WorldWideScience

Sample records for base pairing motif

  1. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  2. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment of p...

  3. Non-Watson-Crick base pairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 20, č. 6 (2003), s. 986 ISSN 0739-1102. [Albany 2003: Conversation 13. 17.06.2003-21.06.2003, Albany] Institutional research plan: CEZ:AV0Z5004920 Keywords : non- Watson -Crick base pairs * Loop E * RNA Subject RIV: BO - Biophysics

  4. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun

    2015-09-27

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  5. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells.

    Science.gov (United States)

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin

    2016-02-01

    The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. The identified motif pair data is compressed and available in the supplementary materials associated with this manuscript. kc.w@cityu.edu.hk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Motifs in triadic random graphs based on Steiner triple systems

    Science.gov (United States)

    Winkler, Marco; Reichardt, Jörg

    2013-08-01

    Conventionally, pairwise relationships between nodes are considered to be the fundamental building blocks of complex networks. However, over the last decade, the overabundance of certain subnetwork patterns, i.e., the so-called motifs, has attracted much attention. It has been hypothesized that these motifs, instead of links, serve as the building blocks of network structures. Although the relation between a network's topology and the general properties of the system, such as its function, its robustness against perturbations, or its efficiency in spreading information, is the central theme of network science, there is still a lack of sound generative models needed for testing the functional role of subgraph motifs. Our work aims to overcome this limitation. We employ the framework of exponential random graph models (ERGMs) to define models based on triadic substructures. The fact that only a small portion of triads can actually be set independently poses a challenge for the formulation of such models. To overcome this obstacle, we use Steiner triple systems (STSs). These are partitions of sets of nodes into pair-disjoint triads, which thus can be specified independently. Combining the concepts of ERGMs and STSs, we suggest generative models capable of generating ensembles of networks with nontrivial triadic Z-score profiles. Further, we discover inevitable correlations between the abundance of triad patterns, which occur solely for statistical reasons and need to be taken into account when discussing the functional implications of motif statistics. Moreover, we calculate the degree distributions of our triadic random graphs analytically.

  7. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  8. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  9. RNA structural motif recognition based on least-squares distance.

    Science.gov (United States)

    Shen, Ying; Wong, Hau-San; Zhang, Shaohong; Zhang, Lin

    2013-09-01

    RNA structural motifs are recurrent structural elements occurring in RNA molecules. RNA structural motif recognition aims to find RNA substructures that are similar to a query motif, and it is important for RNA structure analysis and RNA function prediction. In view of this, we propose a new method known as RNA Structural Motif Recognition based on Least-Squares distance (LS-RSMR) to effectively recognize RNA structural motifs. A test set consisting of five types of RNA structural motifs occurring in Escherichia coli ribosomal RNA is compiled by us. Experiments are conducted for recognizing these five types of motifs. The experimental results fully reveal the superiority of the proposed LS-RSMR compared with four other state-of-the-art methods.

  10. PairMotifChIP: A Fast Algorithm for Discovery of Patterns Conserved in Large ChIP-seq Data Sets.

    Science.gov (United States)

    Yu, Qiang; Huo, Hongwei; Feng, Dazheng

    2016-01-01

    Identifying conserved patterns in DNA sequences, namely, motif discovery, is an important and challenging computational task. With hundreds or more sequences contained, the high-throughput sequencing data set is helpful to improve the identification accuracy of motif discovery but requires an even higher computing performance. To efficiently identify motifs in large DNA data sets, a new algorithm called PairMotifChIP is proposed by extracting and combining pairs of l -mers in the input with relatively small Hamming distance. In particular, a method for rapidly extracting pairs of l -mers is designed, which can be used not only for PairMotifChIP, but also for other DNA data mining tasks with the same demand. Experimental results on the simulated data show that the proposed algorithm can find motifs successfully and runs faster than the state-of-the-art motif discovery algorithms. Furthermore, the validity of the proposed algorithm has been verified on real data.

  11. DNA nanotechnology based on i-motif structures.

    Science.gov (United States)

    Dong, Yuanchen; Yang, Zhongqiang; Liu, Dongsheng

    2014-06-17

    CONSPECTUS: Most biological processes happen at the nanometer scale, and understanding the energy transformations and material transportation mechanisms within living organisms has proved challenging. To better understand the secrets of life, researchers have investigated artificial molecular motors and devices over the past decade because such systems can mimic certain biological processes. DNA nanotechnology based on i-motif structures is one system that has played an important role in these investigations. In this Account, we summarize recent advances in functional DNA nanotechnology based on i-motif structures. The i-motif is a DNA quadruplex that occurs as four stretches of cytosine repeat sequences form C·CH(+) base pairs, and their stabilization requires slightly acidic conditions. This unique property has produced the first DNA molecular motor driven by pH changes. The motor is reliable, and studies show that it is capable of millisecond running speeds, comparable to the speed of natural protein motors. With careful design, the output of these types of motors was combined to drive micrometer-sized cantilevers bend. Using established DNA nanostructure assembly and functionalization methods, researchers can easily integrate the motor within other DNA assembled structures and functional units, producing DNA molecular devices with new functions such as suprahydrophobic/suprahydrophilic smart surfaces that switch, intelligent nanopores triggered by pH changes, molecular logic gates, and DNA nanosprings. Recently, researchers have produced motors driven by light and electricity, which have allowed DNA motors to be integrated within silicon-based nanodevices. Moreover, some devices based on i-motif structures have proven useful for investigating processes within living cells. The pH-responsiveness of the i-motif structure also provides a way to control the stepwise assembly of DNA nanostructures. In addition, because of the stability of the i-motif, this

  12. Differential transmembrane domain GXXXG motif pairing impacts major histocompatibility complex (MHC) class II structure.

    Science.gov (United States)

    Dixon, Ann M; Drake, Lisa; Hughes, Kelly T; Sargent, Elizabeth; Hunt, Danielle; Harton, Jonathan A; Drake, James R

    2014-04-25

    Major histocompatibility complex (MHC) class II molecules exhibit conformational heterogeneity, which influences their ability to stimulate CD4 T cells and drive immune responses. Previous studies suggest a role for the transmembrane domain of the class II αβ heterodimer in determining molecular structure and function. Our previous studies identified an MHC class II conformer that is marked by the Ia.2 epitope. These Ia.2(+) class II conformers are lipid raft-associated and able to drive both tyrosine kinase signaling and efficient antigen presentation to CD4 T cells. Here, we establish that the Ia.2(+) I-A(k) conformer is formed early in the class II biosynthetic pathway and that differential pairing of highly conserved transmembrane domain GXXXG dimerization motifs is responsible for formation of Ia.2(+) versus Ia.2(-) I-A(k) class II conformers and controlling lipid raft partitioning. These findings provide a molecular explanation for the formation of two distinct MHC class II conformers that differ in their inherent ability to signal and drive robust T cell activation, providing new insight into the role of MHC class II in regulating antigen-presenting cell-T cell interactions critical to the initiation and control of multiple aspects of the immune response.

  13. Profile-based short linear protein motif discovery

    Directory of Open Access Journals (Sweden)

    Haslam Niall J

    2012-05-01

    Full Text Available Abstract Background Short linear protein motifs are attracting increasing attention as functionally independent sites, typically 3–10 amino acids in length that are enriched in disordered regions of proteins. Multiple methods have recently been proposed to discover over-represented motifs within a set of proteins based on simple regular expressions. Here, we extend these approaches to profile-based methods, which provide a richer motif representation. Results The profile motif discovery method MEME performed relatively poorly for motifs in disordered regions of proteins. However, when we applied evolutionary weighting to account for redundancy amongst homologous proteins, and masked out poorly conserved regions of disordered proteins, the performance of MEME is equivalent to that of regular expression methods. However, the two approaches returned different subsets within both a benchmark dataset, and a more realistic discovery dataset. Conclusions Profile-based motif discovery methods complement regular expression based methods. Whilst profile-based methods are computationally more intensive, they are likely to discover motifs currently overlooked by regular expression methods.

  14. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  15. Report on Pairing-based Cryptography

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  16. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  17. Leucine-based receptor sorting motifs are dependent on the spacing relative to the plasma membrane

    DEFF Research Database (Denmark)

    Geisler, C; Dietrich, J; Nielsen, B L

    1998-01-01

    Many integral membrane proteins contain leucine-based motifs within their cytoplasmic domains that mediate internalization and intracellular sorting. Two types of leucine-based motifs have been identified. One type is dependent on phosphorylation, whereas the other type, which includes an acidic...... amino acid, is constitutively active. In this study, we have investigated how the spacing relative to the plasma membrane affects the function of both types of leucine-based motifs. For phosphorylation-dependent leucine-based motifs, a minimal spacing of 7 residues between the plasma membrane...... and the phospho-acceptor was required for phosphorylation and thereby activation of the motifs. For constitutively active leucine-based motifs, a minimal spacing of 6 residues between the plasma membrane and the acidic residue was required for optimal activity of the motifs. In addition, we found that the acidic...

  18. Sequence-based classification using discriminatory motif feature selection.

    Directory of Open Access Journals (Sweden)

    Hao Xiong

    Full Text Available Most existing methods for sequence-based classification use exhaustive feature generation, employing, for example, all k-mer patterns. The motivation behind such (enumerative approaches is to minimize the potential for overlooking important features. However, there are shortcomings to this strategy. First, practical constraints limit the scope of exhaustive feature generation to patterns of length ≤ k, such that potentially important, longer (> k predictors are not considered. Second, features so generated exhibit strong dependencies, which can complicate understanding of derived classification rules. Third, and most importantly, numerous irrelevant features are created. These concerns can compromise prediction and interpretation. While remedies have been proposed, they tend to be problem-specific and not broadly applicable. Here, we develop a generally applicable methodology, and an attendant software pipeline, that is predicated on discriminatory motif finding. In addition to the traditional training and validation partitions, our framework entails a third level of data partitioning, a discovery partition. A discriminatory motif finder is used on sequences and associated class labels in the discovery partition to yield a (small set of features. These features are then used as inputs to a classifier in the training partition. Finally, performance assessment occurs on the validation partition. Important attributes of our approach are its modularity (any discriminatory motif finder and any classifier can be deployed and its universality (all data, including sequences that are unaligned and/or of unequal length, can be accommodated. We illustrate our approach on two nucleosome occupancy datasets and a protein solubility dataset, previously analyzed using enumerative feature generation. Our method achieves excellent performance results, with and without optimization of classifier tuning parameters. A Python pipeline implementing the approach is

  19. An Affinity Propagation-Based DNA Motif Discovery Algorithm

    Directory of Open Access Journals (Sweden)

    Chunxiao Sun

    2015-01-01

    Full Text Available The planted (l,d motif search (PMS is one of the fundamental problems in bioinformatics, which plays an important role in locating transcription factor binding sites (TFBSs in DNA sequences. Nowadays, identifying weak motifs and reducing the effect of local optimum are still important but challenging tasks for motif discovery. To solve the tasks, we propose a new algorithm, APMotif, which first applies the Affinity Propagation (AP clustering in DNA sequences to produce informative and good candidate motifs and then employs Expectation Maximization (EM refinement to obtain the optimal motifs from the candidate motifs. Experimental results both on simulated data sets and real biological data sets show that APMotif usually outperforms four other widely used algorithms in terms of high prediction accuracy.

  20. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs

    Directory of Open Access Journals (Sweden)

    Girgis Hani Z

    2012-02-01

    Full Text Available Abstract Background Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF binding sites (TFBSs. Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. Results We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was

  1. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs.

    Science.gov (United States)

    Girgis, Hani Z; Ovcharenko, Ivan

    2012-02-07

    Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs) and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF) binding sites (TFBSs). Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was 21-75% more precise than a related CRM

  2. Transcriptional Network growing Models using Motif-based Preferential Attachment

    Directory of Open Access Journals (Sweden)

    Ahmed Farouk Abdelzaher

    2015-10-01

    Full Text Available Understanding relationships between architectural properties of gene-regulatory networks (GRNs has been one of the major goals in systems biology and bioinformatics, as it can provide insights into, e.g., disease dynamics and drug development. Such GRNs are characterized by their scale-free degree distributions and existence of network motifs--i.e., small-node subgraphs that occur more abundantly in GRNs than expected from chance alone. Because these transcriptional modules represent ``building blocks'' of complex networks and exhibit a wide range of functional and dynamical properties, they may contribute to the remarkable robustness and dynamical stability associated with the whole of GRNs. Here we developed network-construction models to better understand this relationship, which produce randomized GRNs by using transcriptional motifs as the fundamental growth unit in contrast to other methods that construct similar networks on a node-by-node basis. Because this model produces networks with a prescribed lower bound on the number of choice transcriptional motifs (e.g., downlinks, feed-forward loops, its fidelity to the motif distributions observed in model organisms represents an improvement over existing methods, which we validated by contrasting their resultant motif and degree distributions against existing network-growth models and data from the model organism of the bacterium Escherichia coli. These models may therefore serve as novel testbeds for further elucidating relationships between the topology of transcriptional motifs and network-wide dynamical properties.

  3. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    Science.gov (United States)

    (O’ Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  4. Pengembangan Motif Batik Khas Bali

    Directory of Open Access Journals (Sweden)

    Irfa'ina Rohana Salma

    2016-04-01

    Full Text Available ABSTRAKIndustri batik berkembang pesat di Bali, namun motif-motif batiknya tidak mencerminkan identitas khas daerah. Oleh karena itu perlu diciptakan desain motif batik khas Bali yang sumber inspirasinya digali budaya dan alam Bali. Tujuan penelitian dan penciptaan seni ini adalah untuk menghasilkan motif batik yang mempunyai bentuk  unik dan karakteristik sehingga dapat mencerminkan budaya dan alam Bali. Metode yang digunakan yaitu pengumpulan data, perancangan motif, perwujudan menjadi batik, serta uji estetikanya. Dari penciptaan seni ini berhasil diciptakan 5 motif batik yaitu: (1 Motif Jepun Alit; (2 Motif Jepun Ageng; (3 Motif Sekar Jagad Bali; (4 Motif Teratai Banji; dan (5 Motif Poleng Biru. Berdasarkan hasil penilaian “Selera Estetika” diketahui bahwa motif yang paling banyak disukai adalah Motif Jepun Alit, Motif Sekar Jagad Bali,  dan Motif Teratai Banji. Kata kunci: Motif Jepun Alit, Motif Jepun Ageng, Motif Sekar Jagad Bali, Motif Teratai Banji, Motif Poleng Biru ABSTRACT Batik industry is growing rapidly in Bali, but its batik motifs do not reflect the typical regional identities. Therefore, it is necessary to create a distinctive design motif source of Bali excavated  from the repertoire of traditional Balinese arts and culture. The purpose of this research and its art creation is to produce batik motifs that have a unique shape and characteristics  to reflect the Balinese culture and natural surroundings. The method used by gathering and collecting data, designing motifs to  become the embodiment of batik. From the creation of this art had been created 5 motifs, namely: (1 Motif Jepun Alit; (2 Motif Jepun Ageng; (3 Motif Sekar Jagad Bali; (4 Motif Teratai Banji; and (5 Motif Poleng Biru. Based on the results of aesthetical assessment known that the most preferred motif are  Motif Jepun Alit, Motif Sekar Jagad Bali, and Motif Teratai Banji. Key words: Motif Jepun Alit, Motif Jepun Ageng, Motif Sekar Jagad Bali, Motif

  5. A mini-RNA containing the tetraloop, wobble-pair and loop E motifs of the central conserved region of potato spindle tuber viroid is processed into a minicircle.

    Science.gov (United States)

    Schrader, O; Baumstark, T; Riesner, D

    2003-02-01

    A Mini-RNA from potato spindle tuber viroid (PSTVd) was constructed specifically for cleavage and ligation to circles in vitro. It contains the C-domain with the so-called central conserved region (CCR) of PSTVd with a 17 nt duplication in the upper strand and hairpin structures at the left and rights ends of the secondary structure. The CCR was previously shown to be essential for processing of in vitro transcripts. When folded under conditions which favor formation of a kinetically controlled conformation and incubated in a potato nuclear extract, the Mini-RNA is cleaved correctly at the 5'- and the 3'-end and ligated to a circle. Thus, the CCR obviously contains all structural and functional requirements for correct processing and therefore may be regarded as 'processing domain' of PSTVd. Using the Mini-RNA as a model substrate, the structural and functional relevance of its conserved non-canonical motifs GAAA tetraloop, loop E and G:U wobble base pair were studied by mutational analysis. It was found that (i) the conserved GAAA tetraloop is essential for processing by favoring the kinetically controlled conformation, (ii) a G:U wobble base pair at the 5'-cleavage site contributes to its correct recognition and (iii) an unpaired nucleotide in loop E, which is different from the corresponding nucleotide in the conserved loop E motif, is essential for ligation of the 5'- with the 3'-end. Hence all three structural motifs are functional elements for processing in a potato nuclear extract.

  6. DNA regulatory motif selection based on support vector machine ...

    African Journals Online (AJOL)

    Conserved DNA sequences are essential to investigate the regulation and expression of nearby genes. The conserved regions can interact with certain proteins and can potentially determine the transcription speed and amount of the corresponding mRNA in gene replication process. In this paper, motifs of coexpressed ...

  7. Biomimetic trapping cocktail to screen reactive metabolites: use of an amino acid and DNA motif mixture as light/heavy isotope pairs differing in mass shift.

    Science.gov (United States)

    Hosaka, Shuto; Honda, Takuto; Lee, Seon Hwa; Oe, Tomoyuki

    2018-04-14

    Candidate drugs that can be metabolically transformed into reactive electrophilic products, such as epoxides, quinones, and nitroso compounds, are of special concern because subsequent covalent binding to bio-macromolecules can cause adverse drug reactions, such as allergic reactions, hepatotoxicity, and genotoxicity. Several strategies have been reported for screening reactive metabolites, such as a covalent binding assay with radioisotope-labeled drugs and a trapping method followed by LC-MS/MS analyses. Of these, a trapping method using glutathione is the most common, especially at the early stage of drug development. However, the cysteine of glutathione is not the only nucleophilic site in vivo; lysine, histidine, arginine, and DNA bases are also nucleophilic. Indeed, the glutathione trapping method tends to overlook several types of reactive metabolites, such as aldehydes, acylglucuronides, and nitroso compounds. Here, we introduce an alternate way for screening reactive metabolites as follows: A mixture of the light and heavy isotopes of simplified amino acid motifs and a DNA motif is used as a biomimetic trapping cocktail. This mixture consists of [ 2 H 0 ]/[ 2 H 3 ]-1-methylguanidine (arginine motif, Δ 3 Da), [ 2 H 0 ]/[ 2 H 4 ]-2-mercaptoethanol (cysteine motif, Δ 4 Da), [ 2 H 0 ]/[ 2 H 5 ]-4-methylimidazole (histidine motif, Δ 5 Da), [ 2 H 0 ]/[ 2 H 9 ]-n-butylamine (lysine motif, Δ 9 Da), and [ 13 C 0 , 15 N 0 ]/[ 13 C 1 , 15 N 2 ]-2'-deoxyguanosine (DNA motif, Δ 3 Da). Mass tag triggered data-dependent acquisition is used to find the characteristic doublet peaks, followed by specific identification of the light isotope peak using MS/MS. Forty-two model drugs were examined using an in vitro microsome experiment to validate the strategy. Graphical abstract Biomimetic trapping cocktail to screen reactive metabolites.

  8. Effects of osmolytes and macromolecular crowders on stable GAAA tetraloops and their preference for a CG closing base pair

    Directory of Open Access Journals (Sweden)

    Kaethe N. Leonard

    2018-02-01

    Full Text Available Osmolytes and macromolecular crowders have the potential to influence the stability of secondary structure motifs and alter preferences for conserved nucleic acid sequences in vivo. To further understand the cellular function of RNA we observed the effects of a model osmolyte, polyethylene glycol (PEG 200, and a model macromolecular crowding agent, PEG 8000, on the GAAA tetraloop motif. GAAA tetraloops are conserved, stable tetraloops, and are critical participants in RNA tertiary structure. They also have a thermodynamic preference for a CG closing base pair. The thermal denaturation of model hairpins containing GAAA loops was monitored using UV-Vis spectroscopy in the presence and absence of PEG 200 or PEG 8000. Both of the cosolutes tested influenced the thermodynamic preference for a CG base pair by destabilizing the loop with a CG closing base pair relative to the loop with a GC closing base pair. This result also extended to a related DNA triloop, which provides further evidence that the interactions between the loop and closing base pair are identical for the d(GCA triloop and the GAAA tetraloop. Our results suggest that in the presence of model PEG molecules, loops with a GC closing base pair may retain some preferential interactions with the cosolutes that are lost in the presence of the CG closing base pair. These results reveal that relatively small structural changes could influence how neutral cosolutes tune the stability and function of secondary structure motifs in vivo.

  9. Method for sequencing DNA base pairs

    Science.gov (United States)

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  10. Cytosine-Cytosine Base-Pair Mismatch and Chirality in Nucleotide Supramolecular Coordination Complexes.

    Science.gov (United States)

    Qiu, Qi-Ming; Zhou, Pei; Gu, Leilei; Hao, Liang; Liu, Minghua; Li, Hui

    2017-05-29

    The base-pair sequences are the foundation for the biological processes of DNA or RNA, and base-pair mismatch is very important to reveal genetic diseases and DNA rearrangements. However, the lack of well-defined structural information about base-pair mismatch is obstructing the investigation of this issue. The challenge is to crystallize the materials containing the base-pair mismatch. Engineering the small-molecule mimics or model is an effective strategy to solve this issue. Here, six cytidine-5'-monophosphate (CMP) and 2'-deoxycytidine-5'-monophosphate (dCMP) coordination polymers were reported containing cytosine-cytosine base-pair mismatch (i-motif), and their single-crystal structures and chiralities were studied. The precise control over the formation of the i-motif was demonstrated, in which the regulating of supramolecular interactions was achieved based on molecular design. In addition, the chiralities of these coordination polymers were investigated according to their crystal structures and solution- and solid-state circular dichroism spectroscopy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. URS DataBase: universe of RNA structures and their motifs.

    Science.gov (United States)

    Baulin, Eugene; Yacovlev, Victor; Khachko, Denis; Spirin, Sergei; Roytberg, Mikhail

    2016-01-01

    The Universe of RNA Structures DataBase (URSDB) stores information obtained from all RNA-containing PDB entries (2935 entries in October 2015). The content of the database is updated regularly. The database consists of 51 tables containing indexed data on various elements of the RNA structures. The database provides a web interface allowing user to select a subset of structures with desired features and to obtain various statistical data for a selected subset of structures or for all structures. In particular, one can easily obtain statistics on geometric parameters of base pairs, on structural motifs (stems, loops, etc.) or on different types of pseudoknots. The user can also view and get information on an individual structure or its selected parts, e.g. RNA-protein hydrogen bonds. URSDB employs a new original definition of loops in RNA structures. That definition fits both pseudoknot-free and pseudoknotted secondary structures and coincides with the classical definition in case of pseudoknot-free structures. To our knowledge, URSDB is the first database supporting searches based on topological classification of pseudoknots and on extended loop classification.Database URL: http://server3.lpm.org.ru/urs/. © The Author(s) 2016. Published by Oxford University Press.

  12. Base motif recognition and design of DNA templates for fluorescent silver clusters by machine learning.

    Science.gov (United States)

    Copp, Stacy M; Bogdanov, Petko; Debord, Mark; Singh, Ambuj; Gwinn, Elisabeth

    2014-09-03

    Discriminative base motifs within DNA templates for fluorescent silver clusters are identified using methods that combine large experimental data sets with machine learning tools for pattern recognition. Combining the discovery of certain multibase motifs important for determining fluorescence brightness with a generative algorithm, the probability of selecting DNA templates that stabilize fluorescent silver clusters is increased by a factor of >3. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Amplification of Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry

    Science.gov (United States)

    Islam, SK Firoz; Saha, Arijit

    2017-09-01

    Motivated by the recent experiments [Scientific Reports 6, 23051 (2016), 10.1038/srep23051; Phys. Rev. Lett. 114, 096602 (2015), 10.1103/PhysRevLett.114.096602], we theoretically investigate Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry. By considering the graphene-based superconductor as an entangler device, instead of normal [two-dimensional (2D)] BCS superconductor, we show that the Cooper pair splitting current mediated by the crossed Andreev process is amplified compared to its normal superconductor counterpart. This amplification is attributed to the strong suppression of the local normal Andreev reflection process (arising from the Cooper pair splitting) from the graphene-based superconductor to lead via the same quantum dot, in comparison to the usual 2D superconductor. Due to the vanishing density of states at the Dirac point of undoped graphene, a doped graphene-based superconductor is considered here and it is observed that Cooper pair splitting current is very insensitive to the doping level in comparison to the usual 2D superconductor. The transport process of nonlocal spin-entangled electrons also depends on the type of pairing, i.e., whether the electron-hole pairing is onsite, intersublattice or the combination of both. The intersublattice pairing of graphene causes the maximum nonlocal Cooper pair splitting current, whereas the presence of both pairings reduces the Cooper pair splitting current.

  14. Cloud-based MOTIFSIM: Detecting Similarity in Large DNA Motif Data Sets.

    Science.gov (United States)

    Tran, Ngoc Tam L; Huang, Chun-Hsi

    2017-05-01

    We developed the cloud-based MOTIFSIM on Amazon Web Services (AWS) cloud. The tool is an extended version from our web-based tool version 2.0, which was developed based on a novel algorithm for detecting similarity in multiple DNA motif data sets. This cloud-based version further allows researchers to exploit the computing resources available from AWS to detect similarity in multiple large-scale DNA motif data sets resulting from the next-generation sequencing technology. The tool is highly scalable with expandable AWS.

  15. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    WINTEC

    PDB files using RASMOL18 software. Hydrogen atoms were added to these base pairs using MOLDEN19 software. The sugar portions attached to base pairs in. RNA structures were removed, and C1′ atoms were respectively replaced by hydrogen atoms during model building. The change in base pair geometry on re-.

  16. Efficient sequential and parallel algorithms for finding edit distance based motifs.

    Science.gov (United States)

    Pal, Soumitra; Xiao, Peng; Rajasekaran, Sanguthevar

    2016-08-18

    Motif search is an important step in extracting meaningful patterns from biological data. The general problem of motif search is intractable and there is a pressing need to develop efficient, exact and approximation algorithms to solve this problem. In this paper, we present several novel, exact, sequential and parallel algorithms for solving the (l,d) Edit-distance-based Motif Search (EMS) problem: given two integers l,d and n biological strings, find all strings of length l that appear in each input string with atmost d errors of types substitution, insertion and deletion. One popular technique to solve the problem is to explore for each input string the set of all possible l-mers that belong to the d-neighborhood of any substring of the input string and output those which are common for all input strings. We introduce a novel and provably efficient neighborhood exploration technique. We show that it is enough to consider the candidates in neighborhood which are at a distance exactly d. We compactly represent these candidate motifs using wildcard characters and efficiently explore them with very few repetitions. Our sequential algorithm uses a trie based data structure to efficiently store and sort the candidate motifs. Our parallel algorithm in a multi-core shared memory setting uses arrays for storing and a novel modification of radix-sort for sorting the candidate motifs. The algorithms for EMS are customarily evaluated on several challenging instances such as (8,1), (12,2), (16,3), (20,4), and so on. The best previously known algorithm, EMS1, is sequential and in estimated 3 days solves up to instance (16,3). Our sequential algorithms are more than 20 times faster on (16,3). On other hard instances such as (9,2), (11,3), (13,4), our algorithms are much faster. Our parallel algorithm has more than 600 % scaling performance while using 16 threads. Our algorithms have pushed up the state-of-the-art of EMS solvers and we believe that the techniques introduced in

  17. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  18. iTriplet, a rule-based nucleic acid sequence motif finder

    Directory of Open Access Journals (Sweden)

    Gunderson Samuel I

    2009-10-01

    Full Text Available Abstract Background With the advent of high throughput sequencing techniques, large amounts of sequencing data are readily available for analysis. Natural biological signals are intrinsically highly variable making their complete identification a computationally challenging problem. Many attempts in using statistical or combinatorial approaches have been made with great success in the past. However, identifying highly degenerate and long (>20 nucleotides motifs still remains an unmet challenge as high degeneracy will diminish statistical significance of biological signals and increasing motif size will cause combinatorial explosion. In this report, we present a novel rule-based method that is focused on finding degenerate and long motifs. Our proposed method, named iTriplet, avoids costly enumeration present in existing combinatorial methods and is amenable to parallel processing. Results We have conducted a comprehensive assessment on the performance and sensitivity-specificity of iTriplet in analyzing artificial and real biological sequences in various genomic regions. The results show that iTriplet is able to solve challenging cases. Furthermore we have confirmed the utility of iTriplet by showing it accurately predicts polyA-site-related motifs using a dual Luciferase reporter assay. Conclusion iTriplet is a novel rule-based combinatorial or enumerative motif finding method that is able to process highly degenerate and long motifs that have resisted analysis by other methods. In addition, iTriplet is distinguished from other methods of the same family by its parallelizability, which allows it to leverage the power of today's readily available high-performance computing systems.

  19. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  20. Base pairing in RNA structures: A computational analysis

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  1. Photochemical selectivity in guanine–cytosine base-pair structures

    Science.gov (United States)

    Abo-Riziq, Ali; Grace, Louis; Nir, Eyal; Kabelac, Martin; Hobza, Pavel; de Vries, Mattanjah S.

    2005-01-01

    Prebiotic chemistry presumably took place before formation of an oxygen-rich atmosphere and thus under conditions of intense short wavelength UV irradiation. Therefore, the UV photochemical stability of the molecular building blocks of life may have been an important selective factor in determining the eventual chemical makeup of critical biomolecules. To investigate the role of UV irradiation in base-pairing we have studied guanine (G) and cytosine (C) base pairs in the absence of the RNA backbone. We distinguished base-pair structures by IR–UV hole-burning spectroscopy as well as by high-level correlated ab initio calculations. The Watson–Crick structure exhibits broad UV absorption, in stark contrast to other GC structures and other base-pair structures. This broad absorption may be explained by a rapid internal conversion that makes this specific base pair arrangement uniquely photochemically stable. PMID:15618394

  2. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  3. DistAMo: A web-based tool to characterize DNA-motif distribution on bacterial chromosomes

    Directory of Open Access Journals (Sweden)

    Patrick eSobetzko

    2016-03-01

    Full Text Available Short DNA motifs are involved in a multitude of functions such as for example chromosome segregation, DNA replication or mismatch repair. Distribution of such motifs is often not random and the specific chromosomal pattern relates to the respective motif function. Computational approaches which quantitatively assess such chromosomal motif patterns are necessary. Here we present a new computer tool DistAMo (Distribution Analysis of DNA Motifs. The algorithm uses codon redundancy to calculate the relative abundance of short DNA motifs from single genes to entire chromosomes. Comparative genomics analyses of the GATC-motif distribution in γ-proteobacterial genomes using DistAMo revealed that (i genes beside the replication origin are enriched in GATCs, (ii genome-wide GATC distribution follows a distinct pattern and (iii genes involved in DNA replication and repair are enriched in GATCs. These features are specific for bacterial chromosomes encoding a Dam methyltransferase. The new software is available as a stand-alone or as an easy-to-use web-based server version at http://www.computational.bio.uni-giessen.de/distamo.

  4. Base pairing motifs involving 1,8-naphthyridine: an ab initio study

    Czech Academy of Sciences Publication Activity Database

    Czernek, Jiří

    2006-01-01

    Roč. 7, - (2006), s. 124-127. ISBN 90-6764-443-9. ISSN 1573-4196. [International Conference on Computational Methods in Sciences and Engineering. Chania, Crete, 27.10.2006-01.11.2006] R&D Projects: GA AV ČR KJB400500602; GA AV ČR 1ET400500402 Institutional research plan: CEZ:AV0Z40500505 Keywords : ab initio * electron correlation * MP2 Subject RIV: CD - Macromolecular Chemistry

  5. Imidazopyridopyrimidine base pairing motifs consisting of four hydrogen bonds: a quantum chemical study

    Czech Academy of Sciences Publication Activity Database

    Czernek, Jiří

    2004-01-01

    Roč. 392, 4-6 (2004), s. 508-513 ISSN 0009-2614 R&D Projects: GA AV ČR KJB4050311 Institutional research plan: CEZ:AV0Z4050913 Keywords : ab initio * stabilization * DNA Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.438, year: 2004

  6. HIGEDA: a hierarchical gene-set genetics based algorithm for finding subtle motifs in biological sequences.

    Science.gov (United States)

    Le, Thanh; Altman, Tom; Gardiner, Katheleen

    2010-02-01

    Identification of motifs in biological sequences is a challenging problem because such motifs are often short, degenerate, and may contain gaps. Most algorithms that have been developed for motif-finding use the expectation-maximization (EM) algorithm iteratively. Although EM algorithms can converge quickly, they depend strongly on initialization parameters and can converge to local sub-optimal solutions. In addition, they cannot generate gapped motifs. The effectiveness of EM algorithms in motif finding can be improved by incorporating methods that choose different sets of initial parameters to enable escape from local optima, and that allow gapped alignments within motif models. We have developed HIGEDA, an algorithm that uses the hierarchical gene-set genetic algorithm (HGA) with EM to initiate and search for the best parameters for the motif model. In addition, HIGEDA can identify gapped motifs using a position weight matrix and dynamic programming to generate an optimal gapped alignment of the motif model with sequences from the dataset. We show that HIGEDA outperforms MEME and other motif-finding algorithms on both DNA and protein sequences. Source code and test datasets are available for download at http://ouray.cudenver.edu/~tnle/, implemented in C++ and supported on Linux and MS Windows.

  7. An algorithmic perspective of de novo cis-regulatory motif finding based on ChIP-seq data.

    Science.gov (United States)

    Liu, Bingqiang; Yang, Jinyu; Li, Yang; McDermaid, Adam; Ma, Qin

    2017-03-08

    Transcription factors are proteins that bind to specific DNA sequences and play important roles in controlling the expression levels of their target genes. Hence, prediction of transcription factor binding sites (TFBSs) provides a solid foundation for inferring gene regulatory mechanisms and building regulatory networks for a genome. Chromatin immunoprecipitation sequencing (ChIP-seq) technology can generate large-scale experimental data for such protein-DNA interactions, providing an unprecedented opportunity to identify TFBSs (a.k.a. cis-regulatory motifs). The bottleneck, however, is the lack of robust mathematical models, as well as efficient computational methods for TFBS prediction to make effective use of massive ChIP-seq data sets in the public domain. The purpose of this study is to review existing motif-finding methods for ChIP-seq data from an algorithmic perspective and provide new computational insight into this field. The state-of-the-art methods were shown through summarizing eight representative motif-finding algorithms along with corresponding challenges, and introducing some important relative functions according to specific biological demands, including discriminative motif finding and cofactor motifs analysis. Finally, potential directions and plans for ChIP-seq-based motif-finding tools were showcased in support of future algorithm development. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Motif-Based Text Mining of Microbial Metagenome Redundancy Profiling Data for Disease Classification

    Science.gov (United States)

    Wang, Yin; Zhou, Yuhua; Ling, Zongxin; Guo, Xiaokui; Xie, Lu; Liu, Lei

    2016-01-01

    Background. Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Results. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF) to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. Conclusions. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data. PMID:27057545

  9. Motif-Based Text Mining of Microbial Metagenome Redundancy Profiling Data for Disease Classification

    Directory of Open Access Journals (Sweden)

    Yin Wang

    2016-01-01

    Full Text Available Background. Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Results. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. Conclusions. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data.

  10. Motif-Based Text Mining of Microbial Metagenome Redundancy Profiling Data for Disease Classification.

    Science.gov (United States)

    Wang, Yin; Li, Rudong; Zhou, Yuhua; Ling, Zongxin; Guo, Xiaokui; Xie, Lu; Liu, Lei

    2016-01-01

    Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF) to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data.

  11. Probing the nature of hydrogen bonds in DNA base pairs.

    Science.gov (United States)

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  12. Understanding the kinetic mechanism of RNA single base pair formation.

    Science.gov (United States)

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-05

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model.

  13. FastMotif: spectral sequence motif discovery.

    Science.gov (United States)

    Colombo, Nicoló; Vlassis, Nikos

    2015-08-15

    Sequence discovery tools play a central role in several fields of computational biology. In the framework of Transcription Factor binding studies, most of the existing motif finding algorithms are computationally demanding, and they may not be able to support the increasingly large datasets produced by modern high-throughput sequencing technologies. We present FastMotif, a new motif discovery algorithm that is built on a recent machine learning technique referred to as Method of Moments. Based on spectral decompositions, our method is robust to model misspecifications and is not prone to locally optimal solutions. We obtain an algorithm that is extremely fast and designed for the analysis of big sequencing data. On HT-Selex data, FastMotif extracts motif profiles that match those computed by various state-of-the-art algorithms, but one order of magnitude faster. We provide a theoretical and numerical analysis of the algorithm's robustness and discuss its sensitivity with respect to the free parameters. The Matlab code of FastMotif is available from http://lcsb-portal.uni.lu/bioinformatics. vlassis@adobe.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Physical-chemical property based sequence motifs and methods regarding same

    Science.gov (United States)

    Braun, Werner [Friendswood, TX; Mathura, Venkatarajan S [Sarasota, FL; Schein, Catherine H [Friendswood, TX

    2008-09-09

    A data analysis system, program, and/or method, e.g., a data mining/data exploration method, using physical-chemical property motifs. For example, a sequence database may be searched for identifying segments thereof having physical-chemical properties similar to the physical-chemical property motifs.

  15. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  16. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  17. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  18. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  19. T cell receptor zeta allows stable expression of receptors containing the CD3gamma leucine-based receptor-sorting motif

    DEFF Research Database (Denmark)

    Dietrich, J; Geisler, C

    1998-01-01

    The leucine-based motif in the T cell receptor (TCR) subunit CD3gamma constitutes a strong internalization signal. In fully assembled TCR this motif is inactive unless phosphorylated. In contrast, the motif is constitutively active in CD4/CD3gamma and Tac/CD3gamma chimeras independently of phosph......The leucine-based motif in the T cell receptor (TCR) subunit CD3gamma constitutes a strong internalization signal. In fully assembled TCR this motif is inactive unless phosphorylated. In contrast, the motif is constitutively active in CD4/CD3gamma and Tac/CD3gamma chimeras independently...... to mask the CD3gamma leucine-based motif. By studying CD4/CD3gamma and CD16/CD3gamma chimeras, we found that CD16/CD3gamma chimeras associated with TCRzeta. The CD16/CD3gamma-TCRzeta complexes were stably expressed at the cell surface and had a low spontaneous internalization rate, indicating...... that the leucine-based motif in these complexes was inactive. In contrast, the CD4/CD3gamma chimeras did not associate with TCRzeta, and the leucine-based motif in these chimeras was constitutively active resulting in a high spontaneous internalization rate and low expression of the chimeras at the cell surface...

