSO4) were found to affect laccase production significantly by P-B screening. B-B design with three-factor at three levers was performed to explain the combined effects of the three medium constituents. The optimum medium consisted of sucrose (4.26 g/L), yeast powder (15 g/L), ...

  13. Studies on the genus Entoloma (Basidiomycetes, Agaricales) in Kerala State, India (Basidiomycetes, Agaricales) in Kerala State, India

    NARCIS (Netherlands)

    Manimohan, P.; Noordeloos, M.E.; Dhanya, A.M.

    2006-01-01

    Fifteen new taxa are described from Kerala State, India, based on collections made by the first author. Three taxa fit subgenus Pouzarella (E. testaceostrigosum, E. violaceovillosum, and E. dysthales var. keralense). Four species are described as having cuboid spores (E. albidoquadratum, E.

  14. NMR Studies of Peroxidases.

    Science.gov (United States)

    Veitch, Nigel Charles

    Available from UMI in association with The British Library. Requires signed TDF. Peroxidases are a haem-containing group of enzymes with a wide diversity of function within biological systems. While a common characteristic is the ability to catalyse the conversion of hydrogen peroxide to water, it is the accompanying processes of hormone synthesis and degradation which have generated such a high level of interest. However, information at the molecular level is limited to a single well-resolved crystal structure, that of yeast cytochrome c peroxidase. This thesis presents a strategy for the investigation of peroxidase structure and function based on proton nuclear magnetic resonance spectroscopy, a technique which has the ability to address aspects of both protein structure and protein dynamics in solution. The application of one- and two-dimensional NMR techniques has been developed in the context of plant peroxidases, notably the isoenzyme HRP-C derived from the horseradish root. Characterisation of the proton NMR spectra of HRP -C in resting and ligated states provided new information enabling the structure of the binding site for aromatic donor molecules, such as indole-3-propionic, ferulic and benzhydroxamic acids, to be resolved. In order to overcome difficulties encountered with a protein of the complexity of peroxidase, additional information was obtained from chemical shift parameters and the use of peroxidase variants produced by site-directed mutagenesis. A comparative study using NMR spectroscopy was undertaken for wild-type recombinant HRP-C expressed in Escherichia coli, and two protein variants with substitutions made to residues located on the distal side of the haem pocket, Phe41 to Val and Arg38 to Lys. NMR analyses of a plant peroxidase from barley grains and the fungal peroxidase from Coprinus cinereus were also successful using methods conceived with HRP-C. Examination of three specifically constructed recombinant protein variants of C. cinereus

  15. Scale-up fermentation of oil palm empty fruit bunch to produce ruminant feed by radiation processing

    International Nuclear Information System (INIS)

    Awang, M.R.; Mutaat, H.H.; Deres, R.M.; Kume, Tamikazu.

    1992-01-01

    Scale-up fermentation and irradiation conditions of empty fruit bunch (EFB) of oil palm were examined to produce a large amount of fermented products for animal feeds. The EFB substrates pasteurized by irradiation were inoculated with Coprinus cinereus. After 1 month incubation, the crude fiber contents decreased to 20 - 38% and crude protein contents increased to 9 - 13% in small scale fermentation using conical flask (6 - 20 g EFB). In the case of fermentation using polypropylene bags with 400 g EFB, crude fiber and protein contents were 32 - 34% and 11 - 14%, respectively. A larger plastic container packed with 1.5 kg EFB fiber of 10cm thickness was used for mushroom cultivation. After harvest of mushroom (yields were about 250 g per container), the quality of residual substrates improved further as reflected by its crude fiber content of only 16 - 20%, crude protein content of 6 - 8%. These results show that a large volume of products are available under the good aeration by increasing the number of plastic bags or containers. For the irradiation of a lot of fermentation substrates, the advantage of 60 Co gamma-ray and electron beam irradiator was also discussed. (author)

  16. Development of an integrated enzymatic treatment system for phenolic waste streams.

    Science.gov (United States)

    Mao, X; Buchanan, I D; Stanley, S J

    2006-12-01

    An integrated enzymatic treatment system, which includes Coprinus cinereus peroxidase (CIP) production, processing, and usage in batch or plug flow reactors, is being developed to remove phenolic compounds from the aqueous waste streams. CIP production at bench scale yielded a maximum growth medium activity of approximately 60 U CIP ml(-1). A CIP enzyme solution was prepared for use in treatment by successive filtration steps. This yielded a 4.5-fold increase in enzyme activity, with 87% enzyme activity recovery, and 83% reduction in the solution's Chemical Oxygen Demand. The purity of CIP was observed to have no effect on the ability of the enzyme to remove phenol from the aqueous solutions within the range of enzyme solution purities tested. Contrary to observations reported for phenol removal from buffered solutions, the addition of polyethylene glycol to non-buffered reaction solutions had no positive effect on the phenol removal accomplished at pH 7 in these experiments. The efficiency of enzyme use in a plug flow reactor was improved by step additions of CIP and H2O2.

  17. In vitro activity of chloramphenicol, florfenicol and enrofloxacin against Chlamydia pecorum isolated from koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Black, L A; Higgins, D P; Govendir, M

    2015-11-01

    To determine the in vitro susceptibilities of koala isolates of Chlamydia pecorum to enrofloxacin and chloramphenicol, which are frequently used to treat koalas with chlamydiosis, and florfenicol, a derivative of chloramphenicol. The in vitro susceptibilities were determined by culturing three stored isolates and seven clinical swabs of C. pecorum. Susceptibility testing was undertaken using cycloheximide-treated buffalo green monkey kidney cells in 96 well microtitre plates. The minimum inhibitory concentrations (MICs) for all isolates were 0.25-0.50 µg/mL (enrofloxacin), 1-2 µg/mL (chloramphenicol), and 1-2 µg/mL (florfenicol). Minimum bactericidal concentration (MBC) values for five isolates were also determined and were within one two-fold dilution of MICs. The MICs and MBCs of these antimicrobials were within ranges previously reported for other chlamydial species. When combined with previously published pharmacokinetic data, the in vitro susceptibility results support chloramphenicol as a more appropriate treatment option than enrofloxacin for koalas with chlamydiosis. The susceptibility results also indicate florfenicol may be an appropriate treatment option for koalas with chlamydiosis, warranting further investigation. © 2015 Australian Veterinary Association.

  18. Assessment of florfenicol as a possible treatment for chlamydiosis in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Budd, C; Flanagan, C; Gillett, A; Hanger, J; Loader, J J; Govendir, M

    2017-09-01

    Because of limited availability of chloramphenicol to veterinary suppliers, a preliminary study was performed to predict whether an analogue, florfenicol, is an efficacious treatment for chlamydiosis in koalas. Florfenicol was administered to koalas with naturally occurring chlamydiosis at 20 mg/kg SC (n = 3) and at 5 mg/kg (n = 3) and 10 mg/kg (n = 3) IV. The estimated areas under the plasma concentration versus time curves (AUC) were compared with the minimum inhibitory concentration to inhibit Chlamydia pecorum. Clinical data were also examined from field trials conducted on koalas (n = 19) with naturally occurring chlamydiosis and treated with florfenicol at a range of dosages (5-20 mg/kg SC and 6-15 mg/kg IV). Florfenicol binding to proteins in plasma was also determined. Florfenicol was not detectable in plasma 24 h post-administration at 20 mg/kg SC. The estimated AUC 0-24 h following administration at 10 mg/kg IV suggests florfenicol might be effective against Chlamydia spp. via this route. Florfenicol binding to plasma proteins was 13.0% (± 0.30 SEM). After treatment with florfenicol in field trials, 5 of 19 koalas (26%) were released without further treatment, 4 with no long-term follow-up; 6 (32%) required additional treatment with chloramphenicol to resolve chlamydiosis; 7 (36%) failed to clinically improve, of which 3 had clinical signs and/or necropsy findings suggestive of antibiotic-related gastrointestinal dysbiosis; another koala died within minutes of florfenicol administered IV at 7 mg/kg. When administered at dosages tolerable in the field, florfenicol is a problematic treatment for chlamydiosis based on equivocal outcomes and plasma concentrations below those that inhibit the pathogen. © 2017 Australian Veterinary Association.

  19. Some pharmacokinetic indices of oral fluconazole administration to koalas (Phascolarctos cinereus) infected with cryptococcosis.

    Science.gov (United States)

    Govendir, M; Black, L A; Jobbins, S E; Kimble, B; Malik, R; Krockenberger, M B

    2016-08-01

    Three asymptomatic koalas serologically positive for cryptococcosis and two symptomatic koalas were treated with 10 mg/kg fluconazole orally, twice daily for at least 2 weeks. The median plasma Cmax and AUC0-8 h for asymptomatic animals were 0.9 μg/mL and 4.9 μg/mL·h, respectively; and for symptomatic animals 3.2 μg/mL and 17.3 μg/mL·h, respectively. An additional symptomatic koala was treated with fluconazole (10 mg/kg twice daily) and a subcutaneous amphotericin B infusion twice weekly. After 2 weeks the fluconazole Cmax was 3.7 μg/mL and the AUC0-8 h was 25.8 μg/mL*h. An additional three koalas were treated with fluconazole 15 mg/kg twice daily for at least 2 weeks, with the same subcutaneous amphotericin protocol co-administered to two of these koalas (Cmax : 5.0 μg/mL; mean AUC0-8 h : 18.1 μg/mL*h). For all koalas, the fluconazole plasma Cmax failed to reach the MIC90 (16 μg/mL) to inhibit C. gattii. Fluconazole administered orally at either 10 or 15 mg/kg twice daily in conjunction with amphotericin is unlikely to attain therapeutic plasma concentrations. Suggestions to improve treatment of systemic cryptococcosis include testing pathogen susceptibility to fluconazole, monitoring plasma fluconazole concentrations, and administration of 20-25 mg/kg fluconazole orally, twice daily, with an amphotericin subcutaneous infusion twice weekly. © 2015 The Authors. Journal of Veterinary Pharmacology and Therapeutics Published by John Wiley & Sons Ltd.

  20. Identification of MHCII variants associated with chlamydial disease in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Quintin Lau

    2014-06-01

    Full Text Available Chlamydiosis, the most common infectious disease in koalas, can cause chronic urogenital tract fibrosis and infertility. High titres of serum immunoglobulin G against 10 kDa and 60 kDa chlamydial heat-shock proteins (c-hsp10 and c-hsp60 are associated with fibrous occlusion of the koala uterus and uterine tube. Murine and human studies have identified associations between specific major histocompatibility complex class II (MHCII alleles or genotypes, and higher c-hsp 60 antibody levels or chlamydia-associated disease and infertility. In this study, we characterised partial MHCII DAB and DBB genes in female koalas (n = 94 from a single geographic population, and investigated associations among antibody responses to c-hsp60 quantified by ELISA, susceptibility to chlamydial infection, or age. The identification of three candidate MHCII variants provides additional support for the functional role of MHCII in the koala, and will inform more focused future studies. This is the first study to investigate an association between MHC genes with chlamydial pathogenesis in a non-model, free-ranging species.

  1. Concentrations of thyroid hormones and iodothyronine binding proteins in serum of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Lawson, V J; Curtis, A J; Michelangeli, V P; Stockigt, J R; Carrick, F N; Barlow, J W

    1996-07-01

    To examine circulating total and free thyroid hormone (T3 and T4) concentrations, determine serum iodothyronine binding characteristics and estimate thyroid stimulating hormone (TSH) activity in sera of coastal and inland koalas. A prospective study. Koala serum T3 and T4 were measured by radioimmunoassay. T4 binding parameters were determined by radioligand binding and electrophoresis. Koala TSH values were determined by bioassay. Mean total T4 concentrations were 3.2 +/- 2.1 nM although values were significantly higher in inland-dwelling females in comparison to coastal-dwelling males. Free T4 was 3.3 +/- 2.1 pM. Total and free T3 were 0.4 +/- 0.2 nM and 1.4 +/- 0.9 pM respectively, although these values were at the lower end of the assay detection limit and should be viewed with reservation. Electrophoresis of [125I]-T4-labelled serum revealed only two proteins of electrophoretic mobility similar to human transthyretin (TTR) and albumin. Scatchard analysis of T4 binding to serum gave a curvilinear plot, which could be resolved into two binding sites with affinities identical to that of TTR and albumin but both of low concentration. The bioactivity of the TSH present in the sera was measured using a cell line (JP09) transfected with the human TSH receptor. The mean level of stimulation found in the sera corresponded to a bovine TSH activity of less than 10 mU/L. These results suggest that the serum concentrations of free and total thyroid hormones in koalas are low compared to other marsupials and very low compared to eutherian mammals. The mechanism of maintenance of euthyroidism in this species remains to be determined.

  2. The anatomy and histology of the nasal cavity of the koala (Phascolarctos cinereus).

    OpenAIRE

    Kratzing, J E

    1984-01-01

    The anatomy of the nose of the koala was studied from fixed 0.5 cm thick sections of a whole head. Right and left nasal cavities are separated by a slender septum which does not exhibit 'swell bodies'. Dorsal and ventral conchae are simple curved plates without elaborate scrolls; the ventral concha is recurved to form a bulla. The nasal cavity communicates with confluent rostral maxillary and frontal air sinuses. A ventrocaudal maxillary sinus opens from the ventral meatus close to the choana...

  3. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus in Southeast Queensland

    Directory of Open Access Journals (Sweden)

    Emily Burton

    2016-09-01

    Full Text Available Koala populations in southeast Queensland are under threat from many factors, particularly habitat loss, dog attack, vehicle trauma and disease. Animals not killed from these impacts are often rescued and taken into care for rehabilitation, and eventual release back to the wild if deemed to be healthy. This study investigated current rescue, rehabilitation and release data for koalas admitted to the four major wildlife hospitals in southeast Queensland (Australia Zoo Wildlife Hospital (AZWH, Currumbin Wildlife Sanctuary Hospital (CWH, Moggill Koala Hospital (MKH and the Royal Society for the Prevention Against Cruelty to Animals Wildlife Hospital at Wacol (RSPCA, and suggests aspects of the practice that may be changed to improve its contribution to the preservation of the species. It concluded that: (a the main threats to koalas across southeast Queensland were related to urbanization (vehicle collisions, domestic animal attacks and the disease chlamydiosis; (b case outcomes varied amongst hospitals, including time spent in care, euthanasia and release rates; and (c the majority (66.5% of rescued koalas were either euthanized or died in care with only 27% released back to the wild. The results from this study have important implications for further research into koala rescue and rehabilitation to gain a better understanding of its effectiveness as a conservation strategy.

  4. Perception of Male Caller Identity in Koalas (Phascolarctos cinereus): Acoustic Analysis and Playback Experiments

    Science.gov (United States)

    Charlton, Benjamin D.; Ellis, William A. H.; McKinnon, Allan J.; Brumm, Jacqui; Nilsson, Karen; Fitch, W. Tecumseh

    2011-01-01

    The ability to signal individual identity using vocal signals and distinguish between conspecifics based on vocal cues is important in several mammal species. Furthermore, it can be important for receivers to differentiate between callers in reproductive contexts. In this study, we used acoustic analyses to determine whether male koala bellows are individually distinctive and to investigate the relative importance of different acoustic features for coding individuality. We then used a habituation-discrimination paradigm to investigate whether koalas discriminate between the bellow vocalisations of different male callers. Our results show that male koala bellows are highly individualized, and indicate that cues related to vocal tract filtering contribute the most to vocal identity. In addition, we found that male and female koalas habituated to the bellows of a specific male showed a significant dishabituation when they were presented with bellows from a novel male. The significant reduction in behavioural response to a final rehabituation playback shows this was not a chance rebound in response levels. Our findings indicate that male koala bellows are highly individually distinctive and that the identity of male callers is functionally relevant to male and female koalas during the breeding season. We go on to discuss the biological relevance of signalling identity in this species' sexual communication and the potential practical implications of our findings for acoustic monitoring of male population levels. PMID:21633499

  5. Characterisation of four major histocompatibility complex class II genes of the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Lau, Quintin; Jobbins, Sarah E; Belov, Katherine; Higgins, Damien P

    2013-01-01

    Major histocompatibility complex (MHC) class II molecules have an integral role in the adaptive immune response, as they bind and present antigenic peptides to T helper lymphocytes. In this study of koalas, species-specific primers were designed to amplify exon 2 of the MHC class II DA and DB genes, which contain much of the peptide-binding regions of the α and β chains. A total of two DA α1 domain variants and eight DA β1 (DAB), three DB α1 and five DB β1 variants were amplified from 20 koalas from two free-living populations from South East Queensland and the Port Macquarie region in northern New South Wales. We detected greater variation in the β1 than in the α1 domains as well as evidence of positive selection in DAB. The present study provides a springboard to future investigation of the role of MHC in disease susceptibility in koalas.

  6. Perception of male caller identity in Koalas (Phascolarctos cinereus: acoustic analysis and playback experiments.

    Directory of Open Access Journals (Sweden)

    Benjamin D Charlton

    Full Text Available The ability to signal individual identity using vocal signals and distinguish between conspecifics based on vocal cues is important in several mammal species. Furthermore, it can be important for receivers to differentiate between callers in reproductive contexts. In this study, we used acoustic analyses to determine whether male koala bellows are individually distinctive and to investigate the relative importance of different acoustic features for coding individuality. We then used a habituation-discrimination paradigm to investigate whether koalas discriminate between the bellow vocalisations of different male callers. Our results show that male koala bellows are highly individualized, and indicate that cues related to vocal tract filtering contribute the most to vocal identity. In addition, we found that male and female koalas habituated to the bellows of a specific male showed a significant dishabituation when they were presented with bellows from a novel male. The significant reduction in behavioural response to a final rehabituation playback shows this was not a chance rebound in response levels. Our findings indicate that male koala bellows are highly individually distinctive and that the identity of male callers is functionally relevant to male and female koalas during the breeding season. We go on to discuss the biological relevance of signalling identity in this species' sexual communication and the potential practical implications of our findings for acoustic monitoring of male population levels.

  7. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Timms Peter

    2011-04-01

    Full Text Available Abstract Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58, we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine-detailed molecular marker for epidemiological analysis appears justified, the tarP and ORF663 genes also appear to be valuable markers of phylogenetic or biogeographic divisions at the C. pecorum intra-species level. This research has significant implications for future typing studies to understand the phylogeny, genetic diversity, and epidemiology of C. pecorum infections in the koala and other animal species.

  8. Reliable genotyping of the koala (Phascolarctos cinereus) using DNA isolated from a single faecal pellet.

    Science.gov (United States)

    Wedrowicz, Faye; Karsa, Mawar; Mosse, Jennifer; Hogan, Fiona E

    2013-07-01

    The koala, an Australian icon, has been added to the threatened species list. Rationale for the listing includes proposed declines in population size, threats to populations (e.g. disease) and loss and fragmentation of habitat. There is now an urgent need to obtain accurate data to assess the status of koala populations in Australia, to ensure the long-term viability of this species. Advances in genetic techniques have enabled DNA analysis to study and inform the management of wild populations; however, sampling of individual koalas is difficult in tall, often remote, eucalypt forest. The collection of faecal pellets (scats) from the forest floor presents an opportunistic sampling strategy, where DNA can be collected without capturing or even sighting an individual. Obtaining DNA via noninvasive sampling can be used to rapidly sample a large proportion of a population; however, DNA from noninvasively collected samples is often degraded. Factors influencing DNA quality and quantity include environmental exposure, diet and methods of sample collection, storage and DNA isolation. Reduced DNA quality and quantity can introduce genotyping errors and provide inaccurate DNA profiles, reducing confidence in the ability of such data to inform management/conservation strategies. Here, we present a protocol that produces a reliable individual koala genotype from a single faecal pellet and highlight the importance of optimizing DNA isolation and analysis for the species of interest. This method could readily be adapted for genetic studies of mammals other than koalas, particularly those whose diet contains high proportions of volatile materials that are likely to induce DNA damage. © 2013 John Wiley & Sons Ltd.