  20. A redundant role of the CD3 gamma-immunoreceptor tyrosine-based activation motif in mature T cell function

    NARCIS (Netherlands)

    Haks, MC; Cordaro, TA; van den Brakel, JHN; Haanen, JBAG; de Vries, EFR; Borst, J; Krimpenfort, P; Kruisbeek, AM

    2001-01-01

    At least four different CD3 polypeptide chains are contained within the mature TCR complex, each encompassing one (CD3 gamma, CD3 delta, and CD3 epsilon) or three (CD3 zeta) immunoreceptof tyrosine-based activation motifs (ITAMs) within their cytoplasmic domains. Why so many ITAMs are required is

  1. 1H NMR determination of base-pair lifetimes in oligonucleotides containing single base mismatches.

    Science.gov (United States)

    Bhattacharya, Pratip K; Cha, Julie; Barton, Jacqueline K

    2002-11-01

    Proton nuclear magnetic resonance (NMR) spectroscopy is employed to characterize the kinetics of base-pair opening in a series of 9mer duplexes containing different single base mismatches. The imino protons from the different mismatched, as well as fully matched, duplexes are assigned from the imino-imino region in the WATERGATE NOESY spectra. The exchange kinetics of the imino protons are measured from selective longitudinal relaxation times. In the limit of infinite exchange catalyst concentration, the exchange times of the mismatch imino protons extrapolate to much shorter lifetimes than are commonly observed for an isolated GC base pair. Different mismatches exhibit different orders of base-pair lifetimes, e.g. a TT mismatch has a shorter base-pair lifetime than a GG mismatch. The effect of the mismatch was observed up to a distance of two neighboring base pairs. This indicates that disruption in the duplex caused by the mismatch is quite localized. The overall order of base-pair lifetimes in the selected sequence context of the base pair is GC > GG > AA > CC > AT > TT. Interestingly, the fully matched AT base pair has a shorter base-pair lifetime relative to many of the mismatches. Thus, in any given base pair, the exchange lifetime can exhibit a strong dependence on sequence context. These findings may be relevant to the way mismatch recognition is accomplished by proteins and small molecules.

  2. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  3. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  4. Silver-Mediated Base Pairs in DNA Incorporating Purines, 7-Deazapurines, and 8-Aza-7-deazapurines: Impact of Reduced Nucleobase Binding Sites and an Altered Glycosylation Position.

    Science.gov (United States)

    Zhao, Hang; Leonard, Peter; Guo, Xiurong; Yang, Haozhe; Seela, Frank

    2017-04-24

    Formation of silver-mediated DNA was studied with oligonucleotides incorporating 8-aza-7-deazapurine, 7-deazapurine, and purine nucleosides. The investigation was performed on non-self-complementary duplexes with one or two modifications and self-complementary duplexes with an alternating dA-dT motif. Homo base pairs as well as base pair mismatches of dA analogues with dC and Watson-Crick pairs with dT were studied by stoichiometric silver ion titration and T m measurements. N 8 -Glycosylated 8-aza-7-deazaadenine forms silver-ion-mediated base pairs capturing two silver ions (low silver content) whereas regularly glycosylated 8-aza-7-deazapurine, 7-deazapurine (c 7 A d ), and dA do not form comparable structures. Stable silver-mediated "dA-dC" base pair mismatches were detected for all nucleosides. Two silver ions per base pair are bound by 8-aza-7-deazapurine whereas c 7 A d binds only one silver ion. The situation is different when the equivalents of silver ions were increased to the number of total base pairs. Surprisingly, in 12-mer duplexes as well as in related 25-mer duplexes every base pair consumed one silver ion. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  6. Kopi dan Kakao dalam Kreasi Motif Batik Khas Jember

    Directory of Open Access Journals (Sweden)

    Irfa'ina Rohana Salma

    2015-06-01

    , design motifs creation and the embodiment of batik. From the creation of this art successfully created into 6 (six motif, namely: (1 Motif Uwoh Kopi; (2 Motif Godhong Kopi; (3 Motif Ceplok Kakao; (4 Motif Kakao Raja; (5 Motif Kakao Biru; and (6 Motif Wiji Mukti. Based on the results of the “Aesthetics assessment taste" has been noticed that the most widely preferred motif is a Uwoh Kopi motif and Kakao Raja motif. Keywords: Motif Uwoh Kopi, Motif Godong Kopi, Motif Ceplok Kakao, Motif Kakao Raja, Motif Kakao Biru, Motif Wiji Mukti

  7. CeFunMO: A centrality based method for discovering functional motifs with application in biological networks.

    Science.gov (United States)

    Kouhsar, Morteza; Razaghi-Moghadam, Zahra; Mousavian, Zaynab; Masoudi-Nejad, Ali

    2016-09-01

    Detecting functional motifs in biological networks is one of the challenging problems in systems biology. Given a multiset of colors as query and a list-colored graph (an undirected graph with a set of colors assigned to each of its vertices), the problem is reduced to finding connected subgraphs, which best cover the multiset of query. To solve this NP-complete problem, we propose a new color-based centrality measure for list-colored graphs. Based on this newly-defined measure of centrality, a novel polynomial time algorithm is developed to discover functional motifs in list-colored graphs, using a greedy strategy. This algorithm, called CeFunMO, has superior running time and acceptable accuracy in comparison with other well-known algorithms, such as RANGI and GraMoFoNe. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Plasmodium vivax antigen discovery based on alpha-helical coiled coil protein motif

    DEFF Research Database (Denmark)

    Céspedes, Nora; Habel, Catherine; Lopez-Perez, Mary

    2014-01-01

    Protein α-helical coiled coil structures that elicit antibody responses, which block critical functions of medically important microorganisms, represent a means for vaccine development. By using bioinformatics algorithms, a total of 50 antigens with α-helical coiled coil motifs orthologous to Pla...

  9. [Prediction of Promoter Motifs in Virophages].

    Science.gov (United States)

    Gong, Chaowen; Zhou, Xuewen; Pan, Yingjie; Wang, Yongjie

    2015-07-01

    Virophages have crucial roles in ecosystems and are the transport vectors of genetic materials. To shed light on regulation and control mechanisms in virophage--host systems as well as evolution between virophages and their hosts, the promoter motifs of virophages were predicted on the upstream regions of start codons using an analytical tool for prediction of promoter motifs: Multiple EM for Motif Elicitation. Seventeen potential promoter motifs were identified based on the E-value, location, number and length of promoters in genomes. Sputnik and zamilon motif 2 with AT-rich regions were distributed widely on genomes, suggesting that these motifs may be associated with regulation of the expression of various genes. Motifs containing the TCTA box were predicted to be late promoter motif in mavirus; motifs containing the ATCT box were the potential late promoter motif in the Ace Lake mavirus . AT-rich regions were identified on motif 2 in the Organic Lake virophage, motif 3 in Yellowstone Lake virophage (YSLV)1 and 2, motif 1 in YSLV3, and motif 1 and 2 in YSLV4, respectively. AT-rich regions were distributed widely on the genomes of virophages. All of these motifs may be promoter motifs of virophages. Our results provide insights into further exploration of temporal expression of genes in virophages as well as associations between virophages and giant viruses.

  10. Supramolecular polymers constructed from macrocycle-based host-guest molecular recognition motifs.

    Science.gov (United States)

    Dong, Shengyi; Zheng, Bo; Wang, Feng; Huang, Feihe

    2014-07-15

    /physical properties, including stimuli responsiveness, self-healing, and environmental adaptation. It has been reported that macrocycle-based supramolecular polymers can respond to pH change, photoirradition, anions, cations, temperature, and solvent. Macrocycle-based supramolecular polymers have been prepared in solution, in gel, and in the solid state. Furthermore, the solvent has a very important influence on the formation of these supramolecular polymers. Crown ether- and pillararene-based supramolecular polymers have mainly formed in organic solvents, such as chloroform, acetone, and acetonitrile, while cyclodextrin- and cucurbituril-based supramolecular polymerizations have been usually observed in aqueous solutions. For calixarenes, both organic solvents and water have been used as suitable media for supramolecular polymerization. With the development of supramolecular chemistry and polymer science, various methods, such as nuclear magnetic resonance spectroscopy, X-ray techniques, electron microscopies, and theoretical calculation and computer simulation, have been applied for characterizing supramolecular polymers. The fabrication of macrocycle-based supramolecular polymers has become a currently hot research topic. In this Account, we summarize recent results in the investigation of supramolecular polymers constructed from macrocycle-based host-guest molecular recognition motifs. These supramolecular polymers are classified based on the different macrocycles used in them. Their monomer design, structure control, stimuli-responsiveness, and applications in various areas are discussed, and future research directions are proposed. It is expected that the development of supramolecular polymers will not only change the way we live and work but also exert significant influence on scientific research.

  11. Artin t-Motifs

    OpenAIRE

    Taelman, Lenny

    2008-01-01

    We show that analytically trivial t-motifs satisfy a Tannakian duality, without restrictions on the base field, save for that it be of generic characteristic. We show that the group of components of the t-motivic Galois group coincides with the absolute Galois group of the base field.

  12. A combined sequence and structure based method for discovering enriched motifs in RNA from in vivo binding data.

    Science.gov (United States)

    Polishchuk, Maya; Paz, Inbal; Kohen, Refael; Mesika, Rona; Yakhini, Zohar; Mandel-Gutfreund, Yael

    2017-04-15

    RNA binding proteins (RBPs) play an important role in regulating many processes in the cell. RBPs often recognize their RNA targets in a specific manner. In addition to the RNA primary sequence, the structure of the RNA has been shown to play a central role in RNA recognition by RBPs. In recent years, many experimental approaches, both in vitro and in vivo, were developed and employed to identify and characterize RBP targets and extract their binding specificities. In vivo binding techniques, such as CrossLinking and ImmunoPrecipitation (CLIP)-based methods, enable the characterization of protein binding sites on RNA targets. However, these methods do not provide information regarding the structural preferences of the protein. While methods to obtain the structure of RNA are available, inferring both the sequence and the structure preferences of RBPs remains a challenge. Here we present SMARTIV, a novel computational tool for discovering combined sequence and structure binding motifs from in vivo RNA binding data relying on the sequences of the target sites, the ranking of their binding scores and their predicted secondary structure. The combined motifs are provided in a unified representation that is informative and easy for visual perception. We tested the method on CLIP-seq data from different platforms for a variety of RBPs. Overall, we show that our results are highly consistent with known binding motifs of RBPs, offering additional information on their structural preferences. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Cis and trans regulatory mechanisms control AP2-mediated B cell receptor endocytosis via select tyrosine-based motifs.

    Directory of Open Access Journals (Sweden)

    Kathleen Busman-Sahay

    Full Text Available Following antigen recognition, B cell receptor (BCR-mediated endocytosis is the first step of antigen processing and presentation to CD4+ T cells, a crucial component of the initiation and control of the humoral immune response. Despite this, the molecular mechanism of BCR internalization is poorly understood. Recently, studies of activated B cell-like diffuse large B cell lymphoma (ABC DLBCL have shown that mutations within the BCR subunit CD79b leads to increased BCR surface expression, suggesting that CD79b may control BCR internalization. Adaptor protein 2 (AP2 is the major mediator of receptor endocytosis via clathrin-coated pits. The BCR contains five putative AP2-binding YxxØ motifs, including four that are present within two immunoreceptor tyrosine-based activation motifs (ITAMs. Using a combination of in vitro and in situ approaches, we establish that the sole mediator of AP2-dependent BCR internalization is the membrane proximal ITAM YxxØ motif in CD79b, which is a major target of mutation in ABC DLBCL. In addition, we establish that BCR internalization can be regulated at a minimum of two different levels: regulation of YxxØ AP2 binding in cis by downstream ITAM-embedded DCSM and QTAT regulatory elements and regulation in trans by the partner cytoplasmic domain of the CD79 heterodimer. Beyond establishing the basic rules governing BCR internalization, these results illustrate an underappreciated role for ITAM residues in controlling clathrin-dependent endocytosis and highlight the complex mechanisms that control the activity of AP2 binding motifs in this receptor system.

  14. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  15. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    Permanent link: http://www.ias.ac.in/article/fulltext/jcsc/125/01/0041-0049. Keywords. Ferrocene/Lewis acid; optical rotation; frustrated Lewis pairs; organoborane. Abstract. Optically active Lewis acids and Lewis pairs were synthesized and characterized by multinuclear NMR, UV/Vis spectroscopy and elemental analysis.

  16. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    organisms. Furthermore, secondary structures closely similar to phylogenetically proven models can be inferred from the T. thermophila data. Analysis of the snRNA sequences identifies three potential snRNA-snRNA base-pairing interactions, all of which are consistent with available phylogenetic data. Two......We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  17. Fine-tuning of T-cell development by the CD3γ di-leucine-based TCR-sorting motif

    DEFF Research Database (Denmark)

    Lauritsen, Jens Peter Holst; Boding, Lasse; Buus, Terkild B

    2015-01-01

    The CD3γ di-leucine-based (diL) receptor-sorting motif plays a central role in TCR down-regulation and in clonal expansion of virus-specific T cells. However, the role of the CD3γ diL motif in T-cell development is not known. In this study, we show that protein kinase C-induced TCR down-regulatio......The CD3γ di-leucine-based (diL) receptor-sorting motif plays a central role in TCR down-regulation and in clonal expansion of virus-specific T cells. However, the role of the CD3γ diL motif in T-cell development is not known. In this study, we show that protein kinase C-induced TCR down...

  18. SLIDER: a generic metaheuristic for the discovery of correlated motifs in protein-protein interaction networks.

    Science.gov (United States)

    Boyen, Peter; Van Dyck, Dries; Neven, Frank; van Ham, Roeland C H J; van Dijk, Aalt D J

    2011-01-01

    Correlated motif mining (cmm) is the problem of finding overrepresented pairs of patterns, called motifs, in sequences of interacting proteins. Algorithmic solutions for cmm thereby provide a computational method for predicting binding sites for protein interaction. In this paper, we adopt a motif-driven approach where the support of candidate motif pairs is evaluated in the network. We experimentally establish the superiority of the Chi-square-based support measure over other support measures. Furthermore, we obtain that cmm is an np-hard problem for a large class of support measures (including Chi-square) and reformulate the search for correlated motifs as a combinatorial optimization problem. We then present the generic metaheuristic slider which uses steepest ascent with a neighborhood function based on sliding motifs and employs the Chi-square-based support measure. We show that slider outperforms existing motif-driven cmm methods and scales to large protein-protein interaction networks. The slider-implementation and the data used in the experiments are available on http://bioinformatics.uhasselt.be.

  19. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  20. Calculation of the Stabilization Energies of Oxidatively Damaged Guanine Base Pairs with Guanine

    Directory of Open Access Journals (Sweden)

    Hiroshi Miyazawa

    2012-06-01

    Full Text Available DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H-oxazolone (Oz, guanidinohydantoin (Gh/iminoallantoin (Ia and spiro-imino-dihydantoin (Sp are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  1. Genomic analysis of plant chromosomes based on meiotic pairing

    Directory of Open Access Journals (Sweden)

    Lisete Chamma Davide

    2007-12-01

    Full Text Available This review presents the principles and applications of classical genomic analysis, with emphasis on plant breeding. The main mathematical models used to estimate the preferential chromosome pairing in diploid or polyploid, interspecific or intergenera hybrids are presented and discussed, with special reference to the applications and studies for the definition of genome relationships among species of the Poaceae family.

  2. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...

  3. The Study of Meanings of Motifs on Artifacts Discovered from Archeological Sites of Gilan Province and their Classification based on Dumézil’s Trifunctional Model

    Directory of Open Access Journals (Sweden)

    Ziba Kazempoor

    2017-09-01

    Full Text Available Gilan is one of the historical centers which has drawn the attention of archeological and art researchers due to the fact that unique artistic works have been discovered from its archeological sites. The present study seeks to review the meanings of motifs on archeological artifacts discovered from Gilan and to classify the artifacts based on Dumézil’s trifunctional model. This study aims to increase awareness of form and content of designs on historical works of Gilan and to detail historical background of Gilan. To do this, motifs are classified and symbolic meanings of motifs of artifacts discovered from Gilan are consequently detailed. Finally, the three functions of the sacral, the martial and the economic which constitute Dumézil’s trifunctional model for social and cultural structure of Indo-European tribes are used to study the artifacts discovered from Gilan. In general, motifs on archeological artifacts of Gilan could be divided into four groups of plant, animal, human, and abstract which could be analyzed through Dumézil’s trifunctional model. Mixed animal motifs are related to first function and show a sacral function. The artifacts on which war and hunting scenes are represented are concerned with second Dumézil’s function namely “the martial”. Plant and animal motifs and some human figure designs such as figures of historical women are related to certain notions such as life and living which could be categorized into the economic function.

  4. Design of potent inhibitors of human RAD51 recombinase based on BRC motifs of BRCA2 protein: modeling and experimental validation of a chimera peptide.

    KAUST Repository

    Nomme, Julian

    2010-08-01

    We have previously shown that a 28-amino acid peptide derived from the BRC4 motif of BRCA2 tumor suppressor inhibits selectively human RAD51 recombinase (HsRad51). With the aim of designing better inhibitors for cancer treatment, we combined an in silico docking approach with in vitro biochemical testing to construct a highly efficient chimera peptide from eight existing human BRC motifs. We built a molecular model of all BRC motifs complexed with HsRad51 based on the crystal structure of the BRC4 motif-HsRad51 complex, computed the interaction energy of each residue in each BRC motif, and selected the best amino acid residue at each binding position. This analysis enabled us to propose four amino acid substitutions in the BRC4 motif. Three of these increased the inhibitory effect in vitro, and this effect was found to be additive. We thus obtained a peptide that is about 10 times more efficient in inhibiting HsRad51-ssDNA complex formation than the original peptide.

  5. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... [Dixit SB, Mezei M and Beveridge DL 2012 Studies of base pair sequence effects on DNA salvation based on all-atom molecular dynamics simulations. J. Biosci. 37 399–421] DOI 10.1007/s12038-012-9223-5. 1. Introduction. Solvation plays an integral role in stabilizing the structure of the DNA molecule in ...

  6. Structures and stabilities of small DNA dumbbells with Watson-Crick and Hoogsteen base pairs.

    Science.gov (United States)

    Escaja, Nuria; Gómez-Pinto, Irene; Rico, Manuel; Pedroso, Enrique; González, Carlos

    2003-07-07

    The structures and stabilities of cyclic DNA octamers of different sequences have been studied by NMR and CD spectroscopy and by restrained molecular dynamics. At low oligonucleotide concentrations, some of these molecules form stable monomeric structures consisting of a short stem of two base pairs connected by two mini-loops of two residues. To our knowledge, these dumbbell-like structures are the smallest observed to date. The relative stabilities of these cyclic dumbbells have been established by studying their melting transitions. Dumbbells made up purely of GC stems are more stable than those consisting purely of AT base pairs. The order of the base pairs closing the loops also has an important effect on the stabilities of these structures. The NMR data indicate that there are significant differences between the solution structures of dumbbells with G-C base pairs in the stem compared to those with A-T base pairs. In the case of dumbbells with G-C base pairs, the residues in the stem form a short segment of a BDNA helix stabilized by two Watson-Crick base pairs. In contrast, in the case of d, the stem is formed by two A-T base pairs with the glycosidic angles of the adenine bases in a syn conformation, most probably forming Hoogsteen base pairs. Although the conformations of the loop residues are not very well defined, the thymine residues at the first position of the loop are observed to fold back into the minor groove of the stem.

  7. Predicting Kinase Activity in Angiotensin Receptor Phosphoproteomes Based on Sequence-Motifs and Interactions

    DEFF Research Database (Denmark)

    Bøgebo, Rikke; Horn, Heiko; Olsen, Jesper V

    2014-01-01

    Recent progress in the understanding of seven-transmembrane receptor (7TMR) signalling has promoted the development of a new generation of pathway selective ligands. The angiotensin II type I receptor (AT1aR) is one of the most studied 7TMRs with respect to selective activation of the β-arrestin ......Recent progress in the understanding of seven-transmembrane receptor (7TMR) signalling has promoted the development of a new generation of pathway selective ligands. The angiotensin II type I receptor (AT1aR) is one of the most studied 7TMRs with respect to selective activation of the β......-arrestin dependent signalling. Two complimentary global phosphoproteomics studies have analyzed the complex signalling induced by the AT1aR. Here we integrate the data sets from these studies and perform a joint analysis using a novel method for prediction of differential kinase activity from phosphoproteomics data....... The method builds upon NetworKIN, which applies sophisticated linear motif analysis in combination with contextual network modelling to predict kinase-substrate associations with high accuracy and sensitivity. These predictions form the basis for subsequently nonparametric statistical analysis to identify...

  8. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  9. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  10. lsosteric and Nonisosteric Base Pairs in RNA Motifs: Molecular Dynamics and Bioinformatics Study of the Sarcin Ricin Internal Loop

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Réblová, K.; Zirbel, C.L.; Leontis, N. B.

    2013-01-01

    Roč. 117, č. 46 (2013), s. 14302-14319 ISSN 1520-6106 R&D Projects: GA ČR GBP305/12/G034; GA MŠk ED1.1.00/02.0068 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : 23S RIBOSOMAL-RNA * PARTICLE MESH EWALD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 3.377, year: 2013

  11. lsosteric and Nonisosteric Base Pairs in RNA Motifs: Molecular Dynamics and Bioinformatics Study of the Sarcin Ricin Internal Loop

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Réblová, Kamila; Zirbel, C.L.; Leontis, B. N.; Šponer, Jiří

    2013-01-01

    Roč. 117, č. 46 (2013), s. 14302-14319 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68081707 Keywords : 23S RIBOSOMAL-RNA * PARTICLE MESH EWALD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 3.377, year: 2013

  12. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    Science.gov (United States)

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  13. Interaction of Cu+ with cytosine and formation of i-motif-like C-M+-C complexes: alkali versus coinage metals

    NARCIS (Netherlands)

    Gao, J.; Berden, G.; Rodgers, M.T.; Oomens, J.

    2016-01-01

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton

  14. Plasmodium vivax antigen discovery based on alpha-helical coiled coil protein motif.

    Directory of Open Access Journals (Sweden)

    Nora Céspedes

    Full Text Available Protein α-helical coiled coil structures that elicit antibody responses, which block critical functions of medically important microorganisms, represent a means for vaccine development. By using bioinformatics algorithms, a total of 50 antigens with α-helical coiled coil motifs orthologous to Plasmodium falciparum were identified in the P. vivax genome. The peptides identified in silico were chemically synthesized; circular dichroism studies indicated partial or high α-helical content. Antigenicity was evaluated using human sera samples from malaria-endemic areas of Colombia and Papua New Guinea. Eight of these fragments were selected and used to assess immunogenicity in BALB/c mice. ELISA assays indicated strong reactivity of serum samples from individuals residing in malaria-endemic regions and sera of immunized mice, with the α-helical coiled coil structures. In addition, ex vivo production of IFN-γ by murine mononuclear cells confirmed the immunogenicity of these structures and the presence of T-cell epitopes in the peptide sequences. Moreover, sera of mice immunized with four of the eight antigens recognized native proteins on blood-stage P. vivax parasites, and antigenic cross-reactivity with three of the peptides was observed when reacted with both the P. falciparum orthologous fragments and whole parasites. Results here point to the α-helical coiled coil peptides as possible P. vivax malaria vaccine candidates as were observed for P. falciparum. Fragments selected here warrant further study in humans and non-human primate models to assess their protective efficacy as single components or assembled as hybrid linear epitopes.

  15. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... base pair sequence, both via direct interactions and indirectly via sequence preferences for ... Supplementary materials pertaining to this article are available on the Journal of Biosciences Website at http://www.ias.ac.in/jbiosci/ ..... trapped for fairly long times by current routine simulation lengths (~10 ns) but ...

  16. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  17. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Conducting Task-Based Interviews with Pairs of Children: Consensus, Conflict, Knowledge Construction and Turn Taking

    Science.gov (United States)

    Houssart, Jenny; Evens, Hilary

    2011-01-01

    This article explores theoretical and methodological issues associated with task-based interviews conducted with pairs of children. We explore different approaches to interviews from sociological, psychological and subject-based perspectives. Our interviews, concerning mathematical questions and carried out with pairs of 10 and 11-year-olds, are…

  19. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  20. TCR comodulation of nonengaged TCR takes place by a protein kinase C and CD3 gamma di-leucine-based motif-dependent mechanism

    DEFF Research Database (Denmark)

    Bonefeld, Charlotte Menné; Rasmussen, B. A.; Lauritsen, J P

    2003-01-01

    of comodulation. Like internalization of engaged TCR, comodulation was dependent on protein tyrosine kinase activity. Finally, we found that in contrast to internalization of engaged TCR, comodulation was highly dependent on protein kinase C activity and the CD3 gamma di-leucine-based motif. Based...

  1. Structural landscape of base pairs containing post-transcriptional modifications in RNA.

    Science.gov (United States)

    Seelam, Preethi P; Sharma, Purshotam; Mitra, Abhijit

    2017-06-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. © 2017 Seelam et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Common motifs in the response of cereal primary metabolism to fungal pathogens are not based on similar transcriptional reprogramming

    Directory of Open Access Journals (Sweden)

    Lars Matthias Voll

    2011-08-01

    Full Text Available During compatible interactions with their host plants, biotrophic plant pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism towards colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei, the corn smut fungus Ustilago maydis and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment.Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. Increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during

  3. Common Motifs in the Response of Cereal Primary Metabolism to Fungal Pathogens are not Based on Similar Transcriptional Reprogramming

    Science.gov (United States)

    Voll, Lars Matthias; Horst, Robin Jonathan; Voitsik, Anna-Maria; Zajic, Doreen; Samans, Birgit; Pons-Kühnemann, Jörn; Doehlemann, Gunther; Münch, Steffen; Wahl, Ramon; Molitor, Alexandra; Hofmann, Jörg; Schmiedl, Alfred; Waller, Frank; Deising, Holger Bruno; Kahmann, Regine; Kämper, Jörg; Kogel, Karl-Heinz; Sonnewald, Uwe

    2011-01-01

    During compatible interactions with their host plants, biotrophic plant–pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism toward colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei), the corn smut fungus Ustilago maydis, and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment. Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. However, increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during early

  4. Paired fuzzy sets and other opposite-based models

    DEFF Research Database (Denmark)

    Montero, Javier; Gómez, Daniel; Tinguaro Rodríguez, J.

    2016-01-01

    In this paper we stress the relevance of those fuzzy models that impose a couple of simultaneous views in order to represent concepts. In particular, we point out that the basic model to start with should contain at least two somehow opposite valuations plus a number of neutral concepts that are ......In this paper we stress the relevance of those fuzzy models that impose a couple of simultaneous views in order to represent concepts. In particular, we point out that the basic model to start with should contain at least two somehow opposite valuations plus a number of neutral concepts...... that are generated from the semantic relationship between those two opposites. Such a basic model should be distinguished from some other similar approaches that can be found in the literature, and that may bring some difficulties in intuition, partially because of their denomination. The general term “paired fuzzy...

  5. rMotifGen: random motif generator for DNA and protein sequences

    Directory of Open Access Journals (Sweden)

    Hardin C Timothy

    2007-08-01

    Full Text Available Abstract Background Detection of short, subtle conserved motif regions within a set of related DNA or amino acid sequences can lead to discoveries about important regulatory domains such as transcription factor and DNA binding sites as well as conserved protein domains. In order to help assess motif detection algorithms on motifs with varying properties and levels of conservation, we have developed a computational tool, rMotifGen, with the sole purpose of generating a number of random DNA or protein sequences containing short sequence motifs. Each motif consensus can be user-defined, randomly generated, or created from a position-specific scoring matrix (PSSM. Insertions and mutations within these motifs are created according to user-defined parameters and substitution matrices. The resulting sequences can be helpful in mutational simulations and in testing the limits of motif detection algorithms. Results Two implementations of rMotifGen have been created, one providing a graphical user interface (GUI for random motif construction, and the other serving as a command line interface. The second implementation has the added advantages of platform independence and being able to be called in a batch mode. rMotifGen was used to construct sample sets of sequences containing DNA motifs and amino acid motifs that were then tested against the Gibbs sampler and MEME packages. Conclusion rMotifGen provides an efficient and convenient method for creating random DNA or amino acid sequences with a variable number of motifs, where the instance of each motif can be incorporated using a position-specific scoring matrix (PSSM or by creating an instance mutated from its corresponding consensus using an evolutionary model based on substitution matrices. rMotifGen is freely available at: http://bioinformatics.louisville.edu/brg/rMotifGen/.

  6. Masking of the CD3 gamma di-leucine-based motif by zeta is required for efficient T-cell receptor expression

    DEFF Research Database (Denmark)

    Lauritsen, Jens Peter H; Bonefeld, Charlotte Menné; von Essen, Marina

    2004-01-01

    containing the di-leucine-based endocytosis motif of the TCR subunit CD3 gamma have indicated that the zeta chain can mask this motif. In this study, we show that successive truncations of the cytoplasmic tail of zeta led to reduced surface expression levels of completely assembled TCR complexes. The reduced...... TCR expression levels were caused by an increase in the TCR endocytic rate constant in combination with an unaffected exocytic rate constant. Furthermore, the TCR degradation rate constant was increased in cells with truncated zeta. Introduction of a CD3 gamma chain with a disrupted di-leucine...

  7. MotifMark: Finding regulatory motifs in DNA sequences.

    Science.gov (United States)

    Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

    2017-07-01

    The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

  8. [Fourier Transform Spectrometer Based on Rotating Parallel-Mirror-Pair].

    Science.gov (United States)

    Zhao, Bao-wei; Xiangli, Bin; Cai, Qi-sheng; Lü, Qun-bo; Zhou, Jin-song

    2015-11-01

    In the temporally-modulated Fourier transform spectroscopy, the translational moving mirror is difficult to drive accurately, causing tilt and shear problems. While, a rotational moving mirror can solve these problems. A rotary Fourier transform spectrometer is recommanded in this paper. Its principle is analyzed and the optical path difference is deduced. Also, the constrains for engineering realization are presented. This spectrometer consists of one beamsplitter, two fixed mirrors, one rotating parallel mirror pair, a collimating lens, a collecting lens, and one detector. From it's principle, this spectrometer show a simple structure, and it is assembled and adjustmented easily because the two split light are interfered with each other after reflected through the same plane mirror; By calculating the expression of it's optical path difference, the spectrometer is easy to realize large optical path difference, meaning high spectral resolution; Through analyzing it's engineering design constraints and computer simulation, it is known that the spectrometer should get the high resolution sample by high-speed spinning motor, so it is easy to achieve precise motion control, good stability, fast measurement speed.

  9. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  10. The conserved dileucine- and tyrosine-based motifs in MLV and MPMV envelope glycoproteins are both important to regulate a common Env intracellular trafficking

    Directory of Open Access Journals (Sweden)

    Lopez-Vergès Sandra

    2006-09-01

    Full Text Available Abstract Background Retrovirus particles emerge from the assembly of two structural protein components, Gag that is translated as a soluble protein in the cytoplasm of the host cells, and Env, a type I transmembrane protein. Because both components are translated in different intracellular compartments, elucidating the mechanisms of retrovirus assembly thus requires the study of their intracellular trafficking. Results We used a CD25 (Tac chimera-based approach to study the trafficking of Moloney murine leukemia virus and Mason-Pfizer monkey virus Env proteins. We found that the cytoplasmic tails (CTs of both Env conserved two major signals that control a complex intracellular trafficking. A dileucine-based motif controls the sorting of the chimeras from the trans-Golgi network (TGN toward endosomal compartments. Env proteins then follow a retrograde transport to the TGN due to the action of a tyrosine-based motif. Mutation of either motif induces the mis-localization of the chimeric proteins and both motifs are found to mediate interactions of the viral CTs with clathrin adaptors. Conclusion This data reveals the unexpected complexity of the intracellular trafficking of retrovirus Env proteins that cycle between the TGN and endosomes. Given that Gag proteins hijack endosomal host proteins, our work suggests that the endosomal pathway may be used by retroviruses to ensure proper encountering of viral structural Gag and Env proteins in cells, an essential step of virus assembly.

  11. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson -Crick/Sugar Edge Subject RIV: BO - Biophysics

  12. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  13. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  14. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...

  15. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    In keeping with this general trend, all the systems with only one hydrogen bond between the bases, on relaxed optimization, show huge RMS deviation and lead to significant improvements in their interaction energies. As expected, the hydrogen bonding patterns in their relaxed geometries are also very different from their ...

  16. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  17. Detection of base pair mismatches in duplex DNA and RNA oligonucleotides using electrospray mass spectrometry

    Science.gov (United States)

    Griffey, Richard H.; Greig, Michael J.

    1997-05-01

    The identify and location of base pair mismatches in non- covalent DNA:RNA duplexes are established using MS and MS-MS on a quadruple ion trap with electrospray ionization (ESI). MS-MS experiments on a 14mer duplex (D) with a single C:A base pair mismatch using lower activation energy results in selective cleavage of the mismatched A nucleobase, even in the presence of the wild-type duplex. The location of the mismatch base pair can be discerned via presence of the wild-type duplex. The location of the mismatch base pair can be discerned via selection of the (D-5H)5- ion and fragmentation of the backbone at that location in a n additional MS-MS experiment. Selective fragmentation is observed for C in a C-C mismatched base pair, which is very difficult to detect using chemical cleavage or E. coli mismatch binding protein. In an RNA:DNA duplex with a single base pair mismatch, the DNA base is removed without fragmentation of the RNA strand, greatly simplifying the interpretation of the resulting MS spectrum. A method is presented for detecting two DNA strands, for example a point mutation which generates an oncogenic phenotype, and the wild-type message. The results suggest that ESI-MS-MS may provide a rapid and selective method to identify and locate genetic mutations without the need for chemical degradation or protein binding followed by gel electrophoresis.

  18. Motif-based success scores in coauthorship networks are highly sensitive to author name disambiguation

    Science.gov (United States)

    Klosik, David F.; Bornholdt, Stefan; Hütt, Marc-Thorsten

    2014-09-01

    Following the work of Krumov et al. [Eur. Phys. J. B 84, 535 (2011), 10.1140/epjb/e2011-10746-5] we revisit the question whether the usage of large citation datasets allows for the quantitative assessment of social (by means of coauthorship of publications) influence on the progression of science. Applying a more comprehensive and well-curated dataset containing the publications in the journals of the American Physical Society during the whole 20th century we find that the measure chosen in the original study, a score based on small induced subgraphs, has to be used with caution, since the obtained results are highly sensitive to the exact implementation of the author disambiguation task.

  19. Theory of nodal s ± -wave pairing symmetry in the Pu-based 115 superconductor family.

    Science.gov (United States)

    Das, Tanmoy; Zhu, Jian-Xin; Graf, Matthias J

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-Tc superconductors and predict the presence of a nodal s(±) wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface "hot-spots" in the inter-band scattering channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s(±) wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.

  20. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3' untranslated region (3'-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  1. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Igor Ruiz de los Mozos

    Full Text Available The presence of regulatory sequences in the 3' untranslated region (3'-UTR of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  2. Self-assembled nanocages based on the coiled coil bundle motif

    Science.gov (United States)

    Sinha, Nairiti; Villegas, Jose; Saven, Jeffery; Kiick, Kristi; Pochan, Darrin

    Computational design of coiled coil peptide bundles that undergo solution phase self-assembly presents a diverse toolbox for engineering new materials with tunable and pre-determined nanostructures that can have various end applications such as in drug delivery, biomineralization and electronics. Self-assembled cages are especially advantageous as the cage geometry provides three distinct functional sites: the interior, the exterior and the solvent-cage interface. In this poster, syntheses and characterization of a peptide cage based on computationally designed homotetrameric coiled coil bundles as building blocks is discussed. Techniques such as Transmission Electron Microscopy (TEM), Small-Angle Neutron Scattering (SANS) and Analytical Ultracentrifugation (AUC) are employed to characterize the size, shape and molecular weight of the self-assembled peptide cages under different pH and temperature conditions. Various self-assembly pathways such as dialysis and thermal quenching are shown to have a significant impact on the final structure of these peptides in solution. Comparison of results with the target cage design can be used to iteratively improve the peptide design and provide greater understanding of its interactions and folding.

  3. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  4. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    Energy Technology Data Exchange (ETDEWEB)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart [Biodesign Institute, Arizona State University, Tempe, AZ 85287 (United States); Young, Michael [Department of Physics, Arizona State University, Tempe, AZ 85287 (United States)], E-mail: Stuart.Lindsay@asu.edu

    2009-05-06

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  5. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  6. On the Solvability of 2-pair Unicast Networks --- A Cut-based Characterization

    OpenAIRE

    Cai, K.; Letaief, K. B.; Fan, P.; Feng, R.

    2010-01-01

    In this paper, we propose a subnetwork decomposition/combination approach to investigate the single rate $2$-pair unicast problem. It is shown that the solvability of a $2$-pair unicast problem is completely determined by four specific link subsets, namely, $\\mathcal A_{1,1}$, $\\mathcal A_{2,2}$, $\\mathcal A_{1,2}$ and $\\mathcal A_{2,1}$ of its underlying network. As a result, an efficient cut-based algorithm to determine the solvability of a $2$-pair unicast problem is presented.

  7. Pairing susceptibility of iron-based superconductors within a two-layer Hubbard model

    Science.gov (United States)

    Wei, Dan; Wang, Jingyao; Wu, Yang; Liang, Ying; Ma, Tianxing

    2017-12-01

    By using the determinant quantum Monte Carlo method, we studied the dominant pairing susceptibility of iron-based superconductors within an extended Hubbard model, which describes the underlying electronic structure of both iron pnictides and iron chalcogenides. The extended Hubbard model is constructed by two iron layers, each of which forms two sublattices on a square structure. Although the coupling between the two layers has different effects on the behavior of pairings in iron pnictides and iron chalcogenides, our non-biased numerical simulations reveal that the pairing with Sxy symmetry dominates over the studied parameter for both materials.

  8. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    Science.gov (United States)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  9. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey.

    Science.gov (United States)

    Zhou, Huiqing; Hintze, Bradley J; Kimsey, Isaac J; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S; Al-Hashimi, Hashim M

    2015-04-20

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson-Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1'-C1' distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1'-C1' distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5'-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  11. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  12. Density functional MO calculation for stacked DNA base-pairs with backbones.

    Science.gov (United States)

    Kurita, N; Kobayashi, K

    2000-05-01

    In order to elucidate the effect of the sugar and phosphate backbones on the stable structure and electronic properties of stacked DNA base-pairs, we performed ab initio molecular orbital (MO) calculations based on the density functional theory and Slater-type basis set. As a model cluster for stacked base-pairs, we employed three isomers for the dimer unit of stacked guanine-cytosine pairs composed with backbones as well as base-pairs. These structures were fully optimized and their electronic properties were self-consistently investigated. By including the backbones, the difference in total energy among the isomers was largely enhanced, while the trend in relative stability was not changed. The effect of backbones on the electronic properties is remarkable: the MOs with the character of the PO4 parts of backbones appear just below the highest-occupied MO. This result indicates that the PO4 parts might play a rule as a reaction site in chemical processes concerning DNA. Therefore, we conclude that the DNA backbones are indispensable for investigating the stability and electronic properties of the stacked DNA base-pairs.

  13. Network motif-based identification of transcription factor-target gene relationships by integrating multi-source biological data

    Directory of Open Access Journals (Sweden)

    de los Reyes Benildo G

    2008-04-01

    Full Text Available Abstract Background Integrating data from multiple global assays and curated databases is essential to understand the spatio-temporal interactions within cells. Different experiments measure cellular processes at various widths and depths, while databases contain biological information based on established facts or published data. Integrating these complementary datasets helps infer a mutually consistent transcriptional regulatory network (TRN with strong similarity to the structure of the underlying genetic regulatory modules. Decomposing the TRN into a small set of recurring regulatory patterns, called network motifs (NM, facilitates the inference. Identifying NMs defined by specific transcription factors (TF establishes the framework structure of a TRN and allows the inference of TF-target gene relationship. This paper introduces a computational framework for utilizing data from multiple sources to infer TF-target gene relationships on the basis of NMs. The data include time course gene expression profiles, genome-wide location analysis data, binding sequence data, and gene ontology (GO information. Results The proposed computational framework was tested using gene expression data associated with cell cycle progression in yeast. Among 800 cell cycle related genes, 85 were identified as candidate TFs and classified into four previously defined NMs. The NMs for a subset of TFs are obtained from literature. Support vector machine (SVM classifiers were used to estimate NMs for the remaining TFs. The potential downstream target genes for the TFs were clustered into 34 biologically significant groups. The relationships between TFs and potential target gene clusters were examined by training recurrent neural networks whose topologies mimic the NMs to which the TFs are classified. The identified relationships between TFs and gene clusters were evaluated using the following biological validation and statistical analyses: (1 Gene set enrichment

  14. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  15. STUDYING THE INFLUENCE OF THE PYRENE INTERCALATOR TINA ON THE STABILITY OF DNA i-MOTIFS

    DEFF Research Database (Denmark)

    El-Sayed, Ahmed A.; Pedersen, Erik Bjerregaard; Khaireldin, Nahid A.

    2012-01-01

    Certain cytosine-rich (C-rich) DNA sequences can fold into secondary structures as four-stranded i-motifs with hemiprotonated base pairs. Here we synthesized C-rich TINA-intercalating oligonucleotides by inserting a nonnucleotide pyrene moiety between two C-rich regions. The stability of their i......-motif structures was studied by using UV melting temperature measurements and circular dichroism spectra at different pH values under noncrowding and crowding conditions (20% poly(ethylene glycol)). When TINA ((R)-3-((4-(1-pyrenylethynyl)benzyl)oxy) propane-1,2-diol) is inserted, the oligonucleotides could form...

  16. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    Science.gov (United States)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  17. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  18. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  19. Theoretical study of the scalar coupling constants across the noncovalent contacts in RNA base pairs: The cis- and trans-Watson-Crick/sugar edge base pair family

    Czech Academy of Sciences Publication Activity Database

    Vokáčová, Zuzana; Šponer, Jiří; Šponer, Judit E.; Sychrovský, Vladimír

    2007-01-01

    Roč. 111, č. 36 (2007), s. 10813-10824 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA203/05/0388; GA ČR(CZ) GA203/06/0420; GA AV ČR(CZ) IAA400550701; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : RNA base pairs * NMR spin-spin coupling constant * theoretical calculations Subject RIV: BO - Biophysics Impact factor: 4.086, year: 2007

  20. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  1. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  2. New ab initio based pair potential for accurate simulation of phase transitions in ZnO

    NARCIS (Netherlands)

    Wang, Shuaiwei; Fan, Zhaochuan; Koster, Rik S.; Fang, Changming; Van Huis, Marijn A.; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; Vlugt, Thijs J H

    2014-01-01

    A set of interatomic pair potentials is developed for ZnO based on the partially charged rigid ion model (PCRIM). The derivation of the potentials combines lattice inversion, empirical fitting, and ab initio energy surface fitting. We show that, despite the low number of parameters in this model

  3. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  4. Optimization of the pyridyl nucleobase scaffold for polymerase recognition and unnatural base pair replication

    Czech Academy of Sciences Publication Activity Database

    Hari, Y.; Hwang, G. T.; Leconte, A. M.; Joubert, Nicolas; Hocek, Michal; Romesberg, F. E.

    2008-01-01

    Roč. 9, č. 17 (2008), s. 2796-2799 ISSN 1439-4227 R&D Projects: GA MŠk LC512 Grant - others:NIH(US) GM60005 Institutional research plan: CEZ:AV0Z40550506 Keywords : pyridines * C-nucleosides * base-pairs * DNA polymerase * replication Subject RIV: CC - Organic Chemistry Impact factor: 3.322, year: 2008

  5. Spin wave mediated interaction as a mechanism of pairs formation in iron-based superconductors

    Science.gov (United States)

    Lima, Leonardo S.

    2018-03-01

    The spin wave mediated interaction between electrons has been proposed as mechanism to formation of electron pairs in iron-based superconductors. We employe the diagrammatic expansion to calculate the binding energy of electrons pairs mediated by spin wave. Therefore, we propose the coupling of electrons in high-temperature superconductors mediated by spin waves, since that is well known that this class of superconductors materials if relates with spin-1/2 two-dimensional antiferromagnets, where it is well known there be an interplay between antiferromagnetism 2D and high-temperature superconductivity.

  6. RNA Base Pairing Determines the Conformations of RNA Inside Spherical Viruses

    Science.gov (United States)

    Erdemci-Tandogan, Gonca; Orland, Henri; Zandi, Roya

    2017-11-01

    Many simple RNA viruses enclose their genetic material by a protein shell called the capsid. While the capsid structures are well characterized for most viruses, the structure of RNA inside the shells and the factors contributing to it remain poorly understood. We study the impact of base pairing on the conformations of RNA and find that it undergoes a swollen coil to globule continuous transition as a function of the strength of the pairing interaction. We also observe a first order transition and kink profile as a function of RNA length. All these transitions could explain the different RNA profiles observed inside viral shells.

  7. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  8. NNAlign: A Web-Based Prediction Method Allowing Non-Expert End-User Discovery of Sequence Motifs in Quantitative Peptide Data

    DEFF Research Database (Denmark)

    Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole

    2011-01-01

    of data that even a single experiment can produce seriously challenges researchers with limited bioinformatics expertise, who need to handle, analyze and interpret the data before it can be understood in a biological context. Thus, there is an unmet need for tools allowing non-bioinformatics users...... associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can...

  9. The CD3 gamma leucine-based receptor-sorting motif is required for efficient ligand-mediated TCR down-regulation

    DEFF Research Database (Denmark)

    von Essen, Marina; Menné, Charlotte; Nielsen, Bodil L

    2002-01-01

    . The other pathway is dependent on protein kinase C (PKC)-mediated activation of the CD3 gamma di-leucine-based receptor-sorting motif. Previous studies have failed to demonstrate a connection between ligand- and PKC-induced TCR down-regulation. Thus, although an apparent paradox, the dogma has been...... that ligand- and PKC-induced TCR down-regulations are not interrelated. By analyses of a newly developed CD3 gamma-negative T cell variant, freshly isolated and PHA-activated PBMC, and a mouse T cell line, we challenged this dogma and demonstrate in this work that PKC activation and the CD3 gamma di-leucine...

  10. Comparison of NIR FRET pairs for quantitative transferrin-based assay

    Science.gov (United States)

    Sinsuebphon, Nattawut; Bevington, Travis; Zhao, Lingling; Ken, Abe; Barroso, Margarida; Intes, Xavier

    2014-02-01

    Transferrin (Tfn) is commonly used as a drug delivery carrier for cancer treatment. Tfn cellular internalization can be observed by Förster resonance energy transfer (FRET), which occurs when two fluorophores - donor and acceptor - are a few nanometers apart. Donor fluorescence lifetime can be used to sense and quantify FRET occurrence. In FRET state, the donor is quenched leading to a significant reduction in its lifetime. In this study, donor and acceptor near-infrared (NIR) fluorophore-labeled Tfn were used to quantify cellular internalization in breast cancer cell line (T47D). Based on donor lifetime, quantum yield and spectral data, seven NIR FRET pairs were chosen for this comparison. Performance of the different NIR FRET pairs was evaluated in vitro in multiwell plate settings and by analyzing the relationship between quenched donor fraction and acceptor:donor ratio. Additionally, we performed brightness comparison between each pairs. Several parameters, such as brightness, lifetime, R0 and FRET donor population values are used to identify the most suitable NIR FRET pair for in vivo studies in preclinical settings.

  11. Computational reprogramming of homing endonuclease specificity at multiple adjacent base pairs.

    Science.gov (United States)

    Ashworth, Justin; Taylor, Gregory K; Havranek, James J; Quadri, S Arshiya; Stoddard, Barry L; Baker, David

    2010-09-01

    Site-specific homing endonucleases are capable of inducing gene conversion via homologous recombination. Reprogramming their cleavage specificities allows the targeting of specific biological sites for gene correction or conversion. We used computational protein design to alter the cleavage specificity of I-MsoI for three contiguous base pair substitutions, resulting in an endonuclease whose activity and specificity for its new site rival that of wild-type I-MsoI for the original site. Concerted design for all simultaneous substitutions was more successful than a modular approach against individual substitutions, highlighting the importance of context-dependent redesign and optimization of protein-DNA interactions. We then used computational design based on the crystal structure of the designed complex, which revealed significant unanticipated shifts in DNA conformation, to create an endonuclease that specifically cleaves a site with four contiguous base pair substitutions. Our results demonstrate that specificity switches for multiple concerted base pair substitutions can be computationally designed, and that iteration between design and structure determination provides a route to large scale reprogramming of specificity.

  12. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Single-Base Pair Genome Editing in Human Cells by Using Site-Specific Endonucleases

    Directory of Open Access Journals (Sweden)

    Hiroshi Ochiai

    2015-09-01

    Full Text Available Genome-wide association studies have identified numerous single-nucleotide polymorphisms (SNPs associated with human diseases or phenotypes. However, causal relationships between most SNPs and the associated disease have not been established, owing to technical challenges such as unavailability of suitable cell lines. Recently, efficient editing of a single base pair in the genome was achieved using programmable site-specific nucleases. This technique enables experimental confirmation of the causality between SNPs and disease, and is potentially valuable in clinical applications. In this review, I introduce the molecular basis and describe examples of single-base pair editing in human cells. I also discuss the challenges associated with the technique, as well as possible solutions.

  14. Synthesis, structure, and properties of SrC(NH)3 , a nitrogen-based carbonate analogue with the trinacria motif.

    Science.gov (United States)

    Missong, Ronja; George, Janine; Houben, Andreas; Hoelzel, Markus; Dronskowski, Richard

    2015-10-05

    Strontium guanidinate, SrC(NH)3 , the first compound with a doubly deprotonated guanidine unit, was synthesized from strontium and guanidine in liquid ammonia and characterized by X-ray and neutron diffraction, IR spectroscopy, and density-functional theory including harmonic phonon calculations. The compound crystallizes in the hexagonal space group P63 /m, constitutes the nitrogen analogue of strontium carbonate, SrCO3 , and its structure follows a layered motif between Sr(2+) ions and complex anions of the type C(NH)3 (2-) ; the anions adopt the peculiar trinacria shape. A comparison of theoretical phonons with experimental IR bands as well as quantum-chemical bonding analyses yield a first insight into bonding and packing of the formerly unknown anion in the crystal. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens th...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  16. Investigation on traceability of 3D Scanning Electron Microscopy based on the Stereo Pair Technique

    DEFF Research Database (Denmark)

    Bariani, Paolo

    The scanning electron microscope (SEM) has a big potential as a metrology instrument for micro and nanotechnology due to its unique combination of three imaging properties: • Lateral ultimate resolution down to 2nm • Large range of possible magnification levels ranging from a few hundred times...... that addresses the performance of 3D topography calculation based on surface topography imaging using secondary electrons and the Stereo Pair Technique....

  17. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  18. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  19. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  20. Iron-based superconductors: Current status of materials and pairing mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Hosono, Hideo, E-mail: hosono@msl.titech.ac.jp [Materials and Structures Laboratory & Materials Research Center for Element Strategy, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama 226-8503 (Japan); Kuroki, Kazuhiko [Department of Physics, Graduate School of Science, Osaka University, Toyonaka, Osaka 560-0043 (Japan)

    2015-07-15

    Highlight: • An up-to-date review by the discoverer and a theoretical pioneer of iron-based superconductor. - Abstract: Since the discovery of high T{sub c} iron-based superconductors in early 2008, more than 15,000 papers have been published as a result of intensive research. This paper describes the current status of iron-based superconductors (IBSC) covering most up-to-date research progress along with the some background research, focusing on materials (bulk and thin film) and pairing mechanism.

  1. Novel search space updating heuristics-based genetic algorithm for optimizing medium-scale airline crew pairing problems

    Directory of Open Access Journals (Sweden)

    Nihan Cetin Demirel

    2017-01-01

    Full Text Available This study examines the crew pairing problem, which is one of the most comprehensive problems encountered in airline planning, to generate a set of crew pairings that has minimal cost, covers all flight legs and fulfils legal criteria. In addition, this study examines current research related to crew pairing optimization. The contribution of this study is developing heuristics based on an improved dynamic-based genetic algorithm, a deadhead-minimizing pairing search and a partial solution approach (less-costly alternative pairing search. This study proposes genetic algorithm variants and a memetic algorithm approach. In addition, computational results based on real-world data from a local airline company in Turkey are presented. The results demonstrate that the proposed approach can successfully handle medium sets of crew pairings and generate higher-quality solutions than previous methods.

  2. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis.

    Science.gov (United States)

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA.

  3. High efficient key-insulated attribute based encryption scheme without bilinear pairing operations.

    Science.gov (United States)

    Hong, Hanshu; Sun, Zhixin

    2016-01-01

    Attribute based encryption (ABE) has been widely applied for secure data protection in various data sharing systems. However, the efficiency of existing ABE schemes is not high enough since running encrypt and decrypt algorithms need frequent bilinear pairing operations, which may occupy too much computing resources on terminal devices. What's more, since different users may share the same attributes in the system, a single user's private key exposure will threaten the security and confidentiality of the whole system. Therefore, to further decrease the computation cost in attribute based cryptosystem as well as provide secure protection when key exposure happens, in this paper, we firstly propose a high efficient key-insulated ABE algorithm without pairings. The key-insulated mechanism guarantees both forward security and backward security when key exposure or user revocation happens. Besides, during the running of algorithms in our scheme, users and attribute authority needn't run any bilinear pairing operations, which will increase the efficiency to a large extent. The high efficiency and security analysis indicate that our scheme is more appropriate for secure protection in data sharing systems.

  4. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Science.gov (United States)

    2011-01-01

    Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA) and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA). In FDAFSA, adjacent triplet-pairs (hexamer sequences) were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs) were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM), a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better) with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies and random triplet-pair

  5. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  6. Identification of family-specific residue packing motifs and their use for structure-based protein function prediction: I. Method development

    Science.gov (United States)

    Bandyopadhyay, Deepak; Huan, Jun; Prins, Jan; Snoeyink, Jack; Wang, Wei; Tropsha, Alexander

    2009-11-01

    Protein function prediction is one of the central problems in computational biology. We present a novel automated protein structure-based function prediction method using libraries of local residue packing patterns that are common to most proteins in a known functional family. Critical to this approach is the representation of a protein structure as a graph where residue vertices (residue name used as a vertex label) are connected by geometrical proximity edges. The approach employs two steps. First, it uses a fast subgraph mining algorithm to find all occurrences of family-specific labeled subgraphs for all well characterized protein structural and functional families. Second, it queries a new structure for occurrences of a set of motifs characteristic of a known family, using a graph index to speed up Ullman's subgraph isomorphism algorithm. The confidence of function inference from structure depends on the number of family-specific motifs found in the query structure compared with their distribution in a large non-redundant database of proteins. This method can assign a new structure to a specific functional family in cases where sequence alignments, sequence patterns, structural superposition and active site templates fail to provide accurate annotation.

  7. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    Science.gov (United States)

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Pairs for Pairs: A Theoretical Base for Co-Therapy as a Nonsexist Process in Couple Counseling.

    Science.gov (United States)

    Reese-Dukes, Judson; Reese-Dukes, Carolyn

    1983-01-01

    Reviews contemporary literature which provides a theoretical base for female-male co-therapy teams as the most likely modality to mediate sex bias in couple counseling. An egalitarian co-therapy team can encourage change by modeling independent yet mutually supportive and facilitative roles. (JAC)

  9. [Personal motif in art].

    Science.gov (United States)

    Gerevich, József

    2015-01-01

    One of the basic questions of the art psychology is whether a personal motif is to be found behind works of art and if so, how openly or indirectly it appears in the work itself. Analysis of examples and documents from the fine arts and literature allow us to conclude that the personal motif that can be identified by the viewer through symbols, at times easily at others with more difficulty, gives an emotional plus to the artistic product. The personal motif may be found in traumatic experiences, in communication to the model or with other emotionally important persons (mourning, disappointment, revenge, hatred, rivalry, revolt etc.), in self-searching, or self-analysis. The emotions are expressed in artistic activity either directly or indirectly. The intention nourished by the artist's identity (Kunstwollen) may stand in the way of spontaneous self-expression, channelling it into hidden paths. Under the influence of certain circumstances, the artist may arouse in the viewer, consciously or unconsciously, an illusionary, misleading image of himself. An examination of the personal motif is one of the important research areas of art therapy.

  10. A Tyrosine-Based Trafficking Motif of the Tegument Protein pUL71 Is Crucial for Human Cytomegalovirus Secondary Envelopment.

    Science.gov (United States)

    Dietz, Andrea N; Villinger, Clarissa; Becker, Stefan; Frick, Manfred; von Einem, Jens

    2018-01-01

    The human cytomegalovirus (HCMV) tegument protein pUL71 is required for efficient secondary envelopment and accumulates at the Golgi compartment-derived viral assembly complex (vAC) during infection. Analysis of various C-terminally truncated pUL71 proteins fused to enhanced green fluorescent protein (eGFP) identified amino acids 23 to 34 as important determinants for its Golgi complex localization. Sequence analysis and mutational verification revealed the presence of an N-terminal tyrosine-based trafficking motif (YXXΦ) in pUL71. This led us to hypothesize a requirement of the YXXΦ motif for the function of pUL71 in infection. Mutation of both the tyrosine residue and the entire YXXΦ motif resulted in an altered distribution of mutant pUL71 at the plasma membrane and in the cytoplasm during infection. Both YXXΦ mutant viruses exhibited similarly decreased focal growth and reduced virus yields in supernatants. Ultrastructurally, mutant-virus-infected cells exhibited impaired secondary envelopment manifested by accumulations of capsids undergoing an envelopment process. Additionally, clusters of capsid accumulations surrounding the vAC were observed, similar to the ultrastructural phenotype of a UL71-deficient mutant. The importance of endocytosis and thus the YXXΦ motif for targeting pUL71 to the Golgi complex was further demonstrated when clathrin-mediated endocytosis was inhibited either by coexpression of the C-terminal part of cellular AP180 (AP180-C) or by treatment with methyl-β-cyclodextrin. Both conditions resulted in a plasma membrane accumulation of pUL71. Altogether, these data reveal the presence of a functional N-terminal endocytosis motif that is an important determinant for intracellular localization of pUL71 and that is furthermore required for the function of pUL71 during secondary envelopment of HCMV capsids at the vAC. IMPORTANCE Human cytomegalovirus (HCMV) is the leading cause of birth defects among congenital virus infections and can

  11. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  12. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  13. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  14. Unconventional pairing originating from disconnected Fermi surfaces in the iron-based superconductor

    OpenAIRE

    Kuroki, Kazuhiko; Aoki, Hideo

    2009-01-01

    For the iron-based high $T_c$ superconductor LaFeAsO$_{1-x}$F$_x$, we construct a minimal model, where all of the five Fe $d$ bands turn out to be involved. We then investigate the origin of superconductivity with a five-band random-phase approximation by solving the Eliashberg equation. We conclude that the spin fluctuation modes arising from the nesting between the disconnected Fermi pockets realise, basically, an extended s-wave pairing, where the gap changes sign across the nesting vector.

  15. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  16. Theoretical study of metal ion binding in modified and natural cytosine-cytosine base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Sugiyama, K.; Ono, A.; Mulder, J.; Bickelhaupt, F. M.; Tanaka, Y.; Sychrovský, Vladimír; Guerra, C. F.

    2013-01-01

    Roč. 20, č. 1 (2013), s. 39-39 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] R&D Projects: GA ČR GAP205/10/0228; GA ČR(CZ) GAP304/10/1951; GA TA ČR TA01011165 Institutional support: RVO:61388963 Keywords : DFT * NMR * base pair * metal-mediated Subject RIV: CF - Physical ; Theoretical Chemistry

  17. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  18. Computational analyses of synergism in small molecular network motifs.

    Directory of Open Access Journals (Sweden)

    Yili Zhang

    2014-03-01

    Full Text Available Cellular functions and responses to stimuli are controlled by complex regulatory networks that comprise a large diversity of molecular components and their interactions. However, achieving an intuitive understanding of the dynamical properties and responses to stimuli of these networks is hampered by their large scale and complexity. To address this issue, analyses of regulatory networks often focus on reduced models that depict distinct, reoccurring connectivity patterns referred to as motifs. Previous modeling studies have begun to characterize the dynamics of small motifs, and to describe ways in which variations in parameters affect their responses to stimuli. The present study investigates how variations in pairs of parameters affect responses in a series of ten common network motifs, identifying concurrent variations that act synergistically (or antagonistically to alter the responses of the motifs to stimuli. Synergism (or antagonism was quantified using degrees of nonlinear blending and additive synergism. Simulations identified concurrent variations that maximized synergism, and examined the ways in which it was affected by stimulus protocols and the architecture of a motif. Only a subset of architectures exhibited synergism following paired changes in parameters. The approach was then applied to a model describing interlocked feedback loops governing the synthesis of the CREB1 and CREB2 transcription factors. The effects of motifs on synergism for this biologically realistic model were consistent with those for the abstract models of single motifs. These results have implications for the rational design of combination drug therapies with the potential for synergistic interactions.

  19. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  20. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing.

    Science.gov (United States)

    Li, Sanshu; Breaker, Ronald R

    2013-03-01

    Thiamin pyrophosphate (TPP) riboswitches are found in organisms from all three domains of life. Examples in bacteria commonly repress gene expression by terminating transcription or by blocking ribosome binding, whereas most eukaryotic TPP riboswitches are predicted to regulate gene expression by modulating RNA splicing. Given the widespread distribution of eukaryotic TPP riboswitches and the diversity of their locations in precursor messenger RNAs (pre-mRNAs), we sought to examine the mechanism of alternative splicing regulation by a fungal TPP riboswitch from Neurospora crassa, which is mostly located in a large intron separating protein-coding exons. Our data reveal that this riboswitch uses a long-distance (∼530-nt separation) base-pairing interaction to regulate alternative splicing. Specifically, a portion of the TPP-binding aptamer can form a base-paired structure with a conserved sequence element (α) located near a 5' splice site, which greatly increases use of this 5' splice site and promotes gene expression. Comparative sequence analyses indicate that many fungal species carry a TPP riboswitch with similar intron architecture, and therefore the homologous genes in these fungi are likely to use the same mechanism. Our findings expand the scope of genetic control mechanisms relying on long-range RNA interactions to include riboswitches.

  2. A Bilinear Pairing-Based Dynamic Key Management and Authentication for Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Chin-Ling Chen

    2015-01-01

    Full Text Available In recent years, wireless sensor networks have been used in a variety of environments; a wireless network infrastructure, established to communicate and exchange information in a monitoring area, has also been applied in different environments. However, for sensitive applications, security is the paramount issue. In this paper, we propose using bilinear pairing to design dynamic key management and authentication scheme of the hierarchical sensor network. We use the dynamic key management and the pairing-based cryptography (PBC to establish the session key and the hash message authentication code (HMAC to support the mutual authentication between the sensors and the base station. In addition, we also embed the capability of the Global Positioning System (GPS to cluster nodes to find the best path of the sensor network. The proposed scheme can also provide the requisite security of the dynamic key management, mutual authentication, and session key protection. Our scheme can defend against impersonation attack, replay attack, wormhole attack, and message manipulation attack.

  3. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  4. Two-dimensional motifs in organic materials: Nanodisks, nanodisk-based nanocomposites and nanothin surface-mounted films

    Science.gov (United States)

    Tekobo, Samuel

    Various new technologies are benefiting from the incorporation of new nanophase materials into existing materials and devices. This dissertation explores two-dimensional motifs in creation of organic nanomaterials with new and superior properties. The major part of this thesis focuses on organic nanodisks prepared by controlled polymerization in the interior of bicelles, discoidal lipid aggregates. Another shape studied here is nanothin film mounted on a gold surface. Synthesis of nanodisks is carried out by UV-initiated polymerization of a mixture of styrene and divinylbenzene loaded into self-assembled bicelles. Bicelles act as temporary self-assembled scaffolds, and after the synthesis lipids can be separated and recycled to template a new batch of nanodisks. This method yields new two-dimensional nanoparticles with 15--30 nm diameter and 2 nm thickness. Aggregation behavior of nanodisks was studied in water, organic solvents, and solid phase. Aggregation of nanoparticles has been a major problem in developing various applications. Nanodisks formed a stable (>1 week) suspension of single particles in toluene and carbon tetrachloride, but required a surfactant for uniform dispersion in water. Using sodium docecylsulfate (SDS) as the surfactant, zeta potential studies revealed that particles have a good electrostatic stability at SDS concentrations below the critical micelle concentration. Further, varying the surface density of surfactants can control the size of aggregates of nanodisks in water. Upon drying, nanodisks aggregate into sub-micron platelets. Cross-linked polystyrene nanodisks were then incorporated into bulk polystyreme to determine whether they reinforced its thermal and mechanical properties. Small-angle neutron scattering data suggest that material containing small amounts of nanodisks, as little as 0.001%, form true nanocomposites as evidenced by the presence of individual nanodisks in polystyrene matrix. Thermogravimetric analysis and flexure

  5. The MHC motif viewer

    DEFF Research Database (Denmark)

    Rapin, Nicolas Philippe Jean-Pierre; Hoof, Ilka; Lund, Ole

    2010-01-01

    In vertebrates, the onset of cellular immune reactions is controlled by presentation of peptides in complex with major histocompatibility complex (MHC) molecules to T cell receptors. In humans, MHCs are called human leukocyte antigens (HLAs). Different MHC molecules present different subsets...... of peptides, and knowledge of their binding specificities is important for understanding differences in the immune response between individuals. Algorithms predicting which peptides bind a given MHC molecule have recently been developed with high prediction accuracy. The utility of these algorithms...... is hampered by the lack of tools for browsing and comparing specificity of these molecules. We have developed a Web server, MHC Motif Viewer, which allows the display of the binding motif for MHC class I proteins for human, chimpanzee, rhesus monkey, mouse, and swine, as well as HLA-DR protein sequences...

  6. MHC motif viewer

    DEFF Research Database (Denmark)

    Rapin, Nicolas Philippe Jean-Pierre; Hoof, Ilka; Lund, Ole

    2008-01-01

    In vertebrates, the major histocompatibility complex (MHC) presents peptides to the immune system. In humans, MHCs are called human leukocyte antigens (HLAs), and some of the loci encoding them are the most polymorphic in the human genome. Different MHC molecules present different subsets...... of peptides, and knowledge of their binding specificities is important for understanding the differences in the immune response between individuals. Knowledge of motifs may be used to identify epitopes, to understand the MHC restriction of epitopes, and to compare the specificities of different MHC molecules....... Algorithms that predict which peptides MHC molecules bind have recently been developed and cover many different alleles, but the utility of these algorithms is hampered by the lack of tools for browsing and comparing the specificity of these molecules. We have, therefore, developed a web server, MHC motif...

  7. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    Science.gov (United States)

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  8. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  10. Evaluating changes in matrix based, recovery-adjusted concentrations in paired data for pesticides in groundwater

    Science.gov (United States)

    Zimmerman, Tammy M.; Breen, Kevin J.

    2012-01-01

    Pesticide concentration data for waters from selected carbonate-rock aquifers in agricultural areas of Pennsylvania were collected in 1993–2009 for occurrence and distribution assessments. A set of 30 wells was visited once in 1993–1995 and again in 2008–2009 to assess concentration changes. The data include censored matched pairs (nondetections of a compound in one or both samples of a pair). A potentially improved approach for assessing concentration changes is presented where (i) concentrations are adjusted with models of matrix-spike recovery and (ii) area-wide temporal change is tested by use of the paired Prentice-Wilcoxon (PPW) statistical test. The PPW results for atrazine, simazine, metolachlor, prometon, and an atrazine degradate, deethylatrazine (DEA), are compared using recovery-adjusted and unadjusted concentrations. Results for adjusted compared with unadjusted concentrations in 2008–2009 compared with 1993–1995 were similar for atrazine and simazine (significant decrease; 95% confidence level) and metolachlor (no change) but differed for DEA (adjusted, decrease; unadjusted, increase) and prometon (adjusted, decrease; unadjusted, no change). The PPW results were different on recovery-adjusted compared with unadjusted concentrations. Not accounting for variability in recovery can mask a true change, misidentify a change when no true change exists, or assign a direction opposite of the true change in concentration that resulted from matrix influences on extraction and laboratory method performance. However, matrix-based models of recovery derived from a laboratory performance dataset from multiple studies for national assessment, as used herein, rather than time- and study-specific recoveries may introduce uncertainty in recovery adjustments for individual samples that should be considered in assessing change.

  11. A motif-based search in bacterial genomes identifies the ortholog of the small RNA Yfr1 in all lineages of cyanobacteria

    Directory of Open Access Journals (Sweden)

    Axmann Ilka M

    2007-10-01

    Full Text Available Abstract Background Non-coding RNAs (ncRNA are regulators of gene expression in all domains of life. They control growth and differentiation, virulence, motility and various stress responses. The identification of ncRNAs can be a tedious process due to the heterogeneous nature of this molecule class and the missing sequence similarity of orthologs, even among closely related species. The small ncRNA Yfr1 has previously been found in the Prochlorococcus/Synechococcus group of marine cyanobacteria. Results Here we show that screening available genome sequences based on an RNA motif and followed by experimental analysis works successfully in detecting this RNA in all lineages of cyanobacteria. Yfr1 is an abundant ncRNA between 54 and 69 nt in size that is ubiquitous for cyanobacteria except for two low light-adapted strains of Prochlorococcus, MIT 9211 and SS120, in which it must have been lost secondarily. Yfr1 consists of two predicted stem-loop elements separated by an unpaired sequence of 16–20 nucleotides containing the ultraconserved undecanucleotide 5'-ACUCCUCACAC-3'. Conclusion Starting with an ncRNA previously found in a narrow group of cyanobacteria only, we show here the highly specific and sensitive identification of its homologs within all lineages of cyanobacteria, whereas it was not detected within the genome sequences of E. coli and of 7 other eubacteria belonging to the alpha-proteobacteria, chlorobiaceae and spirochaete. The integration of RNA motif prediction into computational pipelines for the detection of ncRNAs in bacteria appears as a promising step to improve the quality of such predictions.

  12. Structure-Based Analysis of Toxoplasma gondii Profilin: A Parasite-Specific Motif Is Required for Recognition by Toll-Like Receptor 11

    Energy Technology Data Exchange (ETDEWEB)

    K Kucera; A Koblansky; L Saunders; K Frederick; E De La Cruz; S Ghosh; Y Modis

    2011-12-31

    Profilins promote actin polymerization by exchanging ADP for ATP on monomeric actin and delivering ATP-actin to growing filament barbed ends. Apicomplexan protozoa such as Toxoplasma gondii invade host cells using an actin-dependent gliding motility. Toll-like receptor (TLR) 11 generates an innate immune response upon sensing T. gondii profilin (TgPRF). The crystal structure of TgPRF reveals a parasite-specific surface motif consisting of an acidic loop, followed by a long {beta}-hairpin. A series of structure-based profilin mutants show that TLR11 recognition of the acidic loop is responsible for most of the interleukin (IL)-12 secretion response to TgPRF in peritoneal macrophages. Deletion of both the acidic loop and the {beta}-hairpin completely abrogates IL-12 secretion. Insertion of the T. gondii acidic loop and {beta}-hairpin into yeast profilin is sufficient to generate TLR11-dependent signaling. Substitution of the acidic loop in TgPRF with the homologous loop from the apicomplexan parasite Cryptosporidium parvum does not affect TLR11-dependent IL-12 secretion, while substitution with the acidic loop from Plasmodium falciparum results in reduced but significant IL-12 secretion. We conclude that the parasite-specific motif in TgPRF is the key molecular pattern recognized by TLR11. Unlike other profilins, TgPRF slows nucleotide exchange on monomeric rabbit actin and binds rabbit actin weakly. The putative TgPRF actin-binding surface includes the {beta}-hairpin and diverges widely from the actin-binding surfaces of vertebrate profilins.

  13. Clip binds to HLA class II using methionine-based, allele-dependent motifs as well as allele-independent supermotifs.

    Science.gov (United States)

    Geluk, A; Van Meijgaarden, K E; Drijfhout, J W; Ottenhoff, T H

    1995-09-01

    The invariant chain (Ii) region that interacts with class II and inhibits premature peptide binding has been mapped to amino acids 82-107, known as CLIP. It is unclear whether CLIP binds directly to the class II peptide binding groove and thus competitively blocks binding of other peptides, or whether it binds to conserved class II sites and indirectly inhibits peptide binding by inducing conformational changes in class II. Here we show evidence that strongly suggests that CLIP binds within the peptide binding groove, as CLIP binds to various HLA-DR alleles using allele-dependent as well as allele-independent, methionine-based binding motifs. First, a core sequence of 12 amino acids was identified within CLIP which is required for optimal binding to DR1, DR2, DR3(17) and DR7. This sequence is composed of CLIP p88-99 (SKMRMATPLLMQ). By substitution analysis, all three methionine residues appeared to control CLIP binding to HLA-DR. However, whereas M90 controlled binding to all four alleles, M92 and M98 were of different importance for the various alleles: M92 is involved in CLIP binding to DR1 and DR3(17) but not to DR2 or DR7, and M98 controls CLIP binding to DR2, DR3(17) and DR7 but not DR1. Also, CLIP competes with known immunogenic peptides for class II binding in a manner indistinguishable from regular, class II binding competitor peptides. Finally, the dissociation rates of CLIP-class II complexed are similar to those of antigenic peptide-class II complexes. Thus, CLIP most likely binds to the class II peptide binding groove, since most allelic class II differences are clustered here. CLIP uses unconventional methionine anchor residues representing an allele-independent supermotif (M90) as well as allele-dependent motifs (M92 and M98).

  14. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing

    Science.gov (United States)

    Riedl, Jan; Ding, Yun; Fleming, Aaron M.; Burrows, Cynthia J.

    2015-01-01

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand. PMID:26542210

  15. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  16. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    Energy Technology Data Exchange (ETDEWEB)

    Palmero, F [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Archilla, J F R [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Hennig, D [Freie Universitaet Berlin, Fachbereich Physik, Arnimallee 14, 14195-Berlin (Germany); Romero, F R [Facultad de FIsica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain)

    2004-02-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder.

  17. GGIP: Structure and sequence-based GPCR-GPCR interaction pair predictor.

    Science.gov (United States)

    Nemoto, Wataru; Yamanishi, Yoshihiro; Limviphuvadh, Vachiranee; Saito, Akira; Toh, Hiroyuki

    2016-09-01

    G Protein-Coupled Receptors (GPCRs) are important pharmaceutical targets. More than 30% of currently marketed pharmaceutical medicines target GPCRs. Numerous studies have reported that GPCRs function not only as monomers but also as homo- or hetero-dimers or higher-order molecular complexes. Many GPCRs exert a wide variety of molecular functions by forming specific combinations of GPCR subtypes. In addition, some GPCRs are reportedly associated with diseases. GPCR oligomerization is now recognized as an important event in various biological phenomena, and many researchers are investigating this subject. We have developed a support vector machine (SVM)-based method to predict interacting pairs for GPCR oligomerization, by integrating the structure and sequence information of GPCRs. The performance of our method was evaluated by the Receiver Operating Characteristic (ROC) curve. The corresponding area under the curve was 0.938. As far as we know, this is the only prediction method for interacting pairs among GPCRs. Our method could accelerate the analyses of these interactions, and contribute to the elucidation of the global structures of the GPCR networks in membranes. Proteins 2016; 84:1224-1233. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Uncertain Risk Assessment of Knowledge Management: Based on Set Pair Analysis

    Directory of Open Access Journals (Sweden)

    Guibin Yang

    2016-01-01

    Full Text Available Since the knowledge resource becomes an important part of enterprise resources, the knowledge management risks could significantly affect the enterprise operation efficiency. Controlling knowledge management risks is one of the enterprise management tasks; the managers and researchers focus on how to effectively evaluate the risks. This paper aims to solve this problem and puts forward an evaluation model of the uncertain risks of knowledge management. Based on set pair theory, a model is established to identify the knowledge management risk. Through the concept of connection number, knowledge management risk is divided into five levels. Meanwhile, the development trend of knowledge management risk is classified into same tendency, equal tendency, and contrary tendency by the concept of set pair theory. The application of this model is empirically verified with Chinese enterprises. Through both static and dynamic evaluations of the knowledge management risk, this paper can effectively analyze risk development trend and provide decision support for the enterprise manager about the uncertain risks of knowledge management.