  9. Can Citizen Science Assist in Determining Koala (Phascolarctos cinereus Presence in a Declining Population?

    Directory of Open Access Journals (Sweden)

    Emily Flower

    2016-07-01

    Full Text Available The acceptance and application of citizen science has risen over the last 10 years, with this rise likely attributed to an increase in public awareness surrounding anthropogenic impacts affecting urban ecosystems. Citizen science projects have the potential to expand upon data collected by specialist researchers as they are able to gain access to previously unattainable information, consequently increasing the likelihood of an effective management program. The primary objective of this research was to develop guidelines for a successful regional-scale citizen science project following a critical analysis of 12 existing citizen science case studies. Secondly, the effectiveness of these guidelines was measured through the implementation of a citizen science project, Koala Quest, for the purpose of estimating the presence of koalas in a fragmented landscape. Consequently, this research aimed to determine whether citizen-collected data can augment traditional science research methods, by comparing and contrasting the abundance of koala sightings gathered by citizen scientists and professional researchers. Based upon the guidelines developed, Koala Quest methodologies were designed, the study conducted, and the efficacy of the project assessed. To combat the high variability of estimated koala populations due to differences in counting techniques, a national monitoring and evaluation program is required, in addition to a standardised method for conducting koala population estimates. Citizen science is a useful method for monitoring animals such as the koala, which are sparsely distributed throughout a vast geographical area, as the large numbers of volunteers recruited by a citizen science project are capable of monitoring a similarly broad spatial range.

  10. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Marsh, James; Kollipara, Avinash; Timms, Peter; Polkinghorne, Adam

    2011-04-18

    Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58), we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Three genes (incA, ORF663, tarP) were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. While the continued use of ompA as a fine-detailed molecular marker for epidemiological analysis appears justified, the tarP and ORF663 genes also appear to be valuable markers of phylogenetic or biogeographic divisions at the C. pecorum intra-species level. This research has significant implications for future typing studies to understand the phylogeny, genetic diversity, and epidemiology of C. pecorum infections in the koala and other animal species.

  11. Validation of ultrasonography in detecting structural disease of the urogenital tract of the koala, Phascolarctos cinereus.

    Science.gov (United States)

    Marschner, C; Flanagan, C; Higgins, D P; Krockenberger, M B

    2014-05-01

    A retrospective review of case records of ultrasonography and necropsy outcomes of 62 koalas was used to investigate the accuracy of ultrasonography in assessing koala urogenital tract structural disease at the Port Macquarie Koala Hospital. The results showed high concordance, supporting ultrasonography as an effective tool for evaluating structural disease of the koala urogenital tract, most commonly seen with chlamydiosis. The study also illustrates the advances benefiting animal welfare that can be made by wildlife carer groups through using a scientific, evidence-based approach. © 2014 Australian Veterinary Association.

  12. A Survey of Pesticide Accumulation in a Specialist Feeder, the Koala (Phascolarctos cinereus).

    Science.gov (United States)

    Marschner, Caroline; Higgins, Damien P; Krockenberger, Mark B

    2017-09-01

    To maintain profitability in Australia's agricultural and urban landscapes pesticides are used throughout the range of koala habitats. The koala is a specialist feeder, reliant on metabolic enzyme capacities to utilise a toxic diet of eucalypt leaves and is potentially prone to adverse effects when xenobiotic interactions between dietary and anthropogenic xenobiotics occur. The aim of this study was to investigate accumulation of frequently used pesticides in wild koalas in 4 areas of New South Wales and Queensland. Liver samples of 57 deceased koalas were collected from care facilities and analysed using a modified QuEChERS extraction method followed by GCMSMS, HRLCMS and LCMSMS. No accumulation of any of the 166 investigated pesticides was found. Data indicate hepatic accumulation of pesticides in this species is uncommon even with close interactions with intensive land use. Despite the lack of hepatic bioaccumulation, this study cannot exclude a direct effect on hepatocellular metabolic pathways.

  13. Fungi from koala (Phascolarctos cinereus) faeces exhibit a broad range of enzyme activities against recalcitrant substrates.

    Science.gov (United States)

    Peterson, R A; Bradner, J R; Roberts, T H; Nevalainen, K M H

    2009-02-01

    Identification of fungi isolated from koala faeces and screening for their enzyme activities of biotechnological interest. Thirty-seven fungal strains were isolated from koala faeces and identified by the amplification and direct sequencing of the internal transcribed spacer (ITS) region of the ribosomal DNA. The fungi were screened for selected enzyme activities using agar plates containing a single substrate for each target class of enzyme. For xylanase, endoglucanase, ligninase (ligninolytic phenoloxidase) and protease over two-thirds of the isolates produced a clearing halo at 25 degrees C, indicating the secretion of active enzyme by the fungus, and one-third produced a halo indicating amylase, mannanase and tannase activity. Some isolates were also able to degrade crystalline cellulose and others displayed lipase activity. Many of the fungal isolates also produced active enzymes at 15 degrees C and some at 39 degrees C. Koala faeces, consisting of highly lignified fibre, undigested cellulose and phenolics, are a novel source of fungi with high and diverse enzyme activities capable of breaking down recalcitrant substrates. To our knowledge, this is the first time fungi from koala faeces have been identified using ITS sequencing and screened for their enzyme activities.

  14. Activity patterns of free-ranging koalas (Phascolarctos cinereus revealed by accelerometry.

    Directory of Open Access Journals (Sweden)

    Michelle A Ryan

    Full Text Available An understanding of koala activity patterns is important for measuring the behavioral response of this species to environmental change, but to date has been limited by the logistical challenges of traditional field methodologies. We addressed this knowledge gap by using tri-axial accelerometer data loggers attached to VHF radio collars to examine activity patterns of adult male and female koalas in a high-density population at Cape Otway, Victoria, Australia. Data were obtained from 27 adult koalas over two 7-d periods during the breeding season: 12 in the early-breeding season in November 2010, and 15 in the late-breeding season in January 2011. Multiple 15 minute observation blocks on each animal were used for validation of activity patterns determined from the accelerometer data loggers. Accelerometry was effective in distinguishing between inactive (sleeping, resting and active (grooming, feeding and moving behaviors. Koalas were more active during the early-breeding season with a higher index of movement (overall dynamic body acceleration [ODBA] for both males and females. Koalas showed a distinct temporal pattern of behavior, with most activity occurring from mid-afternoon to early morning. Accelerometry has potential for examining fine-scale behavior of a wide range of arboreal and terrestrial species.

  15. The zona pellucida of the koala (Phascolarctos cinereus): its morphogenesis and thickness

    Science.gov (United States)

    Chapman, Jamie A; Leigh, Christopher M; Breed, William G

    2006-01-01

    In this study the ultrastructural organization of the koala oocyte and the thickness of the surrounding extracellular coat, the zona pellucida, has been determined to ascertain whether there is coevolution of the morphology of the female gamete with that of the highly divergent male gamete that is found in this marsupial species. Ovaries from several adult koalas were obtained and prepared for transmission electron microscopy. Oocytes in large tertiary follicles were somewhat smaller than those of most other marsupials, although their ultrastructural organization appeared similar and included many yolk vesicles. The zona pellucida surrounding the oocytes in tertiary follicles was approximately 8 µm thick and thus is of similar thickness to that of some eutherian mammals but at least twice as thick as that of most marsupial species so far studied. The results indicate that the koala oocyte is unusually small for a marsupial species whereas the zona pellucida is, by contrast, much thicker. How this relates to sperm–egg interaction at the time of fertilization has yet to be determined. PMID:16928207

  16. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus) in Southeast Queensland

    OpenAIRE

    Burton, Emily; Tribe, Andrew

    2016-01-01

    Simple Summary Little is understood about the overall success of current wildlife rehabilitation techniques and the implications of these as an effective conservation strategy. This study collated admission records from four major wildlife hospitals catering to sick and injured koalas across southeast Queensland from 2009 to 2014, and analyzed specific factors that may be important when quantifying the extent and effectiveness of this work. The study found koalas to be at an increased risk fr...

  17. The Rescue and Rehabilitation of Koalas (Phascolarctos cinereus) in Southeast Queensland.

    Science.gov (United States)

    Burton, Emily; Tribe, Andrew

    2016-09-15

    Koala populations in southeast Queensland are under threat from many factors, particularly habitat loss, dog attack, vehicle trauma and disease. Animals not killed from these impacts are often rescued and taken into care for rehabilitation, and eventual release back to the wild if deemed to be healthy. This study investigated current rescue, rehabilitation and release data for koalas admitted to the four major wildlife hospitals in southeast Queensland (Australia Zoo Wildlife Hospital (AZWH), Currumbin Wildlife Sanctuary Hospital (CWH), Moggill Koala Hospital (MKH) and the Royal Society for the Prevention Against Cruelty to Animals Wildlife Hospital at Wacol (RSPCA)), and suggests aspects of the practice that may be changed to improve its contribution to the preservation of the species. It concluded that: (a) the main threats to koalas across southeast Queensland were related to urbanization (vehicle collisions, domestic animal attacks and the disease chlamydiosis); (b) case outcomes varied amongst hospitals, including time spent in care, euthanasia and release rates; and (c) the majority (66.5%) of rescued koalas were either euthanized or died in care with only 27% released back to the wild. The results from this study have important implications for further research into koala rescue and rehabilitation to gain a better understanding of its effectiveness as a conservation strategy.

  18. Seasonal reproduction in wild and captive male koala (Phascolarctos cinereus) populations in south-east Queensland.

    Science.gov (United States)

    Allen, Camryn D; de Villiers, Deidré L; Manning, Brett D; Dique, David S; Burridge, Michelle; Chafer, Mandy L; Nicolson, Vere N; Jago, Sophia C; McKinnon, Allan J; Booth, Rosemary J; McKee, Jeff J; Pyne, Michael J; Zee, Yeng Peng; Lundie-Jenkins, Geoff; Theilemann, Peter; Wilson, Richard J; Carrick, Frank N; Johnston, Stephen D

    2010-01-01

    The effects of breeding season (late spring to early autumn) on south-east Queensland male koala fertility were examined to improve the efficacy of the AI procedure and to determine the practicality of using free-range animals as semen donors for a genome resource bank. Seasonal changes in male koala reproductive function were assessed in a wild free-range population (n = 14; obtained every 6 weeks from January to November 2005), a necropsied healthy wild population (n = 84; obtained monthly from September 2004 to August 2005) and a captive population (n = 7; obtained monthly from October 2005 to October 2006). Reproductive parameters investigated included bodyweight, coat score, sternal gland area and activity, testosterone secretion, reproductive anatomy volume and semen quality (before and after cryopreservation). Collectively, these findings show that reproduction in male koalas from south-east Queensland changes seasonally and that winter appears to be the optimal season in which to collect semen samples by electroejaculation. While it was possible to repeatedly collect semen from free-range koalas for future genetic management via potential storage in a genome resource bank, the survival of these spermatozoa after cryopreservation was poor and will require further improvement.

  19. Upgrading of oil palm wastes to animal feeds

    Energy Technology Data Exchange (ETDEWEB)

    Kume, Tamikazu (Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment)

    1994-01-01

    A huge amount of agricultural wastes are discarded or burned causing the serious environmental pollution problems in the world. Upgrading of these wastes into useful end-products is suggested not only to recycle the agro-resources but also to reduce pollution. Empty fruit bunch (EFB), stalk material after fruit stripping, is a major cellulosic waste of the palm oil industry. The current availability of EFB in Malaysia is estimated to be 3 million tones per year. EFB is normally incinerated to produce bunch ash. Burning and incineration processes emit considerable amount of smokes and pollutants thus affecting surrounding areas. Recently, it has been realized that there is a need to utilize these by-products effectively in order to improve the economic situation of the oil palm industry as well as to reduce pollution problems. EFB is a valuable and useful biomass. This paper describes the production of animal feed and mushroom from oil palm wastes by radiation and fermentation treatment. The process is as follows: decontamination of microorganisms in fermentation media of EFB by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 30 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, Coprinus cinereus and Pleurotus sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased and the crude fiber content decreased after solid state fermentation. P.sajor-caju was suitable for the mushroom production on EFB with rich bran and the residue can be used as the ruminant animal feeds. It is expected that the process is applicable to other cellulosic wastes such as sugar cane bagasse, rice straw, etc. produced in other Asian countries, and contribute to reduce the environmental pollution problems. (author).

  20. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90 ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  1. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  2. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi

    Science.gov (United States)

    Dana L. Richter; Jessie A. Glaeser

    2015-01-01

    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  3. Biological pretreatment of sugarcane bagasse with basidiomycetes producing varied patterns of biodegradation.

    Science.gov (United States)

    Machado, Angela da Silva; Ferraz, André

    2017-02-01

    This work evaluated sugarcane bagasse pretreatment with wood-decay fungi, producing varied patterns of biodegradation. The overall mass balance of sugars released after pretreatment and enzymatic hydrolysis indicated that a selective white-rot was necessary to provide glucose yields similar to the ones observed from leading physico-chemical pretreatment technologies. The selective white-rot Ceriporiopsis subvermispora was selective for lignin degradation in the lignocellulosic material, preserved most of the glucan fraction, and increased the cellulose digestibility of biotreated material. Glucose mass balances indicated that of the potential glucose of untreated bagasse, 47% was recovered as sugar-rich syrup after C. subvermispora biotreatment for 60days followed by enzymatic digestion of the pretreated material. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. The multigene family of fungal laccases and their expression in the white rot basidiomycete Flammulina velutipes.

    Science.gov (United States)

    Wang, Wei; Liu, Fang; Jiang, Yuji; Wu, Guangmei; Guo, Lixian; Chen, Renliang; Chen, Bingzhi; Lu, Yuanping; Dai, Yucheng; Xie, Baogui

    2015-06-01

    Fungal laccases play important roles in matrix degradation. Eleven laccase genes, including three novel ones (designated lac1, lac2 and lac4) were identified after sequencing the entire genome of the edible, white-rot fungus Flammulina velutipes. Analysis using bioinformatics revealed that all of the laccases, except lac3, possess a signal peptide. These laccase proteins consist of 502-670 amino acids and have predicted molecular weights ranging from 55kDa to 74kDa. These proteins each contain four copper-binding sites, except for Lac10. Transcriptomes were sequenced at different developmental stages and in different fruiting body tissues to analyze if there was differential expression of laccase genes. The novel laccase gene lac4 exhibited the highest expression levels among all of the observed laccases at every developmental stage and in all fruiting body tissues examined. We conclude that laccases in F. velutipes play a role not only in lignin degradation, but also in fruiting body formation and development. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Genetic resources and mycelial characteristics of several medicinal polypore mushrooms (Polyporales, Basidiomycetes).

    Science.gov (United States)

    Badalyan, Susanna M; Shnyreva, Alla V; Iotti, Mirco; Zambonelli, Alessandra

    2015-01-01

    Mycelial characteristics of dikaryotic collections of 6 medicinal polypore mushrooms (Fomes fomentarius, Fomitopsis pinicola, Ganoderma adspersum, G. applanatum, G. lucidum, and G. resinaceum) with different geographical origins (Armenia, China, France, Iran, Italy, and Russia) were screened. A total of 42 polypore collections were molecularly identified by sequencing the internal transcribed spacer region of the ribosomal RNA genes' cluster, and a phylogenetic tree was constructed. Morphological characteristics of 37 cultures were observed on agar media (malt extract agar, potato dextrose agar) at different temperatures (25, 30, 35, and 38°C) at a pH of 6.0. Colony morphology, pigmentation of mycelium and agar, mycelial growth rate, in vitro teleomorph formation, and other macromorphological characteristics were thoroughly described and illustrated. Micromorphological features of mycelia, such as different hyphal structures, clamp cells, presence and type of asexual sporulation, chlamydospores, and others were observed. The taxonomic significance of the mycelial characteristics revealed was estimated. The obtained results will assist further biotechnological cultivation of medicinal polypore mushrooms to develop novel health care biotechnological products.

  6. Effects of Selenium Presence in Mycelia of Ganoderma species (Higher Basidiomycetes) on Their Medicinal Properties.

    Science.gov (United States)

    Milovanović, Ivan; Stajić, Mirjana; Stanojković, Tatjana; Knežević, Aleksandar; Vukojević, Jelena

    2015-01-01

    This study aimed to research the antifungal, antioxidant, and cytotoxic potential of Ganoderma applanatum and Ganoderma lucidum mycelial extracts as well as the possible effect of Se enrichment on these activities. Both Se-enriched and nonenriched extracts of G. applanatum and G. lucidum showed fungi static activity, while a fungicidal effect was not noted. The extracts exhibited significant 1,1-diphenyl-2-picryl-hydrazil radical scavenging capacity, while the effect of Se on this potential was stimulatory in G. applanatum (1.3%-33.9% without Se and 3.1%-67.1% in Se enrichment) and inhibitory in G. lucidum (1.4%-71.6% and 1.3%-48.6% without and with Se, respectively). Only phenols in G. applanatum and phenols and flavonoids in G. lucidum were holders of antioxidant activity. Cytotoxic activity against both HeLa and LS174 cell lines was very low in comparison with cis-diamminedichloroplatinum.

  7. Salinity induced effects on the growth rates and mycelia composition of basidiomycete and zygomycete fungi.

    Science.gov (United States)

    Venâncio, C; Pereira, R; Freitas, A C; Rocha-Santos, T A P; da Costa, J P; Duarte, A C; Lopes, I

    2017-12-01

    Soil salinization, as the combination of primary and secondary events, can adversely affect organisms inhabiting this compartment. In the present study, the effects of increased salinity were assessed in four species of terrestrial fungi: Lentinus sajor caju, Phanerochaete chrysosporium, Rhizopus oryzae and Trametes versicolor. The mycelial growth and biochemical composition of the four fungi were determined under three exposure scenarios: 1) exposure to serial dilutions of natural seawater (SW), 2) exposure to serial concentrations of NaCl (potential surrogate of SW); and 3) exposure to serial concentrations of NaCl after a period of pre-exposure to low levels of NaCl. The toxicity of NaCl was slightly higher than that of SW, for all fungi species: the conductivities causing 50% of growth inhibition (EC 50 ) were within 14.9 and 22.0 mScm -1 for NaCl and within 20.2 and 34.1 mScm -1 for SW. Phanerochaete chrysosporium showed to be the less sensitive species, both for NaCl and SW. Exposure to NaCl caused changes in the biochemical composition of fungi, mainly increasing the production of polysaccharides. When fungi were exposed to SW this pattern of biochemical response was not observed. Fungi pre-exposed to low levels of salinity presented higher EC 50 than fungi non-pre-exposed, though 95% confidence limits overlapped, with the exception of P. chrysosporium. Pre-exposure to low levels of NaCl also induced changes in the biochemical composition of the mycelia of L. sajor caju and R. oryzae, relatively to the respective control. These results suggest that some terrestrial fungi may acquire an increased tolerance to NaCl after being pre-exposed to low levels of this salt, thus, suggesting their capacity to persist in environments that will undergo salinization. Furthermore, NaCl could be used as a protective surrogate of SW to derive safe salinity levels for soils, since it induced toxicity similar or higher than that of SW. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Biological treatment of the effluent from a bleached kraft pulp mill using basidiomycete and zygomycete fungi.

    Science.gov (United States)

    Freitas, A C; Ferreira, F; Costa, A M; Pereira, R; Antunes, S C; Gonçalves, F; Rocha-Santos, T A P; Diniz, M S; Castro, L; Peres, I; Duarte, A C

    2009-05-01

    Three white-rot fungi (Pleurotus sajor caju, Trametes versicolor and Phanerochaete chrysosporium) and one soft-rot fungi (Rhizopus oryzae) species confirmed their potential for future applications in the biological treatment of effluents derived from the secondary treatment of a bleached kraft pulp mill processing Eucalyptus globulus. Among the four species P. sajor caju and R. oryzae were the most effective in the biodegradation of organic compounds present in the effluent, being responsible for the reduction of relative absorbance (25-46% at 250 nm and 72-74% at 465 nm) and of chemical oxygen demand levels (74 to 81%) after 10 days of incubation. Laccase (Lac), lignin (Lip) and manganese peroxidases (MnP) expression varied among fungal species, where Lac and LiP activities were correlated with the degradation of organic compounds in the effluent treated with P. sajor caju. The first two axes of a principal component analysis explained 88.9% of the total variation among sub-samples treated with the four fungus species, after different incubation periods. All the variables measured contributed positively to the first component except for the MnP enzyme activity which was the only variable contributing negatively to the first component. Absorbances at 465 nm, LiP and Lac enzyme activities were the variables with more weight on the second component. P. sajor caju revealed to be the only species able to perform the biological treatment without promoting an increment in the toxicity of the effluent to the Vibrio fischeri, as it was assessed by the Microtox assay. The opposite was recorded for the treatments with the other three species of fungus. EC(50-5 min) values ranging between 28 and 57% (effluent concentrations) were recorded even after 10 to 13 days of treatment with P. chrysosporium, R. oryzae or with T. versicolor.