  19. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  20. Peptide tag/probe pairs based on the coordination chemistry for protein labeling.

    Science.gov (United States)

    Uchinomiya, Shohei; Ojida, Akio; Hamachi, Itaru

    2014-02-17

    Protein-labeling methods serve as essential tools for analyzing functions of proteins of interest under complicated biological conditions such as in live cells. These labeling methods are useful not only to fluorescently visualize proteins of interest in biological systems but also to conduct protein and cell analyses by harnessing the unique functions of molecular probes. Among the various labeling methods available, an appropriate binding pair consisting of a short peptide and a de novo designed small molecular probe has attracted attention because of its wide utility and versatility. Interestingly, most peptide tag/probe pairs exploit metal-ligand coordination interactions as the main binding force responsible for their association. Herein, we provide an overview of the recent progress of these coordination-chemistry-based protein-labeling methods and their applications for fluorescence imaging and functional analysis of cellular proteins, while highlighting our originally developed labeling methods. These successful examples clearly exemplify the utility and versatility of metal coordination chemistry in protein functional analysis.

  1. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    Science.gov (United States)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  2. A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA

    Science.gov (United States)

    Kladwang, Wipapat; Cordero, Pablo; Das, Rhiju

    2011-01-01

    We present a rapid experimental strategy for inferring base pairs in structured RNAs via an information-rich extension of classic chemical mapping approaches. The mutate-and-map method, previously applied to a DNA/RNA helix, systematically searches for single mutations that enhance the chemical accessibility of base-pairing partners distant in sequence. To test this strategy for structured RNAs, we have carried out mutate-and-map measurements for a 35-nt hairpin, called the MedLoop RNA, embedded within an 80-nt sequence. We demonstrate the synthesis of all 105 single mutants of the MedLoop RNA sequence and present high-throughput DMS, CMCT, and SHAPE modification measurements for this library at single-nucleotide resolution. The resulting two-dimensional data reveal visually clear, punctate features corresponding to RNA base pair interactions as well as more complex features; these signals can be qualitatively rationalized by comparison to secondary structure predictions. Finally, we present an automated, sequence-blind analysis that permits the confident identification of nine of the 10 MedLoop RNA base pairs at single-nucleotide resolution, while discriminating against all 1460 false-positive base pairs. These results establish the accuracy and information content of the mutate-and-map strategy and support its feasibility for rapidly characterizing the base-pairing patterns of larger and more complex RNA systems. PMID:21239468

  3. Base Pairing Interaction between 5′- and 3′-UTRs Controls icaR mRNA Translation in Staphylococcus aureus

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M.; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3′ untranslated region (3′-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3′-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3′-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3′-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3′-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3′-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3′-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3′-UTR with the 5′-UTR of the same mRNA. PMID:24367275

  4. RMOD: a tool for regulatory motif detection in signaling network.

    Directory of Open Access Journals (Sweden)

    Jinki Kim

    Full Text Available Regulatory motifs are patterns of activation and inhibition that appear repeatedly in various signaling networks and that show specific regulatory properties. However, the network structures of regulatory motifs are highly diverse and complex, rendering their identification difficult. Here, we present a RMOD, a web-based system for the identification of regulatory motifs and their properties in signaling networks. RMOD finds various network structures of regulatory motifs by compressing the signaling network and detecting the compressed forms of regulatory motifs. To apply it into a large-scale signaling network, it adopts a new subgraph search algorithm using a novel data structure called path-tree, which is a tree structure composed of isomorphic graphs of query regulatory motifs. This algorithm was evaluated using various sizes of signaling networks generated from the integration of various human signaling pathways and it showed that the speed and scalability of this algorithm outperforms those of other algorithms. RMOD includes interactive analysis and auxiliary tools that make it possible to manipulate the whole processes from building signaling network and query regulatory motifs to analyzing regulatory motifs with graphical illustration and summarized descriptions. As a result, RMOD provides an integrated view of the regulatory motifs and mechanism underlying their regulatory motif activities within the signaling network. RMOD is freely accessible online at the following URL: http://pks.kaist.ac.kr/rmod.

  5. Fingerprint identification using SIFT-based minutia descriptors and improved all descriptor-pair matching.

    Science.gov (United States)

    Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

    2013-03-06

    The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  6. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  7. Detecting DNA regulatory motifs by incorporating positional trendsin information content

    Energy Technology Data Exchange (ETDEWEB)

    Kechris, Katherina J.; van Zwet, Erik; Bickel, Peter J.; Eisen,Michael B.

    2004-05-04

    On the basis of the observation that conserved positions in transcription factor binding sites are often clustered together, we propose a simple extension to the model-based motif discovery methods. We assign position-specific prior distributions to the frequency parameters of the model, penalizing deviations from a specified conservation profile. Examples with both simulated and real data show that this extension helps discover motifs as the data become noisier or when there is a competing false motif.

  8. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  9. A single base-pair deletion in the WFS1 gene causes Wolfram syndrome.

    Science.gov (United States)

    Pitt, Katherine; James, Chela; Kochar, Inderpal S; Kapoor, Akshay; Jain, Shilpi; Hussain, Khalid; Bennett, Kate

    2011-01-01

    Wolfram syndrome is a progressive neurodegenerative disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy and deafness). The majority of cases are caused by mutations in the WFS1 gene. WFS1 is located at 4p16.1 and encodes wolframin, a transmembrane endoplasmic reticulum (ER) protein involved in the negative regulation of ER stress signalling. To date, over 120 WFS1 mutations have been described. In this study, we report a consanguineous family with three siblings affected by Wolfram syndrome. A homozygous single base pair deletion (c.877delC, L293fsX303) was found in the WFS1 gene in all three affected siblings.

  10. Chemistry of stannylene-based Lewis pairs: dynamic tin coordination switching between donor and acceptor character.

    Science.gov (United States)

    Krebs, Kilian M; Freitag, Sarah; Schubert, Hartmut; Gerke, Birgit; Pöttgen, Rainer; Wesemann, Lars

    2015-03-16

    The coordination chemistry of cyclic stannylene-based intramolecular Lewis pairs is presented. The P→Sn adducts were treated with [Ni(COD)2] and [Pd(PCy3)2] (COD = 1,5-cyclooctadiene, PCy3 = tricyclohexylphosphine). In the isolated coordination compounds the stannylene moiety acts either as an acceptor or a donor ligand. Examples of a dynamic switch between these two coordination modes of the P-Sn ligand are illustrated and the structures in the solid state together with heteronuclear NMR spectroscopic findings are discussed. In the case of a Ni(0) complex, (119)Sn Mössbauer spectroscopy of the uncoordinated and coordinated phosphastannirane ligand is presented. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ∼30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  12. Analisis Unsur Matematika pada Motif Sulam Usus

    Directory of Open Access Journals (Sweden)

    Fredi Ganda Putra

    2017-12-01

    Full Text Available Based on interviews with researchers sources said that the beginning of the intestine embroidery is an art of genuine crafts. Called the intestine embroidery because this technique is a technique of combining a strand of cloth resembling the intestine formed according to the pattern by means of embroidered using a thread. Intestinal embroidery techniques were originally used to create a cover of the women's customary wardrobe of Lampung or often referred to as bebe. But not many people in Lampung, especially people who live in Lampung are still many who do not know and recognize the intestine embroidery because most only know tapis only characteristic of Lampung, besides that there are other cultural results that is embroidered intestine. There are still many who do not know that the intestine motif there is a knowledge of mathematics. The researcher's problem formulation is whether there are mathematical elements contained in the intestine embroidery motif based on the concept of geometry. The purpose of this study is to determine whether there are elements of mathematics contained in the intestine motif based on the concept of geometry. Subjects in this study consisted of 4 people obtained by purposive sampling technique. From the results of data analysis conducted by using descriptive analysis and discussion as follows: (1 Intestinal embroidery motif contains the meaning of mathematics and culture or often called Etnomatematika. On the meaning of culture there is a link between the embroidery intestine with a culture that has been there before as the existence of cultural linkage between Hindu belief Buddhism and there are similarities of motifs and decorative patterns contained in the motif embroidery intestine with ornamental variety in Indonesia. (2 The relationship between the intestine with mathematical motifs there are elements of mathematics such as geometry elements in the form of geometry of dimension one and dimension two, and the

  13. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  14. Detecting Statistically Significant Communities of Triangle Motifs in Undirected Networks

    Science.gov (United States)

    2016-04-26

    extend the work of Perry et al. [6] by developing a statistical framework that supports the detection of triangle motif- based clusters in complex...priori, the need for triangle motif- based clustering. 2. Developed an algorithm for clustering undirected networks, where the triangle con guration was...13 5 Application to Real Networks 18 5.1 2012 FBS Football Schedule Network

  15. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    Science.gov (United States)

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  16. Characterization of the trans Watson-Crick GU base pair located in the catalytic core of the antigenomic HDV ribozyme.

    Directory of Open Access Journals (Sweden)

    Dominique Lévesque

    Full Text Available The HDV ribozyme's folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U(23 and G(28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U(23 and G(28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction.

  17. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  18. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    Science.gov (United States)

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  19. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    Directory of Open Access Journals (Sweden)

    Heng Yuan

    2015-12-01

    Full Text Available An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET. Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  20. A provably secure identity-based strong designated verifier proxy signature scheme from bilinear pairings

    Directory of Open Access Journals (Sweden)

    SK Hafizul Islam

    2014-01-01

    Full Text Available The proxy signature, a variant of the ordinary digital signature, has been an active research topic in recent years; it has many useful applications, including distributed systems and grid computing. Although many identity-based proxy signature schemes have been proposed in the literature, only a few proposals for identity-based strong designated verifier proxy signature (ID-SDVPS schemes are available. However, it has been found that most of the ID-SDVPS schemes that have been proposed to date are not efficient in terms of computation and security, and a computationally efficient and secured ID-SDVPS scheme using elliptic curve bilinear pairing has been proposed in this paper. The security of the scheme is mainly based on the hardness assumption of CDH and GBDH problems in the random oracle model, which is existentially unforgeable against different types of adversaries. Furthermore, the security of our scheme is simulated in the AVISPA (Automated Validation of Internet Security Protocols and Applications software, a widely used automated internet protocol validation tool, and the simulation results confirm strong security against both active and passive attacks. In addition, because of a high processing capability and supporting additional security features, the scheme is suitable for the environments in which less computational cost with strong security is required.

  1. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    Science.gov (United States)

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-01-01

    An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

  2. Novel H⁺-Ion Sensor Based on a Gated Lateral BJT Pair.

    Science.gov (United States)

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-12-23

    An H⁺-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H⁺-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  3. Discovery of stress responsive DNA regulatory motifs in Arabidopsis.

    Science.gov (United States)

    Ma, Shisong; Bachan, Shawn; Porto, Matthew; Bohnert, Hans J; Snyder, Michael; Dinesh-Kumar, Savithramma P

    2012-01-01

    The discovery of DNA regulatory motifs in the sequenced genomes using computational methods remains challenging. Here, we present MotifIndexer--a comprehensive strategy for de novo identification of DNA regulatory motifs at a genome level. Using word-counting methods, we indexed the existence of every 8-mer oligo composed of bases A, C, G, T, r, y, s, w, m, k, n or 12-mer oligo composed of A, C, G, T, n, in the promoters of all predicted genes of Arabidopsis thaliana genome and of selected stress-induced co-expressed genes. From this analysis, we identified number of over-represented motifs. Among these, major critical motifs were identified using a position filter. We used a model based on uniform distribution and the z-scores derived from this model to describe position bias. Interestingly, many motifs showed position bias towards the transcription start site. We extended this model to show biased distribution of motifs in the genomes of both A. thaliana and rice. We also used MotifIndexer to identify conserved motifs in co-expressed gene groups from two Arabidopsis species, A. thaliana and A. lyrata. This new comparative genomics method does not depend on alignments of homologous gene promoter sequences.

  4. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  5. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  6. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  7. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  8. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  9. STEME: a robust, accurate motif finder for large data sets.

    Directory of Open Access Journals (Sweden)

    John E Reid

    Full Text Available Motif finding is a difficult problem that has been studied for over 20 years. Some older popular motif finders are not suitable for analysis of the large data sets generated by next-generation sequencing. We recently published an efficient approximation (STEME to the EM algorithm that is at the core of many motif finders such as MEME. This approximation allows the EM algorithm to be applied to large data sets. In this work we describe several efficient extensions to STEME that are based on the MEME algorithm. Together with the original STEME EM approximation, these extensions make STEME a fully-fledged motif finder with similar properties to MEME. We discuss the difficulty of objectively comparing motif finders. We show that STEME performs comparably to existing prominent discriminative motif finders, DREME and Trawler, on 13 sets of transcription factor binding data in mouse ES cells. We demonstrate the ability of STEME to find long degenerate motifs which these discriminative motif finders do not find. As part of our method, we extend an earlier method due to Nagarajan et al. for the efficient calculation of motif E-values. STEME's source code is available under an open source license and STEME is available via a web interface.

  10. Motif content comparison between monocot and dicot species

    Directory of Open Access Journals (Sweden)

    Matyas Cserhati

    2015-03-01

    Full Text Available While a number of DNA sequence motifs have been functionally characterized, the full repertoire of motifs in an organism (the motifome is yet to be characterized. The present study wishes to widen the scope of motif content analysis in different monocot and dicot species that include both rice species, Brachypodium, corn, wheat as monocots and Arabidopsis, Lotus japonica, Medicago truncatula, and Populus tremula as dicots. All possible existing motifs were analyzed in different regions of genomes such as were found in different sets of sequences in these species: the whole genome, core proximal and distal promoters, 5′ and 3′ UTRs, and the 1st introns. Due to the increased number of species involved in this study compared to previous works, species relationships were analyzed based on the similarity of common motif content. Certain secondary structure elements were inferred in the genomes of these species as well as new unknown motifs. The distribution of 20 motifs common to the studied species were found to have a significantly larger occurrence within the promoters and 3′ UTRs of genes, both being regulatory regions. Motifs common to the promoter regions of japonica rice, Brachypodium, and corn were also found in a number of orthologous and paralogous genes. Some of our motifs were found to be complementary to miRNA elements in Brachypodium distachyon and japonica rice.

  11. In vivo dynamics of enterovirus protease revealed by fluorescence resonance emission transfer (FRET) based on a novel FRET pair

    International Nuclear Information System (INIS)

    Hsu, Y.-Y.; Liu, Y.-N.; Wang Wenyen; Kao, Fu-Jen; Kung, S.-H.

    2007-01-01

    An in vivo protease assay suitable for analysis by fluorescence resonance energy transfer (FRET) was developed on the basis of a novel FRET pair. The specifically designed fusion substrate consists of green fluorescent protein 2 (GFP 2 )-peptide-red fluorescent protein 2 (DsRed2), with a cleavage motif for the enterovirus 2A protease (2A pro ) embedded within the peptide region. FRET can be readily visualized in real-time from cells expressing the fusion substrate until a proteolytic cleavage by 2A pro from the input virus. The level of FRET decay is a function of the amount and infection duration of the inoculated virus as measured by a fluorometer assay. The FRET biosensor also responded well to other related enteroviruses but not to a phylogenetically distant virus. Western blot analysis confirmed the physical cleavage of the fusion substrate upon the infections. The study provides proof of principle for applying the FRET technology to diagnostics, screening procedures, and cell biological research

  12. Probing structural changes of self assembled i-motif DNA

    KAUST Repository

    Lee, Iljoon

    2015-01-01

    We report an i-motif structural probing system based on Thioflavin T (ThT) as a fluorescent sensor. This probe can discriminate the structural changes of RET and Rb i-motif sequences according to pH change. This journal is

  13. SLIDER: A Generic Metaheuristic for the Discovery of Correlated Motifs in Protein-Protein Interaction Networks

    NARCIS (Netherlands)

    Boyen, P.; Dyck, van D.; Neven, F.; Ham, van R.C.H.J.; Dijk, van A.D.J.

    2011-01-01

    Correlated motif mining (CMM) is the problem of finding overrepresented pairs of patterns, called motifs, in sequences of interacting proteins. Algorithmic solutions for CMM thereby provide a computational method for predicting binding sites for protein interaction. In this paper, we adopt a

  14. Direct AUC optimization of regulatory motifs.

    Science.gov (United States)

    Zhu, Lin; Zhang, Hong-Bo; Huang, De-Shuang

    2017-07-15

    The discovery of transcription factor binding site (TFBS) motifs is essential for untangling the complex mechanism of genetic variation under different developmental and environmental conditions. Among the huge amount of computational approaches for de novo identification of TFBS motifs, discriminative motif learning (DML) methods have been proven to be promising for harnessing the discovery power of accumulated huge amount of high-throughput binding data. However, they have to sacrifice accuracy for speed and could fail to fully utilize the information of the input sequences. We propose a novel algorithm called CDAUC for optimizing DML-learned motifs based on the area under the receiver-operating characteristic curve (AUC) criterion, which has been widely used in the literature to evaluate the significance of extracted motifs. We show that when the considered AUC loss function is optimized in a coordinate-wise manner, the cost function of each resultant sub-problem is a piece-wise constant function, whose optimal value can be found exactly and efficiently. Further, a key step of each iteration of CDAUC can be efficiently solved as a computational geometry problem. Experimental results on real world high-throughput datasets illustrate that CDAUC outperforms competing methods for refining DML motifs, while being one order of magnitude faster. Meanwhile, preliminary results also show that CDAUC may also be useful for improving the interpretability of convolutional kernels generated by the emerging deep learning approaches for predicting TF sequences specificities. CDAUC is available at: https://drive.google.com/drive/folders/0BxOW5MtIZbJjNFpCeHlBVWJHeW8 . dshuang@tongji.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  15. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  16. The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

    Science.gov (United States)

    Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

    2013-01-01

    This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

  17. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  18. Glyoxals as in vivo RNA structural probes of guanine base-pairing.

    Science.gov (United States)

    Mitchell, David; Ritchey, Laura E; Park, Hongmarn; Babitzke, Paul; Assmann, Sarah M; Bevilacqua, Philip C

    2018-01-01

    Elucidation of the folded structures that RNA forms in vivo is vital to understanding its functions. Chemical reagents that modify the Watson-Crick (WC) face of unprotected nucleobases are particularly useful in structure elucidation. Dimethyl sulfate penetrates cell membranes and informs on RNA base-pairing and secondary structure but only modifies the WC face of adenines and cytosines. We present glyoxal, methylglyoxal, and phenylglyoxal as potent in vivo reagents that target the WC face of guanines as well as cytosines and adenines. Tests on rice ( Oryza sativa) 5.8S rRNA in vitro read out by reverse transcription and gel electrophoresis demonstrate specific modification of almost all guanines in a time- and pH-dependent manner. Subsequent in vivo tests on rice, a eukaryote, and Bacillus subtilis and Escherichia coli , Gram-positive and Gram-negative bacteria, respectively, showed that all three reagents enter living cells without prior membrane permeabilization or pH adjustment of the surrounding media and specifically modify solvent-exposed guanine, cytosine, and adenine residues. © 2018 Mitchell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae)

    Science.gov (United States)

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-01-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae. PMID:27759763

  20. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae

    Directory of Open Access Journals (Sweden)

    Vanessa Bellini Bardella

    Full Text Available The subfamily Triatominae (Hemiptera, Reduviidae includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  1. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  2. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  3. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  4. NIR Emitting Nanoprobes Based on Cyclic RGD Motif Conjugated PbS Quantum Dots for Integrin-Targeted Optical Bioimaging.

    Science.gov (United States)

    Depalo, N; Corricelli, M; De Paola, I; Valente, G; Iacobazzi, R M; Altamura, E; Debellis, D; Comegna, D; Fanizza, E; Denora, N; Laquintana, V; Mavelli, F; Striccoli, M; Saviano, M; Agostiano, A; Del Gatto, A; Zaccaro, L; Curri, M L

    2017-12-13

    Here, silica-coated PbS quantum dots (QDs) with photoluminescence emission properties in the near-infrared (NIR) region are proposed as potential effective single particle optical nanoprobes for future in vivo imaging of tumors. The dispersibility in aqueous medium of hydrophobic PbS QDs was accomplished by growing a silica shell on their surface by exploiting a base assisted water-in-oil microemulsion method. The silica-coated PbS QDs were then conjugated with a specifically designed cyclic arginine-glycine-aspartic acid (cRGD) peptide that is able to specifically recognize αvβ3 integrins, which are overexpressed in angiogenic tumor-induced vasculatures and on some solid tumors, to achieve tumor-specific targeting. The cRGD peptide PbS silica-coated QDs were systematically characterized, at each step of their preparation, by means of complementary optical and structural techniques, demonstrating appropriate colloidal stability and the maintenance of their optical futures in aqueous solutions. The cellular uptake of cRGD peptide functionalized luminescent nanostructures in human melanoma cells, where overexpression of αvβ3 was observed, was assessed by means of confocal microscopy analysis and cytometric study. The selectivity of the cRGD peptide PbS silica-coated QDs for the αvβ3 integrin was established, consequently highlighting the significant potential of the developed NIR emitting nanostructures as optically traceable nanoprobes for future αvβ3 integrin receptor in vivo targeting in the NIR region.

  5. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  6. Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

    Directory of Open Access Journals (Sweden)

    Saray Santamaría-Hernando

    Full Text Available Proteins of the animal heme peroxidase (ANP superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20, where it was found to be involved in Ca(2+ coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+ binding with a K(D of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821 is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of

  7. Epitope-based vaccines with the Anaplasma marginale MSP1a functional motif induce a balanced humoral and cellular immune response in mice.

    Directory of Open Access Journals (Sweden)

    Paula S Santos

    Full Text Available Bovine anaplasmosis is a hemoparasitic disease that causes considerable economic loss to the dairy and beef industries. Cattle immunized with the Anaplasma marginale MSP1 outer membrane protein complex presents a protective humoral immune response; however, its efficacy is variable. Immunodominant epitopes seem to be a key-limiting factor for the adaptive immunity. We have successfully demonstrated that critical motifs of the MSP1a functional epitope are essential for antibody recognition of infected animal sera, but its protective immunity is yet to be tested. We have evaluated two synthetic vaccine formulations against A. marginale, using epitope-based approach in mice. Mice infection with bovine anaplasmosis was demonstrated by qPCR analysis of erythrocytes after 15-day exposure. A proof-of-concept was obtained in this murine model, in which peptides conjugated to bovine serum albumin were used for immunization in three 15-day intervals by intraperitoneal injections before challenging with live bacteria. Blood samples were analyzed for the presence of specific IgG2a and IgG1 antibodies, as well as for the rickettsemia analysis. A panel containing the cytokines' transcriptional profile for innate and adaptive immune responses was carried out through qPCR. Immunized BALB/c mice challenged with A. marginale presented stable body weight, reduced number of infected erythrocytes, and no mortality; and among control groups mortality rates ranged from 15% to 29%. Additionally, vaccines have significantly induced higher IgG2a than IgG1 response, followed by increased expression of pro-inflammatory cytokines. This is a successful demonstration of epitope-based vaccines, and protection against anaplasmosis may be associated with elicitation of effector functions of humoral and cellular immune responses in murine model.

  8. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  9. Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

    2013-03-26

    Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

  10. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  11. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  12. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  13. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  14. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  15. Identification of family-specific residue packing motifs and their use for structure-based protein function prediction: II. Case studies and applications

    Science.gov (United States)

    Bandyopadhyay, Deepak; Huan, Jun; Prins, Jan; Snoeyink, Jack; Wang, Wei; Tropsha, Alexander

    2009-11-01

    This paper describes several case studies concerning protein function inference from its structure using our novel approach described in the accompanying paper. This approach employs family-specific motifs, i.e. three-dimensional amino acid packing patterns that are statistically prevalent within a protein family. For our case studies we have selected families from the SCOP and EC classifications and analyzed the discriminating power of the motifs in depth. We have devised several benchmarks to compare motifs mined from unweighted topological graph representations of protein structures with those from distance-labeled (weighted) representations, demonstrating the superiority of the latter for function inference in most families. We have tested the robustness of our motif library by inferring the function of new members added to SCOP families, and discriminating between several families that are structurally similar but functionally divergent. Furthermore we have applied our method to predict function for several proteins characterized in structural genomics projects, including orphan structures, and we discuss several selected predictions in depth. Some of our predictions have been corroborated by other computational methods, and some have been validated by independent experimental studies, validating our approach for protein function inference from structure.

  16. Universal quantitative kinase assay based on diagonal SCX chromatography and stable isotope dimethyl labeling provides high-definition kinase consensus motifs for PKA and human Mps1

    NARCIS (Netherlands)

    Hennrich, M.L.|info:eu-repo/dai/nl/314406778; Marino, F.|info:eu-repo/dai/nl/339461799; Groenewold, V.; Kops, G.J.P.L.; Mohammed, S.|info:eu-repo/dai/nl/30483632X; Heck, A.J.R.|info:eu-repo/dai/nl/105189332

    2013-01-01

    In order to understand cellular signaling, a clear understanding of kinase–substrate relationships is essential. Some of these relationships are defined by consensus recognition motifs present in substrates making them amendable for phosphorylation by designated kinases. Here, we explore a method

  17. Automatic annotation of protein motif function with Gene Ontology terms

    Directory of Open Access Journals (Sweden)

    Gopalakrishnan Vanathi

    2004-09-01

    Full Text Available Abstract Background Conserved protein sequence motifs are short stretches of amino acid sequence patterns that potentially encode the function of proteins. Several sequence pattern searching algorithms and programs exist foridentifying candidate protein motifs at the whole genome level. However, amuch needed and importanttask is to determine the functions of the newly identified protein motifs. The Gene Ontology (GO project is an endeavor to annotate the function of genes or protein sequences with terms from a dynamic, controlled vocabulary and these annotations serve well as a knowledge base. Results This paperpresents methods to mine the GO knowledge base and use the association between the GO terms assigned to a sequence and the motifs matched by the same sequence as evidence for predicting the functions of novel protein motifs automatically. The task of assigning GO terms to protein motifsis viewed as both a binary classification and information retrieval problem, where PROSITE motifs are used as samples for mode training and functional prediction. The mutual information of a motif and aGO term association isfound to be a very useful feature. We take advantageof the known motifs to train a logistic regression classifier, which allows us to combine mutual information with other frequency-based features and obtain a probability of correctassociation. The trained logistic regression model has intuitively meaningful and logically plausible parameter values, and performs very well empirically according to our evaluation criteria. Conclusions In this research, different methods for automatic annotation of protein motifs have been investigated. Empirical result demonstrated that the methods have a great potential for detecting and augmenting information about thefunctions of newly discovered candidate protein motifs.

  18. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-05

    Jun 5, 2012 ... 1College of Computer Science and Technology, Jilin University, Key Laboratory of Symbol Computation and Knowledge ... 3Department of Information Engineering and Computer Science, University of Trento, Via Sommarive 14, 38050 – Povo ... disjoint top scoring pairs of genes as decision rules rather.

  19. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  20. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-05

    Jun 5, 2012 ... machine learning approach without any parameter. The classification rules of TSP contain only a pair of genes. Moreover, because in some datasets the classification rules of TSP classifier will change with the addition or deletion of training samples, Tan et al. (2005) proposed an improved method named ...

  1. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  2. Asymptotic distribution of motifs in a stochastic context-free grammar model of RNA folding.

    Science.gov (United States)

    Poznanović, Svetlana; Heitsch, Christine E

    2014-12-01

    We analyze the distribution of RNA secondary structures given by the Knudsen-Hein stochastic context-free grammar used in the prediction program Pfold. Our main theorem gives relations between the expected number of these motifs--independent of the grammar probabilities. These relations are a consequence of proving that the distribution of base pairs, of helices, and of different types of loops is asymptotically Gaussian in this model of RNA folding. Proof techniques use singularity analysis of probability generating functions. We also demonstrate that these asymptotic results capture well the expected number of RNA base pairs in native ribosomal structures, and certain other aspects of their predicted secondary structures. In particular, we find that the predicted structures largely satisfy the expected relations, although the native structures do not.

  3. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  4. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  5. DNA motif elucidation using belief propagation

    KAUST Repository

    Wong, Ka-Chun

    2013-06-29

    Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k = 8 ?10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors\\' websites: e.g. http://www.cs.toronto.edu/?wkc/kmerHMM. 2013 The Author(s).

  6. Investigation of Nascent Base Pair and Polymerase Behavior in the Presence of Mismatches in DNA Polymerase I Using Molecular Dynamics.

    Science.gov (United States)

    Yeager, Andrew; Humphries, Kathryn; Farmer, Ellen; Cline, Gene; Miller, Bill R

    2018-02-26

    Optimizing DNA polymerases for a broad range of tasks requires an understanding of the factors influencing polymerase fidelity, but many details of polymerase behavior remain unknown, especially in the presence of mismatched nascent base pairs. Using molecular dynamics, the large fragment of Bacillus stearothermophilus DNA polymerase I is simulated in the presence of all 16 possible standard nucleoside triphosphate-template (dNTP-dN) pairs, including four Watson-Crick pairs and 12 mismatches. The precatalytic steps of nucleotide addition from nucleotide insertion to immediately preceding catalysis are explored using three starting structures representing different stages of nucleotide addition. From these simulations, interactions between dNTPs and the DNA-protein complex formed by the polymerase are elucidated. Patterns of large-scale conformational shifts, classification of nucleotide pairs based on composition, and investigation of the roles of residues interacting with dNTPs are completed on 50+ μs of simulation. The role of molecular dynamics in studies of polymerase behavior is discussed.

  7. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  8. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)

    2016-05-06

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  10. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Directory of Open Access Journals (Sweden)

    Jahn Andreas

    2011-07-01

    Full Text Available Abstract Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible.

  12. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  13. Effects of restrained sampling space and nonplanar amino groups on free-energy predictions for RNA with imino and sheared tandem GA base pairs flanked by GC, CG, iGiC or iCiG base pairs

    Czech Academy of Sciences Publication Activity Database

    Yildirim, I.; Stern, H.A.; Šponer, Jiří; Špačková, Naďa; Turner, D.H.

    2009-01-01

    Roč. 5, č. 8 (2009), s. 2088-2100 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA MŠk(CZ) LC06030 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : base pairs * NMR * amber force field Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  14. The influence of substituents and the environment on the NMR shielding constants of supramolecular complexes based on A-T and A-U base pairs

    NARCIS (Netherlands)

    Castro, Abril C.; Swart, Marcel; Guerra, Célia Fonseca

    2017-01-01

    In the present study, we have theoretically analyzed supramolecular complexes based on the Watson-Crick A-T and A-U base pairs using dispersion-corrected density functional theory (DFT). Hydrogen atoms H8 and/or H6 in the natural adenine and thymine/uracil bases were replaced, respectively, by

  15. Influence of gain fiber on dissipative soliton pairs in passively mode-locked fiber laser based on BP as a saturable absorber

    Science.gov (United States)

    Gao, Bo; Ma, Chunyang; Huo, Jiayu; Guo, Yubin; Sun, Tiegang; Wu, Ge

    2018-03-01

    We investigate the influence of gain fiber on dissipative soliton pairs in passively mode-locked (PML) fiber laser based on black phosphorus (BP) as a saturable absorber. Numerical simulations show that we can generate the dissipative soliton pairs in PML fiber laser when the gain fiber parameters (gain saturation energy and gain bandwidth) are in an appropriate dynamic range, and the dissipative soliton pairs become unstable once the range is exceeded. Then we analyze the dynamic evolution of the dissipative soliton pairs and the influence of gain fiber on the pulse separation, peak power, and single-pulse energy of the dissipative solitons pairs.

  16. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    Science.gov (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  17. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    Science.gov (United States)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  18. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  19. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  20. A pairing-free identity-based two-party authenticated key agreement protocol for secure and efficient communication

    Directory of Open Access Journals (Sweden)

    SK Hafizul Islam

    2017-01-01

    Full Text Available Recently, many identity-based two-party authenticated key agreement (ID-2PAKA protocols using elliptic curve cryptography (ECC have been proposed, however, these protocols do not provide adequate security and their computation costs are also relatively high due to bilinear pairing and map-to-point function. Moreover, they require many communication rounds for establishing the session key, and thus results in increased communication latency, which makes them unsuitable for real applications. This paper thus aims to propose a pairing-free ID-2PAKA protocol based on ECC that removes the security flaws of previous protocols. The proposed protocol helps two users to establish a common session key between them through an open network. The formal security analysis using BAN logic and the comparisons with other protocols are given, which demonstrated that our protocol is formally secure and thus, suitable for secure and efficient peer-to-peer communications.

  1. Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

    Science.gov (United States)

    Pinski, Peter; Neese, Frank

    2018-01-01

    Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

  2. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail: b6rgw@fantasy.plala.or.jp; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)

    2007-02-01

    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  3. Motif discovery in ranked lists of sequences

    DEFF Research Database (Denmark)

    Nielsen, Morten Muhlig; Tataru, Paula; Madsen, Tobias

    2016-01-01

    a growing need for motif analysis methods that can exploit this coupled data structure and be tailored for specific biological questions. Here, we present an exploratory motif analysis tool, Regmex (REGular expression Motif EXplorer), which offers several methods to evaluate the correlation of motifs....... These features make Regmex well suited for a range of biological sequence analysis problems related to motif discovery, exemplified by microRNA seed enrichment, but also including enrichment problems involving complex motifs and combinations of motifs. We demonstrate a number of usage scenarios that take...

  4. miRNA-target chimeras reveal miRNA 3'-end pairing as a major determinant of Argonaute target specificity

    DEFF Research Database (Denmark)

    Moore, Michael J; Scheel, Troels K H; Luna, Joseph M

    2015-01-01

    AGO HITS-CLIP strategy termed CLEAR (covalent ligation of endogenous Argonaute-bound RNAs)-CLIP, which enriches miRNAs ligated to their endogenous mRNA targets. CLEAR-CLIP mapped ∼130,000 endogenous miRNA-target interactions in mouse brain and ∼40,000 in human hepatoma cells. Motif and structural...... analysis define expanded pairing rules for over 200 mammalian miRNAs. Most interactions combine seed-based pairing with distinct, miRNA-specific patterns of auxiliary pairing. At some regulatory sites, this specificity confers distinct silencing functions to miRNA family members with shared seed sequences...

  5. ARPES measurements of the superconducting gap of Fe-based superconductors and their implications to the pairing mechanism.

    Science.gov (United States)

    Richard, P; Qian, T; Ding, H

    2015-07-29

    Its direct momentum sensitivity confers to angle-resolved photoemission spectroscopy (ARPES) a unique perspective in investigating the superconducting gap of multi-band systems. In this review we discuss ARPES studies on the superconducting gap of high-temperature Fe-based superconductors. We show that while Fermi-surface-driven pairing mechanisms fail to provide a universal scheme for the Fe-based superconductors, theoretical approaches based on short-range interactions lead to a more robust and universal description of superconductivity in these materials. Our findings are also discussed in the broader context of unconventional superconductivity.

  6. MHC-based patterns of social and extra-pair mate choice in the Seychelles warbler

    Science.gov (United States)

    Richardson, David S; Komdeur, Jan; Burke, Terry; von Schantz, Torbjörn

    2005-01-01

    The existence and nature of indirect genetic benefits to mate choice remain contentious. Major histocompatibility complex (MHC) genes, which play a vital role in determining pathogen resistance in vertebrates, may be the link between mate choice and the genetic inheritance of vigour in offspring. Studies have shown that MHC-dependent mate choice can occur in mammal and fish species, but little work has focused on the role of the MHC in birds. We tested for MHC-dependent mating patterns in the Seychelles warbler (Acrocephalus sechellensis). There was no influence of MHC class I exon 3 variation on the choice of social mate. However, females were more likely to obtain extra-pair paternity (EPP) when their social mate had low MHC diversity, and the MHC diversity of the extra-pair male was significantly higher than that of the cuckolded male. There was no evidence that females were mating disassortatively, or that they preferred males with an intermediate number of MHC bands. Overall, the results are consistent with the ‘good genes’ rather than the ‘genetic compatibility’ hypothesis. As female choice will result in offspring of higher MHC diversity, MHC-dependent EPP may provide indirect benefits in the Seychelles warbler if survival is positively linked to MHC diversity. PMID:15870038

  7. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  8. Understanding the role of base stacking in nucleic acids. MD and QM analysis of tandem GA base pairs in RNA duplexes

    Czech Academy of Sciences Publication Activity Database

    Morgado, C.A.; Svozil, D.; Turner, D.H.; Šponer, Jiří

    2012-01-01

    Roč. 14, č. 36 (2012), s. 12580-12591 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : GA base pairs * base stacking * RNA duplexes Subject RIV: BO - Biophysics Impact factor: 3.829, year: 2012

  9. DMINDA: an integrated web server for DNA motif identification and analyses.

    Science.gov (United States)

    Ma, Qin; Zhang, Hanyuan; Mao, Xizeng; Zhou, Chuan; Liu, Bingqiang; Chen, Xin; Xu, Ying

    2014-07-01

    DMINDA (DNA motif identification and analyses) is an integrated web server for DNA motif identification and analyses, which is accessible at http://csbl.bmb.uga.edu/DMINDA/. This web site is freely available to all users and there is no login requirement. This server provides a suite of cis-regulatory motif analysis functions on DNA sequences, which are important to elucidation of the mechanisms of transcriptional regulation: (i) de novo motif finding for a given set of promoter sequences along with statistical scores for the predicted motifs derived based on information extracted from a control set, (ii) scanning motif instances of a query motif in provided genomic sequences, (iii) motif comparison and clustering of identified motifs, and (iv) co-occurrence analyses of query motifs in given promoter sequences. The server is powered by a backend computer cluster with over 150 computing nodes, and is particularly useful for motif prediction and analyses in prokaryotic genomes. We believe that DMINDA, as a new and comprehensive web server for cis-regulatory motif finding and analyses, will benefit the genomic research community in general and prokaryotic genome researchers in particular. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  11. Solar radiation concentrators paired with multijunction photoelectric converters in ground-based solar power plants (Part II)

    Science.gov (United States)

    Ionova, E. A.; Ulanov, M. V.; Davidyuk, N. Yu.; Sadchikov, N. A.

    2017-04-01

    The present work is devoted to determining the conditions of the joint operation of photoelectric converter-solar concentrator pairs, which are used in solar power plants with concentrators. Three-cascade photoconverters based on A3B5 materials with different distributions of solar radiation in spectral ranges are studied. Concentrators of solar radiation are designed as the Fresnel lenses with silicon-on-glass structure. Refractive lens profile fabricated on the basis of Wacker RT604 silicone rubber is characterized by significant changes in refractive index with temperature. The effect of geometric parameters of the Fresnel lenses and their operating temperature on characteristics of solar radiation concentration in specified spectral intervals have been examined. The parameters of concentrators being paired with a photoelectric converter, which may ensure the efficient functioning of the solar power plant, have been calculated.

  12. Unravelling daily human mobility motifs.

    Science.gov (United States)

    Schneider, Christian M; Belik, Vitaly; Couronné, Thomas; Smoreda, Zbigniew; González, Marta C

    2013-07-06

    Human mobility is differentiated by time scales. While the mechanism for long time scales has been studied, the underlying mechanism on the daily scale is still unrevealed. Here, we uncover the mechanism responsible for the daily mobility patterns by analysing the temporal and spatial trajectories of thousands of persons as individual networks. Using the concept of motifs from network theory, we find only 17 unique networks are present in daily mobility and they follow simple rules. These networks, called here motifs, are sufficient to capture up to 90 per cent of the population in surveys and mobile phone datasets for different countries. Each individual exhibits a characteristic motif, which seems to be stable over several months. Consequently, daily human mobility can be reproduced by an analytically tractable framework for Markov chains by modelling periods of high-frequency trips followed by periods of lower activity as the key ingredient.

  13. A speedup technique for (l, d-motif finding algorithms

    Directory of Open Access Journals (Sweden)

    Dinh Hieu

    2011-03-01

    Full Text Available Abstract Background The discovery of patterns in DNA, RNA, and protein sequences has led to the solution of many vital biological problems. For instance, the identification of patterns in nucleic acid sequences has resulted in the determination of open reading frames, identification of promoter elements of genes, identification of intron/exon splicing sites, identification of SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have proven to be extremely helpful in domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, etc. Motifs are important patterns that are helpful in finding transcriptional regulatory elements, transcription factor binding sites, functional genomics, drug design, etc. As a result, numerous papers have been written to solve the motif search problem. Results Three versions of the motif search problem have been proposed in the literature: Simple Motif Search (SMS, (l, d-motif search (or Planted Motif Search (PMS, and Edit-distance-based Motif Search (EMS. In this paper we focus on PMS. Two kinds of algorithms can be found in the literature for solving the PMS problem: exact and approximate. An exact algorithm identifies the motifs always and an approximate algorithm may fail to identify some or all of the motifs. The exact version of PMS problem has been shown to be NP-hard. Exact algorithms proposed in the literature for PMS take time that is exponential in some of the underlying parameters. In this paper we propose a generic technique that can be used to speedup PMS algorithms. Conclusions We present a speedup technique that can be used on any PMS algorithm. We have tested our speedup technique on a number of algorithms. These experimental results show that our speedup technique is indeed very

  14. Long-read ChIA-PET for base-pair-resolution mapping of haplotype-specific chromatin interactions.

    Science.gov (United States)

    Li, Xingwang; Luo, Oscar Junhong; Wang, Ping; Zheng, Meizhen; Wang, Danjuan; Piecuch, Emaly; Zhu, Jacqueline Jufen; Tian, Simon Zhongyuan; Tang, Zhonghui; Li, Guoliang; Ruan, Yijun

    2017-05-01

    Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) is a robust method for capturing genome-wide chromatin interactions. Unlike other 3C-based methods, it includes a chromatin immunoprecipitation (ChIP) step that enriches for interactions mediated by specific target proteins. This unique feature allows ChIA-PET to provide the functional specificity and higher resolution needed to detect chromatin interactions, which chromosome conformation capture (3C)/Hi-C approaches have not achieved. The original ChIA-PET protocol generates short paired-end tags (2 × 20 base pairs (bp)) to detect two genomic loci that are far apart on linear chromosomes but are in spatial proximity in the folded genome. We have improved the original approach by developing long-read ChIA-PET, in which the length of the paired-end tags is increased (up to 2 × 250 bp). The longer PET reads not only improve the tag-mapping efficiency but also increase the probability of covering phased single-nucleotide polymorphisms (SNPs), which allows haplotype-specific chromatin interactions to be identified. Here, we provide the detailed protocol for long-read ChIA-PET that includes cell fixation and lysis, chromatin fragmentation by sonication, ChIP, proximity ligation with a bridge linker, Tn5 tagmentation, PCR amplification and high-throughput sequencing. For a well-trained molecular biologist, it typically takes 6 d from cell harvesting to the completion of library construction, up to a further 36 h for DNA sequencing and <20 h for processing of raw sequencing reads.

  15. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  16. A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein

    International Nuclear Information System (INIS)

    Staiger, D.; Kaulen, H.; Schell, J.

    1989-01-01

    In the chalcone synthase gene of Antirrhinum majus (snapdragon), 150 base pairs of the 5' flanking region contain cis-acting signals for UV light-induced expression. A nuclear factor, designated CG-1, specifically recognizes a hexameric motif with internal dyad symmetry, CACGTG, located within this light-responsive sequence. Binding of CG-1 is influenced by C-methylation of the CpG dinucleotide in the recognition sequence. CG-1 is a factor found in a variety of dicotyledonous plant species including Nicotiana tabacum, A. majus, Petunia hybrida, Arabidopsis thaliana, and Glycine max. CACGTG motifs contained within trans-acting factor recognition sites in various other plant promoters can interact with CG-1. In addition, the binding site of the human adenovirus major late transcription factor USF can compete for CG-1 binding to the chalcone synthase promoter. This suggests an evolutionary conservation of trans-acting factor recognition sites involved in divergent mechanisms of gene control. (author)

  17. Annotating RNA motifs in sequences and alignments.

    Science.gov (United States)

    Gardner, Paul P; Eldai, Hisham

    2015-01-01

    RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Base pairing and miscoding properties of 1,N(6)-ethenoadenine- and 3,N(4)-ethenocytosine-containing RNA oligonucleotides.

    Science.gov (United States)

    Calabretta, Alessandro; Leumann, Christian J

    2013-03-19

    Two RNA phosphoramidites containing the bases 1,N(6)-ethenoadenine (εA) and 3,N(4)-ethenocytosine (εC) were synthesized. These building blocks were incorporated into two 12-mer oligoribonucleotides for evaluation of the base pairing properties of these base lesions by UV melting curve (Tm) and circular dichroism measurements. The Tm data of the resulting duplexes with the etheno modifications opposing all natural bases showed a substantial destabilization compared to the corresponding natural duplexes, confirming their inability to form base pairs. The coding properties of these lesions were further investigated by introducing them into 31-mer oligonucleotides and assessing their ability to serve as templates in primer extension reactions with HIV, AMV, and MMLV reverse transcriptases (RT). Primer extension reactions showed complete arrest of the incorporation process using MMLV RT and AMV RT, while HIV RT preferentially incorporates dAMP opposite εA and dAMP as well as dTMP opposite εC. The properties of these RNA lesions are discussed in the context of its putative biological role.

  19. High-throughput quantification of palladium in water samples by ion pair based-surfactant assisted microextraction.

    Science.gov (United States)

    Yamini, Yadollah; Moradi, Morteza; Tahmasebi, Elham

    2012-05-30

    A novel method for the determination of palladium as a metal ion model was developed by ion pair based surfactant-assisted microextraction (IP-SAME) and inductively coupled plasma-optical detection (ICP-OES). In this methodology, a cationic surfactant was used in extraction process. It has two fundamental functions: (1) the formation of an emulsified phase and (2) the ion pair formation with Pd(II) in the presence of iodide ions and making PdI4(2-) extractable into organic phase (active microextraction). The effective parameters on the extraction recovery such as the types of extraction solvent and the surfactant, surfactant concentration, KI amount and HCl concentration of the sample were investigated and optimized. In the proposed approach, tetradecyl trimethyl ammonium bromide (TTAB) was used as emulsifier and ion pairing agent, and 1-octanol was selected as extraction solvent. Under the optimum conditions, the enhancement factor as large as 146 was obtained. The detection limit for palladium was 0.2 μg L(-1), and the relative standard deviation (RSD) was 4.1% (n=5, C=10.0 μg L(-1)). The proposed method was applied for extraction and determination of palladium in different water samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  1. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  2. Akurasi Algoritma Density Based Spatial Clustering of Application with Noise (DBSCAN danHill Climbing Pada Accumulator Array Invariant Generalized Hough Transform Dalam Menemukan Posisi Kemunculan Motif pada Citra Batik

    Directory of Open Access Journals (Sweden)

    Uray Heri

    2015-11-01

    Full Text Available Penelitianinimembahastentangekstraksi akumulasi voting pada accumulatorarray yang dihasilkan algoritma InvariantGeneralised Hough Transform (GHT untukmenemukan posisi kemunculan motif pada citrabatik yang telah mengalami perubahan skaladan atau rotasi. Proses ekstraksi accumulatorarray dilakukan dengan 4 (empat metode yaituHillClimbingClustering,KombinasiTresholding dan Density Based SpatialClustering of Application with Noise (DBSCAN,Kombinasi Hill Climbing dan DBSCAN sertaKombinasi Tresholding, Hill Climbing danDBSCAN. Untuk setiap metode yang diusulkan,dihitung nilai Precision dan Recall. Precisiondan Recall tertinggi diperoleh oleh KombinasiTresholding, Hill Climbing dan DBSCAN, yaitusebesar 23% untuk precision dan 35% untukrecall.

  3. A novel Bayesian DNA motif comparison method for clustering and retrieval.

    Directory of Open Access Journals (Sweden)

    Naomi Habib

    2008-02-01

    Full Text Available Characterizing the DNA-binding specificities of transcription factors is a key problem in computational biology that has been addressed by multiple algorithms. These usually take as input sequences that are putatively bound by the same factor and output one or more DNA motifs. A common practice is to apply several such algorithms simultaneously to improve coverage at the price of redundancy. In interpreting such results, two tasks are crucial: clustering of redundant motifs, and attributing the motifs to transcription factors by retrieval of similar motifs from previously characterized motif libraries. Both tasks inherently involve motif comparison. Here we present a novel method for comparing and merging motifs, based on Bayesian probabilistic principles. This method takes into account both the similarity in positional nucleotide distributions of the two motifs and their dissimilarity to the background distribution. We demonstrate the use of the new comparison method as a basis for motif clustering and retrieval procedures, and compare it to several commonly used alternatives. Our results show that the new method outperforms other available methods in accuracy and sensitivity. We incorporated the resulting motif clustering and retrieval procedures in a large-scale automated pipeline for analyzing DNA motifs. This pipeline integrates the results of various DNA motif discovery algorithms and automatically merges redundant motifs from multiple training sets into a coherent annotated library of motifs. Application of this pipeline to recent genome-wide transcription factor location data in S. cerevisiae successfully identified DNA motifs in a manner that is as good as semi-automated analysis reported in the literature. Moreover, we show how this analysis elucidates the mechanisms of condition-specific preferences of transcription factors.

  4. Nuclear mass predictions based on Bayesian neural network approach with pairing and shell effects

    Science.gov (United States)

    Niu, Z. M.; Liang, H. Z.

    2018-03-01

    Bayesian neural network (BNN) approach is employed to improve the nuclear mass predictions of various models. It is found that the noise error in the likelihood function plays an important role in the predictive performance of the BNN approach. By including a distribution for the noise error, an appropriate value can be found automatically in the sampling process, which optimizes the nuclear mass predictions. Furthermore, two quantities related to nuclear pairing and shell effects are added to the input layer in addition to the proton and mass numbers. As a result, the theoretical accuracies are significantly improved not only for nuclear masses but also for single-nucleon separation energies. Due to the inclusion of the shell effect, in the unknown region, the BNN approach predicts a similar shell-correction structure to that in the known region, e.g., the predictions of underestimation of nuclear mass around the magic numbers in the relativistic mean-field model. This manifests that better predictive performance can be achieved if more physical features are included in the BNN approach.

  5. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    Science.gov (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  6. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

    Science.gov (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

    2009-01-01

    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  7. Motif signatures of transcribed enhancers

    KAUST Repository

    Kleftogiannis, Dimitrios

    2017-09-14

    In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.

  8. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  9. Discovering Multidimensional Motifs in Physiological Signals for Personalized Healthcare

    Science.gov (United States)

    Balasubramanian, Arvind; Wang, Jun; Prabhakaran, Balakrishnan

    2016-01-01

    Personalized diagnosis and therapy requires monitoring patient activity using various body sensors. Sensor data generated during personalized exercises or tasks may be too specific or inadequate to be evaluated using supervised methods such as classification. We propose multidimensional motif (MDM) discovery as a means for patient activity monitoring, since such motifs can capture repeating patterns across multiple dimensions of the data, and can serve as conformance indicators. Previous studies pertaining to mining MDMs have proposed approaches that lack the capability of concurrently processing multiple dimensions, thus limiting their utility in online scenarios. In this paper, we propose an efficient real-time approach to MDM discovery in body sensor generated time series data for monitoring performance of patients during therapy. We present two alternative models for MDMs based on motif co-occurrences and temporal ordering among motifs across multiple dimensions, with detailed formulation of the concepts proposed. The proposed method uses an efficient hashing based record to enable speedy update and retrieval of motif sets, and identification of MDMs. Performance evaluation using synthetic and real body sensor data in unsupervised motif discovery tasks shows that the approach is effective for (a) concurrent processing of multidimensional time series information suitable for real-time applications, (b) finding unknown naturally occurring patterns with minimal delay, and (c) tracking similarities among repetitions, possibly during therapy sessions. PMID:28191269

  10. Using weakly conserved motifs hidden in secretion signals to identify type-III effectors from bacterial pathogen genomes.

    Directory of Open Access Journals (Sweden)

    Xiaobao Dong

    Full Text Available BACKGROUND: As one of the most important virulence factor types in gram-negative pathogenic bacteria, type-III effectors (TTEs play a crucial role in pathogen-host interactions by directly influencing immune signaling pathways within host cells. Based on the hypothesis that type-III secretion signals may be comprised of some weakly conserved sequence motifs, here we used profile-based amino acid pair information to develop an accurate TTE predictor. RESULTS: For a TTE or non-TTE, we first used a hidden Markov model-based sequence searching method (i.e., HHblits to detect its weakly homologous sequences and extracted the profile-based k-spaced amino acid pair composition (HH-CKSAAP from the N-terminal sequences. In the next step, the feature vector HH-CKSAAP was used to train a linear support vector machine model, which we designate as BEAN (Bacterial Effector ANalyzer. We compared our method with four existing TTE predictors through an independent test set, and our method revealed improved performance. Furthermore, we listed the most predictive amino acid pairs according to their weights in the established classification model. Evolutionary analysis shows that predictive amino acid pairs tend to be more conserved. Some predictive amino acid pairs also show significantly different position distributions between TTEs and non-TTEs. These analyses confirmed that some weakly conserved sequence motifs may play important roles in type-III secretion signals. Finally, we also used BEAN to scan one plant pathogen genome and showed that BEAN can be used for genome-wide TTE identification. The webserver and stand-alone version of BEAN are available at http://protein.cau.edu.cn:8080/bean/.

  11. Trans Hoogsteen/sugar edge base pairing in RNA. Structures, energies, and stabilities from quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Mládek, Arnošt; Sharma, P.; Mitra, A.; Bhattacharyya, D.; Šponer, Jiří; Šponer, Judit E.

    2009-01-01

    Roč. 113, č. 6 (2009), s. 1743-1755 ISSN 1520-6106 R&D Projects: GA AV ČR(CZ) IAA400550701; GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) 1QS500040581; GA MŠk(CZ) LC06030 Grant - others:GA MŠk(CZ) LC512 Program:LC Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : quantum chemical calculations * base pairing * RNA Subject RIV: BO - Biophysics Impact factor: 3.471, year: 2009

  12. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  13. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...... of their Danish host families. Based on their migratory status as au pairs, these young migrants must therefore negotiate the different moral and contractual rights and obligations that characterize the local and transnational family ties in which they are engaged. This study of Filipina au pair migration through...... pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...

  15. Trypanosoma cruzi I genotypes in different geographic regions and transmission cycles based on a microsatellite motif of the intergenic spacer of spliced leader genes✯

    Science.gov (United States)

    Cura, Carolina I.; Mejía-Jaramillo, Ana M.; Duffy, Tomás; Burgos, Juan M.; Rodriguero, Marcela; Cardinal, Marta V.; Kjos, Sonia; Gurgel-Gonçalves, Rodrigo; Blanchet, Denis; De Pablos, Luis M.; Tomasini, Nicolás; Silva, Alex Da; Russomando, Graciela; Cuba Cuba, Cesar A.; Aznar, Christine; Abate, Teresa; Levin, Mariano J.; Osuna, Antonio; Gürtler, Ricardo E.; Diosque, Patricio; Solari, Aldo; Triana-Chávez, Omar; Schijman, Alejandro G.

    2011-01-01

    The intergenic region of spliced-leader (SL-IR) genes from 105 Trypanosoma cruzi I (Tc I) infected biological samples, culture isolates and stocks from 11 endemic countries, from Argentina to the USA were characterised, allowing identification of 76 genotypes with 54 polymorphic sites from 123 aligned sequences. On the basis of the microsatellite motif proposed by Herrera et al. (2007) to define four haplotypes in Colombia, we could classify these genotypes into four distinct Tc I SL-IR groups, three corresponding to the former haplotypes Ia (11 genotypes), Ib (11 genotypes) and Id (35 genotypes); and one novel group, Ie (19 genotypes). Genotypes harboring the Tc Ic motif were not detected in our study. Tc Ia was associated with domestic cycles in southern and northern South America and sylvatic cycles in Central and North America. Tc Ib was found in all transmission cycles from Colombia. Tc Id was identified in all transmission cycles from Argentina and Colombia, including Chagas cardiomyopathy patients, sylvatic Brazilian samples and human cases from French Guiana, Panama and Venezuela. Tc Ie gathered five samples from domestic Triatoma infestans from northern Argentina, nine samples from wild Mepraia spinolai and Mepraia gajardoi and two chagasic patients from Chile and one from a Bolivian patient with chagasic reactivation. Mixed infections by Tc Ia + Tc Id, Tc Ia + Tc Ie and Tc Id + Tc Ie were detected in vector faeces and isolates from human and vector samples. In addition, Tc Ia and Tc Id were identified in different tissues from a heart transplanted Chagas cardiomyopathy patient with reactivation, denoting histotropism. Trypanosoma cruzi I SL-IR genotypes from parasites infecting Triatoma gerstaeckeri and Didelphis virginiana from USA, T. infestans from Paraguay, Rhodnius nasutus and Rhodnius neglectus from Brazil and M. spinolai and M. gajardoi from Chile are to our knowledge described for the first time. PMID:20670628

  16. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    Science.gov (United States)

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  17. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  18. PISMA: A Visual Representation of Motif Distribution in DNA Sequences

    Directory of Open Access Journals (Sweden)

    Rogelio Alcántara-Silva

    2017-03-01

    Full Text Available Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf .

  19. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  20. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  1. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  2. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  3. Unravelling daily human mobility motifs

    OpenAIRE

    Schneider, Christian M.; Belik, Vitaly; Couronné, Thomas; Smoreda, Zbigniew; González, Marta C.

    2013-01-01

    Human mobility is differentiated by time scales. While the mechanism for long time scales has been studied, the underlying mechanism on the daily scale is still unrevealed. Here, we uncover the mechanism responsible for the daily mobility patterns by analysing the temporal and spatial trajectories of thousands of persons as individual networks. Using the concept of motifs from network theory, we find only 17 unique networks are present in daily mobility and they follow simple rules. These net...

  4. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  5. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  6. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  7. Event Networks and the Identification of Crime Pattern Motifs.

    Directory of Open Access Journals (Sweden)

    Toby Davies

    Full Text Available In this paper we demonstrate the use of network analysis to characterise patterns of clustering in spatio-temporal events. Such clustering is of both theoretical and practical importance in the study of crime, and forms the basis for a number of preventative strategies. However, existing analytical methods show only that clustering is present in data, while offering little insight into the nature of the patterns present. Here, we show how the classification of pairs of events as close in space and time can be used to define a network, thereby generalising previous approaches. The application of graph-theoretic techniques to these networks can then offer significantly deeper insight into the structure of the data than previously possible. In particular, we focus on the identification of network motifs, which have clear interpretation in terms of spatio-temporal behaviour. Statistical analysis is complicated by the nature of the underlying data, and we provide a method by which appropriate randomised graphs can be generated. Two datasets are used as case studies: maritime piracy at the global scale, and residential burglary in an urban area. In both cases, the same significant 3-vertex motif is found; this result suggests that incidents tend to occur not just in pairs, but in fact in larger groups within a restricted spatio-temporal domain. In the 4-vertex case, different motifs are found to be significant in each case, suggesting that this technique is capable of discriminating between clustering patterns at a finer granularity than previously possible.

  8. Event Networks and the Identification of Crime Pattern Motifs

    Science.gov (United States)

    2015-01-01

    In this paper we demonstrate the use of network analysis to characterise patterns of clustering in spatio-temporal events. Such clustering is of both theoretical and practical importance in the study of crime, and forms the basis for a number of preventative strategies. However, existing analytical methods show only that clustering is present in data, while offering little insight into the nature of the patterns present. Here, we show how the classification of pairs of events as close in space and time can be used to define a network, thereby generalising previous approaches. The application of graph-theoretic techniques to these networks can then offer significantly deeper insight into the structure of the data than previously possible. In particular, we focus on the identification of network motifs, which have clear interpretation in terms of spatio-temporal behaviour. Statistical analysis is complicated by the nature of the underlying data, and we provide a method by which appropriate randomised graphs can be generated. Two datasets are used as case studies: maritime piracy at the global scale, and residential burglary in an urban area. In both cases, the same significant 3-vertex motif is found; this result suggests that incidents tend to occur not just in pairs, but in fact in larger groups within a restricted spatio-temporal domain. In the 4-vertex case, different motifs are found to be significant in each case, suggesting that this technique is capable of discriminating between clustering patterns at a finer granularity than previously possible. PMID:26605544

  9. CMD: A Database to Store the Bonding States of Cysteine Motifs with Secondary Structures

    Directory of Open Access Journals (Sweden)

    Hamed Bostan

    2012-01-01

    Full Text Available Computational approaches to the disulphide bonding state and its connectivity pattern prediction are based on various descriptors. One descriptor is the amino acid sequence motifs flanking the cysteine residue motifs. Despite the existence of disulphide bonding information in many databases and applications, there is no complete reference and motif query available at the moment. Cysteine motif database (CMD is the first online resource that stores all cysteine residues, their flanking motifs with their secondary structure, and propensity values assignment derived from the laboratory data. We extracted more than 3 million cysteine motifs from PDB and UniProt data, annotated with secondary structure assignment, propensity value assignment, and frequency of occurrence and coefficiency of their bonding status. Removal of redundancies generated 15875 unique flanking motifs that are always bonded and 41577 unique patterns that are always nonbonded. Queries are based on the protein ID, FASTA sequence, sequence motif, and secondary structure individually or in batch format using the provided APIs that allow remote users to query our database via third party software and/or high throughput screening/querying. The CMD offers extensive information about the bonded, free cysteine residues, and their motifs that allows in-depth characterization of the sequence motif composition.

  10. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  11. Structure and reactivity of an Al/P-based frustrated Lewis pair bearing relatively small substituents at aluminium.

    Science.gov (United States)

    Pleschka, Damian; Layh, Marcus; Rogel, Friedhelm; Uhl, Werner

    2017-08-28

    Reaction of Mes 2 P─C≡C─Ph (Mes = mesityl) with dineopentylaluminium hydride afforded by hydroalumination a geminal Al/P-based frustrated Lewis pair (FLP; 4 ). Its steric shielding is relatively low, and its reactivity in various secondary reactions is less hindered by steric repulsion than observed for related compounds having bulkier groups attached to aluminium. FLP 4 yielded adducts with Me 3 C─NCO or benzaldehyde via the formation of Al-O and P-C bonds. Trimethylsilyl azide reacted with 4 under surprisingly mild conditions to afford a nitrene complex by spontaneous N 2 elimination below room temperature. A carbodiimide molecule was coordinated via one of the C=N bonds to form a five-membered AlCPNC heterocycle with an intact C=N bond in an exocyclic position. A very large molecule was obtained by the reaction of two equivalents of 4 with a bifunctional methylene-bridged phenylene isocyanate precursor.This article is part of the themed issue 'Frustrated Lewis pair chemistry'. © 2017 The Author(s).

  12. Multifactor-dimensionality reduction versus family-based association tests in detecting susceptibility loci in discordant sib-pair studies

    Science.gov (United States)

    Meng, Yan; Ma, Qianli; Yu, Yi; Farrell, John; Farrer, Lindsay A; Wilcox, Marsha A

    2005-01-01

    Complex diseases are generally thought to be under the influence of multiple, and possibly interacting, genes. Many association methods have been developed to identify susceptibility genes assuming a single-gene disease model, referred to as single-locus methods. Multilocus methods consider joint effects of multiple genes and environmental factors. One commonly used method for family-based association analysis is implemented in FBAT. The multifactor-dimensionality reduction method (MDR) is a multilocus method, which identifies multiple genetic loci associated with the occurrence of complex disease. Many studies of late onset complex diseases employ a discordant sib pairs design. We compared the FBAT and MDR in their ability to detect susceptibility loci using a discordant sib-pair dataset generated from the simulated data made available to participants in the Genetic Analysis Workshop 14. Using FBAT, we were able to identify the effect of one susceptibility locus. However, the finding was not statistically significant. We were not able to detect any of the interactions using this method. This is probably because the FBAT test is designed to find loci with major effects, not interactions. Using MDR, the best result we obtained identified two interactions. However, neither of these reached a level of statistical significance. This is mainly due to the heterogeneity of the disease trait and noise in the data. PMID:16451606

  13. Multifactor-dimensionality reduction versus family-based association tests in detecting susceptibility loci in discordant sib-pair studies.

    Science.gov (United States)

    Meng, Yan; Ma, Qianli; Yu, Yi; Farrell, John; Farrer, Lindsay A; Wilcox, Marsha A

    2005-12-30

    Complex diseases are generally thought to be under the influence of multiple, and possibly interacting, genes. Many association methods have been developed to identify susceptibility genes assuming a single-gene disease model, referred to as single-locus methods. Multilocus methods consider joint effects of multiple genes and environmental factors. One commonly used method for family-based association analysis is implemented in FBAT. The multifactor-dimensionality reduction method (MDR) is a multilocus method, which identifies multiple genetic loci associated with the occurrence of complex disease. Many studies of late onset complex diseases employ a discordant sib pairs design. We compared the FBAT and MDR in their ability to detect susceptibility loci using a discordant sib-pair dataset generated from the simulated data made available to participants in the Genetic Analysis Workshop 14. Using FBAT, we were able to identify the effect of one susceptibility locus. However, the finding was not statistically significant. We were not able to detect any of the interactions using this method. This is probably because the FBAT test is designed to find loci with major effects, not interactions. Using MDR, the best result we obtained identified two interactions. However, neither of these reached a level of statistical significance. This is mainly due to the heterogeneity of the disease trait and noise in the data.

  14. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  15. Demonstration of polarization sensitivity of emulsion-based pair conversion telescope for cosmic gamma-ray polarimetry

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, Keita, E-mail: ozaki@radix.h.kobe-u.ac.jp [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan); Takahashi, Satoru, E-mail: satoru@radix.h.kobe-u.ac.jp [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8602 (Japan); Aoki, Shigeki; Kamada, Keiki; Kaneyama, Taichi; Nakagawa, Ryo; Rokujo, Hiroki [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan)

    2016-10-11

    Linear polarization of high-energy gamma-rays (10MeV–100 GeV) can be detected by measuring the azimuthal angle of electron–positron pairs and observing the modulation of the azimuthal distribution. To demonstrate the gamma-ray polarization sensitivity of emulsion, we conducted a test using a polarized gamma-ray beam (0.8–2.4 GeV) at SPring-8/LEPS. Emulsion tracks were reconstructed using scanning data, and gamma-ray events were selected automatically. Using an optical microscope, out of the 2381 gamma-ray conversions that were observed, 1372 remained after event selection, on the azimuthal angle distribution of which we measured the modulation. From the distribution of the azimuthal angles of the selected events, a modulation factor of 0.21+0.11−0.09 was measured, from which the detection of a non-zero modulation was established with a significance of 3.06σ. This attractive polarimeter will be applied to the GRAINE project, a balloon-borne experiment that observes 10–100 GeV cosmic gamma-rays with an emulsion-based pair conversion telescope.

  16. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  17. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  18. Non-linguistic learning and aphasia: evidence from a paired associate and feedback-based task.

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory. Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success. In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Electron pairing without superconductivity

    Science.gov (United States)

    Levy, Jeremy

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

  20. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  1. Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs

    KAUST Repository

    Arold, Stefan T.

    2016-01-25

    Leucine-aspartic acid (LD) motifs are short helical protein-protein interaction motifs involved in cell motility, survival and communication. LD motif interactions are also implicated in cancer metastasis and are targeted by several viruses. LD motifs are notoriously difficult to detect because sequence pattern searches lead to an excessively high number of false positives. Hence, despite 20 years of research, only six LD motif–containing proteins are known in humans, three of which are close homologues of the paxillin family. To enable the proteome-wide discovery of LD motifs, we developed LD Motif Finder (LDMF), a web tool based on machine learning that combines sequence information with structural predictions to detect LD motifs with high accuracy. LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.

  2. A Stereo Pair Based Method for Contactless Evaluation of the Human Breathing Pattern

    Directory of Open Access Journals (Sweden)

    V. S. Gnatiuk

    2015-01-01

    Full Text Available The development of contactless monitoring methods of human vital signs is an important goal for modern medicine. The particular relevance of this issue appears with the control of the patient at home on their own, for example, to estimate the parameters of breathing during sleep, quality assessment and identification of various kinds of sleep disorders, such as, for example, sleep apnea disorder (a condition, which is characterized by the cessation of pulmonary ventilation more than for 10 seconds and fall of blood oxygen saturation.In this article we have implemented and tested an algorithm for non-contact monitoring of breathing pattern by two entrenched webcams aimed at the person. The algorithm is based on using the methods of computer vision and processing of video sequences.Authors pay particular attention to disparity map construction approaches and improving the signal / noise ratio by a combination of known functions comparing the intensity of pixels: AD - a function of absolute differences, and Census function, comparing bit strings of investigated image regions.An important role in the noise minimization plays a simple, but effective assumption for aggregation, the gist of which is that pixels having similar intensity belong to the same structures in the image, and hence have a similar disparity. The variability of input parameters of the method and the ability to adjust the number of iterations provide accurate disparity maps for the input image of almost any quality (testing was conducted for webcams CBR CW 833M.The main result of this approach is the breathing profile based on the reconstructed depth maps, reflecting the respiration rate of the person under examination and presenting data on the amplitude variations of his chest.The main difference of the proposed method from other publications is a high accuracy and the breath profile calculation in real-time. It was achieved through OpenCL technology and parallel computations

  3. A novel 3670-base pair mitochondrial DNA deletion resulting in multi-systemic manifestations in a child.

    Science.gov (United States)

    Liu, Hsin-Ming; Tsai, Li-Ping; Chien, Yin-Hsiu; Wu, Jia-Feng; Weng, Wen-Chin; Peng, Shinn-Forng; Wu, En-Ting; Huang, Pei-Hsin; Lee, Wang-Tso; Tsai, I-Jun; Hwu, Wuh-Liang; Lee, Ni-Chung

    2012-08-01

    Mitochondrial DNA (mtDNA) deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility) that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297) was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected. Copyright © 2012. Published by Elsevier B.V.

  4. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  5. Phyloproteomic Analysis of 11780 Six-Residue-Long Motifs Occurrences

    Directory of Open Access Journals (Sweden)

    O. V. Galzitskaya

    2015-01-01

    Full Text Available How is it possible to find good traits for phylogenetic reconstructions? Here, we present a new phyloproteomic criterion that is an occurrence of simple motifs which can be imprints of evolution history. We studied the occurrences of 11780 six-residue-long motifs consisting of two randomly located amino acids in 97 eukaryotic and 25 bacterial proteomes. For all eukaryotic proteomes, with the exception of the Amoebozoa, Stramenopiles, and Diplomonadida kingdoms, the number of proteins containing the motifs from the first group (one of the two amino acids occurs once at the terminal position made about 20%; in the case of motifs from the second (one of two amino acids occurs one time within the pattern and third (the two amino acids occur randomly groups, 30% and 50%, respectively. For bacterial proteomes, this relationship was 10%, 27%, and 63%, respectively. The matrices of correlation coefficients between numbers of proteins where a motif from the set of 11780 motifs appears at least once in 9 kingdoms and 5 phyla of bacteria were calculated. Among the correlation coefficients for eukaryotic proteomes, the correlation between the animal and fungi kingdoms (0.62 is higher than between fungi and plants (0.54. Our study provides support that animals and fungi are sibling kingdoms. Comparison of the frequencies of six-residue-long motifs in different proteomes allows obtaining phylogenetic relationships based on similarities between these frequencies: the Diplomonadida kingdoms are more close to Bacteria than to Eukaryota; Stramenopiles and Amoebozoa are more close to each other than to other kingdoms of Eukaryota.

  6. Detection of Cytosolic Shigella flexneri via a C-Terminal Triple-Arginine Motif of GBP1 Inhibits Actin-Based Motility

    Directory of Open Access Journals (Sweden)

    Anthony S. Piro

    2017-12-01

    Full Text Available Dynamin-like guanylate binding proteins (GBPs are gamma interferon (IFN-γ-inducible host defense proteins that can associate with cytosol-invading bacterial pathogens. Mouse GBPs promote the lytic destruction of targeted bacteria in the host cell cytosol, but the antimicrobial function of human GBPs and the mechanism by which these proteins associate with cytosolic bacteria are poorly understood. Here, we demonstrate that human GBP1 is unique among the seven human GBP paralogs in its ability to associate with at least two cytosolic Gram-negative bacteria, Burkholderia thailandensis and Shigella flexneri. Rough lipopolysaccharide (LPS mutants of S. flexneri colocalize with GBP1 less frequently than wild-type S. flexneri does, suggesting that host recognition of O antigen promotes GBP1 targeting to Gram-negative bacteria. The targeting of GBP1 to cytosolic bacteria, via a unique triple-arginine motif present in its C terminus, promotes the corecruitment of four additional GBP paralogs (GBP2, GBP3, GBP4, and GBP6. GBP1-decorated Shigella organisms replicate but fail to form actin tails, leading to their intracellular aggregation. Consequentially, the wild type but not the triple-arginine GBP1 mutant restricts S. flexneri cell-to-cell spread. Furthermore, human-adapted S. flexneri, through the action of one its secreted effectors, IpaH9.8, is more resistant to GBP1 targeting than the non-human-adapted bacillus B. thailandensis. These studies reveal that human GBP1 uniquely functions as an intracellular “glue trap,” inhibiting the cytosolic movement of normally actin-propelled Gram-negative bacteria. In response to this powerful human defense program, S. flexneri has evolved an effective counterdefense to restrict GBP1 recruitment.

  7. Discovering sequence motifs in quantitative and qualitative pepetide data

    DEFF Research Database (Denmark)

    Andreatta, Massimo

    the number of experimental tests needed to identify new epitopes. Taken as a whole, this thesis provides a valuable series of algorithms and tools for the analysis of peptide data, both from the point of view of characterization of sequence motifs and the prediction of protein-peptide interactions....... and interpret such data. The first paper in this thesis presents a new, publicly available method based on artificial neural networks that allows custom analysis of quantitative peptide data. The online NNAlign web-server provides a simple yet powerful tool for the discovery of sequence motifs in large...... with the presence of multiple motifs, due to the experimental setup or the actual poly-specificity of the receptor, in peptide data. A new algorithm, based on Gibbs sampling, identifies multiple specificities by performing two tasks simultaneously: alignment and clustering of peptide data. The method, available...

  8. Anion induced conformational preference of Cα NN motif residues in functional proteins.

    Science.gov (United States)

    Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb

    2017-12-01

    Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.

  9. Mechanism of thermal renaturation and hybridization of nucleic acids: Kramers' process and universality in Watson-Crick base pairing.

    Science.gov (United States)

    Sikorav, Jean-Louis; Orland, Henri; Braslau, Alan

    2009-03-26

    Renaturation and hybridization reactions lead to the pairing of complementary single-stranded nucleic acids. We present here a theoretical investigation of the mechanism of these reactions in vitro under thermal conditions (dilute solutions of single-stranded chains, in the presence of molar concentrations of monovalent salts and at elevated temperatures). The mechanism follows a Kramers' process, whereby the complementary chains overcome a potential barrier through Brownian motion. The barrier originates from a single rate-limiting nucleation event in which the first complementary base pairs are formed. The reaction then proceeds through a fast growth of the double helix. For the DNA of bacteriophages T7, T4, and phiX174, as well as for Escherichia coli DNA, the bimolecular rate k2 of the reaction increases as a power law of the average degree of polymerization of the reacting single-strands: k2 is proportional to alpha. This relationship holds for 100 < or = 50,000 with an experimentally determined exponent alpha = 0.51 +/- 0.01. The length dependence results from a thermodynamic excluded-volume effect. The reacting single-stranded chains are predicted to be in universal good solvent conditions, and the scaling law is determined by the relevant equilibrium monomer contact probability. The value theoretically predicted for the exponent is alpha = 1 - nutheta2, where nu is Flory's swelling exponent (nu approximately equal 0.588), and theta2 is a critical exponent introduced by des Cloizeaux (theta2 approximately equal 0.82), yielding alpha = 0.52 +/- 0.01, in agreement with the experimental results.

  10. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    IAS Admin

    The fundamental concept of Lewis acid–base interactions have played a substantial role in the progress of chemistry and enriched its understanding, most significantly in the evolution of coordination compounds. In the last 7 years, the chemistry of Lewis Pairs (i.e., acids and bases) has witnessed a different.