  9. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  10. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available the importance of screening to select superior fungal strains for use in biopulping. Under the specific pulping conditions of the screening trials, 38 strains of white-rot fungi were tested that were more suitable than the reference strains of P. chrysosporium...

  11. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  12. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.

    2017-01-01

    canopy gaps in oak forests. In one of the last remaining Quercus ilex L. old-growth forests (on the island of Corsica, western Mediterranean basin), we systematically recorded and conducted molecular analyses of X. subpileatus basidiomes in 80 dated natural canopy gaps representing a 45-year long...... sequence of residence time of tree logs on the forest floor. Xylobolus subpileatus fruited exclusively on Q. ilex logs. The probability of fruiting of X. subpileatus significantly increases during the process of wood decomposition to reach its maximum in the oldest gaps, approximately 40 years after......Documenting succession in forest canopy gaps provides insights into the ecological processes governing the temporal dynamics of species within communities. We analyzed the fruiting patterns of a rare but widely distributed saproxylic macromycete, Xylobolus subpileatus, during the ageing of natural...

  13. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.

    2009-01-01

    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  14. Molecular data show that Omphalina foliacea is a lichen-forming basidiomycete

    Czech Academy of Sciences Publication Activity Database

    Palice, Zdeněk; Schmitt, I.; Lumbsch, H. T.

    2005-01-01

    Roč. 109, č. 4 (2005), s. 447-451 ISSN 0953-7562 Institutional research plan: CEZ:AV0Z60050516 Keywords : basidiolichens * molecular phylogeny * LSU DNA Subject RIV: EF - Botanics Impact factor: 1.572, year: 2005

  15. The histogenesis of Bulb and trama tissue of the higher Basidiomycetes and its phylogenetic implications

    NARCIS (Netherlands)

    Reijnders, A.F.M.

    1977-01-01

    At the base of the stipe in Agaricales basal plectenchyma is found which may enlarge to form a bulb. This tissue is not homogeneous. It is characterized by peculiar configurations: free tips of branches, sinuous hyphae, loops, spirals and rings (sometimes enclosing another hypha) and hyphal knots.

  16. Gerronema wildpretii sp. nov. (Agaricales, Basidiomycetes) a new species from the Canary Islands.

    Science.gov (United States)

    Bañares, Angel; Beltrán, Esperanza; Bon, Marcel

    2006-01-01

    Gerronema wildpretii, collected in climactic sites of the monteverde forest of the Canary Islands is described and illustrated. Its macro- and microscopic features delimit this taxon as a new species.

  17. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  18. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  19. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455 ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  20. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80 ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  1. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  2. The community structure of macroscopic basidiomycetes (Fungi in Brazilian mangroves influenced by temporal and spatial variations

    Directory of Open Access Journals (Sweden)

    Georgea Santos Nogueira-Melo

    2014-12-01

    Full Text Available Mangroves are transitional ecosystems between terrestrial and marine environments, and are distinguished by a high abundance of animals, plants, and fungi. Although macrofungi occur in different types of habitat, including mangroves, little is known about their community structure and dynamic. Therefore the aim of this study was to analyze the diversity of macrofungi in a number of Brazilian mangroves, and the relationship between such diversity, precipitation and area of collection. A total of 32 field trips were undertaken from 2009 to 2010, and macrofungi were studied in four 250×40m transects: Timbó and Santa Cruz Channel on the Northern coast, and Maracaípe and Ariquindá on the Southern coast. All basidiomata found along the transects were placed in paper bags, air-dried and identified using existing literature. It was found that Northern areas predominantly featured Avicennia schaueriana mangroves, while Rhizophora mangle dominated in Southern transects. A total of 275 specimens were collected, and 33 species, 28 genera, 14 families and six orders were represented. Overall abundance and species richness did not vary significantly among areas, but varied according to time, being higher during the rainy season. Subtle differences in composition were observed over time and between areas, probably due to variations in plant species occurrence. Further studies with collections during months of greater precipitation in transects dominated by different mangrove species of the same ecosystem are suggested to assess the overall diversity of mycobiota in these ecosystems.

  3. Basidiomycetes capability to degrade endosulfan and chlorpyrifos in a complex matrix

    OpenAIRE

    Niell, Silvina; Heinzen, Horacio; Cesio, Verónica; Rivero, Anisleidy; Pareja, Lucía; Cerdeiras, M. Pía

    2012-01-01

    Los hongos de la podredumbre blanca y marrón de la madera han demostrado presentar una alta capacidad para degradar compuestos xenobióticos. Estas propiedades están determinadas por la batería de enzimas extracelulares que pueden transformar los compuestos a CO2 y H2O. Compuestos como el endosulfán y el clorpirifós han sido considerados en Uruguay de importancia dado su uso indiscriminado en los cultivos agrícolas como la soja, cereales, frutas, entre otros. Estos compuestos son considerados ...

  4. Activities of chitinolytic enzymes during primary and secondary colonization of wood by basidiomycetous fungi.

    Science.gov (United States)

    Lindahl, Björn D; Finlay, Roger D

    2006-01-01

    The nitrogen (N) content of wood is usually suboptimal for fungal colonization. During decomposition of wood, an increasing fraction of the N becomes incorporated into fungal mycelium. Between 5 and 50% of the N in wood-degrading mycelium may be incorporated into chitin. Chitinolytic enzymes render this N available for re-utilization. Here, the activities of chitinolytic enzymes produced by wood-rotting fungi during degradation of spruce (Picea abies) wood were quantified in situ using fluorogenic 4-methylumbelliferyl substrates. A new method was developed that enables spatial quantification of enzyme activities on solid surfaces. All of the three tested fungi produced endochitinases, chitobiosidases and N-acetylhexosaminidases during colonization of wood. N-acetylhexosaminidase activity, and in some cases also chitobiosidase and endochitinase activities, were higher during secondary overgrowth of another fungus than during primary colonization of noncolonized wood. The results suggest that wood-degrading fungi degrade their own cell walls as well as the hyphae of earlier colonizers. Recycling of cell wall material within single mycelia and between fungal individuals during succession may lead to retention of N within woody debris.

  5. Evidence of natural hybridization among homothallic members of the basidiomycete Armillaria mellea

    Science.gov (United States)

    Populations of Armillaria mellea (Basidiomycota, Agaricales, Physalacriaceae) across much of its geographic range are heterothallic; homothallic populations are reported only from Africa (A. mellea ssp. africana), China [China Biological Species (CBS) G], and Japan (A. mellea ssp. nipponica). Monos...

  6. Antioxidant Properties of the Edible Basidiomycete Armillaria mellea in Submerged Cultures

    Directory of Open Access Journals (Sweden)

    Ming-Yeou Lung

    2011-09-01

    Full Text Available Antioxidant components, ascorbic acid, total flavonoids and total phenols are produced effectively by Armillaria mellea submerged cultures. Dried mycelia and mycelia-free broths obtained by A. mellea submerged cultures are extracted with methanol and hot water and investigated for antioxidant properties. Methanolic extracts from dried mycelia (MEM and mycelia-free broth (MEB and hot water extracts from dried mycelia (HWEM by A. mellea submerged cultures show good antioxidant properties as evidenced by low EC50 values (< 10 mg/mL. Total flavonoid is mainly found in hot water extracts; however, total phenol is rich in methanol and hot water extracts from mycelia. Ascorbic acid and total phenol contents are well correlated with the reducing power and the scavenging effect on superoxide anions. Total flavonoid content is dependent on the antioxidant activity and the chelating effect on ferrous ions. Total antioxidant component contents are closely related to the antioxidant activity and the scavenging superoxide anion ability. Results confirm that extracts with good antioxidant properties from fermenting products by A. mellea are potential good substitutes for synthetic antioxidants and can be applied to antioxidant-related functional food and pharmaceutical industries.

  7. Biodegradation and metabolite transformation of pyrene by basidiomycetes fungal isolate Armillaria sp. F022.

    Science.gov (United States)

    Hadibarata, Tony; Kristanti, Risky Ayu

    2013-04-01

    Armillaria sp. F022 is a white-rot fungus isolated from a tropical rain forest in Indonesia that is capable of utilizing pyrene as a source of carbon and energy. Enzymes production during the degradation process by Armillaria sp. F022 was certainly related to the increase in biomass. In the first week after incubation, the growth rate rapidly increased, but enzyme production decreased. After 7 days of incubation, rapid growth was observed, whereas, the enzymes were produced only after a good amount of biomass was generated. About 63 % of pyrene underwent biodegradation when incubated with this fungus in a liquid medium on a rotary shaker (120 rpm, 25 °C) for 30 days; during this period, pyrene was transformed to five stable metabolic products. These metabolites were extracted in ethyl acetate, isolated by column chromatography, and then identified using thin layer chromatography (TLC) and gas chromatography-mass spectrometry (GC-MS). 1-Hydroxypyrene was directly identified by GC-MS, while 4-phenanthroic acid, 1-hydroxy-2-naphthoic acid, phthalic acid, and protocatechuic acid were identified to be present in their derivatized forms (methylated forms and silylated forms). Protocatechuic acid was the end product of pyrene degradation by Armillaria sp. F022. Dynamic profiles of two key enzymes, namely laccase and 1,2-dioxygenase, were revealed during the degradation process, and the results indicated the presence of a complicated mechanism in the regulation of pyrene-degrading enzymes. In conclusion, Armillaria sp. F022 is a white-rot fungus with potential for application in the degradation of polycyclic aromatic hydrocarbons such as pyrene in the environment.

  8. Evidence of natural hybridization among homothallic members of the basidiomycete Armillaria mellea sensu stricto.

    Science.gov (United States)

    Baumgartner, Kendra; Baker, Bethany R; Korhonen, Kari; Zhao, Jun; Hughes, Karen W; Bruhn, Johann; Bowman, Tiffany S; Bergemann, Sarah E

    2012-06-01

    Populations of Armillaria mellea (Basidiomycota, Agaricales) across much of its range are heterothallic; homothallic populations occur only in Africa (A. mellea ssp. africana), China (China Biological Species CBS G), and Japan (A. mellea ssp. nipponica). Monosporous isolates of heterothallic A. mellea are haploid and their mating behaviour is consistent with the requirement of two different alleles at two mating-type loci (tetrapolar mating system) to create a diploid individual. In contrast, monosporous isolates of homothallic A. mellea are putatively diploid; they bypass the haploid phase by undergoing karyogamy in the basidium (a unique type of secondary homothallism/pseudohomothallism). In order to determine the genetic origin of this homothallism, we analyzed genetic variation of 47 heterothallic isolates from China, Europe, and North America, and 14 homothallic isolates from Africa, China, and Japan. Gene trees and mutational networks were constructed for partial mitochondrial gene ATP synthase subunit 6 (ATP6) and for the following nuclear genes: actin (ACTIN), elongation factor subunit 1-alpha (EFA), glyceraldehyde 3-phosphate dehydrogenase (GPD), and the RNA polymerase subunit II (RPB2). Homothallic isolates from Africa and Japan shared a common mitochondrial ATP6 haplotype with homothallic isolates from China, and are likely introductions. Homothallic isolates from China that shared a common mitochondrial haplotype with all European isolates did not share European nuclear haplotypes, as revealed by median-joining networks, but instead clustered with haplotypes from China or were intermediate between those of China and Europe. Such mitochondrial-nuclear discordance in homothallic isolates from China is indicative of hybridization between lineages originating from China and Europe. Copyright © 2012 British Mycological Society. All rights reserved.

  9. Antioxidant properties of the edible Basidiomycete Armillaria mellea in submerged cultures.

    Science.gov (United States)

    Lung, Ming-Yeou; Chang, Yu-Cheng

    2011-01-01

    Antioxidant components, ascorbic acid, total flavonoids and total phenols are produced effectively by Armillaria mellea submerged cultures. Dried mycelia and mycelia-free broths obtained by A. mellea submerged cultures are extracted with methanol and hot water and investigated for antioxidant properties. Methanolic extracts from dried mycelia (MEM) and mycelia-free broth (MEB) and hot water extracts from dried mycelia (HWEM) by A. mellea submerged cultures show good antioxidant properties as evidenced by low EC(50) values (<10 mg/mL). Total flavonoid is mainly found in hot water extracts; however, total phenol is rich in methanol and hot water extracts from mycelia. Ascorbic acid and total phenol contents are well correlated with the reducing power and the scavenging effect on superoxide anions. Total flavonoid content is dependent on the antioxidant activity and the chelating effect on ferrous ions. Total antioxidant component contents are closely related to the antioxidant activity and the scavenging superoxide anion ability. Results confirm that extracts with good antioxidant properties from fermenting products by A. mellea are potential good substitutes for synthetic antioxidants and can be applied to antioxidant-related functional food and pharmaceutical industries.

  10. Chemical constituents of Stereum subtomentosum and two other birch-associated basidiomycetes: An interspecies comparative study

    Czech Academy of Sciences Publication Activity Database

    Hybelbauerová, S.; Sejbal, J.; Dračínský, Martin; Hahnová, H.; Koutek, Bohumír

    2008-01-01

    Roč. 5, č. 5 (2008), s. 743-750 ISSN 1612-1872 Institutional research plan: CEZ:AV0Z40550506 Keywords : Stereum subtomentosum * Trametes versicolor * Piptoporus betulinus * steroids * saccharides Subject RIV: CC - Organic Chemistry Impact factor: 1.659, year: 2008

  11. Cryptococcus spencermartinsiae sp. nov., a basidiomycetous yeast isolated from glacial waters and apple fruits.

    Science.gov (United States)

    de García, Virginia; Brizzio, Silvia; Russo, Gabriel; Rosa, Carlos A; Boekhout, Teun; Theelen, Bart; Libkind, Diego; van Broock, María

    2010-03-01

    Seven strains representing a novel yeast species belonging to the genus Cryptococcus were isolated from different substrates from Patagonia, Argentina, and The Netherlands. Three strains were isolated from a meltwater river draining from the Frias glacier at Mount Tronador situated in Nahuel Huapi National Park (Patagonia) and four were isolated from apple surfaces in Randwijk, The Netherlands. Analysis of the D1/D2 large-subunit rRNA gene and ITS region sequences indicated that these strains represent a single species that is distinct from other species of the Tremellales clade. The name Cryptococcus spencermartinsiae sp. nov. is proposed to accommodate these strains. The type strain is CRUB 1230(T) (=CBS 10760(T) =DBVPG 8010(T)).

  12. Cryptococcus spencermartinsiae sp. nov., a basidiomycetous yeast isolated from glacial waters and apple fruits

    NARCIS (Netherlands)

    de Garcia, V.; Brizzio, S.; Russo, G.; Rosa, C.A.; Boekhout, T.; Theelen, B.J.F.; Libkind, D.; van Broock, M.

    2010-01-01

    Seven strains representing a novel yeast species belonging to the genus Cryptococcus were isolated from different substrates from Patagonia Argentina and The Netherlands. Three strains were isolates from a meltwater river draining from the Frias glacier at Mount Tronador situated in Nahuel Huapi

  13. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance

    Science.gov (United States)

    Dolores Linde; Francisco J. Ruiz-Dueñas; Elena Fernández-Fueyo; Victor Guallar; Kenneth E. Hammel; Rebecca Pogni; Angel T. Martínez

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus...

  14. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  15. Cd and Zn interactions and toxicity in ectomycorrhizal basidiomycetes in axenic culture

    Directory of Open Access Journals (Sweden)

    Vinicius H. De Oliveira

    2018-03-01

    Full Text Available Background Metal contamination in soils affects both above- and belowground communities, including soil microorganisms. Ectomycorrhizal (ECM fungi are an important component in belowground community and tolerant strains have great potential in enhancing plant-based remediation techniques. We assessed cadmium and zinc toxicity in five ECM species in liquid media (Hebeloma subsaponaceum; H. cylindrosporum; H. crustuliniforme; Scleroderma sp.; Austroboletus occidentalis and investigated the potential of Zn to alleviate Cd toxicity. Due to highly divergent results reported in the literature, liquid and solid media were compared experimentally for the first time in terms of differential toxicity thresholds in Cd and Zn interactions. Methods A wide range of Cd and Zn concentrations were applied to ectomycorrhizal fungi in axenic cultures (in mg L−1: 0; 1; 3; 9; 27; 81; 243 for the Cd treatments, and 0; 1; 30; 90; 270; 810; 2,430 for Zn. Combined Zn and Cd treatments were also applied to H. subsaponaceum and Scleroderma sp. Dry weight was recorded after 30 days, and in case of solid medium treatments, radial growth was also measured. Results and Discussion All species were adversely affected by high levels of Cd and Zn, and A. occidentalis was the most sensitive, with considerable biomass decrease at 1 mg L−1 Cd, while Scleroderma sp. and H. subsaponaceum were the most tolerant, which are species commonly found in highly contaminated sites. Cd was generally 10 times more toxic than Zn, which may explain why Zn had little impact in alleviating Cd effects. In some cases, Cd and Zn interactions led to a synergistic toxicity, depending on the concentrations applied and type of media used. Increased tolerance patterns were detected in fungi grown in solid medium and may be the cause of divergent toxicity thresholds found in the literature. Furthermore, solid medium allows measuring radial growth/mycelial density as endpoints which are informative and in this case appeared be related to the high tolerance indices found in H. subsaponaceum.

  16. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2,6-dichloroindophenol. While L. shimeji P2Ox is the least thermostable of these three enzymes (melting temperature Tm of 54.9°C; half-life time of activity τ1/2 of 0.12 at 50°C and pH 6.5, P. chrysosporium P2Ox showed remarkable thermostability with Tm of 75.4°C and τ1/2 of 96 h under identical conditions.

  17. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes).

    Science.gov (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik

    2009-09-01

    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  18. Copper sorption by native and modified pellets of wood-rotting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Baldrian, Petr; Hladíková, K.; Háková, M.

    2001-01-01

    Roč. 32, - (2001), s. 194-198 ISSN 0266-8254 R&D Projects: GA ČR GA204/99/1528 Institutional research plan: CEZ:A53/98:Z5-020-9ii Subject RIV: EE - Microbiology , Virology Impact factor: 1.151, year: 2001

  19. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    .0°N latitude, 72.0° to 73.0°E longitude) off the west coast of India in the Arabian Sea. Within 2 h after collection, discs (0.5-cm diameter) cut from the sea grass leaves were surface sterilized in 0.5% sodium hypochlorite for 3 min (42), washed... components of low-nitrogen (LN) medium (13), 1.5 g of Instant Ocean (IO) salts (24) (Instant Ocean of Aquarium System, Mentor, Ohio),2gofBacto Agar (Difco), 0.02% Poly-R, 10,000 U of sodium benzylpenicillin, and 0.05 g of streptomycin sulfate. One of the Poly...

  20. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  1. Evaluation of Anticholinesterase and Inflammation Inhibitory Activity of Medicinal Mushroom Phellinus pini (Basidiomycetes) Fruiting Bodies.

    Science.gov (United States)

    Im, Kyung Hoan; Nguyen, Trung Kien; Kim, Jae Kwang; Choi, Jae-Hyuk; Lee, Tae Soo

    2016-01-01

    Phellinus pini, a medicinal mushroom, has been used as folk medicine in Asian countries for treating ailments such as cancer and gastrointestinal diseases. In this study we evaluated in vitro the antidementia and anti-inflammatory activities of Ph. Pini fruiting bodies. Eleven phenol compounds were detected by high-performance liquid chromatography analysis. Acetylcholinesterase and butyrylcholinesterase inhibitory effects of a methanol extract and a hot water extract were moderate and comparable with those of galanthamine, the standard drug used to treat the early stages of Alzheimer's disease. The methanol extract had a neuroprotective effect against glutamate-induced cytotoxicity on PC-12 cells at concentration ranging from 20 to 40 µg/mL. The mushroom extracts also inhibited the production of nitric oxide and the expression of inducible nitric oxide synthase in lipopolysaccharide-induced RAW 264.7 macrophages, and they significantly inhibited in vivo carrageenan-induced hind-paw edema in rats. Therefore, it is suggested that Ph. Pini fruiting bodies possess anticholinesterase and anti-inflammatory effects.

  2. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products.

    Science.gov (United States)

    Uhnáková, Bronislava; Ludwig, Roland; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, Daniela; Křen, Vladimír; Haltrich, Dietmar; Martínková, Ludmila

    2011-10-01

    Tetrabromobisphenol A (TBBPA) degradation was investigated using white rot fungi and their oxidative enzymes. Strains of the Trametes, Pleurotus, Bjerkandera and Dichomitus genera eliminated almost 1 mM TBBPA within 4 days. Laccase, whose role in TBBPA degradation was demonstrated in fungal cultures, was applied to TBBPA degradation alone and in combination with cellobiose dehydrogenase from Sclerotium rolfsii. Purified laccase from Trametes versicolor degraded approximately 2 mM TBBPA within 5 h, while the addition of cellobiose dehydrogenase increased the degradation rate to almost 2.5 mM within 3 h. Laccase was used to prepare TBBPA metabolites 2,6-dibromo-4-(2-hydroxypropane-2-yl) phenol (1), 2,6-dibromo-4-(2-methoxypropane-2-yl) phenol (2) and 1-(3,5-dibromo-4-hydroxyphen-1-yl)-2,2',6,6'-tetrabromo-4,4'-isopropylidene diphenol (3). As compounds 1 and 3 were identical to the TBBPA metabolites prepared by using rat and human liver fractions (Zalko et al., 2006), laccase can provide a simple means of preparing these metabolites for toxicity studies. Products 1 and 2 exhibited estrogenic effects, unlike TBBPA, but lower cell toxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Decomposition, nitrogen and phosphorus mineralization from beech leaf litter colonized with ectomycorrhizal or litter decomposing basidiomycetes

    OpenAIRE

    COLPAERT, Jan; VAN TICHELEN, Katia

    1996-01-01

    The decomposition and the nitrogen and phosphorus mineralization of fresh beech (Fagus sylvatica L.) leaf litter are described. Leaves were buried for up to 6 months in plant containers in which Scots pine (Pinus sylvestris L.) seedlings were cultivated at a low rate of nutrient addition. The saprotrophic abilities of three ectomycorrhizal fungi, Thelephora terrestris Ehrh.: Fr., Suillus bovinus (L.: Fr.) O. Kuntze and Paxillus involutes (Batsch: Fr) Fr., were compared with the degradation ca...

  4. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  5. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415 ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  6. Chlamydiaceae and Chlamydia-like organisms in the koala (Phascolarctos cinereus)--organ distribution and histopathological findings.

    Science.gov (United States)

    Burach, Fabienne; Pospischil, Andreas; Hanger, Jon; Loader, Jo; Pillonel, Trestan; Greub, Gilbert; Borel, Nicole

    2014-08-06

    Chlamydial infections in koalas can cause life-threatening diseases leading to blindness and sterility. However, little is known about the systemic spread of chlamydiae in the inner organs of the koala, and data concerning related pathological organ lesions are limited. The aim of this study was to perform a thorough investigation of organs from 23 koalas and to correlate their histopathological lesions to molecular chlamydial detection. To reach this goal, 246 formalin-fixed and paraffin embedded organ samples from 23 koalas were investigated by histopathology, Chlamydiaceae real-time PCR and immunohistochemistry, ArrayTube Microarray for Chlamydiaceae species identification as well as Chlamydiales real-time PCR and sequencing. By PCR, two koalas were positive for Chlamydia pecorum whereas immunohistochemical labelling for Chlamydiaceae was detected in 10 tissues out of nine koalas. The majority of these (n=6) had positive labelling in the urogenital tract related to histopathological lesions such as cystitis, endometritis, pyelonephritis and prostatitis. Somehow unexpected was the positive labelling in the gastrointestinal tract including the cloaca as well as in lung and spleen indicating systemic spread of infection. Uncultured Chlamydiales were detected in several organs of seven koalas by PCR, and four of these suffered from plasmacytic enteritis of unknown aetiology. Whether the finding of Chlamydia-like organisms in the gastrointestinal tract is linked to plasmacytic enteritis is unclear and remains speculative. However, as recently shown in a mouse model, the gastrointestinal tract might play a role being the site for persistent chlamydial infections and being a source for reinfection of the genital tract. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Molecular characterisation and expression analysis of interferon gamma in response to natural Chlamydia infection in the koala, Phascolarctos cinereus.

    Science.gov (United States)

    Mathew, Marina; Pavasovic, Ana; Prentis, Peter J; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-09-25

    Interferon gamma (IFNγ) is a key Th1 cytokine, with a principal role in the immune response against intracellular organisms such as Chlamydia. Along with being responsible for significant morbidity in human populations, Chlamydia is also responsible for wide spread infection and disease in many animal hosts, with reports that many Australian koala subpopulations are endemically infected. An understanding of the role played by IFNγ in koala chlamydial diseases is important for the establishment of better prophylactic and therapeutic approaches against chlamydial infection in this host. A limited number of IFNγ sequences have been published from marsupials and no immune reagents to measure expression have been developed. Through preliminary analysis of the koala transcriptome, we have identified the full coding sequence of the koala IFNγ gene. Transcripts were identified in spleen and lymph node tissue samples. Phylogenetic analysis demonstrated that koala IFNγ is closely related to other marsupial IFNγ sequences and more distantly related to eutherian mammals. To begin to characterise the role of this important cytokine in the koala's response to chlamydial infection, we developed a quantitative real time PCR assay and applied it to a small cohort of koalas with and without active chlamydial disease, revealing significant differences in expression patterns between the groups. Description of the IFNγ sequence from the koala will not only assist in understanding this species' response to its most important pathogen but will also provide further insight into the evolution of the marsupial immune system. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. First report of a spermatic granuloma and varicocele in a marsupial: A Koala (Phascolarctos cinereus) Case Study.

    Science.gov (United States)

    Schultz, B K; Palmieri, C; Nicolson, V; Larkin, R; Keeley, T; McGowan, M; Johnston, S D

    2016-08-01

    This study reports the first documented clinical case of a spermatic granuloma and varicocele in a marsupial. Initial clinical presentation included gross morphological changes in the left scrotal cord, epididymis and testis. Ultrasonography of the scrotum and spermatic cord, and gross and histopathological examination after hemicastration, confirmed the condition as a spermatic granuloma affecting the left caput epididymis, with a varicocele in the left proximal spermatic cord, which was causing azoospermia and infertility. Semen quality and serum testosterone secretion following a GnRH challenge was assessed prior to, and following surgery. After hemi-castration, an increase in androgen secretion to within normal reference ranges for the koala was observed with a subsequent increase in semen production and sperm quality resulting in the sire of a pouch young, 12months later. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The first case of onychomycosis in a koala (Phascolarctos cinereus due to atypical isolates of Microsporum gypseum, a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Hossein Mirhendi

    2016-06-01

    Conclusion: To the best of our knowledge, the present report is the first confirmed case of dermatophytosis in a koala. The genetics underlying a variety of phenotypic traits in most classical dermatophyte species are unknown, and further studies are needed to understand this phenomenon. 

  10. Dimethylacetamide can be used as an alternative to glycerol for the successful cryopreservation of koala (Phascolarctos cinereus) spermatozoa.

    Science.gov (United States)

    Zee, Yeng Peng; Holt, William V; Gosalvez, Jaime; Allen, Camryn D; Nicolson, Vere; Pyne, Michael; Burridge, Michelle; Carrick, Frank N; Johnston, Stephen D

    2008-01-01

    Swelling of koala sperm chromatin following cryopreservation has largely been attributed to the absence of intermolecular disulfide cross-linkages in the marsupial sperm nucleus. Fish spermatozoa also lack disulfide bonds within their chromatin, but have been successfully cryopreserved. The present study examined the hypothesis that the cryoprotectants used for fish sperm cryopreservation would confer a similar degree of protection on koala spermatozoa. Three concentrations each of five cryoprotectants (dimethyl sulfoxide, methanol, propylene glycol, ethylene glycol and dimethylacetamide (DMA)) were evaluated. Each treatment was compared against an established koala sperm cryopreservation protocol that uses 14% glycerol. Post-thaw assessment of progressive motility, plasma membrane integrity and mitochondrial membrane potential (MMP) revealed that protocols using 15% DMA achieved 62.2 +/- 3.6% (P koala spermatozoa. High DMA concentrations (17.5% and 20%) resulted in significantly lower proportions of live spermatozoa showing high MMP immediately after thawing compared with spermatozoa frozen in the lower concentrations. The percentage of koala spermatozoa with swollen chromatin following cryopreservation was not affected by DMA concentration.

  11. Successful artificial insemination in the koala (Phascolarctos cinereus) using extended and extended-chilled semen collected by electroejaculation.

    Science.gov (United States)

    Allen, Camryn D; Burridge, Michelle; Mulhall, Sarah; Chafer, Mandy L; Nicolson, Vere N; Pyne, Michael; Zee, Yeng Peng; Jago, Sophia C; Lundie-Jenkins, Geoff; Holt, William V; Carrick, Frank N; Curlewis, Jonathan D; Lisle, Allan T; Johnston, Stephen D

    2008-04-01

    Artificial insemination in the koala using chilled, electroejaculated semen provides for a marked improvement in the reproductive and genetic management of captive koala colonies in Australia and internationally, and makes available the option of using semen collected from wild populations to expand restricted gene pools. Dilution of koala semen for artificial insemination is complicated because koalas are induced ovulators, and it is thought that ovulating factors are present in the semen, so that semen extension for preservation purposes might be anticipated to result in a failure to induce ovulation. The first two experiments of this study were designed to determine whether artificial insemination using undiluted, extended, and extended-chilled semen collected by electroejaculation was capable of inducing a luteal phase and/or the production of pouch young. In Experiment 1, 1 ml undiluted electroejaculated semen, 2 ml diluted (1:1) semen, and 1 ml diluted (1:1) semen resulted in seven of nine, six of nine, and six of nine koalas showing a luteal phase, respectively; four pouch young were produced in each treatment. A second artificial insemination experiment was conducted in which 2 ml diluted (1:1) semen was administered in three groups of nine koalas. The first group received semen that had been collected and diluted immediately without chilling, the second group was deposited with semen stored chilled for 24 h, and the final group received semen that had been chilled for 72 h. In the first group, five females had a luteal phase, but none became pregnant. In group 2, two of the five females that had a luteal phase gave birth, whereas in group 3, four of the six females that had a luteal phase produced pouch young. In addition, experiment 3 was conducted to determine whether it was possible to produce pouch young by naturally mating koalas that were in the latter stages of their behavioral estrus; this information is important to the logistics of transporting koala semen for artificial insemination by establishing the maximum time frame in which females might be expected to shed a fertile oocyte. Of the 12 females mated on Day 8 of estrus, 6 gave birth, whereas only 3 of the 10 females naturally mated on Day 10 of estrus produced pouch young. The majority of females (21 of 22) in experiment 3 showed evidence of a luteal phase. Together, these experiments have shown that it is possible to use undiluted, extended, or extended-chilled semen to produce koala offspring up to Day 8 of estrus at conception rates similar to those achieved following natural mating. These findings represent a significant advancement in the use of reproductive technology in marsupials and provide the basis for the shipment of koala semen over long distances. The pouch young produced in this study represent the first marsupials born following artificial insemination of extended-chilled semen and bring the total number of koalas produced by artificial insemination to 31.

  12. Cues to body size in the formant spacing of male koala (Phascolarctos cinereus) bellows: honesty in an exaggerated trait.

    Science.gov (United States)

    Charlton, Benjamin D; Ellis, William A H; McKinnon, Allan J; Cowin, Gary J; Brumm, Jacqui; Nilsson, Karen; Fitch, W Tecumseh

    2011-10-15

    Determining the information content of vocal signals and understanding morphological modifications of vocal anatomy are key steps towards revealing the selection pressures acting on a given species' vocal communication system. Here, we used a combination of acoustic and anatomical data to investigate whether male koala bellows provide reliable information on the caller's body size, and to confirm whether male koalas have a permanently descended larynx. Our results indicate that the spectral prominences of male koala bellows are formants (vocal tract resonances), and show that larger males have lower formant spacing. In contrast, no relationship between body size and the fundamental frequency was found. Anatomical investigations revealed that male koalas have a permanently descended larynx: the first example of this in a marsupial. Furthermore, we found a deeply anchored sternothyroid muscle that could allow male koalas to retract their larynx into the thorax. While this would explain the low formant spacing of the exhalation and initial inhalation phases of male bellows, further research will be required to reveal the anatomical basis for the formant spacing of the later inhalation phases, which is predictive of vocal tract lengths of around 50 cm (nearly the length of an adult koala's body). Taken together, these findings show that the formant spacing of male koala bellows has the potential to provide receivers with reliable information on the caller's body size, and reveal that vocal adaptations allowing callers to exaggerate (or maximise) the acoustic impression of their size have evolved independently in marsupials and placental mammals.

  13. Season- and Age-related Reproductive Changes Based on Fecal Androgen Concentrations in Male Koalas, Phascolarctos cinereus

    Science.gov (United States)

    KUSUDA, Satoshi; HASHIKAWA, Hisashi; TAKEDA, Masato; ITO, Hideki; GOTO, Atsushi; OGUCHI, Jun; DOI, Osamu

    2013-01-01

    Abstract The purposes of the present study were to clarify age- and season- related androgen patterns, and to compare the reproductive physiology between Japanese captive koala populations and Australian populations. To measure fecal androgens, feces were collected from male koalas (4.2 to 13.8 years of age) kept in Japanese zoos. Fecal androgens were extracted with methanol from the lyophilized samples and determined by enzyme immunoassay using 4-androstene-3,17-dione antibody. Fecal androgen concentration in male koalas increased after sexual maturation and remained relatively high until old age. In the survey with the Japanese zoo studbook of koalas, copulation (conception) month showed a pyramid shape with a peak in March to June (60.7%) in koalas born and reared in Japanese zoos and from July to April with the highest concentration in September to January (69.7%) in Australian institutes. Japanese zoo koala populations have a characteristic physiological cycle adapted to Japan's seasonal changes. The suitable month of year for copulation or conception in Japan is diametrically opposed to that in Australia. Mean fecal androgen concentrations by month in the males born and reared in Japan indicated annual changes with the highest concentration in May and the lowest value in November. Fecal androgen analysis may be a noninvasive alternative tool to monitor circulating testosterone and may be helpful in understanding reproductive activity and physiology in male koalas. PMID:23502854

  14. The distribution and abundance of an island population of Koalas (Phascolarctos cinereus in the far north of their geographic range.

    Directory of Open Access Journals (Sweden)

    Denise C McGregor

    Full Text Available Koalas are an iconic species of charismatic megafauna, of substantial social and conservation significance. They are widely distributed, often at low densities, and individuals can be difficult to detect, making population surveys challenging and costly. Consequently, koala population estimates have been limited and the results inconsistent. The aims of this study were to estimate the distribution, relative abundance and population size of the koalas on Magnetic Island, far north Queensland. Population densities were estimated in 18 different vegetation types present on the island using a Fecal Standing Crop Method. Koala density ranged from 0.404 ha(-1, recorded in forest red gum and bloodwood woodland, to absence from eight of the vegetation types surveyed. The second highest density of 0.297 koalas ha(-1 was recorded in mixed eucalypt woodland, which covers 45% of the island. The total abundance of koalas on Magnetic Island, not including those present in urban areas, was estimated at 825±175 (SEM. The large variation in koala density across vegetation types reinforces the need for sampling stratification when calculating abundance over large areas, as uniformity of habitat quality cannot be assumed. In this context, koala populations also occur in low densities in areas generally regarded as poor quality koala habitat. These results highlight the importance of protecting vegetation communities not traditionally considered to have high conservation value to koalas, as these habitats may be essential for maintaining viable, widespread, low-density populations. The results from this study provide a baseline to assess future trends in koala distribution, density and abundance on Magnetic Island.

  15. Surgical implantation of temperature-sensitive transmitters and data-loggers to record body temperature in koalas (Phascolarctos cinereus).

    Science.gov (United States)

    Adam, D; Johnston, S D; Beard, L; Nicholson, V; Lisle, A; Gaughan, J; Larkin, R; Theilemann, P; Mckinnon, A; Ellis, W

    2016-01-01

    Under predicted climate change scenarios, koala distribution in Australia is expected to be adversely affected. Recent studies have attempted to identify suitable habitat, based on models of bioclimatic regions, but to more accurately reflect the thermal tolerance and behavioural adaptations of the various regional populations, the koala's response to periods of heat stress will need to be investigated at the individual animal level. To explore the safety and suitability of temperature-sensitive intra-abdominal implants for monitoring core body temperature in the koala. A temperature-sensitive radio transmitter and thermal iButton data-logger, waxed together as a package, were surgically implanted into the abdominal cavity of four captive koalas. In one animal the implant was tethered and in the other three, it was left free-floating. After 3 months, the implants were removed and all four koalas recovered without complications. The tethering of the package in the one koala resulted in minor inflammation and adhesion, so this practice was subsequently abandoned. The free-floating deployments were complication-free and revealed a diurnal body temperature rhythm, with daily ranges of 0.4-2.8°C. The minimum recorded body temperature was 34.2°C and the maximum was 37.7°C. The difference in the readings obtained from the transmitters and iButtons never exceeded 0.3°C. The suitability of the surgical approach was confirmed, from both the animal welfare and data collection points of view. © 2016 Australian Veterinary Association.

  16. Mycodiversity of xylophilous basidiomycetes (Basidiomycota, Fungi in Mondaí, Santa Catarina, Brazil II: A new addition

    Directory of Open Access Journals (Sweden)

    Marisa de Campos-Santana

    2010-04-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2010v23n1p13 Micodiversidade de basidiomicetes (Fungi xilófilos para Mondaí, Santa Catarina, Brasil, II: Nova contribuição. Um levantamento recente da micodiversidade de basidiomicetes xilófilos (Basidiomycota, Fungi no município de Mondaí (Santa Catarina, Brasil resultou na identificação de 15 espécies não registradas anteriormente para a área de estudo; todas elas são causadoras de podridão branca na madeira.

  17. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  18. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  19. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  20. Mycelial growth rate and macro- and micromorphological characteristics of medicinal species of genus Ganoderma (higher Basidiomycetes) from Iran.

    Science.gov (United States)

    Keypour, Somayeh; Riahi, Hossein; Safaie, Naser; Borhani, Ali

    2014-01-01

    Mycelial growth rate is a distinguishing quality that demonstrates continuous variation in different isolates collected from various hosts and locations. The objectives of this research were (1) to reinvestigate the previous identification of Iranian species, and (2) to recognize the best native isolate(s) for cultivation of different Ganoderma species. Of 78 samples collected from different hosts and sites, only 43 mycelia could be purified and examined for further study. Growth rate (GR; Δd/Δt) and growth coefficient (GC; dgh/t) were analyzed by growing isolate culture on 2% malt-extract agar medium (pH 5.5) incubated at 25°C. Macro- and micromorphological studies on mycelia and fruiting bodies such as basidiospore and cutis microcharacters as well as fruiting body quality were used for precise identification. Results revealed that samples belonged to 4 species: G. lucidum, G. applanatum, G. resinaceum, and G. australe. Among all samples, the isolate morphologically identified as G. applanatum showed the best GR (12 mm/day) and good GC (128 mm/day), followed by the 2 other isolates identified as G. resinaceum (GRs and GCs of 11 and 55 mm/day and 10.9 and 43.6 mm/day, respectively).