  11. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash

    2017-01-01

    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  12. Cofunctional Subpathways Were Regulated by Transcription Factor with Common Motif, Common Family, or Common Tissue

    Directory of Open Access Journals (Sweden)

    Fei Su

    2015-01-01

    Full Text Available Dissecting the characteristics of the transcription factor (TF regulatory subpathway is helpful for understanding the TF underlying regulatory function in complex biological systems. To gain insight into the influence of TFs on their regulatory subpathways, we constructed a global TF-subpathways network (TSN to analyze systematically the regulatory effect of common-motif, common-family, or common-tissue TFs on subpathways. We performed cluster analysis to show that the common-motif, common-family, or common-tissue TFs that regulated the same pathway classes tended to cluster together and contribute to the same biological function that led to disease initiation and progression. We analyzed the Jaccard coefficient to show that the functional consistency of subpathways regulated by the TF pairs with common motif, common family, or common tissue was significantly greater than the random TF pairs at the subpathway level, pathway level, and pathway class level. For example, HNF4A (hepatocyte nuclear factor 4, alpha and NR1I3 (nuclear receptor subfamily 1, group I, member 3 were a pair of TFs with common motif, common family, and common tissue. They were involved in drug metabolism pathways and were liver-specific factors required for physiological transcription. In short, we inferred that the cofunctional subpathways were regulated by common-motif, common-family, or common-tissue TFs.

  13. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality.

    Science.gov (United States)

    Renapurkar, Rahul D; Primak, Andrew; Azok, Joseph; Lempel, Jason; Tandon, Yasmeen; Bullen, Jennifer; Dong, Frank; Karim, Wadih; Graham, Ruffin

    2017-08-01

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair ("switched" cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the "switched" cohort was 1.3 mGy (95% CI 1.2, 1.4; p quality. • Attenuation-based kV pair selection in dual energy examination is feasible. • It can offer radiation dose reduction to approximately 50% of patients. • Approximate 15% reduction in radiation dose was achieved using this technique. • The image quality is not compromised by use of attenuation-based kV pair selection.

  14. Fitness for synchronization of network motifs

    DEFF Research Database (Denmark)

    Vega, Y.M.; Vázquez-Prada, M.; Pacheco, A.F.

    2004-01-01

    We study the synchronization of Kuramoto's oscillators in small parts of networks known as motifs. We first report on the system dynamics for the case of a scale-free network and show the existence of a non-trivial critical point. We compute the probability that network motifs synchronize, and fi...... that the fitness for synchronization correlates well with motifs interconnectedness and structural complexity. Possible implications for present debates about network evolution in biological and other systems are discussed....

  15. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  16. Hubs with network motifs organize modularity dynamically in the protein-protein interaction network of yeast.

    Science.gov (United States)

    Jin, Guangxu; Zhang, Shihua; Zhang, Xiang-Sun; Chen, Luonan

    2007-11-21

    It has been recognized that modular organization pervades biological complexity. Based on network analysis, 'party hubs' and 'date hubs' were proposed to understand the basic principle of module organization of biomolecular networks. However, recent study on hubs has suggested that there is no clear evidence for coexistence of 'party hubs' and 'date hubs'. Thus, an open question has been raised as to whether or not 'party hubs' and 'date hubs' truly exist in yeast interactome. In contrast to previous studies focusing on the partners of a hub or the individual proteins around the hub, our work aims to study the network motifs of a hub or interactions among individual proteins including the hub and its neighbors. Depending on the relationship between a hub's network motifs and protein complexes, we define two new types of hubs, 'motif party hubs' and 'motif date hubs', which have the same characteristics as the original 'party hubs' and 'date hubs' respectively. The network motifs of these two types of hubs display significantly different features in spatial distribution (or cellular localizations), co-expression in microarray data, controlling topological structure of network, and organizing modularity. By virtue of network motifs, we basically solved the open question about 'party hubs' and 'date hubs' which was raised by previous studies. Specifically, at the level of network motifs instead of individual proteins, we found two types of hubs, motif party hubs (mPHs) and motif date hubs (mDHs), whose network motifs display distinct characteristics on biological functions. In addition, in this paper we studied network motifs from a different viewpoint. That is, we show that a network motif should not be merely considered as an interaction pattern but be considered as an essential function unit in organizing modules of networks.

  17. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  19. i-Clamp phenoxazine for the fine tuning of DNA i-motif stability

    Science.gov (United States)

    Tsvetkov, Vladimir B; Zatsepin, Timofei S; Belyaev, Evgeny S; Kostyukevich, Yury I; Shpakovski, George V; Podgorsky, Victor V; Pozmogova, Galina E; Varizhuk, Anna M

    2018-01-01

    Abstract Non-canonical DNA structures are widely used for regulation of gene expression, in DNA nanotechnology and for the development of new DNA-based sensors. I-motifs (iMs) are two intercalated parallel duplexes that are held together by hemiprotonated C-C base pairs. Previously, iMs were used as an accurate sensor for intracellular pH measurements. However, iM stability is moderate, which in turn limits its in vivo applications. Here, we report the rational design of a new substituted phenoxazine 2′-deoxynucleotide (i-clamp) for iM stabilization. This residue contains a C8-aminopropyl tether that interacts with the phosphate group within the neighboring chain without compromising base pairing. We studied the influence of i-clamp on pH-dependent stability for intra- and intermolecular iM structures and found the optimal positions for modification. Two i-clamps on opposite strands provide thermal stabilization up to 10–11°C at a pH of 5.8. Thus, we developed a new modification that shows significant iM-stabilizing effect both at strongly and mildly acidic pH and increases iM transition pH values. i-Clamp can be used for tuning iM-based pH probes or assembling extra stable iM structures for various applications. PMID:29474573

  20. WordSpy: identifying transcription factor binding motifs by building a dictionary and learning a grammar.

    Science.gov (United States)

    Wang, Guandong; Yu, Taotao; Zhang, Weixiong

    2005-07-01

    Transcription factor (TF) binding sites or motifs (TFBMs) are functional cis-regulatory DNA sequences that play an essential role in gene transcriptional regulation. Although many experimental and computational methods have been developed, finding TFBMs remains a challenging problem. We propose and develop a novel dictionary based motif finding algorithm, which we call WordSpy. One significant feature of WordSpy is the combination of a word counting method and a statistical model which consists of a dictionary of motifs and a grammar specifying their usage. The algorithm is suitable for genome-wide motif finding; it is capable of discovering hundreds of motifs from a large set of promoters in a single run. We further enhance WordSpy by applying gene expression information to separate true TFBMs from spurious ones, and by incorporating negative sequences to identify discriminative motifs. In addition, we also use randomly selected promoters from the genome to evaluate the significance of the discovered motifs. The output from WordSpy consists of an ordered list of putative motifs and a set of regulatory sequences with motif binding sites highlighted. The web server of WordSpy is available at http://cic.cs.wustl.edu/wordspy.

  1. A cost-aggregating integer linear program for motif finding

    Science.gov (United States)

    Kingsford, Carl; Zaslavsky, Elena; Singh, Mona

    2011-01-01

    In the motif finding problem one seeks a set of mutually similar substrings within a collection of biological sequences. This is an important and widely-studied problem, as such shared motifs in DNA often correspond to regulatory elements. We study a combinatorial framework where the goal is to find substrings of a given length such that the sum of their pairwise distances is minimized. We describe a novel integer linear program for the problem, which uses the fact that distances between substrings come from a limited set of possibilities allowing for aggregate consideration of sequence position pairs with the same distances. We show how to tighten its linear programming relaxation by adding an exponential set of constraints and give an efficient separation algorithm that can find violated constraints, thereby showing that the tightened linear program can still be solved in polynomial time. We apply our approach to find optimal solutions for the motif finding problem and show that it is effective in practice in uncovering known transcription factor binding sites. PMID:22081765

  2. Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

    Science.gov (United States)

    Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

    1998-03-03

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

  3. Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

    Science.gov (United States)

    Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

    1998-01-01

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

  4. A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data.

    Science.gov (United States)

    Tran, Ngoc Tam L; Huang, Chun-Hsi

    2014-02-20

    ChIP-Seq (chromatin immunoprecipitation sequencing) has provided the advantage for finding motifs as ChIP-Seq experiments narrow down the motif finding to binding site locations. Recent motif finding tools facilitate the motif detection by providing user-friendly Web interface. In this work, we reviewed nine motif finding Web tools that are capable for detecting binding site motifs in ChIP-Seq data. We showed each motif finding Web tool has its own advantages for detecting motifs that other tools may not discover. We recommended the users to use multiple motif finding Web tools that implement different algorithms for obtaining significant motifs, overlapping resemble motifs, and non-overlapping motifs. Finally, we provided our suggestions for future development of motif finding Web tool that better assists researchers for finding motifs in ChIP-Seq data.

  5. Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise

    Science.gov (United States)

    Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San

    2018-01-01

    Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…

  6. Modulation of Interparticle Distance in Discrete Gold Nanoparticle Dimers and Trimers by DNA Single-Base Pairing.

    Science.gov (United States)

    Akiyama, Yoshitsugu; Shikagawa, Hiroto; Kanayama, Naoki; Takarada, Tohru; Maeda, Mizuo

    2015-07-01

    Self-assembled structures of metallic nanoparticles with dynamically changeable interparticle distance hold promise for the regulation of collective physical properties. This paper describes gold nanoparticle dimers and trimers that exhibit spontaneous and reversible changes in interparticle distance. To exploit this property, a gold nanoparticle is modified with precisely one long DNA strand and approximately five short DNA strands. The long DNA serves to align the nanoparticles on a template DNA via hybridization, while the short DNAs function to induce the interparticle distance changes. The obtained dimer and trimer are characterized with gel electrophoresis, dynamic light scattering measurements, and transmission electron microscopy (TEM). When the complementary short DNA is added to form the fully matched duplexes on the particle surface in the presence of MgCl2 , spontaneous reduction of the interparticle distance is observed with TEM and cryo-electron microscopy. By contrast, when the terminal-mismatched DNA is added, no structural change occurs under the same conditions. Therefore, the single base pairing/unpairing at the outermost surface of the nanoparticle impacts the interparticle distance. This unique feature could be applied to the regulation of structures and properties of various DNA-functionalized nanoparticle assemblies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Whole genome sequencing reveals a 7 base-pair deletion in DMD exon 42 in a dog with muscular dystrophy.

    Science.gov (United States)

    Nghiem, Peter P; Bello, Luca; Balog-Alvarez, Cindy; López, Sara Mata; Bettis, Amanda; Barnett, Heather; Hernandez, Briana; Schatzberg, Scott J; Piercy, Richard J; Kornegay, Joe N

    2017-04-01

    Dystrophin is a key cytoskeletal protein coded by the Duchenne muscular dystrophy (DMD) gene located on the X-chromosome. Truncating mutations in the DMD gene cause loss of dystrophin and the classical DMD clinical syndrome. Spontaneous DMD gene mutations and associated phenotypes occur in several other species. The mdx mouse model and the golden retriever muscular dystrophy (GRMD) canine model have been used extensively to study DMD disease pathogenesis and show efficacy and side effects of putative treatments. Certain DMD gene mutations in high-risk, the so-called hot spot areas can be particularly helpful in modeling molecular therapies. Identification of specific mutations has been greatly enhanced by new genomic methods. Whole genome, next generation sequencing (WGS) has been recently used to define DMD patient mutations, but has not been used in dystrophic dogs. A dystrophin-deficient Cavalier King Charles Spaniel (CKCS) dog was evaluated at the functional, histopathological, biochemical, and molecular level. The affected dog's phenotype was compared to the previously reported canine dystrophinopathies. WGS was then used to detect a 7 base pair deletion in DMD exon 42 (c.6051-6057delTCTCAAT mRNA), predicting a frameshift in gene transcription and truncation of dystrophin protein translation. The deletion was confirmed with conventional PCR and Sanger sequencing. This mutation is in a secondary DMD gene hotspot area distinct from the one identified earlier at the 5' donor splice site of intron 50 in the CKCS breed.

  8. Isolation breeds naivety: island living robs Australian varanid lizards of toad-toxin immunity via four-base-pair mutation.

    Science.gov (United States)

    Ujvari, Beata; Mun, Hee-chang; Conigrave, Arthur D; Bray, Alessandra; Osterkamp, Jens; Halling, Petter; Madsen, Thomas

    2013-01-01

    Since their introduction to the toad-free Australian continent cane toads (Bufo marinus) have caused a dramatic increase in naïve varanid mortality when these large lizards attempt to feed on this toxic amphibian. In contrast Asian-African varanids, which have coevolved with toads, are resistant to toad toxin. Toad toxins, such as Bufalin target the H1-H2 domain of the α(1) subunit of the sodium-potassium-ATPase enzyme. Sequencing of this domain revealed identical nucleotide sequences in four Asian as well as in three African varanids, and identical sequences in all 11 Australian varanids. However, compared to the Asian-African varanids, the Australian varanids showed four-base-pair substitutions, resulting in the alteration in three of the 12 amino acids representing the H1-H2 domain. The phenotypic effect of the substitutions was investigated in human embryonic kidney (HEK) 293 cells stably transfected with the Australian and the Asian-African H1-H2 domains. The transfections resulted in an approximate 3000-fold reduction in resistance to Bufalin in the Australian HEK293 cells compared to the Asian-African HEK293 cells, demonstrating the critical role of this minor mutation in providing Bufalin resistance. Our study hence presents a clear link between genotype and phenotype, a critical step in understanding the evolution of phenotypic diversity. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  9. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang

    2018-02-01

    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  10. 19-base pair deletion polymorphism of the dihydrofolate reductase (DHFR gene: maternal risk of Down syndrome and folate metabolism

    Directory of Open Access Journals (Sweden)

    Cristiani Cortez Mendes

    Full Text Available CONTEXT AND OBJECTIVE: Polymorphisms in genes involved in folate metabolism may modulate the maternal risk of Down syndrome (DS. This study evaluated the influence of a 19-base pair (bp deletion polymorphism in intron-1 of the dihydrofolate reductase (DHFR gene on the maternal risk of DS, and investigated the association between this polymorphism and variations in the concentrations of serum folate and plasma homocysteine (Hcy and plasma methylmalonic acid (MMA. DESIGN AND SETTING: Analytical cross-sectional study carried out at Faculdade de Medicina de São José do Rio Preto (Famerp. METHODS: 105 mothers of individuals with free trisomy of chromosome 21, and 184 control mothers were evaluated. Molecular analysis on the polymorphism was performed using the polymerase chain reaction (PCR through differences in the sizes of fragments. Folate was quantified by means of chemiluminescence, and Hcy and MMA by means of liquid chromatography and sequential mass spectrometry. RESULTS: There was no difference between the groups in relation to allele and genotype frequencies (P = 0.44; P = 0.69, respectively. The folate, Hcy and MMA concentrations did not differ significantly between the groups, in relation to genotypes (P > 0.05. CONCLUSIONS: The 19-bp deletion polymorphism of DHFR gene was not a maternal risk factor for DS and was not related to variations in the concentrations of serum folate and plasma Hcy and MMA in the study population.

  11. Polysiloxane/Polystyrene Thermo-Responsive and Self-Healing Polymer Network via Lewis Acid-Lewis Base Pair Formation

    Directory of Open Access Journals (Sweden)

    Fernando Vidal

    2018-02-01

    Full Text Available The use of thermo-reversible Lewis Pair (LP interactions in the formation of transient polymer networks is still greatly underexplored. In this work, we describe the synthesis and characterization of polydimethylsiloxane/polystyrene (PDMS/PS blends that form dynamic Lewis acid-Lewis base adducts resulting in reversible crosslinks. Linear PS containing 10 mol % of di-2-thienylboryl pendant groups randomly distributed was obtained in a two-step one-pot functionalization reaction from silyl-functionalized PS, while ditelechelic PDMS with pyridyl groups at the chain-termini was directly obtained via thiol-ene “click” chemistry from commercially available vinyl-terminated PDMS. The resulting soft gels, formed after mixing solutions containing the PDMS and PS polymers, behave at room temperature as elastomeric solid-like materials with very high viscosity (47,300 Pa·s. We applied rheological measurements to study the thermal and time dependence of the viscoelastic moduli, and also assessed the reprocessability and self-healing behavior of the dry gel.

  12. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  13. Differences in chemosensitivity between primary and paired metastatic lung cancer tissues: In vitro analysis based on the collagen gel droplet embedded culture drug test (CD-DST).

    Science.gov (United States)

    Higashiyama, Masahiko; Okami, Jiro; Maeda, Jun; Tokunaga, Toshiteru; Fujiwara, Ayako; Kodama, Ken; Imamura, Fumio; Kobayashi, Hisayuki

    2012-02-01

    To elucidate the differences in chemosensitivity to anticancer drugs between primary and metastatic lesions in non-small cell lung cancer (NSCLC) patients, we examined the in vitro chemosensitivities of surgically resected NSCLC tissues. A total of 32 specimens were enrolled: 26 specimens of primary lesions paired with metastases in the lymph node, 3 specimens of primary lesions paired with metastases in the adrenal gland, and 3 specimens of primary lesions paired with metastases in the lung. The collagen gel droplet embedded culture drug test (CD-DST) was applied to examine the sensitivity of the tissues to anticancer drugs, including cisplatin, gemcitabine, vinorelbine, docetaxel and 5-fluorouracil. The degree of in vitro sensitivity to each anticancer drug varied between the primary and metastatic lesions. The sensitivity of the paired metastatic lesions was significantly lower than that of the primary lesions only for gemcitabine (P=0.029), vinorelbine (P=0.012), and docetaxel (P=0.009). The incidence of cases diagnosed as CD-DST-sensitive among the paired metastatic lesions was significantly lower than that for the primary lesions for vinorelbine (P=0.035) or docetaxel (P=0.022). The difference in the sensitivity to gemcitabine between the primary and paired non-lymphatic metastases was clearer than that between the primary lesion and paired lymph node metastases. The sensitivities of the paired metastatic lesions to some anticancer drugs were significantly lower than those of the primary lesions. When performing chemotherapy based on CD-DST data using primary tumors from patients with postoperative recurrence, an appropriate regimen can be selected by carefully considering these differences.

  14. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  15. G.T wobble base-pairing in Z-DNA at 1.0 A atomic resolution: the crystal structure of d(CGCGTG).

    OpenAIRE

    Ho, P S; Frederick, C A; Quigley, G J; van der Marel, G A; van Boom, J H; Wang, A H; Rich, A

    1985-01-01

    The DNA oligomer d(CGCGTG) crystallizes as a Z-DNA double helix containing two guanine-thymine base pair mismatches of the wobble type. The crystal diffracts to 1 A resolution and the structure has been solved and refined. At this resolution, a large amount of information is revealed about the organization of the water molecules in the lattice generally and more specifically around the wobble base pairs. By comparing this structure with the analogous high resolution structure of d(CGCGCG) we ...

  16. Theoretical study on absorption and emission spectra of size-expanded Janus-type AT nucleobases and effect of base pairing.

    Science.gov (United States)

    Liu, Hongxia; Song, Qixia; Liu, Jianhua; Li, Yan; Wang, Haijun

    2014-01-01

    Fluorescent nucleoside analogues have attracted much attention in studying the structure and dynamics of nucleic acids in recent years. In the present work, we design benzo- and naphtha-expanded Janus AT base analogues, using DFT, TDDFT, and CIS methods to investigate the structural and optical properties of the Janus AT base analogues (termed as J-AT, xJ-AT, yyJ-AT, BF, xBF and yyBF), and also consider the effect of base pairing. The results show that the Janus AT base analogues can pair with T and A simultaneously to form stable H-bonded WC base pairs. The ground state structure of J-AT is similar to BF, the size expansion is 2.42Å for the x-Janus AT bases and 4.86Å for the yy-Janus AT bases. The excited state geometries of J-AT and BF change dramatically, while the other bases are similar to the ground state geometries. The lowest excited singlet transitions of the Janus AT base analogues are predicted to be of ππ(*) character and mainly dominated by the configuration HOMO-LUMO. The maximum absorption wavelengths of size expansion Janus AT base analogues are greatly red shifted compared with J-AT (or BF). BF, xBF and yyJ-AT have larger oscillator strengths than J-AT, xJ-AT and yyBF. The emission wavelengths of the Janus AT base analogues also exhibit red shifts from x-Janus AT bases to yy-Janus AT bases. However, the emission wavelengths of J-AT and BF change greatly, which are coincident with the structures observed in the excited state geometries. With regard to the WC base pairs, the B3LYP functional reveals that the lowest energy transitions of some base pairs are charge transfer excitation, while the other base pairs are local excitation. The CAM-B3LYP functional predicts that all the lowest transitions are localized on the Janus AT bases, and show good agreement with the results of the M062X functional. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  18. Towards 3D structure prediction of large RNA molecules: an integer programming framework to insert local 3D motifs in RNA secondary structure.

    Science.gov (United States)

    Reinharz, Vladimir; Major, François; Waldispühl, Jérôme

    2012-06-15

    The prediction of RNA 3D structures from its sequence only is a milestone to RNA function analysis and prediction. In recent years, many methods addressed this challenge, ranging from cycle decomposition and fragment assembly to molecular dynamics simulations. However, their predictions remain fragile and limited to small RNAs. To expand the range and accuracy of these techniques, we need to develop algorithms that will enable to use all the structural information available. In particular, the energetic contribution of secondary structure interactions is now well documented, but the quantification of non-canonical interactions-those shaping the tertiary structure-is poorly understood. Nonetheless, even if a complete RNA tertiary structure energy model is currently unavailable, we now have catalogues of local 3D structural motifs including non-canonical base pairings. A practical objective is thus to develop techniques enabling us to use this knowledge for robust RNA tertiary structure predictors. In this work, we introduce RNA-MoIP, a program that benefits from the progresses made over the last 30 years in the field of RNA secondary structure prediction and expands these methods to incorporate the novel local motif information available in databases. Using an integer programming framework, our method refines predicted secondary structures (i.e. removes incorrect canonical base pairs) to accommodate the insertion of RNA 3D motifs (i.e. hairpins, internal loops and k-way junctions). Then, we use predictions as templates to generate complete 3D structures with the MC-Sym program. We benchmarked RNA-MoIP on a set of 9 RNAs with sizes varying from 53 to 128 nucleotides. We show that our approach (i) improves the accuracy of canonical base pair predictions; (ii) identifies the best secondary structures in a pool of suboptimal structures; and (iii) predicts accurate 3D structures of large RNA molecules. RNA-MoIP is publicly available at: http://csb.cs.mcgill.ca/RNAMoIP.

  19. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  20. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  1. A recurring two-hydrogen-bond motif incorporating a serine or threonine residue is found both at alpha-helical N termini and in other situations.

    Science.gov (United States)

    Wan, W Y; Milner-White, E J

    1999-03-12

    Side-chain hydroxyl residues in protein crystal structures often form hydrogen bonds with main-chain atoms. The most common bond arrangement is a four to five residue motif in which a serine or threonine is the first residue forming two characteristic hydrogen bonds to residues ahead of it in sequence. We call them ST-motifs, by analogy with the term Asx-motif we suggested for the related motifs with aspartate and asparagine residues. ST-motifs are common, there being just under one and a half in a typical protein subunit. Asx-motifs are even more common, such that 9 % of the residues of an average protein consist of Asx or ST-motifs. Of the ST-motifs, three-quarters are at helical N termini, and the rest occur by themselves or in conjunction with beta-bulge loops. A third of all alpha-helices have either ST-motifs or Asx-motifs at their N termini. Previous work has emphasised the occurrence of the capping box at alpha-helical N termini, but the capping box occurs in only 5 % of alpha-helical N termini; also, we point out that it can be regarded as a subset of the ST-motif (or, occasionally, of the Asx-motif). By comparing related sequences, the rates which amino acid residues at the first position of ST or Asx-motifs interchange during evolution are examined. Serine threonine, and aspartate asparagine, interchange is rapid; inter-pair exchange is slower, but much faster than exchange with other amino acid residues. This is consistent with the general similarity of ST-motifs and Asx-motifs combined with some subtle structural differences between them that are described. Copyright 1999 Academic Press.

  2. MotifNet: a web-server for network motif analysis.

    Science.gov (United States)

    Smoly, Ilan Y; Lerman, Eugene; Ziv-Ukelson, Michal; Yeger-Lotem, Esti

    2017-06-15

    Network motifs are small topological patterns that recur in a network significantly more often than expected by chance. Their identification emerged as a powerful approach for uncovering the design principles underlying complex networks. However, available tools for network motif analysis typically require download and execution of computationally intensive software on a local computer. We present MotifNet, the first open-access web-server for network motif analysis. MotifNet allows researchers to analyze integrated networks, where nodes and edges may be labeled, and to search for motifs of up to eight nodes. The output motifs are presented graphically and the user can interactively filter them by their significance, number of instances, node and edge labels, and node identities, and view their instances. MotifNet also allows the user to distinguish between motifs that are centered on specific nodes and motifs that recur in distinct parts of the network. MotifNet is freely available at http://netbio.bgu.ac.il/motifnet . The website was implemented using ReactJs and supports all major browsers. The server interface was implemented in Python with data stored on a MySQL database. estiyl@bgu.ac.il or michaluz@cs.bgu.ac.il. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  3. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  4. Enhancement of galaxy overdensity around quasar pairs at z < 3.6 based on the Hyper Suprime-Cam Subaru Strategic Program Survey

    Science.gov (United States)

    Onoue, Masafusa; Kashikawa, Nobunari; Uchiyama, Hisakazu; Akiyama, Masayuki; Harikane, Yuichi; Imanishi, Masatoshi; Komiyama, Yutaka; Matsuoka, Yoshiki; Nagao, Tohru; Nishizawa, Atsushi J.; Oguri, Masamune; Ouchi, Masami; Tanaka, Masayuki; Toba, Yoshiki; Toshikawa, Jun

    2018-01-01

    We investigate the galaxy overdensity around proto-cluster scale quasar pairs at high (z > 3) and low (z ˜ 1) redshift based on the unprecedentedly wide and deep optical survey of the Hyper Suprime-Cam Subaru Strategic Program (HSC-SSP). Using the first-year survey data covering effectively ˜121 deg2 with the 5σ depth of i ˜ 26.4 and the SDSS DR12Q catalog, we find two luminous pairs at z ˜ 3.3 and 3.6 which reside in >5σ overdensity regions of g-dropout galaxies at i R⊥ = 1.75 and 1.04 proper Mpc (pMpc), and their velocity offsets are ΔV = 692 and 1448 km s-1, respectively. This result is in clear contrast to the average z ˜ 4 quasar environments as discussed in Uchiyama et al. (2018, PASJ 70, S32) and implies that the quasar activities of the pair members are triggered via major mergers in proto-clusters, unlike the vast majority of isolated quasars in general fields that may turn on via non-merger events such as bar and disk instabilities. At z ˜ 1, we find 37 pairs with R⊥ 4σ) regions. Thanks to the large sample size, we find statistical evidence that this excess is unique to the pair environments when compared to single-quasar and randomly selected galaxy environments at the same redshift range. Moreover, there are nine small-scale (R⊥ < 1 pMpc) pairs, two of which are found to reside in cluster fields. Our results demonstrate that <2 pMpc scale quasar pairs at both redshift ranges tend to occur in massive haloes, although perhaps not the most massive ones, and that they are useful in searching for rare density peaks.

  5. Gemcitabine, Pyrrologemcitabine, and 2'-Fluoro-2'-Deoxycytidines: Synthesis, Physical Properties, and Impact of Sugar Fluorination on Silver Ion Mediated Base Pairing.

    Science.gov (United States)

    Guo, Xiurong; Leonard, Peter; Ingale, Sachin A; Seela, Frank

    2017-12-14

    The stability of silver-mediated "dC-dC" base pairs relies not only on the structure of the nucleobase, but is also sensitive to structural modification of the sugar moiety. 2'-Fluorinated 2'-deoxycytidines with fluorine atoms in the arabino (up) and ribo (down) configuration as well as with geminal fluorine substitution (anticancer drug gemcitabine) and the novel fluorescent phenylpyrrolo-gemcitabine ( ph PyrGem) have been synthesized. All the nucleosides display the recognition face of naturally occurring 2'-deoxycytidine. The nucleosides were converted into phosphoramidites and incorporated into 12-mer oligonucleotides by solid-phase synthesis. The addition of silver ions to DNA duplexes with a fluorine-modified "dC-dC" pair near the central position led to significant duplex stabilization. The increase in stability was higher for duplexes with fluorinated sugar residues than for those with an unchanged 2'-deoxyribose moiety. Similar observations were made for "dC-dT" pairs and to a minor extent for "dC-dA" pairs. The increase in silver ion mediated base-pair stability was reversed by annulation of a pyrrole ring to the cytosine moiety, as shown for 2'-fluorinated ph PyrGem in comparison with phenylpyrrolo-dC ( ph PyrdC). This phenomenon results from stereoelectronic effects induced by fluoro substitution, which are transmitted from the sugar moiety to the silver ion mediated base pairs. The extent of the effect depends on the number of fluorine substituents, their configuration, and the structure of the nucleobase. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. MicroRNA mediated network motifs in autoimmune diseases and its crosstalk between genes, functions and pathways.

    Science.gov (United States)

    Prabahar, Archana; Natarajan, Jeyakumar

    2017-01-01

    Autoimmune diseases (AIDs) are incurable but suppressible diseases whose molecular mechanisms are yet to be elucidated. In this work, we selected five systemic autoimmune diseases such as Rheumatoid Arthritis (RA), Type 1 Diabetes (T1D), Inflammatory Bowel Disease (IBD), Autoimmune Thyroid Disease (ATD) and Systemic Lupus Erythematosus (SLE). Heterogeneous data such as miRNA, transcription factor (TF), target genes and protein-protein interactions involved in these AIDs were integrated to understand their roles at different functional levels of miRNA such as transcription initiation, gene regulatory network formation and post transcriptional regulation. To understand the functional characteristics of these complex biological networks, they can be simplified as network motifs (sub networks) and motif-motif interacting pairs (MMIs). The network motif patterns and motif-motif interacting pairs that occur for the selected five diseases were identified. To further understand the functional association between AIDs, functions and pathways were determined using gene set enrichment analysis and five selected immune signaling pathways (ISPs). The crosstalk within AIDs and between the immune signaling pathways (ISPs) could provide novel insights in deciphering disease mechanisms. This study represents the first investigation of miRNA-TF regulatory network for AIDs and its association with ISPs using sub-network motifs. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. MotifLab: a tools and data integration workbench for motif discovery and regulatory sequence analysis.

    Science.gov (United States)

    Klepper, Kjetil; Drabløs, Finn

    2013-01-16

    Traditional methods for computational motif discovery often suffer from poor performance. In particular, methods that search for sequence matches to known binding motifs tend to predict many non-functional binding sites because they fail to take into consideration the biological state of the cell. In recent years, genome-wide studies have generated a lot of data that has the potential to improve our ability to identify functional motifs and binding sites, such as information about chromatin accessibility and epigenetic states in different cell types. However, it is not always trivial to make use of this data in combination with existing motif discovery tools, especially for researchers who are not skilled in bioinformatics programming. Here we present MotifLab, a general workbench for analysing regulatory sequence regions and discovering transcription factor binding sites and cis-regulatory modules. MotifLab supports comprehensive motif discovery and analysis by allowing users to integrate several popular motif discovery tools as well as different kinds of additional information, including phylogenetic conservation, epigenetic marks, DNase hypersensitive sites, ChIP-Seq data, positional binding preferences of transcription factors, transcription factor interactions and gene expression. MotifLab offers several data-processing operations that can be used to create, manipulate and analyse data objects, and complete analysis workflows can be constructed and automatically executed within MotifLab, including graphical presentation of the results. We have developed MotifLab as a flexible workbench for motif analysis in a genomic context. The flexibility and effectiveness of this workbench has been demonstrated on selected test cases, in particular two previously published benchmark data sets for single motifs and modules, and a realistic example of genes responding to treatment with forskolin. MotifLab is freely available at http://www.motiflab.org.

  8. Prediction of host - pathogen protein interactions between Mycobacterium tuberculosis and Homo sapiens using sequence motifs.

    Science.gov (United States)

    Huo, Tong; Liu, Wei; Guo, Yu; Yang, Cheng; Lin, Jianping; Rao, Zihe

    2015-03-26

    Emergence of multiple drug resistant strains of M. tuberculosis (MDR-TB) threatens to derail global efforts aimed at reigning in the pathogen. Co-infections of M. tuberculosis with HIV are difficult to treat. To counter these new challenges, it is essential to study the interactions between M. tuberculosis and the host to learn how these bacteria cause disease. We report a systematic flow to predict the host pathogen interactions (HPIs) between M. tuberculosis and Homo sapiens based on sequence motifs. First, protein sequences were used as initial input for identifying the HPIs by 'interolog' method. HPIs were further filtered by prediction of domain-domain interactions (DDIs). Functional annotations of protein and publicly available experimental results were applied to filter the remaining HPIs. Using such a strategy, 118 pairs of HPIs were identified, which involve 43 proteins from M. tuberculosis and 48 proteins from Homo sapiens. A biological interaction network between M. tuberculosis and Homo sapiens was then constructed using the predicted inter- and intra-species interactions based on the 118 pairs of HPIs. Finally, a web accessible database named PATH (Protein interactions of M. tuberculosis and Human) was constructed to store these predicted interactions and proteins. This interaction network will facilitate the research on host-pathogen protein-protein interactions, and may throw light on how M. tuberculosis interacts with its host.

  9. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  11. Mobile Technology for Improved Family Planning (MOTIF): the development of a mobile phone-based (mHealth) intervention to support post-abortion family planning (PAFP) in Cambodia.

    Science.gov (United States)

    Smith, Chris; Vannak, Uk; Sokhey, Ly; Ngo, Thoai D; Gold, Judy; Free, Caroline

    2016-01-05

    The objective of this paper is to outline the formative research process used to develop the MOTIF mobile phone-based (mHealth) intervention to support post-abortion family planning in Cambodia. The formative research process involved literature reviews, interviews and focus group discussions with clients, and consultation with clinicians and organisations implementing mHealth activities in Cambodia. This process led to the development of a conceptual framework and the intervention. Key findings from the formative research included identification of the main reasons for non-use of contraception and patterns of mobile phone use in Cambodia. We drew on components of existing interventions and behaviour change theory to develop a conceptual framework. A multi-faceted voice-based intervention was designed to address health concerns and other key determinants of contraception use. Formative research was essential in order to develop an appropriate mHealth intervention to support post-abortion contraception in Cambodia. Each component of the formative research contributed to the final intervention design.

  12. Pair-Bonded Humans Conform to Sexual Stereotypes in Web-Based Advertisements for Extra-Marital Partners

    Directory of Open Access Journals (Sweden)

    Trish C. Kelley

    2010-10-01

    Full Text Available Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those stereotypes. Our findings thus provide further evidence that human mating behavior is highly constrained by fundamental biological differences between males and females.

  13. Selection of optimal spawning pairs to maintain genetic variation among captive populations of Acipenseridae based on the polymorphism of microsatellite loci

    Directory of Open Access Journals (Sweden)

    Kaczmarczyk Dariusz

    2016-06-01

    Full Text Available The American paddlefish, Polyodon spathula (Walbaum, is an endangered acipenserid fish. Its wild populations are supplemented with stocking material that is obtained by conducting artificial spawning in aquaculture conditions. When fish are bred in captivity, it is important to select breeding pairs that will produce the most genetically diverse progeny, since this permits maintaining the fitness of wild populations. Breeding pairs of land animals are selected successfully based on the polymorphism of their microsatellite loci. This theoretical paper asks how to adapt this technique to fish so that American paddlefish spawners can be paired with the aim of producing restocking material in aquaculture that maintains genetic variation. To test our calculating techniques, we used actual data on the polymorphism of the microsatellites from paddlefish broodstock at the Pogorze fish farm (Poland. The data enabled us to do calculations that showed which spawner pairs would create the most genetically diverse offspring and how to assemble sets of spawning pairs that would be best for maintaining genetic variation. The method presented in this paper can be used for breeding fish in aquaculture to help conserve species. It could also be used in a computer program which would automate calculations and present them in easy-to-read tables and graphs.

  14. A generalized profile syntax for biomolecular sequence motifs and its function in automatic sequence interpretation

    Energy Technology Data Exchange (ETDEWEB)

    Bucher, P. [Swiss Institute for Experimental Cancer Research, Lausanne (Switzerland); Bairoch, A. [Centre Medical Universitaire, Geneva (Switzerland)

    1994-12-31

    A general syntax for expressing bimolecular sequence motifs is described, which will be used in future releases of the PROSITE data bank and in a similar collection of nucleic acid sequence motifs currently under development. The central part of the syntax is a regular structure which can be viewed as a generalization of the profiles introduced by Gribskov and coworkers. Accessory features implement specific motif search strategies and provide information helpful for the interpretation of predicted matches. Two contrasting examples, representing E. coli promoters and SH3 domains respectively, are shown to demonstrate the versatility of the syntax, and its compatibility with diverse motif search methods. It is argued, that a comprehensive machine-readable motif collection based on the new syntax, in conjunction with a standard search program, can serve as a general-purpose sequence interpretation and function prediction tool.

  15. DNA recognition by the SwaI restriction endonuclease involves unusual distortion of an 8 base pair A:T-rich target.

    Science.gov (United States)

    Shen, Betty W; Heiter, Daniel F; Lunnen, Keith D; Wilson, Geoffrey G; Stoddard, Barry L

    2017-02-17

    R.SwaI, a Type IIP restriction endonuclease, recognizes a palindromic eight base pair (bp) symmetric sequence, 5΄-ATTTAAAT-3΄, and cleaves that target at its center to generate blunt-ended DNA fragments. Here, we report three crystal structures of SwaI: unbound enzyme, a DNA-bound complex with calcium ions; and a DNA-bound, fully cleaved complex with magnesium ions. We compare these structures to two structurally similar ‘PD-D/ExK’ restriction endonucleases (EcoRV and HincII) that also generate blunt-ended products, and to a structurally distinct enzyme (the HNH endonuclease PacI) that also recognizes an 8-bp target site consisting solely of A:T base pairs. Binding by SwaI induces an extreme bend in the target sequence accompanied by un-pairing and re-ordering of its central A:T base pairs. This result is reminiscent of a more dramatic target deformation previously described for PacI, implying that long A:T-rich target sites might display structural or dynamic behaviors that play a significant role in endonuclease recognition and cleavage.