  1. Anti-inflammatory effect, total polysaccharide, total phenolics content and antioxidant activity of the aqueous extract of three basidiomycetes

    Directory of Open Access Journals (Sweden)

    M. Vazirian

    2014-01-01

    Full Text Available Inflammation is a part of the non-specific immune response which occurs in reaction to any type of injury. Medicinal mushrooms have had application in various disorders including cancer, liver injuries, inflammation and diabetes. In the present study, the anti-inflammatory effects of the aqueous extracts of medicinal mushrooms (Fomes fomentarius, Ganoderma applanatum and Trametes hirsuta were evaluated using carrageenan method. In addition, total polysaccharide, total phenolics contents and the radical scavenging activity of the extracts have also been examined. Mushrooms were extracted with distilled water in 100 °C for 4 hours and then the extracts were freeze dried. Indomethacin was considered as the positive control in the anti-inflammatory evaluation. Polysaccharide contents of F. fomentarius, G. applanatum, and T. hirsuta extracts were assessed as 53.3±0.2, 31.7±0.03, and 19.1±0.6 glucose equivalent µg/100 µgEXT and total phenolic contents of them were successfully revealed as 9.9±0.2, 8.2±0.1, and 8.8±0.2 µgGAE/100 µgEXT, respectively. Furthermore, the IC50 values for F. fomentarius, G. applanatum, and T. hirsuta extracts in DPPH assay, were calculated as 90.9, 108.6, and 908.3 µg/mL, respectively. The results of the experiment showed that the extracts possessed potent anti-inflammatory effect which was comparable to indomethacin.

  2. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  3. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Helbert David Siabatto F.

    2005-07-01

    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  4. Multidimensional NMR analysis reveals truncated lignin structures in wood decayed by the brown rot basidiomycete Postia placenta

    Science.gov (United States)

    Daniel J. Yelle; Dongsheng Wei; John Ralph; Kenneth E. Hammel

    2011-01-01

    Lignocellulose biodegradation, an essential step in terrestrial carbon cycling, generally involves removal of the recalcitrant lignin barrier that otherwise prevents infiltration by microbial polysaccharide hydrolases. However, fungi that cause brown rot of wood, a major route for biomass recycling in coniferous forests, utilize wood polysaccharides efficiently while...

  5. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660 ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  6. Armillaridin, a Honey Medicinal Mushroom, Armillaria mellea (Higher Basidiomycetes) Component, Inhibits Differentiation and Activation of Human Macrophages.

    Science.gov (United States)

    Liu, Tsang-Pai; Chen, Chien-Chih; Shiao, Pei-Yu; Shieh, Hui-Ru; Chen, Yu-Yawn; Chen, Yu-Jen

    2015-01-01

    Armillaridin (AM) is an aromatic ester compound isolated from honey medicinal mushroom, Armillaria mellea, which has anti-cancer potential. This study was designed to examine the effects of AM on differentiation and activation macrophages, the major ontogeny of innate immunity. Macrophages were derived from CD14+ monocytes which were sorted from human peripheral blood mononuclear cells. Cell viability was assessed by trypan blue exclusion test. Cells were stained with Liu's dye for observation of morphology. Expression of surface antigens was examined by flow cytometric analysis. Phagocytosis and generation of reactive oxygen species (ROS), as functional assays, were evaluated by counting engulfed yeasts and DCFH-DA reaction. The viability of macrophages was not significantly reduced by AM. AM at nontoxic concentrations markedly increased cytoplasmic vacuoles. The expression of surface CD14, CD16, CD36, and HLA-DR was suppressed. The phagocytosis function, but not ROS production, of macrophages was inhibited by AM. Armillaridin could inhibit the differentiation and activation of human macrophages. It may have potential to be developed as a biological response modifier for inflammatory diseases.

  7. Effect of surfactants and identification of metabolites on the biodegradation of fluoranthene by basidiomycetes fungal isolate Armillaria sp. F022.

    Science.gov (United States)

    Hadibarata, Tony; Kristanti, Risky Ayu

    2014-04-01

    The effects of structure and concentration of surfactants on the biodegradation of fluoranthene, a three rings polycyclic aromatic hydrocarbon in the aqueous phase, as well as their effects on the biodegradation and enzyme activity were investigated. The toxicity ranking of studied surfactants is: non-ionic Tween 80 Armillaria sp. F022 (>4,500 mg/L) was showed by Tween 80 (10 mg/L) culture, manifesting that the non-ionic surfactant present in the culture were beneficial to the fungal growth. Laccase showed the highest enzymes activity in all surfactants culture. Non-ionic Tween 80 showed a significant result for laccase activity (1,902 U/L) in the Armillaria sp. F022 culture. The increased enzymes cumulative activity may stem directly from the rising fluoranthene biodegradability as addition of appropriate surfactants. The biotransformation of fluoranthene was greatly improved by Tween 80, and totally fluoranthene degradation was obtained as Tween 80 was 10 mg/L. Two fluoranthene metabolites were isolated from the culture medium and analyzed by a thin layer chromatography, UV visible spectrometer and gas chromatography-mass spectrometry (GC-MS). The oxidation of fluoranthene is initiated by oxygenation at the C-2,3 positions resulting 9-fluorenone. At the end of experiment, one metabolite was detected in the culture extract and identified as phthalic acid. Evidently, Armillaria sp. F022 seems efficient, high effective and deserves further application on the enhanced bioremediation technologies for the treatment of fluoranthene-contaminated soil.

  8. Mating tests among geographically separated collections of the Trametes versicolor (Fr.) Pilát (Basidiomycetes, Polyporales) group

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 79, 3-4 (2004), s. 425-431 ISSN 0029-5035 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : trametes versicolor * mating tests Subject RIV: EE - Microbiology, Virology Impact factor: 0.594, year: 2004

  9. Physiological Peculiarities of Lignin-Modifying Enzyme Production by the White-Rot Basidiomycete Coriolopsis gallica Strain BCC 142

    Directory of Open Access Journals (Sweden)

    Vladimir Elisashvili

    2017-11-01

    Full Text Available Sixteen white-rot Basidiomycota isolates were screened for production of lignin-modifying enzymes (LME in glycerol- and mandarin peel-containing media. In the synthetic medium, Cerrena unicolor strains were the only high laccase (Lac (3.2–9.4 U/mL and manganese peroxidase (MnP (0.56–1.64 U/mL producers while one isolate Coriolopsis gallica was the only lignin peroxidase (LiP (0.07 U/mL producer. Addition of mandarin peels to the synthetic medium promoted Lac production either due to an increase in fungal biomass (Funalia trogii, Trametes hirsuta, and T. versicolor or enhancement of enzyme production (C. unicolor, Merulius tremellosus, Phlebia radiata, Trametes ochracea. Mandarin peels favored enhanced MnP and LiP secretion by the majority of the tested fungi. The ability of LiP activity production by C. gallica, C. unicolor, F. trogii, T. ochracea, and T. zonatus in the medium containing mandarin-peels was reported for the first time. Several factors, such as supplementation of the nutrient medium with a variety of lignocellulosic materials, nitrogen source or surfactant (Tween 80, Triton X-100 significantly influenced production of LME by a novel strain of C. gallica. Moreover, C. gallica was found to be a promising LME producer with a potential for an easy scale up cultivation in a bioreactor and high enzyme yields (Lac-9.4 U/mL, MnP-0.31 U/mL, LiP-0.45 U/mL.

  10. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. Copyright © 2010 John Wiley & Sons, Ltd.

  11. Genome sequence of the basidiomycetous fungus Pseudozyma aphidis DSM70725, an efficient producer of biosurfactant mannosylerythritol lipids

    OpenAIRE

    Lorenz, Stefan; Günther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-01-01

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  12. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants.

  13. Genome Sequence of the Basidiomycetous Fungus Pseudozyma aphidis DSM70725, an Efficient Producer of Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Lorenz, Stefan; Guenther, Michael; Grumaz, Christian; Rupp, Steffen; Zibek, Susanne; Sohn, Kai

    2014-02-13

    Pseudozyma aphidis is an efficient producer of mannosylerythritol lipids exceeding concentrations of >100 g/liter from renewable feed stocks. Additionally, a biosurfactant cellobiose lipid is also secreted during nitrogen limitation. Here, we describe the sequencing of P. aphidis to unravel the genomic basis of biosurfactant metabolism in P. aphidis.

  14. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots

    NARCIS (Netherlands)

    Tagu, D; De Bellis, R; Balestrini, R; De Vries, OMH; Piccoli, G; Stocchi, [No Value; Bonfante, P; Martin, F

    The immunolocalization of one of the hydrophobins of Pisolithus tinctorius (HYDPt-1) is reported. Hydrophobin proteins play key roles in adhesion and aggregation of fungal hyphae, and it is already known that formation of ectomycorrhizas on eucalypt roots enhances the accumulation of hydrophobin

  15. Anxiolytic Effects of Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) on Ischemia-Induced Anxiety in Rats.

    Science.gov (United States)

    Zhang, Chunjing; Gao, Xiulan; Sun, Yan; Sun, Xiaojie; Wu, Yanmin; Liu, Ying; Yu, Haitao; Cui, Guangcheng

    2015-01-01

    We investigated the anxiolytic effects Agaricus brasiliensis extract (AbSE) on ischemia-induced anxiety using the plus-maze test and the social interaction test. The animals were treated orally with AbSE (4, 8, and 10 mg/kg/d, respectively) for 30 d, followed by middle cerebral artery occlusion-induced cerebral ischemia. Levels of noradrenaline, dopamine, and serotonin in the cerebral cortex of rats, as well as oxidative stress and plasma corticosterone levels were analyzed, respectively. The rota-rod test was carried out to exclude any false positive results in experimental procedures related to anxiety disorders, and the catalepsy test was carried out to investigate whether AbSE induces catalepsy. Our results demonstrate that oral administration of AbSE presented anxiolytic-like effects in the elevated plus-maze test and the social interaction test. Furthermore, AbSE did not induce extrapyramidal symptoms in the catalepsy test. The mechanism underlying the anxiolytic effect of AbSE might be increased brain monoamine levels and plasma corticosterone levels and decreased oxidative stress in cerebral ischemia/reperfusion rats.

  16. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  17. Antigenotoxic potential of aqueous extracts from the chanterelle mushroom, Cantharellus cibarius (higher Basidiomycetes), on human mononuclear cell cultures.

    Science.gov (United States)

    Mendez-Espinoza, Claudia; Garcia-Nieto, Edelmira; Esquivel, Adriana Montoya; Gonzalez, Monica Montiel; Bautista, Efrain Velasco; Ezquerro, Carmen Calderon; Santacruz, Libertad Juarez

    2013-01-01

    Cantharellus cibarius is one of the most important wild, edible, and ectomycorrhizal mushrooms growing at La Malinche National Park, Tlaxcala, Mexico; therefore, the assessment of its biological properties is of great interest to know its potential as an alternative treatment to chemopreventive strategies when it is consumed as part of a diet. Comet assay was used to evaluate the antigenotoxic properties of several concentrations of aqueous extracts (0.0125, 0.025, 0.05, 0.1, and 0.2% w/v) prepared at room temperature (22 ± 2°C). As a test system we used human mononuclear cells exposed to methyl methanesulphonate (MMS) in vitro according to 3 different protocols: previous, simultaneous, and posterior. Previous (0.0125%) and simultaneous (0.1%) treatments resulted in the highest inhibitory efficiency. In the former, the cells assessed showed a tail length of 94.9 ± 64 µm; in the latter, the tails measured 106.2 ± 40 µm. Resulting percentages of reduction in damage were 236% and 196.1%, respectively. We did not obtain a dose-dependent response. The mean tail length for each protocol (previous, 133.1 ± 80 µm; simultaneous, 127.8 ± 57 µm; posterior, 146.3 ± 74 µm) was statistically significant with regard to the positive control (MMS).

  18. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    of Kaiserslautern (Germany).The ML algorithm employed the GTRGAMMAI model and bootstrapping was performed with 1000 replicates. Additionally, Neighbour Joining (NJ) trees were constructed in SeaView version 4. Robustness of NJ trees in the analyses... was assessedwith 1000 NJ bootstrap replicates.The alignments (including individual gene alignments) are deposited in TreeBase under submission ID 14277. 6 3. Results 3.1 Phylogenetic analyses Without exception and with significant support, phylogenetic...

  19. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  20. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  1. A Prototype Recombinant-Protein Based Chlamydia pecorum Vaccine Results in Reduced Chlamydial Burden and Less Clinical Disease in Free-Ranging Koalas (Phascolarctos cinereus.

    Directory of Open Access Journals (Sweden)

    Courtney Waugh

    Full Text Available Diseases associated with Chlamydia pecorum infection are a major cause of decline in koala populations in Australia. While koalas in care can generally be treated, a vaccine is considered the only option to effectively reduce the threat of infection and disease at the population level. In the current study, we vaccinated 30 free-ranging koalas with a prototype Chlamydia pecorum vaccine consisting of a recombinant chlamydial MOMP adjuvanted with an immune stimulating complex. An additional cohort of 30 animals did not receive any vaccine and acted as comparison controls. Animals accepted into this study were either uninfected (Chlamydia PCR negative at time of initial vaccination, or infected (C. pecorum positive at either urogenital (UGT and/or ocular sites (Oc, but with no clinical signs of chlamydial disease. All koalas were vaccinated/sampled and then re-released into their natural habitat before re-capturing and re-sampling at 6 and 12 months. All vaccinated koalas produced a strong immune response to the vaccine, as indicated by high titres of specific plasma antibodies. The incidence of new infections in vaccinated koalas over the 12-month period post-vaccination was slightly less than koalas in the control group, however, this was not statistically significant. Importantly though, the vaccine was able to significantly reduce the infectious load in animals that were Chlamydia positive at the time of vaccination. This effect was evident at both the Oc and UGT sites and was stronger at 6 months than at 12 months post-vaccination. Finally, the vaccine was also able to reduce the number of animals that progressed to disease during the 12-month period. While the sample sizes were small (statistically speaking, results were nonetheless striking. This study highlights the potential for successful development of a Chlamydia vaccine for koalas in a wild setting.

  2. Evaluating the utility of an accelerometer and urinary hormone analysis as indicators of estrus in a Zoo-housed koala (Phascolarctos cinereus).

    Science.gov (United States)

    Takahashi, Maressa; Tobey, Jennifer R; Pisacane, Corinne Bacon; Andrus, Chris Hamlin

    2009-01-01

    Induced ovulators, such as the koala, do not always have overt signs of estrus, which makes pairing these animals for breeding purposes difficult to achieve in a zoo setting. This study examined the possibility of using alternative methods to behavioral sampling and weight fluctuations for monitoring estrus in a female koala of reproductive age. We attempt to gain an improved understanding of koala estrus and enhance our ability to detect it by combining a noninvasive technique for hormone analysis with a newer method for recording activity level. The findings suggest that activity levels were accurately measured using an accelerometer and increased activity was associated with one estrus behavior, bellowing. Weekly weight declines occur with increases in activity registered from the accelerometer. We also validated an assay to detect progesterone and estradiol in female koala urine in an attempt to detect an estrus spike. However, neither urinary concentrations of estradiol nor progesterone was associated with behavioral cues of estrus in our subject. We suggest that increased female activity, bellowing, and weight loss all indicate a pro-estrus state that requires proper male stimulation in order to achieve a full estrus display.

  3. An investigation into the similarities and differences governing the cryopreservation success of koala (Phascolarctos cinereus: goldfuss) and common wombat (Vombatus ursinus: shaw) spermatozoa.

    Science.gov (United States)

    Johnston, S D; MacCallum, C; Blyde, D; McClean, R; Lisle, A; Holt, W V

    2006-10-01

    The aim of this study was to determine the relative cryopreservation success of koala and wombat spermatozoa and to investigate reasons for their respective post-thaw survival by examining the sperm's response to a range of osmotic media and determining the presence and distribution of F-actin. An hypothesis was proposed that F-actin may be imparting a degree of structural inflexibility to the koala sperm plasma membrane; hence, exposure of spermatozoa to cytochalasin D (5 microM), a F-actin depolymerisation agent, should result in increased plasticisation of the membrane and greater tolerance of cell volume changes that typically occur during cryopreservation. In experiment 1, koala (n = 4) and wombat (n = 4) spermatozoa packaged in 0.25 mL straws were cryopreserved using two freezing rates (fast-3 cm above liquid N2 interface; slow-6 degrees C/min in a freezing chamber) and two glycerol concentrations (8 and 14% v/v) in a tris-citrate glucose buffer with 15% (v/v) egg yolk. Wombat spermatozoa showed better (P koala spermatozoa. When exposed to media of varying osmolality, koala spermatozoa were less tolerant (% intact plasma membrane) of hyper-osmotic conditions (920 and 1410 mOsmol/kg) than wombat spermatozoa. F-actin was localised using a monoclonal antibody but only found in the wombat sperm head. When koala and wombat spermatozoa were exposed to media of varying osmolality, cytochalasin D had no beneficial effect on sperm survival (% intact plasma membranes). This study has demonstrated that wombat spermatozoa are highly tolerant of cryopreservation when compared to koala sperm but that spermatozoa from both species show greatest post-thaw survival when frozen slowly in 14% glycerol. Koala sperm are also particularly susceptible to hyper-osmotic environments but lack of detectable F-actin in the koala spermatozoan suggests that poor cryopreservation success in this species is unlikely to be associated with F-actin induced plasma membrane inflexibility.

  4. Metabolic regulation at the tricarboxylic acid and glyoxylate cycles of the lignin-degrading basidiomycete Phanerochaete chrysosporium against exogenous addition of vanillin.

    Science.gov (United States)

    Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki

    2005-10-01

    A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.

  5. Effect of introns and AT-rich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Scholtmeijer, K; Wosten, HAB; Springer, J; Wessels, JGH

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation

  6. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  7. Pleurotus opuntiae (Durieu et Lév.) Sacc. (higher Basidiomycetes) and other species related to Agave and Opuntia plants in Mexico-taxonomy, distribution, and applications.

    Science.gov (United States)

    Camacho, Marcelo; Guzmán, Gastón; Guzmán-Dávalos, Laura

    2012-01-01

    Pleurotus opuntiae is an important mushroom from xerophytic temperate regions of Mexico, as parasite or saprobe on Agave and Opuntia. Discussions on the taxonomic relationships of P opuntiae with P djamor, P. agaves, P. levis, and P. yuccae are presented, of which P. agaves is a synonym of P. opuntiae, and P. yuccae is a synonym of P. djamor. This latter and P levis are close species of P. opuntiae. The traditional uses of P opuntiae and P. djamor as food and remedy for several health problems, and also to get a traditional alcoholic drink from the Agave, are also considered.

  8. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  9. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  10. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages.

    Science.gov (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie

    2015-01-01

    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  11. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes).

    Science.gov (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin

    2017-01-01

    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  12. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  13. Selection of white-rot basidiomycetes for bioconversion of mustard (Brassica compestris) straw under solid-state fermentation into energy substrate for rumen micro-organism.

    Science.gov (United States)

    Tripathi, M K; Mishra, A S; Misra, A K; Vaithiyanathan, S; Prasad, R; Jakhmola, R C

    2008-03-01

    Selection of white-rot fungi of bio-conversion of mustard straw (MS) into feed for ruminants. Mustard straw was cultured with Ganoderma applanatum, Coriolus versicolor and Phanerochaete chrysosporium for solid-state fermentation at 35 degrees C from 7 to 63 days for delignification and for 21 days to study dry matter digestibility and protein enrichment. Lignin loss in fungus cultured straw varied between 100 and 470 g kg(-1) lignin. Delignification was higher between 7 and 28 days fermentation with C. versicolor. Among the three fungi P. chrysosporium was the most effective in degrading lignin for longer fermentation. In-vitro dry matter digestibility (IVDMD) and crude protein content was higher in C. versicolor cultured straw. Large quantity of straw was cultured by C. versicolor for 21 days, for in vivo evaluation. Mean pH and metabolites of rumen fermentation were not different while, pH and volatile fatty acid increased at 6 h postfermentation on cultured straw feeding. Cultured straw fermentation increased (P = 0.001) small holotricks and reduced (P = 0.005) large holotricks population. Fungus cultures straw did not improve microbial enzyme concentration. Coriolus versicolor and P. chrysosporium were the promising fungus for MS bio-delignification. Coriolus versicolor treated MS improved dry matter digestibility and protein content.

  14. Characterization of interspecific hybrid dikaryons of the oyster mushrooms, Pleurotus florida PAU-5 and P. sajor-caju PAU-3 (higher Basidiomycetes) from India.

    Science.gov (United States)

    Jaswal, Ravinder Kumar; Sodhi, Harpreet Singh; Sharma, Shivani

    2014-01-01

    Five Pleurotus hybrid dikaryons, developed through cross-breeding of P. florida PAU-5 (PF-5) and P. sajor-caju PAU-3 (PSC-3) were characterized with respect to textural properties, color, and enzymatic and genetic variability. Texture profile revealed significant differences in springiness, resilience, cohesiveness, and chewiness between all hybrids compared to the parents. Among the hybrid cultures, maximum whiteness was reported in hybrid 37, whereas hybrid 8 had minimum whiteness. Three hybrids (16, 37, 42) showed an increased linear growth rate in relation to PF-5, whereas no hybrid showed a higher growth rate than PSC-3. Maximum endoglucanase and xylanase activity was observed in hybrid 46, whereas minimum activity occurred in hybrid 42. Laccase and protease activity was higher in hybrid 37 and 46, respectively. Four hybrids (16, 37, 42, 46) showed increased peroxidase activity in relation to PF-5, whereas hybrid 46 showed activity higher than the parent PSC-3. Comparison of isozyme patterns confirmed the hybrid nature of hybrid 16. The large variation in the intensity of bands could be a result of recombination. Sodium dodecyl sulfate polyacrylamide gel electrophoresis of extracellular enzymes revealed 60.3- and 43-KDa bands in all the hybrids. An additional 25-KDa band was reported in hybrids 37, 42, and 46 and the parent PF-5, indicating their close relatedness. Parental strains showed higher divergence in small-subunit ribosomal DNA region compared with the internal transcribed spacer region, indicating their significance in varietal discrimination. Hybrid 46 had a small-subunit ribosomal DNA region more similar to that of PSC-3 compared with PF-5, whereas the internal transcribed spacer region of hybrids 42 and 46 revealed close resemblance to that of PF-5 and PSC-3, respectively.

  15. Antioxidant activities and bioactive compound determination from caps and stipes of specialty medicinal mushrooms Calocybe indica and Pleurotus sajor-caju (higher Basidiomycetes) from India.

    Science.gov (United States)

    Mishra, Krishna Kant; Pal, Ramesh Singh; Arunkumar, Raja

    2014-01-01

    In this study, we evaluated total phenolics, condensed tannins, ascorbic acid, lycopene, β-carotene, total antioxidant activity, reducing power, ferric-reducing antioxidant power, and radical scavenging activity (RSA) on ABTS and DPPH as well as metal chelating activity of methanolic and aqueous extract from caps and stipes of Calocybe indica and Pleurotus sajor-caju mushrooms. Per gram of extract, the different mushroom extracts contained 18.09-27.47 mg gallic acid equivalent of phenolics, 5.06-8.89 mg catechins of tannins, and 0.15-0.21 mg ascorbic acid. Principal component analysis (PCA) revealed that methanolic extract from caps of C. indica and P. sajor-caju contained higher ascorbic acid, total antioxidant activity, β-carotene and radical scavenging activity (RSA) on 2,2-diphenyl-1-picrylhydrazyl (DPPH) than did the stipes. The aqueous extract from cap and stipe of P. sajor-caju had higher total phenolics and RSA on 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) as well as higher metal-chelating activity and ferric-reducing antioxidant power. The antioxidant potential is higher in the caps of P. sajor-caju and C. indica than in the stipes; the cap contributes most to antioxidant activity.

  16. Enhanced mycelial biomass production of the hairy bracket mushroom, Trametes hirsuta (Higher Basidiomycetes), by optimizing medium component with Plackett-Burman design and response surface methodology.

    Science.gov (United States)

    Yang, Rongling; Liu, Xueming; Zhao, Xiangjie; Xu, Yujuan; Ma, Rongxia

    2013-01-01

    Statistical analyses based on experimental designs were applied to optimize the medium components for mycelial biomass production by Trametes hirsuta in shake flask cultivation. First, the effects of different carbon resources (glucose, sucrose, lactose, maltose, fructose, soluble starch and potato), nitrogen resources (yeast extract, peptone, (NH4)2SO4, NH4NO3, NH4Cl, peanut powder, soybean powder) and mineral elements (CaCl2, ZnSO4·7H2O, FeSO4·7H2O, MnSO4·H2O, CuSO4·7H2O) on mycelial biomass production were investigated using a univariate design. Second, a Plackett-Burman design was applied to identify the significant variables that principally influenced the mycelial biomass production, and the path of steepest ascent was pursued to approach the regions of optimal value of the significant variables. Subsequently, these significant variables were optimized using the Box-Behnken design of response surface methodology. Ultimately, the optimized medium conditions were composed of sucrose 25.65 g·L-1, MgSO4·7H2O 1.24 g·L-1, and FeSO4·7H2O 3.36 g·L-1, and the yield of mycelial biomass reached 15.45 g·L-1, which represents an approximately 1.6-fold increase above the initial yield.

  17. Genomics and Transcriptomics Analyses of the Oil-Accumulating Basidiomycete Yeast Trichosporon oleaginosus : Insights into Substrate Utilization and Alternative Evolutionary Trajectories of Fungal Mating Systems

    NARCIS (Netherlands)

    Kourist, Robert; Bracharz, Felix; Lorenzen, Jan; Kracht, Octavia N; Chovatia, Mansi; Daum, Chris; Deshpande, Shweta; Lipzen, Anna; Nolan, Matt; Ohm, Robin A; Grigoriev, Igor V; Sun, Sheng; Heitman, Joseph; Brück, Thomas; Nowrousian, Minou

    2015-01-01

    UNLABELLED: Microbial fermentation of agro-industrial waste holds great potential for reducing the environmental impact associated with the production of lipids for industrial purposes from plant biomass. However, the chemical complexity of many residues currently prevents efficient conversion into

  18. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav

    2012-01-01

    Roč. 355, č. 1-2 (2012), s. 341-352 ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  19. First records of ectomycorrhizal Cortinarius species (Agaricales, Basidiomycetes) from tropical India and their phylogenetic position based on rDNA ITS sequences.

    Science.gov (United States)

    Peintner, Ursula; Moser, Meinhard M; Thomas, K Agretious; Manimohan, P

    2003-04-01

    Three new Cortinarius species, Cortinarius conopileus, C. keralensis, and C. phlegmophorus spp. nov., are described from Kerala State in southern India. This is the first record of ectomycorrhizal Cortinarius spp. in the tropical part of India. In addition to distinct morphological characters, the comparative analysis of rDNA ITS sequences of the collections from India and morphologically similar species support the recognition of these taxa as new species. Phylogenetic analyses demonstrate that the three Indian Cortinarius spp. belong to both larger subclades of the genus Cortinarius, clade/cortinarius and clade/telamonia. As supported by morphological and molecular data, C. phlegmophorus belongs to Cortinarius subgen. Myxacium sect. Defibulati. Based on classical morphological characters, both C. keralensis and C. conopileus are representatives of subgen. Telamonia. However, C. conopileus belongs to clade/obtusi, which is a well-supported subclade of clade/cortinarius. Thus, in contrast to classical taxonomy, the clade/obtusi represents an independent evolutionary origin of telamonioid taxa. This result is also reflected by the distinct morphological characters of taxa of clade/obtusi, namely the lamellar trama with ellipsoid inflated hyphae and the presence of cystidia. In contrast, C. keralensis is a typical member of clade/telamonia. Within/telamonia, only relationships of closely related taxa are resolved due to the low genetic divergence found in ITS sequences. Based on morphological and molecular criteria, C. keralensis is a distinct taxon of sect. Saturnini.

  20. Transformation of 14C-labelled lignin and humic substances in forest soil by the saprobic basidiomycetes Gymnopus erythropus and Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    2010-01-01

    Roč. 42, č. 9 (2010), s. 1541-1548 ISSN 0038-0717 R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : Forest soil * Humic acid * Gymnopus erythropus Subject RIV: EE - Microbiology, Virology Impact factor: 3.242, year: 2010

  1. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with degree of soil organic matter humification and available electrolytes

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Soukupová, Lucie; Gryndlerová, Hana; Baldrian, Petr; Hršelová, Hana

    2010-01-01

    Roč. 55, č. 5 (2010), s. 454-460 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : mixed forest * fungi * community Subject RIV: EE - Microbiology, Virology Impact factor: 0.977, year: 2010

  2. Antioxidant and antiedema properties of solid-state cultured honey mushroom, Armillaria mellea (higher Basidiomycetes), extracts and their polysaccharide and polyphenol contents.

    Science.gov (United States)

    Lai, Min-Nan; Ng, Lean Teik

    2013-01-01

    Culinary-medicinal honey mushroom or Mi-Huan-Ku, Armillaria mellea (AM), is a popular ingredient in the traditional Chinese medicine for treating diseases of geriatric patients. This study aimed to examine the effect of cultured substrates on the mycelial growth of AM and evaluate its antioxidant and antiedema activities as well as its total polysaccharide and polyphenol contents. Results showed that AM grew best on the maize medium and worst on the potato medium. AM ethanol extract (AM-EtOH) showed stronger DPPH radical scavenging activity than AM aqueous extract (AM-H₂O). However, they were weak in metal chelation and reducing power. AM-EtOH but not AM-H₂O at 200 mg/kg showed antiedema activity in rats. The total β-glucan content of AM-H₂O and AM-EtOH was 21.95% and 3.50%, respectively. AM-EtOH showed higher phenol but lower flavonoid content than AM-H₂O. These results indicate that maize is a good source of substrate for mass production of AM mycelia, and its potency of DPPH radical scavenging and antiedema activities was contributed mainly by the phenolic compounds, not the level of polysaccharide content.

  3. Mycochemical Investigation of the Turkey Tail Medicinal Mushroom Trametes versicolor (Higher Basidiomycetes): A Potential Application of the Isolated Compounds in Documented Pharmacological Studies.

    Science.gov (United States)

    Habibi, Emran; Sadat-Ebrahimi, Seyed Esmaeel; Mousazadeh, Saeed Ali; Amanzadeh, Yaghoub

    2015-01-01

    The purpose of this study was to elucidate the chemical properties of the n-hexane, chloroform, and ethyl acetate extracts of the fruiting body of the medicinal mushroom Trametes versicolor. The study led to the isolation of 5 sterols, 2 triterpene derivatives, 1 hydroquinone-derived aromatic compound, and, finally, 1 cerebroside and 1 triglyceride derivative. These compounds were identified for first time in T. versicolor and were named as follows: 4-isobutoxyphenyl palmitate (5), N-D-2'-hydroxyheptanoic-1-O-β-D-glucopyranosyl-9-methyl-4,8-sphinga-dienine(cerebroside) (6), 3β-linoleyloxyergosta-7,22-diene (7), 3β-linoleyloxyergosta-7-ene (8), and betulinic acid (9). Other compounds elucidated in our study were ergosterol (1), ergosterol peroxide (2), trilinolein (3), ergosta-7, 22-dien-3β-ol (4), and betuline (10). These compounds were obtained via column or thin-layer chromatography before being identified by nuclear magnetic resonance spectroscopic analyses and infrared data. In addition, the beneficial pharmacological effects of the compounds are described here.

  4. Protective effects of new medicinal mushroom, Grifola gargal singer (higher Basidiomycetes), on induced DNA damage in somatic cells of Drosophila melanogaster.

    Science.gov (United States)

    Postemsky, Pablo Daniel; Palermo, Ana Maria; Curvetto, Néstor Raúl

    2011-01-01

    Grifola gargal is an edible mushroom with attributed antioxidant properties. Different sources of G. gargal materials, i.e., fruit bodies and mycelia grown in liquid or solid media, were used to study its potential protective capacity when somatic mutation and recombination is induced in Drosophila melanogaster using DMBA (7-12-dimethyl-benz(α)anthracene) as promutagen. Heterozygote larvae (white/white+) were grown in media with different concentrations of DMBA. Grifola gargal fruit bodies (GgFB) or mycelia from liquid culture (GgLC) or from solid culture (GgWG), i.e., biotransformed wheat kernel flour, were added to the culture media in combined treatments with DMBA. Water, DMBA solvent, or wheat flour (WF) plus DMBA solvent were used as negative controls. Larval mortality increased from 9% to 11% in negative controls to 31% to 36% in DMBA treatments. The addition of GgFB, GgLC, or GgWG materials produced a protective effect on 25 μmol/vial DMBA-induced mortality. Mutations observed in SMART, as light spots per 100 eyes (LS/100 eyes), increased with increasing doses of DMBA; this was also true when considering the mutation incidence expressed as percentage of eyes exhibiting light spots (% eyes with LS). Interestingly, mycelia from GgFB, GgLC, or GgWG, in the presence of 25 μmol/vial DMBA, showed lower values in SMART of both the total LS/100 eyes and the percentage of eyes with LS. Thus, Grifola gargal materials were not only nontoxic, but in combination with 25 μmol/vial DMBA lowered the mortality induced by the promutagen and showed antimutagenic effects. Protective effects of G. gargal against DMBA are discussed in terms of the onset of desmutagenic and/or bioantimutagenic mechanisms of detoxification in the host organism, probably due to some bioactive compounds known to occur in higher mushrooms.

  5. Fatty acid composition of cold-adapted carotenogenic basidiomycetous yeasts Composición de ácidos grasos de levaduras carotenogénicas

    Directory of Open Access Journals (Sweden)

    D. Libkind

    2008-12-01

    Full Text Available We studied fatty acids (FAs profiles in six carotenoid-producing yeast species isolated from temperate aquatic environments in Patagonia. Total FAs ranged from 2 to 15% of dry biomass. Linoleic, oleic, palmitic and α-linolenic acids were the major FAs constituents, which accounted for as much as 40%, 34%, 13% and 9% of total FAs, respectively. The proportion of each FA varied markedly depending on the taxonomic affiliation of the yeast species and on the culture media used. The high percentage of polyunsaturated fatty acids (PUFAs found in Patagonian yeasts, in comparison to other yeasts, is indicative of their cold-adapted metabolism. Our results suggest that Patagonian yeasts may be considered an interesting source of essential PUFAs.Se estudiaron los ácidos grasos de seis especies de levaduras productoras de carotenoides aisladas de ambientes acuáticos templados de la Patagonia. El contenido total de ácidos grasos fluctuó entre 2 y 15% de la biomasa seca. Los ácidos linoleico, oleico, palmítico y α-linolénico fueron los mayoritarios y contribuyeron en un 40%, 34%, 13% y 9% al total de ácidos grasos, respectivamente. La proporción de cada ácido graso varió de modo considerable según la filiación taxonómica de la especie y el medio de cultivo utilizado. El alto porcentaje de ácidos grasos poliinsaturados (PUFA observado en las levaduras patagónicas, en comparación con levaduras de otros orígenes, es indicativo de un metabolismo adaptado al frío. Nuestros resultados sugieren que las levaduras patagónicas pueden ser consideradas una fuente interesante de PUFA esenciales.

  6. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast.

  7. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs.

  8. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.

    2016-02-01

    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  9. HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

    Science.gov (United States)

    Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

    2014-01-01

    The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

  10. Biotreatment of tannin-rich beer-factory wastewater with white-rot basidiomycete Coriolopsis gallica monitored by pyrolysis/gas chromatography/mass spectrometry.

    Science.gov (United States)

    Yagüe, S; Terrón, M C; González, T; Zapico, E; Bocchini, P; Galletti, G C; González, A E

    2000-01-01

    Some fractions of beer-factory wastewaters represent an important environmental concern owing to their high content of polyphenols and dark-brown color. The capacity of Coriolopsis gallica to preferentially degrade lignin has been successfully applied in our laboratory to the biotreatment and decolorization of paper-industry effluents. In this work, the ability of this white-rot fungus to degrade high-tannin-containing wastewaters is evaluated. Under all the conditions studied, effluent decolorization and chemical oxygen demand reduction achieved by C. gallica at day 12 of incubation were close to 50 and 65%, respectively. No adhesion of dark color to the fungal mycelium was observed suggesting that decolorization could be ascribed to C. gallica degradation systems. Mycelium dry-weight values showed that C. gallica is tolerant to relatively high tannin content present in the effluent samples. In the sample containing the highest effluent concentration (60% v/v), dry-weight values suggested an inhibition of fungal growth at day 6 of incubation and a further adaptation of the fungus to the stressing tannin effect at day 12 of fungal treatment. Pyrolysis/gas chromatography/mass spectrometry results showed a decrease of polyphenols pyrolysis products, mainly phenol and guaiacol, with the incubation time. All these results indicate the potential use of C. gallica in bioremediation of tannin-containing industrial wastewaters and in other applications where a reduction in polyphenols content is required. Copyright 2000 John Wiley & Sons, Ltd.

  11. Screening of basidiomycete fungi for the quinone-dependent sugar C-2/C-3 oxidoreductase, pyranose dehydrogenase, and properties of the enzyme from Macrolepiota rhacodes

    Czech Academy of Sciences Publication Activity Database

    Volc, Jindřich; Kubátová, Elena; Daniel, G.; Sedmera, Petr; Haltrich, D.

    2001-01-01

    Roč. 176, - (2001), s. 178-186 ISSN 0302-8933 R&D Projects: GA ČR GA206/99/1191 Grant - others:Swedish Council for Forestryamd Agricultural Research (SE) 201.0384/99; Austrian Science Foundation(AT) P11459-MOB Institutional research plan: CEZ:AV0Z5020903 Keywords : pyranose dehydrogenase * pyranose oxidase Subject RIV: EE - Microbiology, Virology Impact factor: 2.156, year: 2001

  12. Methanolic soluble fractions of lingzhi or reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes) extract inhibit neuraminidase activity in Newcastle disease virus (LaSota).

    Science.gov (United States)

    Shamaki, Bala U; Sandabe, Umar K; Ogbe, Adamu O; Abdulrahman, Fanna I; El-Yuguda, Abdul-Dahiru

    2014-01-01

    The antineuraminidase activity of different organic soluble fractions of Ganoderma lucidum extract was investigated using inhibition of hemagglutination and elution of chicken erythrocytes by Newcastle disease virus (NDV). Fractions of methanol, ethylacetate, and normal butanol (n-butanol) of the G. lucidum were tested against neuraminidase producing NDV as antigen. Different dilutions of the organic soluble fractions inhibited elution of 1% red blood cells by neuraminidase of NDV While the methanolic and n-butanol extracts inhibited neuraminidase activity even at a dilution of 1:16 and that of ethylacetate fraction inhibited even at 1:32 respectively. This finding indicates that G. lucidum has some antineuraminidase activity against NDV and may be exploited in the management of NDV infection.

  13. The agaricoglyceride of royal sun medicinal mushroom, Agaricus brasiliensis (higher basidiomycetes) is anti-inflammatory and reverses diabetic glycemia in the liver of mice.

    Science.gov (United States)

    Yu, Haitao; Han, Chunchao; Sun, Yan; Qi, Xiaodan; Shi, Yan; Gao, Xu; Zhang, Chunjing

    2013-01-01

    The agaricoglyceride is a new fungal secondary metabolite that constitutes esters of chlorinated 4-hydroxy benzoic acid and glycerol. The objective of this study was to explore whether the administration of agaricoglyceride could correct hepatic glycemic metabolism dysfunction by attenuating inflammation in the liver. The effects of agaricoglycerides on tumor necrosis factor-α, interleukin-1β, vascular endothelial growth factor-α, interleukin-17, insulin secretion, adiponectin, leptin, hepatic glycogen, nuclear factor-κB activation, and total antioxidant activity were studied respectively. We demonstrated that administration of agaricoglycerides alleviated glycemic metabolism dysfunction, inflammation, and oxidative stress in mice. These data indicate that agaricoglyceride supplementation could restrain metabolic dysfunction through suppressing the nuclear factor-κB pathway as well as decreasing the levels of inflammatory cytokines and total antioxidant activities.

  14. COMPARATIVE GENOME ANALYSES OF MONILIOPHTHORA PERNICIOSA AND MONILIOPHTHORA RORERI: TWO CLOSELY RELATED PHYTOPATHOGENIC BASIDIOMYCETES THAT CAUSE DISTINCTLY DIFFERENT DISEASES OF THEOBROMA CACAO

    Science.gov (United States)

    Theobroma cacao (cacao), the source of chocolate, is a tropical understory tree. Fungal diseases such as Witches’ Broom Disease (WBD) and Frosty Pod Rot Disease (FPRD) of cacao have devastated cacao production in much of the Western Hemisphere and are threats to the main cacao producing regions in A...