  16. Cooper pairs in atomic nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Pittel, S. [Bartol Research Institute and Department of Physics and Astronomy, University of Delaware, Newark, 19716 Delaware (United States); Dussel, G. G. [Departamento de Fisica J.J. Giambiagi, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Dukelsky, J.; Sarriguren, P. [Instituto de Estructura de la Materia, CSIC, Serrano 123, 28006 Madrid (Spain)

    2008-12-15

    We describe recent efforts to study Cooper pairs in atomic nuclei. We consider a self-consistent Hartree Fock mean field for the even Sm isotopes and compare results based on three treatments of pairing correlations: a BCS treatment, a number-projected BCS treatment and an exact treatment using the Richardson Ansatz. Significant differences are seen in the pairing correlation energies. Furthermore, because it does not average over the properties of the fermion pairs, the Richardson solution permits a more meaningful definition of the Cooper wave function and of the fraction of pairs that are collective. Our results confirm that only a few pairs near the Fermi surface in realistic atomic nuclei are collective. (Author)

  17. Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs

    KAUST Repository

    Alam, Tanvir

    2018-03-11

    Short Linear Motifs (SLiMs) contribute to almost every cellular function by connecting appropriate protein partners. Accurate prediction of SLiMs is difficult due to their shortness and sequence degeneracy. Leucine-aspartic acid (LD) motifs are SLiMs that link paxillin family proteins to factors controlling (cancer) cell adhesion, motility and survival. The existence and importance of LD motifs beyond the paxillin family is poorly understood. To enable a proteome-wide assessment of these motifs, we developed an active-learning based framework that iteratively integrates computational predictions with experimental validation. Our analysis of the human proteome identified a dozen proteins that contain LD motifs, all being involved in cell adhesion and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter-species comparison revealed a conserved LD signalling core, and reveals the emergence of species-specific adaptive connections, while maintaining a strong functional focus of the LD motif interactome. Collectively, our data elucidate the mechanisms underlying the origin and adaptation of an ancestral SLiM.

  18. Comparison of SIFT and SURF based DEM extraction approaches on a GEOEYE-1 satellite stereo-pair

    Science.gov (United States)

    Daliakopoulos, Ioannis; Tsanis, Ioannis

    2014-05-01

    A MATLAB module for Digital Elevation Model (DEM) extraction from Very High Resolution (VHR) satellite stereo-pair imagery is used to compare the efficiency of two well established feature detection and description algorithms. A procedure for parallel processing of cascading image tiles is used for handling the large datasets requirements of VHR satellite imagery. Scale-Invariant Feature Transform (SIFT) and Speeded Up Robust Features (SURF) algorithms are used to detect potentially tentative feature matches in the members of the stereo-pair. The resulting feature pairs are filtered using the RANdom SAmple Consensus (RANSAC) algorithm by using a variable distance threshold. Finally, tentative feature matches are converted to point cloud ground coordinates for DEM generation. A 0.5 m × 0.5 m Geoeye-1 stereo-pair acquired over an area of 25 km2 in the island of Crete, Greece is used as input for the module. The resulting 2 m × 2 m DEMs has superior detail over previously developed 2 m and 5 m DEMs that are used as reference, and yields a Root Mean Square Error (RMSE) of about 1 m compared to ground truth measurements. Results suggest that SURF's superior runtime performance outweighs the slightly better feature quality attained with SIFT.

  19. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    Science.gov (United States)

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  20. Hunting Motifs in Situla Art

    Directory of Open Access Journals (Sweden)

    Andrej Preložnik

    2013-07-01

    Full Text Available Situla art developed as an echo of the toreutic style which had spread from the Near East through the Phoenicians, Greeks and Etruscans as far as the Veneti, Raeti, Histri, and their eastern neighbours in the region of Dolenjska (Lower Carniola. An Early Iron Age phenomenon (c. 600—300 BC, it rep- resents the major and most arresting form of the contemporary visual arts in an area stretching from the foot of the Apennines in the south to the Drava and Sava rivers in the east. Indeed, individual pieces have found their way across the Alpine passes and all the way north to the Danube. In the world and art of the situlae, a prominent role is accorded to ani- mals. They are displayed in numerous representations of human activities on artefacts crafted in the classic situla style – that is, between the late 6th  and early 5th centuries BC – as passive participants (e.g. in pageants or in harness or as an active element of the situla narrative. The most typical example of the latter is the hunting scene. Today we know at least four objects decorat- ed exclusively with hunting themes, and a number of situlae and other larger vessels where hunting scenes are embedded in composite narratives. All this suggests a popularity unparallelled by any other genre. Clearly recognisable are various hunting techniques and weapons, each associated with a particu- lar type of game (Fig. 1. The chase of a stag with javelin, horse and hound is depicted on the long- familiar and repeatedly published fibula of Zagorje (Fig. 2. It displays a hound mauling the stag’s back and a hunter on horseback pursuing a hind, her neck already pierced by the javelin. To judge by the (so far unnoticed shaft end un- der the stag’s muzzle, the hunter would have been brandishing a second jave- lin as well, like the warrior of the Vače fibula or the rider of the Nesactium situla, presumably himself a hunter. Many parallels to his motif are known from Greece, Etruria, and

  1. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    Science.gov (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  2. Bayesian centroid estimation for motif discovery.

    Science.gov (United States)

    Carvalho, Luis

    2013-01-01

    Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.

  3. Bayesian centroid estimation for motif discovery.

    Directory of Open Access Journals (Sweden)

    Luis Carvalho

    Full Text Available Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.

  4. Sequence alignment reveals possible MAPK docking motifs on HIV proteins.

    Directory of Open Access Journals (Sweden)

    Perry Evans

    Full Text Available Over the course of HIV infection, virus replication is facilitated by the phosphorylation of HIV proteins by human ERK1 and ERK2 mitogen-activated protein kinases (MAPKs. MAPKs are known to phosphorylate their substrates by first binding with them at a docking site. Docking site interactions could be viable drug targets because the sequences guiding them are more specific than phosphorylation consensus sites. In this study we use multiple bioinformatics tools to discover candidate MAPK docking site motifs on HIV proteins known to be phosphorylated by MAPKs, and we discuss the possibility of targeting docking sites with drugs. Using sequence alignments of HIV proteins of different subtypes, we show that MAPK docking patterns previously described for human proteins appear on the HIV matrix, Tat, and Vif proteins in a strain dependent manner, but are absent from HIV Rev and appear on all HIV Nef strains. We revise the regular expressions of previously annotated MAPK docking patterns in order to provide a subtype independent motif that annotates all HIV proteins. One revision is based on a documented human variant of one of the substrate docking motifs, and the other reduces the number of required basic amino acids in the standard docking motifs from two to one. The proposed patterns are shown to be consistent with in silico docking between ERK1 and the HIV matrix protein. The motif usage on HIV proteins is sufficiently different from human proteins in amino acid sequence similarity to allow for HIV specific targeting using small-molecule drugs.

  5. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  6. Influence of carboxylic ion-pairing reagents on retention of peptides in thin-layer chromatography systems with C18 silica-based adsorbents.

    Science.gov (United States)

    Gwarda, Radosław Ł; Aletańska-Kozak, Monika; Klimek-Turek, Anna; Ziajko-Jankowska, Agnieszka; Matosiuk, Dariusz; Dzido, Tadeusz H

    2016-04-01

    One of the main problems related to chromatography of peptides concerns adverse interactions of their strong basic groups with free silanol groups of the silica based stationary phase. Influence of type and concentration of ion-pairing regents on peptide retention in reversed-phase high-performance liquid chromatography (RP-HPLC) systems has been discussed before. Here we present influence of these mobile phase additives on retention of some peptide standards in high-performance thin-layer chromatography (HPTLC) systems with C18 silica-based adsorbents. We prove, that due to different characteristic of adsorbents used in both techniques (RP HPLC and HPTLC), influence of ion-pairing reagents on retention of basic and/or amphoteric compounds also may be quite different. C18 silica-based HPTLC adsorbents provide more complex mechanism of retention and should be rather considered as mixed-mode adsorbents. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A robust method for the reconstruction of disparity maps based on multilevel processing of stereo color image pairs

    Science.gov (United States)

    Kravchenko, V. F.; Ponomaryov, V. I.; Pustovoit, V. I.; Sadovnychiy, S. N.

    2017-08-01

    A novel method for the reconstruction of disparity maps (DMs) with robust properties to nonideal registration conditions, reflections, and noise in stereo color image pairs has been substantiated for the first time. The novel approach proposes a scheme for image DM reconstruction where Jaccard distance metric is used as a proximity criterion in stereo image pair matching. A physical interpretation of the method that allows the quality of the formed DMs to be improved significantly is given. A processing block diagram has been developed in accordance with the novel approach. Simulations of the novel DM reconstruction method have shown an advantage of the proposed DM reconstruction scheme in terms of generally recognized criteria, such as the structural similarity index measure and the bad matching pixels, and when visually comparing the formed DMs.

  8. Solar radiation concentrators paired with multijunction photoelectric converters in ground-based solar power plants (part I)

    Science.gov (United States)

    Ionova, E. A.; Ulanov, M. V.; Davidyuk, N. Yu.; Sadchikov, N. A.

    2016-12-01

    We have developed a method for determining parameters of radiation concentrator in solar power plants. To estimate the efficiency of concentrators in the form of Fresnel lenses in setups with three-junction photoelectric converters, the concept of the efficiency of the concentrator-photoelectric converter pair has been introduced. We have proposed a method for calculating the refracting profile of concentrators taking into account the dispersion relation for the refractive index and its variations with temperature for the material of the refracting profile of the concentrator (Wacker RT604 silicone compound). The results of calculation make it possible to achieve the maximal efficiency of the concentrator-photoelectric converter pair in the presence of chromatic aberrations in the optical system of solar radiation concentration.

  9. Identification of a TAAT-containing motif required for high level expression of the COL1A1 promoter in differentiated osteoblasts of transgenic mice

    Science.gov (United States)

    Dodig, M.; Kronenberg, M. S.; Bedalov, A.; Kream, B. E.; Gronowicz, G.; Clark, S. H.; Mack, K.; Liu, Y. H.; Maxon, R.; Pan, Z. Z.; hide

    1996-01-01

    Our previous studies have shown that the 49-base pair region of promoter DNA between -1719 and -1670 base pairs is necessary for transcription of the rat COL1A1 gene in transgenic mouse calvariae. In this study, we further define this element to the 13-base pair region between -1683 and -1670. This element contains a TAAT motif that binds homeodomain-containing proteins. Site-directed mutagenesis of this element in the context of a COL1A1-chloramphenicol acetyltransferase construct extending to -3518 base pairs decreased the ratio of reporter gene activity in calvariae to tendon from 3:1 to 1:1, suggesting a preferential effect on activity in calvariae. Moreover, chloramphenicol acetyltransferase-specific immunofluorescence microscopy of transgenic calvariae showed that the mutation preferentially reduced levels of chloramphenicol acetyltransferase protein in differentiated osteoblasts. Gel mobility shift assays demonstrate that differentiated osteoblasts contain a nuclear factor that binds to this site. This binding activity is not present in undifferentiated osteoblasts. We show that Msx2, a homeodomain protein, binds to this motif; however, Northern blot analysis revealed that Msx2 mRNA is present in undifferentiated bone cells but not in fully differentiated osteoblasts. In addition, cotransfection studies in ROS 17/2.8 osteosarcoma cells using an Msx2 expression vector showed that Msx2 inhibits a COL1A1 promoter-chloramphenicol acetyltransferase construct. Our results suggest that high COL1A1 expression in bone is mediated by a protein that is induced during osteoblast differentiation. This protein may contain a homeodomain; however, it is distinct from homeodomain proteins reported previously to be present in bone.

  10. Predicting Bond Dissociation Energies of Transition-Metal Compounds by Multiconfiguration Pair-Density Functional Theory and Second-Order Perturbation Theory Based on Correlated Participating Orbitals and Separated Pairs.

    Science.gov (United States)

    Bao, Junwei Lucas; Odoh, Samuel O; Gagliardi, Laura; Truhlar, Donald G

    2017-02-14

    We study the performance of multiconfiguration pair-density functional theory (MC-PDFT) and multireference perturbation theory for the computation of the bond dissociation energies in 12 transition-metal-containing diatomic molecules and three small transition-metal-containing polyatomic molecules and in two transition-metal dimers. The first step is a multiconfiguration self-consistent-field calculation, for which two choices must be made: (i) the active space and (ii) its partition into subspaces, if the generalized active space formulation is used. In the present work, the active space is chosen systematically by using three correlated-participating-orbitals (CPO) schemes, and the partition is chosen by using the separated-pair (SP) approximation. Our calculations show that MC-PDFT generally has similar accuracy to CASPT2, and the active-space dependence of MC-PDFT is not very great for transition-metal-ligand bond dissociation energies. We also find that the SP approximation works very well, and in particular SP with the fully translated BLYP functional SP-ftBLYP is more accurate than CASPT2. SP greatly reduces the number of configuration state functions relative to CASSCF. For the cases of FeO and NiO with extended-CPO active space, for which complete active space calculations are unaffordable, SP calculations are not only affordable but also of satisfactory accuracy. All of the MC-PDFT results are significantly better than the corresponding results with broken-symmetry spin-unrestricted Kohn-Sham density functional theory. Finally we test a perturbation theory method based on the SP reference and find that it performs slightly worse than CASPT2 calculations, and for most cases of the nominal-CPO active space, the approximate SP perturbation theory calculations are less accurate than the much less expensive SP-PDFT calculations.

  11. Interaction of Cu(+) with cytosine and formation of i-motif-like C-M(+)-C complexes: alkali versus coinage metals.

    Science.gov (United States)

    Gao, Juehan; Berden, Giel; Rodgers, M T; Oomens, Jos

    2016-03-14

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton (C-H(+)-C) may give rise to the so-called i-motif, which occurs primarily in expanded trinucleotide repeats and the telomeric region of DNA, particularly at low pH. At physiological pH, silver cations were recently found to stabilize C dimers in a C-Ag(+)-C structure analogous to the hemiprotonated C-dimer. Here we use infrared ion spectroscopy in combination with density functional theory calculations at the B3LYP/6-311G+(2df,2p) level to show that copper in the 1+ oxidation state induces an analogous formation of C-Cu(+)-C structures. In contrast to protons and these transition metal ions, alkali metal ions induce a different dimer structure, where each ligand coordinates the alkali metal ion in a bidentate fashion in which the N3 and O2 atoms of both cytosine ligands coordinate to the metal ion, sacrificing hydrogen-bonding interactions between the ligands for improved chelation of the metal cation.

  12. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  13. [Pharmacokinetic research strategies of compatibilities and synergistic effects of classical Danshen herb pairs based on pharmacokinetics of "Danshen-Bingpian" and "Danshen-Honghua"].

    Science.gov (United States)

    Zhang, Cui-Ying; Ren, Wei-Guang

    2017-06-01

    Herb pairs are usual clinical compatibility forms and one of compound prescription sources in Chinese medicine. Pharmacokinetic research in vivo is one of the important items in elucidating the mechanism for synergistic and attenuated mechanisms of herb pairs. The paper comprehensively summarized and systemized the pharmacokinetic researches of marker-ingredients about Danshen-Honghua and Danshen-Bingpian in order to elucidate the rationality and scientificity of herb pairs and provide some feasible suggestions on the pharmacokinetics of drugs in the future. In view of complicated system of Traditional Chinese medicines and a chemical system that is not separated from its natural state, comparative pharmacokinetic researches on marker-ingredients from the herb pairs are reasonable to elucidate the synergistic and attenuated mechanisms of monarch-subjects compatible herbs and monarch-guide compatible herbs. Such pharmacokinetic research can better explain the mechanism of drug compatibility, while the pharmacokinetic researches based on the monomer chemical compositions and marker-ingredients that have been separated from complex chemical environment of traditional Chinese Medicine are still unreasonable and should be discussed deeply. Copyright© by the Chinese Pharmaceutical Association.

  14. CircularLogo: A lightweight web application to visualize intra-motif dependencies.

    Science.gov (United States)

    Ye, Zhenqing; Ma, Tao; Kalmbach, Michael T; Dasari, Surendra; Kocher, Jean-Pierre A; Wang, Liguo

    2017-05-22

    The sequence logo has been widely used to represent DNA or RNA motifs for more than three decades. Despite its intelligibility and intuitiveness, the traditional sequence logo is unable to display the intra-motif dependencies and therefore is insufficient to fully characterize nucleotide motifs. Many methods have been developed to quantify the intra-motif dependencies, but fewer tools are available for visualization. We developed CircularLogo, a web-based interactive application, which is able to not only visualize the position-specific nucleotide consensus and diversity but also display the intra-motif dependencies. Applying CircularLogo to HNF6 binding sites and tRNA sequences demonstrated its ability to show intra-motif dependencies and intuitively reveal biomolecular structure. CircularLogo is implemented in JavaScript and Python based on the Django web framework. The program's source code and user's manual are freely available at http://circularlogo.sourceforge.net . CircularLogo web server can be accessed from http://bioinformaticstools.mayo.edu/circularlogo/index.html . CircularLogo is an innovative web application that is specifically designed to visualize and interactively explore intra-motif dependencies.

  15. The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli.

    Science.gov (United States)

    Beisel, Chase L; Storz, Gisela

    2011-02-04

    Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base-pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse nonpreferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multioutput feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base-pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Perception Enhancement using Visual Attributes in Sequence Motif Visualization

    OpenAIRE

    Oon, Yin; Lee, Nung; Kok, Wei

    2016-01-01

    Sequence logo is a well-accepted scientific method to visualize the conservation characteristics of biological sequence motifs. Previous studies found that using sequence logo graphical representation for scientific evidence reports or arguments could seriously cause biases and misinterpretation by users. This study investigates on the visual attributes performance of a sequence logo in helping users to perceive and interpret the information based on preattentive theories and Gestalt principl...

  17. Design and Development of a Two-Color Emissive FRET Pair Based on a Photostable Fluorescent Deoxyuridine Donor Presenting a Mega-Stokes Shift.

    Science.gov (United States)

    Barthes, Nicolas P F; Gavvala, Krishna; Bonhomme, Dominique; Dabert-Gay, Anne Sophie; Debayle, Delphine; Mély, Yves; Michel, Benoît Y; Burger, Alain

    2016-11-18

    We report the synthesis and site-specific incorporation in oligodeoxynucleotides (ODNs) of an emissive deoxyuridine analog electronically conjugated on its C5-position with a 3-methoxychromone moiety acting as a fluorophore. When incorporated in ODNs, this fluorescent deoxyuridine analog exhibits remarkable photostability and good quantum yields. This deoxyuridine analog also displays a mega-Stokes shift, which allows for its use as an efficient donor for FRET-based studies when paired with the yellow emissive indocarbocyanine Cy3 acceptor.

  18. On the role of the cis Hoogsteen:sugar-edge family of base pairs in platforms and triplets-quantum chemical insights into RNA structural biology

    Czech Academy of Sciences Publication Activity Database

    Sharma, P.; Šponer, Judit E.; Šponer, Jiří; Sharma, S.; Bhattacharyya, D.; Mitra, A.

    2010-01-01

    Roč. 114, č. 9 (2010), s. 3307-3320 ISSN 1520-6106 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairs * cis Hoogsteen/Sugar edge Subject RIV: BO - Biophysics Impact factor: 3.603, year: 2010

  19. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  20. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  1. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations

    Science.gov (United States)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.

    2018-02-01

    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  2. Development of a novel prediction method of cis-elements to hypothesize collaborative functions of cis-element pairs in iron-deficient rice.

    Science.gov (United States)

    Kakei, Yusuke; Ogo, Yuko; Itai, Reiko N; Kobayashi, Takanori; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K

    2013-09-22

    Cis-acting elements are essential genomic sequences that control gene expression. In higher eukaryotes, a series of cis-elements function cooperatively. However, further studies are required to examine the co-regulation of multiple cis-elements on a promoter. The aim of this study was to propose a model of cis-element networks that cooperatively regulate gene expression in rice under iron (Fe) deficiency. We developed a novel clustering-free method, microarray-associated motif analyzer (MAMA), to predict novel cis-acting elements based on weighted sequence similarities and gene expression profiles in microarray analyses. Simulation of gene expression was performed using a support vector machine and based on the presence of predicted motifs and motif pairs. The accuracy of simulated gene expression was used to evaluate the quality of prediction and to optimize the parameters used in this method. Based on sequences of Oryza sativa genes upregulated by Fe deficiency, MAMA returned experimentally identified cis-elements responsible for Fe deficiency in O. sativa. When this method was applied to O. sativa subjected to zinc deficiency and Arabidopsis thaliana subjected to salt stress, several novel candidate cis-acting elements that overlap with known cis-acting elements, such as ZDRE, ABRE, and DRE, were identified. After optimization, MAMA accurately simulated more than 87% of gene expression. Predicted motifs strongly co-localized in the upstream regions of regulated genes and sequences around transcription start sites. Furthermore, in many cases, the separation (in bp) between co-localized motifs was conserved, suggesting that predicted motifs and the separation between them were important in the co-regulation of gene expression. Our results are suggestive of a typical sequence model for Fe deficiency-responsive promoters and some strong candidate cis-elements that function cooperatively with known cis-elements.

  3. Evidence of weak pair coupling in the penetration depth of bi-based high-Tc superconductors

    International Nuclear Information System (INIS)

    Thompson, J.R.; Sun, Yang Ren; Ossandon, J.G.; Christen, D.K.; Chakoumakos, B.C.; Sales, B.C.; Kerchner, H.R.; Sonder, E.

    1990-01-01

    The magnetic penetration depth λ(T) has been investigated in Bi(Pb)SrCaCuO high-T c compounds having 2- and 3-layers of copper-oxygen per unit cell. Studies of the magnetization in the vortex state were employed and the results were compared with weak and strong coupling calculations. The temperature dependence of λ is described well by BCS theory in the clean limit, giving evidence for weak pair coupling in this family of materials. For the short component of the λ tensor, we obtain values of 292 and 220 nm (T = 0) for Bi-2212 and (BiPb)-2223, respectively

  4. The Effect of Think-Pair-Share-Write Based on Hybrid Learning on Metakognitive Skills, Creative Thinking and Cognitive Learning at SMA Negeri 3 Malang

    Directory of Open Access Journals (Sweden)

    Ika Yulianti Siregar

    2017-07-01

    Full Text Available The results of biology learning observation show that there are many constraints during the learning process in the class and consultation meeting between teacher and students. The think-pair-share-write based on hybrid learning was conducted to analyze the effect on metacognitive skills, creative thinking and learning outcomes. The research design was quasi experiment with pretest-posttest non-equivalent control group design. The independent variable is think-pair-share-write based on Hybrid learning model, while the dependent variables are metacognitive skills, creative thinking, and cognitive learning outcomes. Metacognitive skills are measured by using metacognitive rubrics. Creative thinking skills and cognitive learning outcomes are measured by using a description test. The data were taken by conducting pretest and posttest. The hypothesis test used was anakova with level of significance 0,05 (P <0,05, as the test result was significant then the test was continued to LSD. Before the anakova test, normality and homogeneity test were performed. The results showed that think-pair-share-write based on Hybrid Learning significantly affecting: 1 the metacognitive skills with F arithmetic of 183,472 and Sig. 0,000; 2 the creative thinking skill with F value of 325,111 and Sig. 0,000; 3 the cognitive learning outcomes with F arithmetic of 175.068 and Sig. 0,000.

  5. Single promoters as regulatory network motifs

    Science.gov (United States)

    Zopf, Christopher; Maheshri, Narendra

    2012-02-01

    At eukaryotic promoters, chromatin can influence the relationship between a gene's expression and transcription factor (TF) activity. This additional complexity might allow single promoters to exhibit dynamical behavior commonly attributed to regulatory motifs involving multiple genes. We investigate the role of promoter chromatin architecture in the kinetics of gene activation using a previously described set of promoter variants based on the phosphate-regulated PHO5 promoter in S. cerevisiae. Accurate quantitative measurement of transcription activation kinetics is facilitated by a controllable and observable TF input to a promoter of interest leading to an observable expression output in single cells. We find the particular architecture of these promoters can result in a significant delay in activation, filtering of noisy TF signals, and a memory of previous activation -- dynamical behaviors reminiscent of a feed-forward loop but only requiring a single promoter. We suggest this is a consequence of chromatin transactions at the promoter, likely passing through a long-lived ``primed'' state between its inactive and competent states. Finally, we show our experimental setup can be generalized as a ``gene oscilloscope'' to probe the kinetics of heterologous promoter architectures.

  6. Prevalent RNA recognition motif duplication in the human genome.

    Science.gov (United States)

    Tsai, Yihsuan S; Gomez, Shawn M; Wang, Zefeng

    2014-05-01

    The sequence-specific recognition of RNA by proteins is mediated through various RNA binding domains, with the RNA recognition motif (RRM) being the most frequent and present in >50% of RNA-binding proteins (RBPs). Many RBPs contain multiple RRMs, and it is unclear how each RRM contributes to the binding specificity of the entire protein. We found that RRMs within the same RBP (i.e., sibling RRMs) tend to have significantly higher similarity than expected by chance. Sibling RRM pairs from RBPs shared by multiple species tend to have lower similarity than those found only in a single species, suggesting that multiple RRMs within the same protein might arise from domain duplication followed by divergence through random mutations. This finding is exemplified by a recent RRM domain duplication in DAZ proteins and an ancient duplication in PABP proteins. Additionally, we found that different similarities between sibling RRMs are associated with distinct functions of an RBP and that the RBPs tend to contain repetitive sequences with low complexity. Taken together, this study suggests that the number of RBPs with multiple RRMs has expanded in mammals and that the multiple sibling RRMs may recognize similar target motifs in a cooperative manner.

  7. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)

    2016-09-15

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  8. A tilt-pair based method for assigning the projection directions of randomly oriented single-particle molecules.

    Science.gov (United States)

    Ueno, Yutaka; Mine, Shouhei; Kawasaki, Kazunori

    2015-04-01

    In this article, we describe an improved method to assign the projection angle for averaged images using tilt-pair images for three-dimensional reconstructions from randomly oriented single-particle molecular images. Our study addressed the so-called 'initial volume problem' in the single-particle reconstruction, which involves estimation of projection angles of the particle images. The projected images of the particles in different tilt observations were mixed and averaged for the characteristic views. After the ranking of these group average images in terms of reliable tilt angle information, mutual tilt angles between images are assigned from the constituent tilt-pair information. Then, multiples of the conical tilt series are made and merged to construct a network graph of the particle images in terms of projection angles, which are optimized for the three-dimensional reconstruction. We developed the method with images of a synthetic object and applied it to a single-particle image data set of the purified deacetylase from archaea. With the introduction of low-angle tilt observations to minimize unfavorable imaging conditions due to tilting, the results demonstrated reasonable reconstruction models without imposing symmetry to the structure. This method also guides its users to discriminate particle images of different conformational state of the molecule. © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    International Nuclear Information System (INIS)

    Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian

    2016-01-01

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers

  10. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Correlating novel variable and conserved motifs in the Hemagglutinin protein with significant biological functions

    Directory of Open Access Journals (Sweden)

    Werner Mark

    2008-08-01

    Full Text Available Abstract Background Variations in the influenza Hemagglutinin protein contributes to antigenic drift resulting in decreased efficiency of seasonal influenza vaccines and escape from host immune response. We performed an in silico study to determine characteristics of novel variable and conserved motifs in the Hemagglutinin protein from previously reported H3N2 strains isolated from Hong Kong from 1968–1999 to predict viral motifs involved in significant biological functions. Results 14 MEME blocks were generated and comparative analysis of the MEME blocks identified blocks 1, 2, 3 and 7 to correlate with several biological functions. Analysis of the different Hemagglutinin sequences elucidated that the single block 7 has the highest frequency of amino acid substitution and the highest number of co-mutating pairs. MEME 2 showed intermediate variability and MEME 1 was the most conserved. Interestingly, MEME blocks 2 and 7 had the highest incidence of potential post-translational modifications sites including phosphorylation sites, ASN glycosylation motifs and N-myristylation sites. Similarly, these 2 blocks overlap with previously identified antigenic sites and receptor binding sites. Conclusion Our study identifies motifs in the Hemagglutinin protein with different amino acid substitution frequencies over a 31 years period, and derives relevant functional characteristics by correlation of these motifs with potential post-translational modifications sites, antigenic and receptor binding sites.

  12. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    Directory of Open Access Journals (Sweden)

    Asita Elengoe

    2015-01-01

    Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  13. Functional characterization of variations on regulatory motifs.

    Directory of Open Access Journals (Sweden)

    Michal Lapidot

    2008-03-01

    Full Text Available Transcription factors (TFs regulate gene expression through specific interactions with short promoter elements. The same regulatory protein may recognize a variety of related sequences. Moreover, once they are detected it is hard to predict whether highly similar sequence motifs will be recognized by the same TF and regulate similar gene expression patterns, or serve as binding sites for distinct regulatory factors. We developed computational measures to assess the functional implications of variations on regulatory motifs and to compare the functions of related sites. We have developed computational means for estimating the functional outcome of substituting a single position within a binding site and applied them to a collection of putative regulatory motifs. We predict the effects of nucleotide variations within motifs on gene expression patterns. In cases where such predictions could be compared to suitable published experimental evidence, we found very good agreement. We further accumulated statistics from multiple substitutions across various binding sites in an attempt to deduce general properties that characterize nucleotide substitutions that are more likely to alter expression. We found that substitutions involving Adenine are more likely to retain the expression pattern and that substitutions involving Guanine are more likely to alter expression compared to the rest of the substitutions. Our results should facilitate the prediction of the expression outcomes of binding site variations. One typical important implication is expected to be the ability to predict the phenotypic effect of variation in regulatory motifs in promoters.

  14. How curved membranes recruit amphipathic helices and protein anchoring motifs.

    Science.gov (United States)

    Hatzakis, Nikos S; Bhatia, Vikram K; Larsen, Jannik; Madsen, Kenneth L; Bolinger, Pierre-Yves; Kunding, Andreas H; Castillo, John; Gether, Ulrik; Hedegård, Per; Stamou, Dimitrios

    2009-11-01

    Lipids and several specialized proteins are thought to be able to sense the curvature of membranes (MC). Here we used quantitative fluorescence microscopy to measure curvature-selective binding of amphipathic motifs on single liposomes 50-700 nm in diameter. Our results revealed that sensing is predominantly mediated by a higher density of binding sites on curved membranes instead of higher affinity. We proposed a model based on curvature-induced defects in lipid packing that related these findings to lipid sorting and accurately predicted the existence of a new ubiquitous class of curvature sensors: membrane-anchored proteins. The fact that unrelated structural motifs such as alpha-helices and alkyl chains sense MC led us to propose that MC sensing is a generic property of curved membranes rather than a property of the anchoring molecules. We therefore anticipate that MC will promote the redistribution of proteins that are anchored in membranes through other types of hydrophobic moieties.

  15. WildSpan: mining structured motifs from protein sequences

    Directory of Open Access Journals (Sweden)

    Chen Chien-Yu

    2011-03-01

    Full Text Available Abstract Background Automatic extraction of motifs from biological sequences is an important research problem in study of molecular biology. For proteins, it is desired to discover sequence motifs containing a large number of wildcard symbols, as the residues associated with functional sites are usually largely separated in sequences. Discovering such patterns is time-consuming because abundant combinations exist when long gaps (a gap consists of one or more successive wildcards are considered. Mining algorithms often employ constraints to narrow down the search space in order to increase efficiency. However, improper constraint models might degrade the sensitivity and specificity of the motifs discovered by computational methods. We previously proposed a new constraint model to handle large wildcard regions for discovering functional motifs of proteins. The patterns that satisfy the proposed constraint model are called W-patterns. A W-pattern is a structured motif that groups motif symbols into pattern blocks interleaved with large irregular gaps. Considering large gaps reflects the fact that functional residues are not always from a single region of protein sequences, and restricting motif symbols into clusters corresponds to the observation that short motifs are frequently present within protein families. To efficiently discover W-patterns for large-scale sequence annotation and function prediction, this paper first formally introduces the problem to solve and proposes an algorithm named WildSpan (sequential pattern mining across large wildcard regions that incorporates several pruning strategies to largely reduce the mining cost. Results WildSpan is shown to efficiently find W-patterns containing conserved residues that are far separated in sequences. We conducted experiments with two mining strategies, protein-based and family-based mining, to evaluate the usefulness of W-patterns and performance of WildSpan. The protein-based mining mode

  16. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning.

    Science.gov (United States)

    Koh, Jansen; Dubrowski, Adam

    2016-06-19

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician's lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning.

  17. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

    Science.gov (United States)

    Koh, Jansen

    2016-01-01

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  18. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  19. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    Science.gov (United States)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  20. [Mechanism of treatment effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats based on metabolomic approach].

    Science.gov (United States)

    Cao, Hui-Ting; Zhu, Hua-Xu; Zhang, Qi-Chun; Guo, Li-Wei

    2017-06-01

    The metabolic effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats was studied by using metabolomic method. The rat model of ischemia reperfusion injury induced by introduction of transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Ultra high performance liquid chromatography-series four pole time of flight mass spectrometry method(UPLC-Q-TOF/MS), Markerlynx software, and principal component analysis and partial least-squares discriminant analysis were used to analyze the different endogenous metabolites among the urine samples of sham rats, cerebral ischemia model rats, Huanglian groups (HL), Huangqin groups (HQ) and Huanglian-Huangqin herb pairs groups (LQ) was achieved, combined with accurate information about the endogenous metabolites level and secondary fragment ions, retrieval and identification of possible biological markers, metabolic pathway which build in MetPA database. The 20 potential biomarkers were found in the urine of rats with cerebral ischemia, which mainly involved in the neurotransmitter regulation, amino acid metabolism, energy metabolism, lipid metabolism and so on. Those metabolic pathways were disturbed in cerebral ischemia model rats, the principal component analysis showed that the normal and cerebral ischemia model is clearly distinguished, and the compound can be given to the normal state of change after HL, HQ, LQ administration. This study index the interpretation of cerebral ischemia rat metabolism group and mechanism, the embodiment of metabonomics can reflect the physiological and metabolic state, which can better reflect the traditional Chinese medicine as a whole view, system view and the features of multi ingredient synergistic or antagonistic effects. Copyright© by the Chinese Pharmaceutical Association.

  1. Architecture based on the integration of intermolecular G-quadruplex structure with sticky-end pairing and colorimetric detection of DNA hybridization.

    Science.gov (United States)

    Li, Hongbo; Wu, Zai-Sheng; Shen, Zhifa; Shen, Guoli; Yu, Ruqin

    2014-02-21

    An interesting discovery is reported in that G-rich hairpin-based recognition probes can self-assemble into a nano-architecture based on the integration of an intermolecular G-quadruplex structure with the sticky-end pairing effect in the presence of target DNAs. Moreover, GNPs modified with partly complementary DNAs can intensively aggregate by hybridization-based intercalation between intermolecular G-quadruplexes, indicating an inspiring assembly mechanism and a powerful colorimetric DNA detection. The proposed intermolecular G-quadruplex-integrated sticky-end pairing assembly (called GISA)-based colorimetric system allows a specific and quantitative assay of p53 DNA with a linear range of more than two orders of magnitude and a detection limit of 0.2 nM, suggesting a considerably improved analytical performance. And more to the point, the discrimination of single-base mismatched target DNAs can be easily conducted via visual observation. The successful development of the present colorimetric system, especially the GISA-based aggregation mechanism of GNPs is different from traditional approaches, and offers a critical insight into the dependence of the GNP aggregation on the structural properties of oligonucleotides, opening a good way to design colorimetric sensing probes and DNA nanostructure.

  2. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    Science.gov (United States)

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  3. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  4. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  5. Targeting functional motifs of a protein family

    Science.gov (United States)

    Bhadola, Pradeep; Deo, Nivedita

    2016-10-01

    The structural organization of a protein family is investigated by devising a method based on the random matrix theory (RMT), which uses the physiochemical properties of the amino acid with multiple sequence alignment. A graphical method to represent protein sequences using physiochemical properties is devised that gives a fast, easy, and informative way of comparing the evolutionary distances between protein sequences. A correlation matrix associated with each property is calculated, where the noise reduction and information filtering is done using RMT involving an ensemble of Wishart matrices. The analysis of the eigenvalue statistics of the correlation matrix for the β -lactamase family shows the universal features as observed in the Gaussian orthogonal ensemble (GOE). The property-based approach captures the short- as well as the long-range correlation (approximately following GOE) between the eigenvalues, whereas the previous approach (treating amino acids as characters) gives the usual short-range correlations, while the long-range correlations are the same as that of an uncorrelated series. The distribution of the eigenvector components for the eigenvalues outside the bulk (RMT bound) deviates significantly from RMT observations and contains important information about the system. The information content of each eigenvector of the correlation matrix is quantified by introducing an entropic estimate, which shows that for the β -lactamase family the smallest eigenvectors (low eigenmodes) are highly localized as well as informative. These small eigenvectors when processed gives clusters involving positions that have well-defined biological and structural importance matching with experiments. The approach is crucial for the recognition of structural motifs as shown in β -lactamase (and other families) and selectively identifies the important positions for targets to deactivate (activate) the enzymatic actions.

  6. ssHMM: extracting intuitive sequence-structure motifs from high-throughput RNA-binding protein data.

    Science.gov (United States)

    Heller, David; Krestel, Ralf; Ohler, Uwe; Vingron, Martin; Marsico, Annalisa

    2017-11-02

    RNA-binding proteins (RBPs) play an important role in RNA post-transcriptional regulation and recognize target RNAs via sequence-structure motifs. The extent to which RNA structure influences protein binding in the presence or absence of a sequence motif is still poorly understood. Existing RNA motif finders either take the structure of the RNA only partially into account, or employ models which are not directly interpretable as sequence-structure motifs. We developed ssHMM, an RNA motif finder based on a hidden Markov model (HMM) and Gibbs sampling which fully captures the relationship between RNA sequence and secondary structure preference of a given RBP. Compared to previous methods which output separate logos for sequence and structure, it directly produces a combined sequence-structure motif when trained on a large set of sequences. ssHMM's model is visualized intuitively as a graph and facilitates biological interpretation. ssHMM can be used to find novel bona fide sequence-structure motifs of uncharacterized RBPs, such as the one presented here for the YY1 protein. ssHMM reaches a high motif recovery rate on synthetic data, it recovers known RBP motifs from CLIP-Seq data, and scales linearly on the input size, being considerably faster than MEMERIS and RNAcontext on large datasets while being on par with GraphProt. It is freely available on Github and as a Docker image. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. A novel swarm intelligence algorithm for finding DNA motifs.