  15. Cell-based bioreporter assay coupled to HPLC micro-fractionation in the evaluation of antimicrobial properties of the basidiomycete fungus Pycnoporus cinnabarinus.

    Science.gov (United States)

    Järvinen, Päivi; Nybond, Susanna; Marcourt, Laurence; Ferreira Queiroz, Emerson; Wolfender, Jean-Luc; Mettälä, Aila; Karp, Matti; Vuorela, Heikki; Vuorela, Pia; Hatakka, Annele; Tammela, Päivi

    2016-01-01

    Identification of bioactive components from complex natural product extracts can be a tedious process that aggravates the use of natural products in drug discovery campaigns. This study presents a new approach for screening antimicrobial potential of natural product extracts by employing a bioreporter assay amenable to HPLC-based activity profiling. A library of 116 crude extracts was prepared from fungal culture filtrates by liquid-liquid extraction with ethyl acetate, lyophilised, and screened against Escherichia coli using TLC bioautography. Active extracts were studied further with a broth microdilution assay, which was, however, too insensitive for identifying the active microfractions after HPLC separation. Therefore, an assay based on bioluminescent E. coli K-12 (pTetLux1) strain was coupled with HPLC micro-fractionation. Preliminary screening yielded six fungal extracts with potential antimicrobial activity. A crude extract from a culture filtrate of the wood-rotting fungus, Pycnoporus cinnabarinus (Jacq.) P. Karst. (Polyporaceae), was selected for evaluating the functionality of the bioreporter assay in HPLC-based activity profiling. In the bioreporter assay, the IC50 value for the crude extract was 0.10 mg/mL. By integrating the bioreporter assay with HPLC micro-fractionation, the antimicrobial activity was linked to LC-UV peak of a compound in the chromatogram of the extract. This compound was isolated and identified as a fungal pigment phlebiarubrone. HPLC-based activity profiling using the bioreporter-based approach is a valuable tool for identifying antimicrobial compound(s) from complex crude extracts, and offers improved sensitivity and speed compared with traditional antimicrobial assays, such as the turbidimetric measurement.

  16. Comparative analysis of the secretomes of Schizophyllum commune and other wood-decay basidiomycetes during solid-state fermentation reveals its unique lignocellulose-degrading enzyme system.

    Science.gov (United States)

    Zhu, Ning; Liu, Jiawen; Yang, Jinshui; Lin, Yujian; Yang, Yi; Ji, Lei; Li, Meng; Yuan, Hongli

    2016-01-01

    The genome of Schizophyllum commune encodes a diverse repertoire of degradative enzymes for plant cell wall breakdown. Recent comparative genomics study suggests that this wood decayer likely has a mode of biodegradation distinct from the well-established white-rot/brown-rot models. However, much about the extracellular enzyme system secreted by S. commune during lignocellulose deconstruction remains unknown and the underlying mechanism is poorly understood. In this study, extracellular proteins of S. commune colonizing Jerusalem artichoke stalk were analyzed and compared with those of two white-rot fungi Phanerochaete chrysosporium and Ceriporiopsis subvermispora and a brown-rot fungus Gloeophyllum trabeum. Under solid-state fermentation (SSF) conditions, S. commune displayed considerably higher levels of hydrolytic enzyme activities in comparison with those of P. chrysosporium, C. subvermispora and G. trabeum. During biodegradation process, this fungus modified the lignin polymer in a way which was consistent with a hydroxyl radical attack, similar to that of G. trabeum. The crude enzyme cocktail derived from S. commune demonstrated superior performance over a commercial enzyme preparation from Trichoderma longibrachiatum in the hydrolysis of pretreated lignocellulosic biomass at low enzyme loadings. Secretomic analysis revealed that compared with three other fungi, this species produced a higher diversity of carbohydrate-degrading enzymes, especially hemicellulases and pectinases acting on polysaccharide backbones and side chains, and a larger set of enzymes potentially supporting the generation of hydroxyl radicals. In addition, multiple non-hydrolytic proteins implicated in enhancing polysaccharide accessibility were identified in the S. commune secretome, including lytic polysaccharide monooxygenases (LPMOs) and expansin-like proteins. Plant lignocellulose degradation by S. commune involves a hydroxyl radical-mediated mechanism for lignocellulose modification in parallel with the synergistic system of various polysaccharide-degrading enzymes. Furthermore, the complex enzyme system of S. commune holds significant potential for application in biomass saccharification. These discoveries will help unveil the diversity of natural lignocellulose-degrading mechanisms, and advance the design of more efficient enzyme mixtures for the deconstruction of lignocellulosic feedstocks.

  17. 16 CFR 301.0 - Fur products name guide.

    Science.gov (United States)

    2010-01-01

    ... Rodentia Sciuridae Sciurus vulgaris. Squirrel, Flying ......do ......do Eupetaurus cinereus, Pteromys... Mustelidae Mustela altaica and Mustela rixosa. Wolf ......do Canidae Canis lupus and Canis niger. Wolverine...

  18. 65 Comparative Studies of Some Polypores Using High ...

    African Journals Online (AJOL)

    Administrator

    Polypores are aphyllophorales with corky, woody, leathery, and papery basidiocarps (Zjawiony, 2004). Aphyllophorales are mushrooms in the class basidiomycetes with holobasidia but usually lack gills (Kirk et al., 2001), they include. Ganoderma species, Tremetes species, Daedalea species and other basidiomycetes.

  19. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  20. Genes controlling plant growth habit in Leymus (Triticeae): maize barren stalk1 (ba1), rice lax panicle, and wheat tiller inhibition (tin3) genes as possible candidates

    Science.gov (United States)

    Parminder Kaur; Steven R. Larson; B. Shaun Bushman; Richard R.-C. Wang; Ivan W. Mott; David Hole; Jyothi Thimmapuram; George Gong; Lei Liu

    2008-01-01

    Leymus cinereus and L. triticoides are large caespitose and rhizomatous perennial grasses, respectively. Previous studies detected quantitative trait loci (QTL) controlling rhizome spreading near the viviparous1 (vp1) gene markers on linkage groups LG3a and LG3b in two families, TTC1 and TTC2, derived from Leymus triticoides x Leymus cinereus hybrids. The wheat tiller...

  1. Pro- and antioxidative properties of medicinal mushroom extracts

    NARCIS (Netherlands)

    Song, W.; Griensven, van L.J.L.D.

    2008-01-01

    Hot water extracts of 2 groups of medicinal mushrooms have been tested from the genera Agaricus, Antrodia, Auricularia, Coprinus, Cordyceps, Hericium, Grifola, Ganoderma, Lentinus, Phellinus, and Trametes for ROS-generating activity in human cells and for DPPH-TEAC antioxidant activity. Group 1

  2. Proximate and mineral analysis of some wild edible mushrooms ...

    African Journals Online (AJOL)

    Proximate and mineral analysis of five species of mushroom, Lentinus squarrosulus, Volvariella volvacea, Coprinus micaceus, Lepiota procera, and Auricularia auricula were examined in this study to determine their nutritional value. These mushrooms were found to contain on the average, 3.24 to 8.70% of crude fibre; 4.12 ...

  3. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  4. Cyanide profiles of some Nigerian edible mushrooms in the raw and ...

    African Journals Online (AJOL)

    Slices of eight species of Nigerian edible mushrooms, namely, Volvorella vulvacaea, Marasmius spp., Coprinus comatus, Pleurotus squarulotus, Pleurotus ostreatus, Schizophyllum commune, Rigidiporus lignosus and Ganaderma oregonense were analysed for free and bound (glycosidic) cyanide in the raw state as well as ...

  5. Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes.

    Science.gov (United States)

    Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin

    2015-01-01

    Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

  6. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  7. Evaluation of Anticonvulsant, Antidepressant-, and Anxiolytic-like Effects of an Aqueous Extract from Cultured Mycelia of the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes) in Mice.

    Science.gov (United States)

    Socala, Katarzyna; Nieoczym, Dorota; Grzywnowicz, Krzysztof; Stefaniuk, Dawid; Wlaz, Piotr

    2015-01-01

    Ganoderma lucidum is a well-known medicinal mushroom with a long history of use. This study was designed to assess the anticonvulsant potential of an aqueous extract from cultured G. lucidum mycelium in 3 acute seizure models: timed intravenous pentylenetetrazole infusion, maximal electroshock seizure threshold, and 6-Hz-induced psychomotor seizure tests in mice. Moreover, antidepressant-like and anxiolytic-like effects of G. lucidum were evaluated using the forced swim test and the elevated plus maze test in mice, respectively. No changes in seizure thresholds in the intravenous pentylenetetrazole and maximal electroshock seizure threshold tests after acute treatment with G. lucidum extract (200-600 mg/kg) was observed. However, the studied extract (100-400 mg/kg) significantly increased the threshold for psychomotor seizures in the 6-Hz seizure test. In the forced swim test, G. lucidum (100-400 mg/kg) significantly reduced the duration of immobility. No anxiolytic-like or sedative effects were reported in mice pretreated with the extract (400-600 mg/kg). G. lucidum extract (50-2400 mg/kg) did not produce toxic effects in the chimney test (motor coordination) or grip-strength test (neuromuscular strength). Further studies are required to explain the neuropharmacological effects of G. lucidum and to identify its active ingredients that may affect seizure threshold, mood, or anxiety.

  8. Production of Ginkgo leaf-shaped basidiocarps of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes), containing high levels of α- and β-D-glucan and ganoderic acid A.

    Science.gov (United States)

    Yajima, Yuka; Miyazaki, Minoru; Okita, Noriyasu; Hoshino, Tamotsu

    2013-01-01

    Ganoderic acid A and α- and β-D-glucan content were compared among morphologically different basidiocarps of the medicinal mushroom Ganoderma lucidum. Ginkgo leaf-shaped basidiocarps gradually hardened from the base to the pileus and accumulated a higher amount of bioactive components than normal (kidney-shaped) and antler/deer horn-shaped basidiocarps. In the normal G. lucidum stipe, the outer context contained the highest amount of α- and β-D-glucan (approximately 55%) and the highest amount of ganoderic acid A (approximately 0.3%). Ginkgo leaf-shaped G. lucidum had a large area of outer layer and stout outer context, which contributed to their high α- and β-D-glucan and ganoderic acid A content.

  9. 78 FR 73877 - Endangered Species; Marine Mammals; Receipt of Applications for Permit

    Science.gov (United States)

    2013-12-09

    ...: Koala (Phascolarctos cinereus) Applicant: Florida Tortoise and Iguana Breeders, S.W. Ranches, FL; PRT... iguana (Cyclura nubila nubila), Grand Cayman blue iguana (Cyclura lewisi), and Cayman Brac ground iguana...

  10. 78 FR 23286 - Endangered Species; Marine Mammals; Receipt of Applications for Permit

    Science.gov (United States)

    2013-04-18

    ... likely to influence agency decisions are: (1) Those supported by quantitative information or studies; and...) African wild dog (Lycaon pictus) Rothschild's starling (Leucopsar rothschildi) Radiated tortoise...) Koala (Phascolarctos cinereus) African wild dog (Lycaon pictus) Andean condor (Vultur gryphus) Harpy...

  11. Skin test reactivity of allergic subjects to basidiomycetes’ crude extracts in a tropical environment

    OpenAIRE

    Rivera-Mariani, Félix E.; Nazario-Jiménez, Sylvette; López-Malpica, Fernando; Bolaños-Rosero, Benjamín

    2011-01-01

    Fungal allergies can be detected by the skin prick test with extracts of the organisms, but not all fungi, including the basidiomycetes, are being examined. We determined the level of sensitization to basidiomycetes in allergic subjects and compared their reactivity to commercial extracts commonly used to detect allergies. Crude spore extracts of the basidiomycetes Ganoderma applanatum, Chlorophyllum molybdites, and Pleurotus ostreatus, which are known to release numerous spores, were examine...

  12. Perception and response to gravity in higher fungi--a critical appraisal.

    Science.gov (United States)

    Moore, D

    1991-01-01

    hymenophore (gill, tube or tooth) is positively gravitropic and responds independently of the stem. Bracket polypores do not show tropisms but exhibit gravimorphogenetic responses such that gross disturbance leads to renewal of growth to produce and entirely new fruiting structure suitably reoriented to the new spatial position. One experiment performed on an orbiting space station suggests that, in the absence of a light stimulus, gravity may be required for initiation of fruiting in Polyporus brumalis. Otherwise, the indications from both clinostat and space-borne experiments are that the basic form of the mushroom (overall tissue arrangement of stem, cap, gills, hymenium, veil) in agaric and polypore alike is established independently of the gravity vector. Abnormal stem growth has been observed in clinostat cultures of Panus (= Lentinus) tigrinus and Polyporus brumalis, but the morphogenetic event which seems most dependent on gravity is sporulation (in the broadest sense). Cultures of P. brumalis on orbiting space craft fail to produce the poroid hymenophore and in clinostat experiments on the ground even karyogamy was rare in similar cultures. Coprinus cinereus grown on the clinostat was able to produce apparently normal fruit body primordia which failed to produce spores and then aborted, forming a new flush of primordia on the old. Taken together with the clear association between observation of gravitropism and the onset of sporulation, the implication is that commitment to the meiosis-sporulation pathway both requires the gravity vector and couples it in some way to fruit-body growth. There is no convincing evidence for a graviperception mechanism in fungi. There is no evidence for any organised means of communicating the gravitropic stimulus once it has been perceived. Reports of three different experimental studies reveal the authors' conviction that the apparently coordinated expression of gravitropic response is in truth a common, but independent, response by

  13. 26 - 30 Kutama

    African Journals Online (AJOL)

    DR. AMINU

    wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

  14. Larvicidal activity of (oxiran-2-yl)methylpentanoate extracted from ...

    African Journals Online (AJOL)

    In our continuing search for mosquito larvicidal compounds from defined laboratory cultures of higher fungi (ascomycete and basidiomycetes), one basidiomycete Cyptotrama asprata showed strong larvicidal activity against mosquito Aedes aegyptii. From submerged cultures of C. asprata, a secondary metabolite ...

  15. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1982-01-01

    A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

  16. Diversity of edible mushrooms in pakistan

    International Nuclear Information System (INIS)

    Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

    2007-01-01

    Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

  17. Climate-mediated competition in a high-elevation salamander community

    Science.gov (United States)

    Dallalio, Eric A.; Brand, Adrianne B,; Grant, Evan H. Campbell

    2017-01-01

    The distribution of the federally endangered Shenandoah Salamander (Plethodon shenandoah) is presumed to be limited by competition with the Red-backed Salamander (Plethodon cinereus). In particular, the current distribution of P. shenandoah is understood to be restricted to warmer and drier habitats because of interspecific interactions. These habitats may be particularly sensitive to climate change, though the influence of competition may also be affected by temperature and relative humidity. We investigated the response of P. shenandoah to competition with P. cinereus under four climate scenarios in 3-dimensional mesocosms. The results suggest that, although climate change may alleviate competitive pressure from P. cinereus, warmer temperatures may also significantly influence the persistence of the species across its known range.

  18. In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.

    Science.gov (United States)

    Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S

    2006-06-01

    The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

  19. Some endophytes of Juncus trifidus from Tatra Mts. in Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Chlebicki

    2013-12-01

    Full Text Available This is a first part of work devoted highland rush endophytes: Penicillium expansum, Cladosporium oxysporum, Arthrinium state of Apiospora montagnei and Aureobasidium pullulans. The basidiomycete strain, possibly Lagarobasidium detriticum was also isolated.

  20. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  1. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  2. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)

    DR GATSING

    indexmedicus.afro.who.int. Induction of early apoptosis and reactive oxygen species (ROS) production by. Tanzanian basidiomycete (Cantharellus miomboensis). Rose MASALU 1*, Ken M. HOSEA 1, Mervin MEYER 2, Sylvester LYANTAGAYE 1 ...

  3. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress the ...

  4. Macrufungi flora oft the "Perkuć" Reservation in the Puszcza Augustowska Forest

    Directory of Open Access Journals (Sweden)

    Maria Lisiewska

    2014-08-01

    Full Text Available The paper contains a list of 160 macrofungi species (mainly Basidiomycetes, Agaricales. collected from the "Perkuć" Reservation with regard lo the substratum, forest community and seasonal occurrence.

  5. Medicinal mushrooms

    NARCIS (Netherlands)

    Gargano, Maria Letizia; Griensven, van Leo J.L.D.; Isikhuemhen, Omoanghe S.; Lindequist, Ulrike; Venturella, Giuseppe; Wasser, Solomon P.; Zervakis, Georgios I.

    2017-01-01

    Higher Basidiomycetes and Ascomycetes mushrooms possess various immunological and anticancer properties. They also offer important health benefits and exhibit a broad spectrum of pharmacological activities including antibacterial, antifungal, antiviral, cytotoxic, immunomodulating,

  6. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  7. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

    -degrading enzymes namely laccase, lignin peroxidase and manganese peroxidase as well as on the decolorization of industrial effluents like black liquor, molasses spent wash and textile mill effluents was studied using the basidiomycetous fungus NIOCC No.2a isolated...

  8. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  9. Wood decay fungus Flavodon ambrosius (Basidiomycota: Polyporales) is widely farmed by two genera of ambrosia beetles

    Science.gov (United States)

    You Li; Craig Christopher Bateman; James Skelton; Michelle Alice Jusino; Zachary John Nolen; David Rabern Simmons; Jiri Hulcr

    2017-01-01

    The ambrosia fungus Flavodon ambrosius is the primary nutritional mutualist of ambrosia beetles Ambrosiodmus and Ambrosiophilus in North America. F. ambrosius is the only known ambrosial basidiomycete, unique in its efficient lignocellulose degradation. F. ambrosius is associated with...

  10. 12038_2016_9614_Article_print 265..275

    Indian Academy of Sciences (India)

    2016-05-13

    s12038-016-9614-0. 1. Introduction. Ganoderma lucidum (GL) is a fungus that belongs to the class basidiomycetes and polyporaceae family (Russell and Paterson. 2006). This mushroom is quite well known from ancient times.

  11. Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.

    Science.gov (United States)

    Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

    2008-07-01

    Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

  12. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  13. Contiguous allopatry of the masked shrew and southeastern shrew in the Southern Appalachians: segregation along an elevational and habitat gradient

    Science.gov (United States)

    W. Mark Ford; Michael A. Menzel; Timothy S. McCay; Joshua Laerm

    2001-01-01

    Southeastern shrew. (Sorex longirostris) and masked shrew (Sorex cinereus) distributions converge in the Southern Appalachians. A 306,454-pitfall--trapnight survey in Alabama, Georgia, North Carolina, and South Carolina doc-umented the presence of southeastern shrews in the Cumberland Plateau, Ridge and Valley, Upper Piedmont, and...

  14. A nondestructive technique to monitor the relative abundance of terrestrial salamanders

    Science.gov (United States)

    Richard M. DeGraaf; Mariko. Yamasaki

    1992-01-01

    Salamanders are abundant vertebrates in many forest ecosystems, and their annual biomass production can be important in forest food webs (Pough et al. 1987). Population densities of eastern redback salamanders (Plethodon cinereus) can exceed 2 individuals/m2 in deciduous forests of the United States (Heatwole 1962, Jaeger 1980...

  15. Effects of edge contrast on redback salamander distribution in even-aged northern hardwoods

    Science.gov (United States)

    Richard M. DeGraaf; Mariko. Yamasaki

    2002-01-01

    Terrestrial salamanders are sensitive to forest disturbance associated with even-aged management. We studied the distribution of redback salamanders (Plethodon cinereus) for 4 yr at edges between even-aged northern hardwood stands along three replicate transects in each of three edge contrast types: regeneration/mature, sapling/mature, and...

  16. Roost characteristics of hoary bats in Arkansas

    Science.gov (United States)

    Roger W. Perry; Ronald E. Thill

    2007-01-01

    We radiotracked nine hoary bats (Lasiurus cinereus) and characterized 12 roosts during late spring and early summer in the Ouachita Mountains of central Arkansas. Hoary bats generally roosted on the easterly sides of tree canopies in the foliage of white oaks (Quercus alba), post oaks (Q. stellata) and shortleaf pines (Pinus...

  17. Chesapeake Bay Low Freshwater Inflow Study. Appendix E. Biota.

    Science.gov (United States)

    1984-09-01

    sapidus (blue crab) Crangon septernspinosa (sand shrimp) Palaemonetes pugio (grass shrimp) Paiaemronetes vulgaris (grass shrim) ogy’rides limnicola...Examples of tne water oriented animals are the bald eagle (Haiaeetus leucocephalus), and the Delmarva fox squirrel ( Sciurus niger cinereus). Other threatened... vulgaris and P. inter- medius, which has raised interesting questions as to habitat Spartitioning among these sympatric species. Palaemonetes typically

  18. Genomic Resources Notes accepted 1 October 2013-30 November 2013.

    Science.gov (United States)

    Keller, Stephen R; Nelson, David M; Pylant, Cortney; Santos, Scott R; Trott, Regina

    2014-03-01

    This article documents the public availability of (i) genomic sequence data and 43 microsatellite loci for the bat species, Lasiurus borealis and Lasiurus cinereus, and (ii) complete mitochondrial and partial nuclear genomes for two jack species, Caranx ignobilis, Caranx melampygus. © 2013 John Wiley & Sons Ltd.

  19. Validating the Operational Draft Regional Guidebook for the Functional Assessment of High-Gradient Ephemeral and Intermittent Headwater Streams in Western West Virginia and Eastern Kentucky

    Science.gov (United States)

    2014-04-01

    December – February because many salamanders hibernate underground during freezing temperatures. At Site 6, two Plethodon cinereus were detected in March...of Forest Research 29:291-302. Fisher, S.G., and G.E. Likens, 1973. Energy flow in Bear Brook, New Hampshire: an integrative approach to stream

  20. Fatalities at wind turbines may threaten population viability of a migratory bat

    Science.gov (United States)

    W.F. Frick; E.F. Baerwald; J.F. Pollock; R.M.R. Barclay; J.A. Szymanski; Ted Weller; A.L. Russell; Susan Loeb; R.A. Medellin; L.P. McGuire

    2017-01-01

    Large numbers of migratory bats are killed every year at wind energy facilities. However, population-level impacts are unknown as we lack basic demographic information about these species. We investigated whether fatalities at wind turbines could impact population viability of migratory bats, focusing on the hoary bat (Lasiurus cinereus),...

  1. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Directory of Open Access Journals (Sweden)

    Paul M Cryan

    Full Text Available Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus, eastern red bats (L. borealis, and silver-haired bats (Lasionycteris noctivagans found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  2. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines

    Science.gov (United States)

    Cryan, P.M.; Jameson, J.W.; Baerwald, E.F.; Willis, C.K.R.; Barclay, R.M.R.; Snider, E.A.; Crichton, E.G.

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  3. Evidence of late-summer mating readiness and early sexual maturation in migratory tree-roosting bats found dead at wind turbines.

    Science.gov (United States)

    Cryan, Paul M; Jameson, Joel W; Baerwald, Erin F; Willis, Craig K R; Barclay, Robert M R; Snider, E Apple; Crichton, Elizabeth G

    2012-01-01

    Understanding animal mating systems is an important component of their conservation, yet the precise mating times for many species of bats are unknown. The aim of this study was to better understand the details and timing of reproductive events in species of bats that die most frequently at wind turbines in North America, because such information can help inform conservation strategies. We examined the reproductive anatomy of hoary bats (Lasiurus cinereus), eastern red bats (L. borealis), and silver-haired bats (Lasionycteris noctivagans) found dead beneath industrial-scale wind turbines to learn more about when they mate. We evaluated 103 L. cinereus, 18 L. borealis, and 47 Ln. noctivagans from wind energy facilities in the United States and Canada. Histological analysis revealed that most male L. cinereus and L. borealis, as well as over half the Ln. noctivagans examined had sperm in the caudae epididymides by late August, indicating readiness to mate. Testes regression in male hoary bats coincided with enlargement of seminal vesicles and apparent growth of keratinized spines on the glans penis. Seasonality of these processes also suggests that mating could occur during August in L. cinereus. Spermatozoa were found in the uterus of an adult female hoary bat collected in September, but not in any other females. Ovaries of all females sampled had growing secondary or tertiary follicles, indicating sexual maturity even in first-year females. Lasiurus cinereus, L. borealis, and Ln. noctivagans are the only North American temperate bats in which most first-year young of both sexes are known to sexually mature in their first autumn. Our findings provide the first detailed information published on the seasonal timing of mating readiness in these species most affected by wind turbines.

  4. The effects of meteorological factors on airborne fungal spore concentration in two areas differing in urbanisation level

    Science.gov (United States)

    Oliveira, M.; Ribeiro, H.; Delgado, J. L.; Abreu, I.

    2009-01-01

    Although fungal spores are an ever-present component of the atmosphere throughout the year, their concentration oscillates widely. This work aims to establish correlations between fungal spore concentrations in Porto and Amares and meteorological data. The seasonal distribution of fungal spores was studied continuously (2005-2007) using volumetric spore traps. To determine the effect of meteorological factors (temperature, relative humidity and rainfall) on spore concentration, the Spearman rank correlation test was used. In both locations, the most abundant fungal spores were Cladosporium, Agaricus, Agrocybe, Alternaria and Aspergillus/Penicillium, the highest concentrations being found during summer and autumn. In the present study, with the exception of Coprinus and Pleospora, spore concentrations were higher in the rural area than in the urban location. Among the selected spore types, spring-autumn spores ( Coprinus, Didymella, Leptosphaeria and Pleospora) exhibited negative correlations with temperature and positive correlations both with relative humidity and rainfall level. On the contrary, late spring-early summer (Smuts) and summer spores ( Alternaria, Cladosporium, Epicoccum, Ganoderma, Stemphylium and Ustilago) exhibited positive correlations with temperature and negative correlations both with relative humidity and rainfall level. Rust, a frequent spore type during summer, had a positive correlation with temperature. Aspergillus/Penicillium, showed no correlation with the meteorological factors analysed. This knowledge can be useful for agriculture, allowing more efficient and reliable application of pesticides, and for human health, by improving the diagnosis and treatment of respiratory allergic disease.

  5. Nueva contribución al conocimiento de los macromicetos de la Reserva Ecológica del Pedregal de San Ángel, D.F., México New contribution to the knowledge of the macromycetes of the Ecological Reserve of the Pedregal of San Ángel, D.F., Mexico

    Directory of Open Access Journals (Sweden)

    Teófilo Herrera

    2006-06-01

    Full Text Available Se citan 8 especies de macromicetos recolectados en el área poniente de la Reserva Ecológica del Pedregal de San Ángel, D.F., México, de las cuales 5 son lignícolas y 3 humícolas, Se desarrollan a la sombra y entre hojarasca de plantas superiores. Entre los agaricales la familia Agaricaceae es la mejor representada. Se citan por primera vez en la micobiota del Pedregal de San Ángel: Gymnopus confluens, Agrocybe pediades, Agaricus arvensis y A. silvaticus, Setchelliogaster rheophyllus y Coprinus truncorumse citan por primera vez para México.Eight species of macromycetes were collected from the Ecological Reserve of the Pedregal de San Angel D.F. Mexico. Five of them are lignicolous, and 3 are humicolous developing under the shade of trees and among the litter of vascular plants. In the Agaricales the family Agaricaceae is the best represented. Gymnopus confluens, Agrocybe pediades, Agaricus arvensis and A. silvaticus, are first records in the mycobiota of the Pedregal de San Ángel. Setchelliogaster rheophyllus and Coprinus truncorum first records for Mexico are presented in this paper.

  6. Skin test reactivity of allergic subjects to basidiomycetes’ crude extracts in a tropical environment

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Nazario-Jiménez, Sylvette; López-Malpica, Fernando; Bolaños-Rosero, Benjamín

    2012-01-01

    Fungal allergies can be detected by the skin prick test with extracts of the organisms, but not all fungi, including the basidiomycetes, are being examined. We determined the level of sensitization to basidiomycetes in allergic subjects and compared their reactivity to commercial extracts commonly used to detect allergies. Crude spore extracts of the basidiomycetes Ganoderma applanatum, Chlorophyllum molybdites, and Pleurotus ostreatus, which are known to release numerous spores, were examined along with commercial extracts on 33 subjects with asthma, allergic or non-allergic rhinitis. Overall, affected subjects showed the highest reactivity to mites (36%), followed by Ganoderma applanatum (30%), grass (27%) Chlorophyllum molybdites (12%) and Pleurotus ostreatus (12%). Allergic rhinitis patients were most reactive to mites (58%), grass (42%), Ganoderma applanatum (25%), Penicillium spp. (25%), and cat (17%). Those with asthma primarily responded to mites (44%), Ganoderma applanatum (44%), grass (33%), and Pleurotus ostreatus (22%). IgE levels correlated with positive basidiomycetes extracts. This finding, coupled with higher reactivity to basidiospores as compared to mitospores, and the similar sensitivities of patients to G. applanatum and mites, suggest that basidiomycetes are important allergen sources in the tropics. PMID:21506892

  7. The good, the bad and the tasty: The many roles of mushrooms

    Directory of Open Access Journals (Sweden)

    K.M.J. de Mattos-Shipley

    2016-09-01

    Full Text Available Fungi are often inconspicuous in nature and this means it is all too easy to overlook their importance. Often referred to as the “Forgotten Kingdom”, fungi are key components of life on this planet. The phylum Basidiomycota, considered to contain the most complex and evolutionarily advanced members of this Kingdom, includes some of the most iconic fungal species such as the gilled mushrooms, puffballs and bracket fungi. Basidiomycetes inhabit a wide range of ecological niches, carrying out vital ecosystem roles, particularly in carbon cycling and as symbiotic partners with a range of other organisms. Specifically in the context of human use, the basidiomycetes are a highly valuable food source and are increasingly medicinally important. In this review, seven main categories, or ‘roles’, for basidiomycetes have been suggested by the authors: as model species, edible species, toxic species, medicinal basidiomycetes, symbionts, decomposers and pathogens, and two species have been chosen as representatives of each category. Although this is in no way an exhaustive discussion of the importance of basidiomycetes, this review aims to give a broad overview of the importance of these organisms, exploring the various ways they can be exploited to the benefit of human society.

  8. Assemblage and diversity of fungi on wood and seaweed litter of seven northwest portuguese beaches.

    Science.gov (United States)

    Sridhar, K R; Karamchand, K S; Pascoal, C; Cássio, F

    2012-01-01

    Three hundred and fifty woody litter and one hundred and forty seaweed litter sampled from seven beaches of Northwest Portugal were assessed for the filamentous fungal assemblage and diversity. The woody litter was screened for fungi up to 42 months using damp chamber incubation. They consisted of 36 taxa (ascomycetes, 21; basidiomycetes, 3; anamorphic taxa, 12) comprising 10 core group taxa (≥10%) (ascomycetes, 8; basidiomycete, 1; anamorphic taxa, 1). The total fungal isolates ranged between 150 and 243, while the number of fungal taxa per wood ranged between 3 and 4.9. The seaweed litter was screened up to four months in damp chamber incubation. They encompassed 29 taxa (ascomycetes, 16; basidiomycetes, 2; anamorphic taxa, 11) comprising 15 core group taxa (ascomycetes, 9; basidiomycete, 1; anamorphic taxa, 5). Total fungal isolates ranged between 56 and 120, while the number of fungal taxa per seaweed segment ranged between 4.8 and 6.3. Fifteen taxa of ascomycetes, two of basidiomycetes, and four anamorphic taxa were common to wood and seaweed litter. On both the substrates, two arenicolous fungi Arenariomyces trifurcates and Corollospora maritima were the predominant fungi (72.6-85.9%). The species abundance curves showed higher frequency of occurrence of fungal taxa in seaweed than woody litter. Our study revealed rich assemblage and diversity of marine fungi on wood and seaweed litter of Northwest Portugal beaches. The fungal composition and diversity of this survey have been compared with earlier investigations on marine fungi of Portugal coast.

  9. A study of bat populations at Los Alamos National Laboratory and Bandelier National Monument, Jemez Mountains, New Mexico: FY95--97 report to Los Alamos National Laboratory and Bandelier National Monument

    Energy Technology Data Exchange (ETDEWEB)

    Bogan, M.A.; O`Shea, T.J.; Cryan, P.M.; Ditto, A.M.; Schaedla, W.H.; Valdez, E.W.; Castle, K.T.; Ellison, L. [Univ. of New Mexico, Albuquerque, NM (United States)

    1998-12-31

    In 1995, a three-year study was initiated to assess the current status of bat species of concern, elucidate distribution and relative abundance, and obtain information on roosting sites of bats. The authors captured and released 1532 bats of 15 species (Myotis californicus, M. ciliolabrum, M. evotis, M. thysanodes, M. volans, M. yumanensis, Lasiurus cinereus, Lasionycteris noctivagans, Pipistrellus hesperus, Eptesicus fuscus, Euderma maculatum, Corynorhinus townsendii, Antrozous pallidus, Tadarida brasiliensis, and Nyctinomops macrotis) and followed 32 bats of eight species (M. evotis, M. thysanodes, M. volans, E. fuscus, E. maculatum, C. townsendii, A. pallidus, and N. macrotis) to 51 active diurnal roosts. The most abundant species were L. noctivagans, E. fuscus, L. cinereus, M. evotis, M. volans, and M. ciliolabrum. Most of these species are typical inhabitants of ponderosa pine-mixed coniferous forests.

  10. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  11. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Determinants of the relative reduction potentials of type-1 copper sites in proteins.

    Science.gov (United States)

    Li, Hui; Webb, Simon P; Ivanic, Joseph; Jensen, Jan H

    2004-06-30

    The relative Cu(2+)/Cu(+) reduction potentials of six type-1 copper sites (cucumber stellacyanin, P. aeruginosa azurin, poplar plastocyanin, C. cinereus laccase, T. ferrooxidans rusticyanin, and human ceruloplasmin), which lie in a reduction potential range from 260 mV to over 1000 mV, have been studied by quantum mechanical calculations. The range and relative orderings of the reduction potentials are reproduced very well compared to experimental values. The study suggests that the main structural determinants of the relative reduction potentials of the blue copper sites are located within 6 A of the Cu atoms. Further analysis suggests that the reduction potential differences of type-1 copper sites are caused by axial ligand interactions, hydrogen bonding to the S(Cys), and protein constraint on the inner sphere ligand orientations. The low reduction potential of cucumber stellacyanin is due mainly to a glutamine ligand at the axial position, rather than a methionine or a hydrophobic residue as in the other proteins. A stronger interaction with a backbone carbonyl group is a prime contributor to the lower reduction potential of P. aeruginosa azurin as compared to poplar plastocyanin, whereas the reverse is true for C. cinereus laccase and T. ferrooxidans rusticyanin. The lack of an axial methonine ligand also contributes significantly to the increased reduction potentials of C. cinereus laccase and human ceruloplasmin. However, in the case of C. cinereus laccase, this increase is attenuated by the presence of only one amide NH hydrogen bond to the S(Cys) rather than two in the other proteins. In human ceruloplasmin the reduction potential is further increased by the structural distortion of the equatorial ligand orientation.

  13. Seizure Of Live Otters In Bangkok Airport, Thailand

    OpenAIRE

    Chris R. Shepherd; Panjit Tansom

    2013-01-01

    On 22 January, 2013, TRAFFIC reported that the Royal Thai Customs officers working at the Wildlife Checkpoint of Bangkok’s Suvarnabhumi International Airport discovered 11 live otters when they scanned a bag that had been left at the oversized luggage area of the airport. The otters, six Smooth Otters Lutrogale perspicllata and five Oriental Small-clawed Otters Aonyx cinereus were all juveniles and are suspected to have been smuggled out of Thailand, bound for Japan to be sold as exotic pets....

  14. Comparison of trace element content in marine organisms collected from the La Maddalena archipelago and other Mediterranean and Pacific ocean sites

    International Nuclear Information System (INIS)

    Boniforti, R.; Moauro, A.

    1982-01-01

    As, Sb, Zn, Hg, Fe, Co and Cs were analysed by instrumental neutron activation analysis in four fish species (Mullus surmuletus, Scorpaena porcus, Crenilabus cinereus, and Serranus scriba) and one gesteropod (Sepia officinalis). The results were compared with those obtained by other authors for fish collected both in the Mediterranean and the Pacific. The difficulty of comparing results obtained by different authors was stressed and some suggestions to overcome this difficulty were given

  15. Implementation and Commercialization of New Plant Germplasms for Use on Military Ranges

    Science.gov (United States)

    2009-07-01

    Alfalfa Medicago sativa Introduced Basin wildrye Leymus cinereus (Scribn. & Merr.) Á. Löve Native (western U.S.) Beardless wildrye Leymus triticoides...used our investigations into root growth and establishment relationships among various species to select seed mixes of rapidly establishing...establish native plants, we developed the concept of “ecological bridges.” In this innovative work, we investigated root growth and establishment

  16. Ope`ape`a: Solving the puzzles of Hawaii's only bat

    Science.gov (United States)

    Bonaccorso, Frank J.

    2010-01-01

    The Hawaiian hoary bat is described as the only land mammal native to Hawaii. In fact, this bat (Lasiurus cinereus semotus) arrived on the islands some 10,000 years ago – in what must qualify as one of the most spectacular immigrations in the history of mammals. The Hawaiian islands, after all, are 2,400 miles (3,860 kilometers) from the nearest landfall on the North American continent, and the distance to Australia, New Guinea or Asia is even farther.

  17. Threatened and Endangered Species on Army Installations: A MACOM Report.

    Science.gov (United States)

    1997-12-01

    ONsrE AND CONTIGuOUS Plants Haha Oha, Cyanea koolanensis (PE) ESMP Haha Oha, Cyanea longiflora (PE) ESMP Nanu, Gardenia mannii (PE) ESMP No Common Name... Haha Oha, Cyanea grimesiana ssp. grimesiana (E) ESMP No Common Name, Phyllostegia hirsuta (FE) ESMP Popolo ’Aiakeakua, Solanum sandwicense (E) ESMP...Lasiurus cinereus semnotus (E) ESMP Plants Akoko, Chamaesyce rockii (PE) ESMF Haha Oha, Cyanea acuminata (FE) ESMP Haha Oha, Cyanea grimesiana ssp

  18. Structural and functional properties of actinomycetal communities in chernozems and saline soils of Ukraine

    Science.gov (United States)

    Grishko, V. N.; Syshchikova, O. V.

    2010-02-01

    In the profiles of ordinary and southern chernozems, the total numbers of amylolytic microorganisms and actinomycetes decreased with the depth by 2.4-4.2 and 3.4 times, respectively; in the profiles of solonetz and solonchak soils, by 4.2-5.3 and 4.8 times, respectively. In the genetic horizons of the ordinary and southern chernozems, the share of actinomycetes amounted to 29-30% of the total population of microorganisms; in the saline soils, it increases with the depth from 23 to 43%. In the chernozems, Streptomyces violaceomaculatus (Roseus section), St. sporoherbeus (Azureus), St. aerionidulus (Cinereus), St. enduracidicus (Cinereus), and St. grisinus (Cinereus) predominated; in the saline soils, St. violaceomaculatus and St. aerionidulus prevailed. In the ordinary chernozem, the Berger-Parker index was 1.5 times higher than in the southern chernozem. High similarity was found between the streptomycete communities in the chernozems (the Sorensen coefficient was 0.78). In the solonetzes, the species richness of the streptomycetes was higher by 1.7 times than in the solonchaks. In the chernozems, the similarity of the streptomycete communities was higher than in the solonchaks (0.78 and 0.60, respectively).

  19. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  20. Molecular characterization of beta-tubulin gene from Pleurotus sajor-caju.

    Science.gov (United States)

    Kim, B G; Yoo, Y B; Kwon, S T; Magae, Y

    2001-10-01

    A beta-tubulin gene (TUB1) from the basidiomycete Pleurotus sajor-caju was sequenced. TUB1 encodes a 446-amino-acid protein. The coding region is interrupted by 9 introns, all of which had a 5'-GTRNGT... YAG-3' sequence at the boundaries. Locations of the introns in TUB1 were common between the beta-tubulin genes of other basidiomycetes, but not with animals, ascomycetes, or plants. This suggests that the introns were inserted independently into the beta-tubulin gene after these divisions had diverged.