    Science.gov (United States)

    Lei, Chengwei; Ruan, Jianhua

    2009-01-01

    Discovering DNA motifs from co-expressed or co-regulated genes is an important step towards deciphering complex gene regulatory networks and understanding gene functions. Despite significant improvement in the last decade, it still remains one of the most challenging problems in computational molecular biology. In this work, we propose a novel motif finding algorithm that finds consensus patterns using a population-based stochastic optimisation technique called Particle Swarm Optimisation (PSO), which has been shown to be effective in optimising difficult multidimensional problems in continuous domains. We propose to use a word dissimilarity graph to remap the neighborhood structure of the solution space of DNA motifs, and propose a modification of the naive PSO algorithm to accommodate discrete variables. In order to improve efficiency, we also propose several strategies for escaping from local optima and for automatically determining the termination criteria. Experimental results on simulated challenge problems show that our method is both more efficient and more accurate than several existing algorithms. Applications to several sets of real promoter sequences also show that our approach is able to detect known transcription factor binding sites, and outperforms two of the most popular existing algorithms.

  8. Key Roles of Lewis Acid-base Pairs on ZnxZryOz in Direct Ethanol/Acetone to Isobutene Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Junming; Baylon, Rebecca A.; Liu, Changjun; Mei, Donghai; Martin, Kevin J.; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-20

    The effects of surface acidity on the cascade ethanol-to-isobutene conversion were studied using ZnxZryOz catalysts. The ethanol-to-isobutene reaction was found to be limited by the secondary reaction of the key intermediate, acetone, namely the acetone-to-isobutene reaction. Although the catalysts with coexisting Brønsted acidity could catalyze the rate-limiting acetone-to-isobutene reaction, the presence of Brønsted acidity is also detrimental. First, secondary isobutene isomerization is favored, producing a mixture of butene isomers. Second, undesired polymerization and coke formation prevail, leading to rapid catalyst deactivation. Most importantly, both steady-state and kinetic reaction studies as well as FTIR analysis of adsorbed acetone-d6 and D2O unambiguously showed that a highly active and selective nature of balanced Lewis acid-base pairs was masked by the coexisting Brønsted acidity in the aldolization and self-deoxygenation of acetone to isobutene. As a result, ZnxZryOz catalysts with only Lewis acid-base pairs were discovered, on which nearly a theoretical selectivity to isobutene (~88.9%) was successfully achieved, which has never been reported before. Moreover, the absence of Brønsted acidity in such ZnxZryOz catalysts also eliminates the side isobutene isomerization and undesired polymerization/coke reactions, resulting in the production of high purity isobutene with significantly improved catalyst stability (< 2% activity loss after 200 h time-on-stream). This work not only demonstrates a balanced Lewis acid-base pair for the highly active and selective cascade ethanol-to-isobutene reaction, but also sheds light on the rational design of selective and robust acid-base catalyst for C-C coupling via aldolization reaction.

  9. Identification of common motifs in unaligned DNA sequences: application to Escherichia coli Lrp regulon.

    Science.gov (United States)

    Fraenkel, Y M; Mandel, Y; Friedberg, D; Margalit, H

    1995-08-01

    We describe a relatively simple method for the identification of common motifs in DNA sequences that are known to share a common function. The input sequences are unaligned and there is no information regarding the position or orientation of the motif. Often such data exists for protein-binding regions, where genetic or molecular information that defines the binding region is available, but the specific recognition site within it is unknown. The method is based on the principle of 'divide and conquer'; we first search for dominant submotifs and then build full-length motifs around them. This method has several useful features: (i) it screens all submotifs so that the results are independent of the sequence order in the data; (ii) it allows the submotifs to contain spacers; (iii) it identifies an existing motif even if the data contains 'noise'; (iv) its running time depends linearly on the total length of the input. The method is demonstrated on two groups of protein-binding sequences: a well-studied group of known CRP-binding sequences, and a relatively newly identified group of genes known to be regulated by Lrp. The Lrp motif that we identify, based on 23 gene sequences, is similar to a previously identified motif based on a smaller data set, and to a consensus sequence of experimentally defined binding sites. Individual Lrp sites are evaluated and compared in regard to their regulation mode.

  10. A functional EXXEK motif is essential for proton coupling and active glucosinolate transport by NPF2.11

    DEFF Research Database (Denmark)

    Jørgensen, Morten Egevang; Olsen, Carl Erik; Geiger, Dietmar

    2015-01-01

    K motif variant in a plant NPF transporter. Using liquid chromatography-mass spectrometry (LC-MS)-based uptake assays and two-electrode voltage clamp (TEVC) electrophysiology, we demonstrate an essential role for the E1X1X2E2K motif for accumulation of substrate by NPF2.11. Our data suggest...

  11. Alu pair exclusions in the human genome

    Directory of Open Access Journals (Sweden)

    Cook George W

    2011-09-01

    Full Text Available Abstract Background The human genome contains approximately one million Alu elements which comprise more than 10% of human DNA by mass. Alu elements possess direction, and are distributed almost equally in positive and negative strand orientations throughout the genome. Previously, it has been shown that closely spaced Alu pairs in opposing orientation (inverted pairs are found less frequently than Alu pairs having the same orientation (direct pairs. However, this imbalance has only been investigated for Alu pairs separated by 650 or fewer base pairs (bp in a study conducted prior to the completion of the draft human genome sequence. Results We performed a comprehensive analysis of all (> 800,000 full-length Alu elements in the human genome. This large sample size permits detection of small differences in the ratio between inverted and direct Alu pairs (I:D. We have discovered a significant depression in the full-length Alu pair I:D ratio that extends to repeat pairs separated by ≤ 350,000 bp. Within this imbalance bubble (those Alu pairs separated by ≤ 350,000 bp, direct pairs outnumber inverted pairs. Using PCR, we experimentally verified several examples of inverted Alu pair exclusions that were caused by deletions. Conclusions Over 50 million full-length Alu pairs reside within the I:D imbalance bubble. Their collective impact may represent one source of Alu element-related human genomic instability that has not been previously characterized.

  12. Coherence length determination of meso-meso linked porphyrin arrays based on forward-backward pair trajectory analysis.

    Science.gov (United States)

    Lee, Myeongwon; Kim, Heeyoung; Kim, Dongho; Sim, Eunji

    2008-06-12

    We investigated the excitation energy transfer process of meso-meso linked zinc(II) porphyrin arrays using the on-the-fly filtered propagator path integral method. Details of the dynamics such as coherence length of a porphyrin array are estimated by analysis of the characteristics of forward-backward pair trajectories. Upon examination of the convergence of the reduced density matrix with respect to the subset of Hilbert space trajectories, we determine the number of porphyrin units that form collective coherent states, that is, the coherence length. Simulation results show that the coherence length of zinc(II) porphyrin arrays is up to 4 units, which agrees excellently with experimental observations. On the other hand, the energy bias provided by the energy-accepting 5,15-bisphenylethynylated zinc(II) porphyrin reduces the degree of coherence which becomes negligible for an array with more than for porphyrin units. Considering conformational inhomogeneity, we found that the experimentally determined coherence length is the result of electronic and environmental influence rather than the structure disorder. Temperature dependence is also discussed.

  13. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  14. Identifying motifs in folktales using topic models

    NARCIS (Netherlands)

    Karsdorp, F.; Bosch, A.P.J. van den

    2013-01-01

    With the undertake of various folktale digitalization initiatives, the need for computational aids to explore these collections is increasing. In this paper we compare Labeled LDA (L-LDA) to a simple retrieval model on the task of identifying motifs in folktales. We show that both methods are well

  15. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoit

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  16. THE EVALUATION OF POSSIBILITY OF NORMAL OPERATION OF CABLES BASED ON TWISTED PAIRS WITH PVC JACKET UNDER THE CONDITIONS OF HIGH HUMIDITY AND TEMPERATURE

    Directory of Open Access Journals (Sweden)

    G. V. Bezprozvannych

    2017-10-01

    Full Text Available Introduction. Development of cables for structured cabling systems based on twisted pairs for shipbuilding is carried out in two main directions: increasing the fire safety of cables and increasing the long-term permissible operating temperature by using new, more heat-resistant, electrical insulating materials. Purpose. Substantiation of the possibility of unshielded cables on the basis of unshielded twisted pairs with thermoplastic polyethylene insulation in PVC protective jacket in conditions of high humidity and high operating temperatures on the basis of the results of accelerated aging. Methodology. The cycle of aging under conditions of increased humidity is performed for 336 hours. Then the sample was under natural drying conditions for 1440 hours. Thermal aging in a thermostat at 90 °C was carried out in two stages: first – for 206 hours, the second – for 260 hours. In the initial state and after accelerated aging, measurements of the capacitance and tangent of the dielectric loss angle of all the insulating gaps at frequencies of 100 Hz, 1 and 10 kHz were performed. Results. According to the results of accelerated aging under conditions of high humidity and temperature, it is established that the design of an unshielded cable based on unshielded twisted pairs with thermoplastic polyethylene insulation in a protective coating based on PVC-plastic is resistant to external influencing factors. Practical value. The prolonged holding at temperature of 90 °C is equivalent to operation at temperature of 40 °C for 6.8 years. At higher operating temperatures, the lifetime of the cable is significantly reduced.

  17. The Verrucomicrobia LexA-binding Motif: Insights into the Evolutionary Dynamics of the SOS Response

    Directory of Open Access Journals (Sweden)

    Ivan Erill

    2016-07-01

    Full Text Available The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

  18. Bridging of anions by hydrogen bonds in nest motifs and its significance for Schellman loops and other larger motifs within proteins.

    Science.gov (United States)

    Afzal, Avid M; Al-Shubailly, Fawzia; Leader, David P; Milner-White, E James

    2014-11-01

    The nest is a protein motif of three consecutive amino acid residues with dihedral angles 1,2-αR αL (RL nests) or 1,2-αL αR (LR nests). Many nests form a depression in which an anion or δ-negative acceptor atom is bound by hydrogen bonds from the main chain NH groups. We have determined the extent and nature of this bridging in a database of protein structures using a computer program written for the purpose. Acceptor anions are bound by a pair of bridging hydrogen bonds in 40% of RL nests and 20% of LR nests. Two thirds of the bridges are between the NH groups at Positions 1 and 3 of the motif (N1N3-bridging)-which confers a concavity to the nest; one third are of the N2N3 type-which does not. In bridged LR nests N2N3-bridging predominates (14% N1N3: 75% N2N3), whereas in bridged RL nests the reverse is true (69% N1N3: 25% N2N3). Most bridged nests occur within larger motifs: 45% in (hexapeptide) Schellman loops with an additional 4 → 0 hydrogen bond (N1N3), 11% in Schellman loops with an additional 5 → 1 hydrogen bond (N2N3), 12% in a composite structure including a type 1β-bulge loop and an asx- or ST- motif (N1N3)-remarkably homologous to the N1N3-bridged Schellman loop-and 3% in a composite structure including a type 2β-bulge loop and an asx-motif (N2N3). A third hydrogen bond is a previously unrecognized feature of Schellman loops as those lacking bridged nests have an additional 4 → 0 hydrogen bond. © 2014 Wiley Periodicals, Inc.

  19. Parallel motif extraction from very long sequences

    KAUST Repository

    Sahli, Majed

    2013-01-01

    Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern applications require mining of motifs in one very long sequence (i.e., in the order of several gigabytes). For this case, there exist statistical approaches that are fast but inaccurate; or combinatorial methods that are sound and complete. Unfortunately, existing combinatorial methods are serial and very slow. Consequently, they are limited to very short sequences (i.e., a few megabytes), small alphabets (typically 4 symbols for DNA sequences), and restricted types of motifs. This paper presents ACME, a combinatorial method for extracting motifs from a single very long sequence. ACME arranges the search space in contiguous blocks that take advantage of the cache hierarchy in modern architectures, and achieves almost an order of magnitude performance gain in serial execution. It also decomposes the search space in a smart way that allows scalability to thousands of processors with more than 90% speedup. ACME is the only method that: (i) scales to gigabyte-long sequences; (ii) handles large alphabets; (iii) supports interesting types of motifs with minimal additional cost; and (iv) is optimized for a variety of architectures such as multi-core systems, clusters in the cloud, and supercomputers. ACME reduces the extraction time for an exact-length query from 4 hours to 7 minutes on a typical workstation; handles 3 orders of magnitude longer sequences; and scales up to 16, 384 cores on a supercomputer. Copyright is held by the owner/author(s).

  20. Preferential solvation, ion pairing, and dynamics of concentrated aqueous solutions of divalent metal nitrate salts

    Science.gov (United States)

    Yadav, Sushma; Chandra, Amalendu

    2017-12-01

    We have investigated the characteristics of preferential solvation of ions, structure of solvation shells, ion pairing, and dynamics of aqueous solutions of divalent alkaline-earth metal nitrate salts at varying concentration by means of molecular dynamics simulations. Hydration shell structures and the extent of preferential solvation of the metal and nitrate ions in the solutions are investigated through calculations of radial distribution functions, tetrahedral ordering, and also spatial distribution functions. The Mg2+ ions are found to form solvent separated ion-pairs while the Ca2+ and Sr2+ ions form contact ion pairs with the nitrate ions. These findings are further corroborated by excess coordination numbers calculated through Kirkwood-Buff G factors for different ion-ion and ion-water pairs. The ion-pairing propensity is found to be in the order of Mg(NO3) 2 ions which is achieved in the current study through electronic continuum correction force fields. A detailed analysis of the effects of ion-pairs on the structure and dynamics of water around the hydrated ions is done through classification of water into different subspecies based on their locations around the cations or anions only or bridged between them. We have looked at the diffusion coefficients, relaxation of orientational correlation functions, and also the residence times of different subspecies of water to explore the dynamics of water in different structural environments in the solutions. The current results show that the water molecules are incorporated into fairly well-structured hydration shells of the ions, thus decreasing the single-particle diffusivities and increasing the orientational relaxation times of water with an increase in salt concentration. The different structural motifs also lead to the presence of substantial dynamical heterogeneity in these solutions of strongly interacting ions. The current study helps us to understand the molecular details of hydration structure, ion

  1. Matched molecular pair-based data sets for computer-aided medicinal chemistry [v2; ref status: indexed, http://f1000r.es/309

    Directory of Open Access Journals (Sweden)

    Ye Hu

    2014-02-01

    Full Text Available Matched molecular pairs (MMPs are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17 for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community.

  2. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  3. Matched molecular pair-based data sets for computer-aided medicinal chemistry [v1; ref status: indexed, http://f1000r.es/2w9

    Directory of Open Access Journals (Sweden)

    Ye Hu

    2014-02-01

    Full Text Available Matched molecular pairs (MMPs are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the latest release of the ChEMBL database for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community.

  4. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization

    Science.gov (United States)

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin

    2017-08-01

    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously.

  5. Key Roles of Lewis Acid-Base Pairs on ZnxZryOz in Direct Ethanol/Acetone to Isobutene Conversion.

    Science.gov (United States)

    Sun, Junming; Baylon, Rebecca A L; Liu, Changjun; Mei, Donghai; Martin, Kevin J; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-20

    The effects of surface acidity on the cascade ethanol-to-isobutene conversion were studied using ZnxZryOz catalysts. The ethanol-to-isobutene reaction was found to be limited by the secondary reaction of the key intermediate, acetone, namely the acetone-to-isobutene reaction. Although the catalysts with coexisting Brønsted acidity could catalyze the rate-limiting acetone-to-isobutene reaction, the presence of Brønsted acidity is also detrimental. First, secondary isobutene isomerization is favored, producing a mixture of butene isomers. Second, undesired polymerization and coke formation prevail, leading to rapid catalyst deactivation. Most importantly, both steady-state and kinetic reaction studies as well as FTIR analysis of adsorbed acetone-d6 and D2O unambiguously showed that a highly active and selective nature of balanced Lewis acid-base pairs was masked by the coexisting Brønsted acidity in the aldolization and self-deoxygenation of acetone to isobutene. As a result, ZnxZryOz catalysts with only Lewis acid-base pairs were discovered, on which nearly a theoretical selectivity to isobutene (∼ 88.9%) was successfully achieved, which has never been reported before. Moreover, the absence of Brønsted acidity in such ZnxZryOz catalysts also eliminates the side isobutene isomerization and undesired polymerization/coke reactions, resulting in the production of high purity isobutene with significantly improved catalyst stability (catalyst for C-C coupling via aldolization reaction.

  6. A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

    Science.gov (United States)

    Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu

    2017-01-01

    Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (T R ) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the T R domain between MPVd-M ( 176 U:A 185 ) and MPVd-S ( 174 G:C 183 ) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the T R domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.

  7. An analysis of multi-type relational interactions in FMA using graph motifs with disjointness constraints.

    Science.gov (United States)

    Zhang, Guo-Qiang; Luo, Lingyun; Ogbuji, Chime; Joslyn, Cliff; Mejino, Jose; Sahoo, Satya S

    2012-01-01

    The interaction of multiple types of relationships among anatomical classes in the Foundational Model of Anatomy (FMA) can provide inferred information valuable for quality assurance. This paper introduces a method called Motif Checking (MOCH) to study the effects of such multi-relation type interactions for detecting logical inconsistencies as well as other anomalies represented by the motifs. MOCH represents patterns of multi-type interaction as small labeled (with multiple types of edges) sub-graph motifs, whose nodes represent class variables, and labeled edges represent relational types. By representing FMA as an RDF graph and motifs as SPARQL queries, fragments of FMA are automatically obtained as auditing candidates. Leveraging the scalability and reconfigurability of Semantic Web Technology, we performed exhaustive analyses of a variety of labeled sub-graph motifs. The quality assurance feature of MOCH comes from the distinct use of a subset of the edges of the graph motifs as constraints for disjointness, whereby bringing in rule-based flavor to the approach as well. With possible disjointness implied by antonyms, we performed manual inspection of the resulting FMA fragments and tracked down sources of abnormal inferred conclusions (logical inconsistencies), which are amendable for programmatic revision of the FMA. Our results demonstrate that MOCH provides a unique source of valuable information for quality assurance. Since our approach is general, it is applicable to any ontological system with an OWL representation.

  8. Pipeline for the Analysis of ChIP-seq Data and New Motif Ranking Procedure

    KAUST Repository

    Ashoor, Haitham

    2011-06-01

    This thesis presents a computational methodology for ab-initio identification of transcription factor binding sites based on ChIP-seq data. This method consists of three main steps, namely ChIP-seq data processing, motif discovery and models selection. A novel method for ranking the models of motifs identified in this process is proposed. This method combines multiple factors in order to rank the provided candidate motifs. It combines the model coverage of the ChIP-seq fragments that contain motifs from which that model is built, the suitable background data made up of shuffled ChIP-seq fragments, and the p-value that resulted from evaluating the model on actual and background data. Two ChIP-seq datasets retrieved from ENCODE project are used to evaluate and demonstrate the ability of the method to predict correct TFBSs with high precision. The first dataset relates to neuron-restrictive silencer factor, NRSF, while the second one corresponds to growth-associated binding protein, GABP. The pipeline system shows high precision prediction for both datasets, as in both cases the top ranked motif closely resembles the known motifs for the respective transcription factors.

  9. Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

    Science.gov (United States)

    Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

    2014-01-01

    This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

  10. Discovery of cell-type specific DNA motif grammar in cis-regulatory elements using random Forest.

    Science.gov (United States)

    Wang, Xin; Lin, Peijie; Ho, Joshua W K

    2018-01-19

    It has been observed that many transcription factors (TFs) can bind to different genomic loci depending on the cell type in which a TF is expressed in, even though the individual TF usually binds to the same core motif in different cell types. How a TF can bind to the genome in such a highly cell-type specific manner, is a critical research question. One hypothesis is that a TF requires co-binding of different TFs in different cell types. If this is the case, it may be possible to observe different combinations of TF motifs - a motif grammar - located at the TF binding sites in different cell types. In this study, we develop a bioinformatics method to systematically identify DNA motifs in TF binding sites across multiple cell types based on published ChIP-seq data, and address two questions: (1) can we build a machine learning classifier to predict cell-type specificity based on motif combinations alone, and (2) can we extract meaningful cell-type specific motif grammars from this classifier model. We present a Random Forest (RF) based approach to build a multi-class classifier to predict the cell-type specificity of a TF binding site given its motif content. We applied this RF classifier to two published ChIP-seq datasets of TF (TCF7L2 and MAX) across multiple cell types. Using cross-validation, we show that motif combinations alone are indeed predictive of cell types. Furthermore, we present a rule mining approach to extract the most discriminatory rules in the RF classifier, thus allowing us to discover the underlying cell-type specific motif grammar. Our bioinformatics analysis supports the hypothesis that combinatorial TF motif patterns are cell-type specific.

  11. A Basic Set of Homeostatic Controller Motifs

    Science.gov (United States)

    Drengstig, T.; Jolma, I.W.; Ni, X.Y.; Thorsen, K.; Xu, X.M.; Ruoff, P.

    2012-01-01

    Adaptation and homeostasis are essential properties of all living systems. However, our knowledge about the reaction kinetic mechanisms leading to robust homeostatic behavior in the presence of environmental perturbations is still poor. Here, we describe, and provide physiological examples of, a set of two-component controller motifs that show robust homeostasis. This basic set of controller motifs, which can be considered as complete, divides into two operational work modes, termed as inflow and outflow control. We show how controller combinations within a cell can integrate uptake and metabolization of a homeostatic controlled species and how pathways can be activated and lead to the formation of alternative products, as observed, for example, in the change of fermentation products by microorganisms when the supply of the carbon source is altered. The antagonistic character of hormonal control systems can be understood by a combination of inflow and outflow controllers. PMID:23199928

  12. Alanine substitutions in the GXXXG motif alter C99 cleavage by γ-secretase but not its dimerization.

    Science.gov (United States)

    Higashide, Hidekazu; Ishihara, Seiko; Nobuhara, Mika; Ihara, Yasuo; Funamoto, Satoru

    2017-03-01

    The amyloid β (Aβ) protein is a major component of senile plaques, one of the neuropathological hallmarks of Alzheimer's disease. Amyloidogenic processing of amyloid precursor protein (APP) by β- and γ-secretases leads to production of Aβ. APP contains tandem triple repeats of the GXXXG motif in its extracellular juxtamembrane and transmembrane regions. It is reported that the GXXXG motif is related to protein-protein interactions, but it remains controversial whether the GXXXG motif in APP is involved in substrate dimerization and whether dimerization affects γ-secretase-dependent cleavage. Therefore, the relationship between the GXXXG motifs, substrate dimerization, and γ-secretase-dependent cleavage sites remains unclear. Here, we applied blue native poly acrylamide gel electrophoresis to examine the effect of alanine substitutions within the GXXXG motifs of APP carboxyl terminal fragment (C99) on its dimerization and Aβ production. Surprisingly, alanine substitutions in the motif failed to alter C99 dimerization in detergent soluble state. Cell-based and solubilized γ-secretase assays demonstrated that increasing alanine substitutions in the motif tended to decrease long Aβ species such as Aβ42 and Aβ43 and to increase in short Aβ species concomitantly. Our data suggest that the GXXXG motif is crucial for Aβ production, but not for C99 dimerization. © 2016 International Society for Neurochemistry.

  13. Solution structure of the DNA decamer duplex containing a 3′-T·T base pair of the cis–syn cyclobutane pyrimidine dimer: implication for the mutagenic property of the cis–syn dimer

    OpenAIRE

    Lee, Joon-Hwa; Choi, Yun-Jeong; Choi, Byong-Seok

    2000-01-01

    The cis–syn dimer is the major DNA photoproduct produced by UV irradiation. In order to determine the origin of the mutagenic property of the cis–syn dimer, we used NMR restraints and molecular dynamics to determine the solution structure of a DNA decamer duplex containing a wobble pair between the 3′-T of the cis–syn dimer and the opposite T residue (CS/TA duplex). The solution structure of the CS/TA duplex revealed that the 3′-T·T base pair of the cis–syn dimer had base pair geometry that w...

  14. Matched-pair classification

    Energy Technology Data Exchange (ETDEWEB)

    Theiler, James P [Los Alamos National Laboratory

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  15. Dynamic motifs in socio-economic networks

    Science.gov (United States)

    Zhang, Xin; Shao, Shuai; Stanley, H. Eugene; Havlin, Shlomo

    2014-12-01

    Socio-economic networks are of central importance in economic life. We develop a method of identifying and studying motifs in socio-economic networks by focusing on “dynamic motifs,” i.e., evolutionary connection patterns that, because of “node acquaintances” in the network, occur much more frequently than random patterns. We examine two evolving bi-partite networks: i) the world-wide commercial ship chartering market and ii) the ship build-to-order market. We find similar dynamic motifs in both bipartite networks, even though they describe different economic activities. We also find that “influence” and “persistence” are strong factors in the interaction behavior of organizations. When two companies are doing business with the same customer, it is highly probable that another customer who currently only has business relationship with one of these two companies, will become customer of the second in the future. This is the effect of influence. Persistence means that companies with close business ties to customers tend to maintain their relationships over a long period of time.

  16. Multifactor-dimensionality reduction versus family-based association tests in detecting susceptibility loci in discordant sib-pair studies

    OpenAIRE

    Yu Yi; Ma Qianli; Meng Yan; Farrell John; Farrer Lindsay A; Wilcox Marsha A

    2005-01-01

    Abstract Complex diseases are generally thought to be under the influence of multiple, and possibly interacting, genes. Many association methods have been developed to identify susceptibility genes assuming a single-gene disease model, referred to as single-locus methods. Multilocus methods consider joint effects of multiple genes and environmental factors. One commonly used method for family-based association analysis is implemented in FBAT. The multifactor-dimensionality reduction method (M...

  17. Large-scale discovery of promoter motifs in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Thomas A Down

    2007-01-01

    Full Text Available A key step in understanding gene regulation is to identify the repertoire of transcription factor binding motifs (TFBMs that form the building blocks of promoters and other regulatory elements. Identifying these experimentally is very laborious, and the number of TFBMs discovered remains relatively small, especially when compared with the hundreds of transcription factor genes predicted in metazoan genomes. We have used a recently developed statistical motif discovery approach, NestedMICA, to detect candidate TFBMs from a large set of Drosophila melanogaster promoter regions. Of the 120 motifs inferred in our initial analysis, 25 were statistically significant matches to previously reported motifs, while 87 appeared to be novel. Analysis of sequence conservation and motif positioning suggested that the great majority of these discovered motifs are predictive of functional elements in the genome. Many motifs showed associations with specific patterns of gene expression in the D. melanogaster embryo, and we were able to obtain confident annotation of expression patterns for 25 of our motifs, including eight of the novel motifs. The motifs are available through Tiffin, a new database of DNA sequence motifs. We have discovered many new motifs that are overrepresented in D. melanogaster promoter regions, and offer several independent lines of evidence that these are novel TFBMs. Our motif dictionary provides a solid foundation for further investigation of regulatory elements in Drosophila, and demonstrates techniques that should be applicable in other species. We suggest that further improvements in computational motif discovery should narrow the gap between the set of known motifs and the total number of transcription factors in metazoan genomes.

  18. Motif decomposition of the phosphotyrosine proteome reveals a new N-terminal binding motif for SHIP2

    DEFF Research Database (Denmark)

    Miller, Martin Lee; Hanke, S.; Hinsby, A. M.

    2008-01-01

    Advances in mass spectrometry-based proteomics have yielded a substantial mapping of the tyrosine phosphoproteome and thus provided an important step toward a systematic analysis of intracellular signaling networks in higher eukaryotes. In this study we decomposed an uncharacterized proteomics data...... set of 481 unique phosphotyrosine (Tyr(P)) peptides by sequence similarity to known ligands of the Src homology 2 (SH2) and the phosphotyrosine binding (PTB) domains. From 20 clusters we extracted 16 known and four new interaction motifs. Using quantitative mass spectrometry we pulled down Tyr...

  19. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  20. Unique TTC repeat base pair loss mutation in cases of pure neural leprosy: A survival strategy of Mycobacterium leprae?

    Directory of Open Access Journals (Sweden)

    Abhishek De

    2015-01-01

    Full Text Available Background: Genomic reduction helps obligate intracellular microbes to survive difficult host niches. Adaptation of Mycobacterium leprae in cases of pure neural leprosy (PNL in the intracellular niche of peripheral nerves can be associated with some gene loss. Recently, a stable but variable number of tandem repefzats (TTC have been reported in strains of M. leprae. FolP and rpoB genes are the two common mutation sites which deal with the susceptibility of the bacteria to drugs. Aim: We attempted to find if genomic reduction of M. leprae in context of these TTC repeats or mutations in folP1 and rpoB can be the reason for the restriction of M. leprae in the nerves in PNL. Materials and Methods: DNA extracts taken from fine needle aspiration of affected nerves of 24 PNL cases were studied for tandem repeats with 21TTC primer in multiplex-PCR. Mutations were also studied by PCR Amplification of SRDR (Sulphone Resistance Determining Region of the folP1 and multiple primer PCR amplification refractory mutation system (MARS of the rpoB. Results: Of the 24 PNL, only 1 patient showed mutation in the rpoB gene and none in the folp1 gene. Studying the mutation in TTC region of the M. leprae gene we found that all the cases have a loss of a few bases in the sequence. Conclusion: We can conclude that there is consistent loss in the bases in the TTC region in all cases of pure neural Hansen and we postulate that it may be an adaptive response of the bacteria to survive host niche resulting in its restriction to peripheral nerves.

  1. The EH1 motif in metazoan transcription factors

    Directory of Open Access Journals (Sweden)

    Copley Richard R

    2005-11-01

    Full Text Available Abstract Background The Engrailed Homology 1 (EH1 motif is a small region, believed to have evolved convergently in homeobox and forkhead containing proteins, that interacts with the Drosophila protein groucho (C. elegans unc-37, Human Transducin-like Enhancers of Split. The small size of the motif makes its reliable identification by computational means difficult. I have systematically searched the predicted proteomes of Drosophila, C. elegans and human for further instances of the motif. Results Using motif identification methods and database searching techniques, I delimit which homeobox and forkhead domain containing proteins also have likely EH1 motifs. I show that despite low database search scores, there is a significant association of the motif with transcription factor function. I further show that likely EH1 motifs are found in combination with T-Box, Zinc Finger and Doublesex domains as well as discussing other plausible candidate associations. I identify strong candidate EH1 motifs in basal metazoan phyla. Conclusion Candidate EH1 motifs exist in combination with a variety of transcription factor domains, suggesting that these proteins have repressor functions. The distribution of the EH1 motif is suggestive of convergent evolution, although in many cases, the motif has been conserved throughout bilaterian orthologs. Groucho mediated repression was established prior to the evolution of bilateria.

  2. CONTEMPORARY USAGE OF TRADITIONAL TURKISH MOTIFS IN PRODUCT DESIGNS

    Directory of Open Access Journals (Sweden)

    Tulay Gumuser

    2012-12-01

    Full Text Available The aim of this study is to identify the traditional Turkish motifs and its relations among present industrial designs. Traditional Turkish motifs played a very important role in 16th century onwards. The arts of the Ottoman Empire were used because of their symbolic meanings and unique styles. When we examine these motifs we encounter; Tiger Stripe, Three Spot (Çintemani, Rumi, Hatayi, Penç, Cloud, Crescent, Star, Crown, Hyacinth, Tulip and Carnation motifs. Nowadays, Turkish designers have begun to use these traditional Turkish motifs in their designs so as to create differences and awareness in the world design. The examples of these industrial designs, using the Turkish motifs, have survived and have Ottoman heritage and historical value. In this study, the Turkish motifs will be examined along with their focus on contemporary Turkish industrial designs used today.

  3. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  4. Highly Efficient One-Pot Synthesis of COS-Based Block Copolymers by Using Organic Lewis Pairs.

    Science.gov (United States)

    Yang, Jia-Liang; Cao, Xiao-Han; Zhang, Cheng-Jian; Wu, Hai-Lin; Zhang, Xing-Hong

    2018-01-31

    A one-pot synthesis of block copolymer with regioregular poly(monothiocarbonate) block is described via metal-free catalysis. Lewis bases such as guanidine, quaternary onium salts, and Lewis acid triethyl borane (TEB) were equivalently combined and used as the catalysts. By using polyethylene glycol (PEG) as the macromolecular chain transfer agent (CTA), narrow polydispersity block copolymers were obtained from the copolymerization of carbonyl sulfide (COS) and propylene oxide (PO). The block copolymers had a poly(monothiocarbonate) block with perfect alternating degree and regioregularity. Unexpectedly, the addition of CTA to COS/PO copolymerization system could dramatically improve the turnover frequency (TOF) of PO (up to 240 h -1 ), higher than that of the copolymerization without CTA. In addition, the conversion of CTA could be up to 100% in most cases, as revealed by ¹H NMR spectra. Of consequence, the number-average molecular weights ( M n s) of the resultant block copolymers could be regulated by varying the feed ratio of CTA to PO. Oxygen-sulfur exchange reaction (O/S ER), which can generate randomly distributed thiocarbonate and carbonate units, was effectively suppressed in all of the cases in the presence of CTA, even at 80 °C. This work presents a versatile method for synthesizing sulfur-containing block copolymers through a metal-free route, providing an array of new block copolymers.

  5. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  6. Optical sensing system based on wireless paired emitter detector diode device and ionogels for lab-on-a-disc water quality analysis.

    Science.gov (United States)

    Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando

    2012-12-07

    This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.

  7. Novel single base-pair deletion in exon 1 of XK gene leading to McLeod syndrome with chorea, muscle wasting, peripheral neuropathy, acanthocytosis and haemolysis.

    Science.gov (United States)

    Wiethoff, Sarah; Xiromerisiou, Georgia; Bettencourt, Conceição; Kioumi, Anna; Tsiptsios, Iakovos; Tychalas, Athanasios; Evaggelia, Markousi; George, Kaltsounis; Makris, Vasileios; Hardy, John; Houlden, Henry

    2014-04-15

    We present a 70-year-old male patient of Greek origin with choreatic movements of the tongue and face, lower limb muscle weakness, peripheral neuropathy, elevated creatinephosphokinase (CPK), acanthocytosis and haemolysis in the absence of Kell RBC antigens with an additional Factor IX-deficiency. Genetic testing for mutations in the three exons of the XK gene revealed a previously unreported hemizygous single base-pair frameshift deletion at exon 1 (c.229delC, p.Leu80fs). In conclusion, we hereby describe a rare phenotype of a patient with McLeod syndrome which was discovered coincidentally during routine blood group testing and consecutively genetically confirmed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Multicomponent Molecular Puzzles for Photofunction Design: Emission Color Variation in Lewis Acid-Base Pair Crystals Coupled with Guest-to-Host Charge Transfer Excitation.

    Science.gov (United States)

    Ono, Toshikazu; Sugimoto, Manabu; Hisaeda, Yoshio

    2015-08-05

    Simple yet ubiquitous multimolecular assembly systems with color-tunable emissions are realized by cooperative electron donor-acceptor interactions, such as the boron-nitrogen (B-N) dative bond as a Lewis acid-base pair and charge transfer (CT) interactions. These are ternary-component systems consisting of a naphthalenediimide derivative (NDI), tris(pentafluorophenyl)borane (TPFB), and aromatic molecules (guest) with an NDI:TPFB:guest ratio of 1:2:2. The crystal shows guest-dependent color-tunable emissions such as deep blue to orange when a guest molecule of benzene is replaced with other π-conjugated systems. A good correlation between the emission wavelength and ionization potential of the guest and electronic structure calculations indicated that the emission is due to the CT transition from the guest to the NDI. The present study suggests that a rational solution of multcomponent molecular puzzles would be useful for obtaining novel photofunctional solid-state systems.

  9. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    Science.gov (United States)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  10. Application of a model based on a pair of Laplace transforms for standard low-energy X-ray beams spectral reconstruction

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Alessandro M., E-mail: amcosta@usp.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Fisica e Matematica; Potiens, Maria da Penha A., E-mail: mppalbu@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP) Sao Paulo, SP (Brazil)

    2009-07-01

    The direct measurement of the spectrum of an X-ray beam by some spectroscopic method is relatively difficult and expensive. Spectra can be alternatively derived by an indirect method from measurements of transmission curve of the X-ray beam and the use of Laplace transforms. The objective of this work was the application of an indirect method that use a spectral model based on a pair of Laplace transforms to reconstruct experimental published spectra of standard low energy X-ray beams at radiation protection level and determine the mean photon energy from the reconstructed spectra for radiation quality specification. The spectral model was applied using calculated transmission curves and the reconstructed spectra provided a coarse approximation to experimental data. Even though, the mean photon energy of the X-ray beams determined from these reconstructed spectra present a satisfactory result showing the value of the analysis of transmission curves for the X-ray beam quality specification. (author)

  11. Assessing the Exceptionality of Coloured Motifs in Networks

    Directory of Open Access Journals (Sweden)

    Lacroix Vincent

    2009-01-01

    Full Text Available Various methods have been recently employed to characterise the structure of biological networks. In particular, the concept of network motif and the related one of coloured motif have proven useful to model the notion of a functional/evolutionary building block. However, algorithms that enumerate all the motifs of a network may produce a very large output, and methods to decide which motifs should be selected for downstream analysis are needed. A widely used method is to assess if the motif is exceptional, that is, over- or under-represented with respect to a null hypothesis. Much effort has been put in the last thirty years to derive -values for the frequencies of topological motifs, that is, fixed subgraphs. They rely either on (compound Poisson and Gaussian approximations for the motif count distribution in Erdös-Rényi random graphs or on simulations in other models. We focus on a different definition of graph motifs that corresponds to coloured motifs. A coloured motif is a connected subgraph with fixed vertex colours but unspecified topology. Our work is the first analytical attempt to assess the exceptionality of coloured motifs in networks without any simulation. We first establish analytical formulae for the mean and the variance of the count of a coloured motif in an Erdös-Rényi random graph model. Using simulations under this model, we further show that a Pólya-Aeppli distribution better approximates the distribution of the motif count compared to Gaussian or Poisson distributions. The Pólya-Aeppli distribution, and more generally the compound Poisson distributions, are indeed well designed to model counts of clumping events. Altogether, these results enable to derive a -value for a coloured motif, without spending time on simulations.

  12. Growing Right Onto Wellness (GROW): a family-centered, community-based obesity prevention randomized controlled trial for preschool child-parent pairs.

    Science.gov (United States)

    Po'e, Eli K; Heerman, William J; Mistry, Rishi S; Barkin, Shari L

    2013-11-01

    Growing Right Onto Wellness (GROW) is a randomized controlled trial that tests the efficacy of a family-centered, community-based, behavioral intervention to prevent childhood obesity among preschool-aged children. Focusing on parent-child pairs, GROW utilizes a multi-level framework, which accounts for macro (i.e., built-environment) and micro (i.e., genetics) level systems that contribute to the childhood obesity epidemic. Six hundred parent-child pairs will be randomized to a 3-year healthy lifestyle intervention or a 3-year school readiness program. Eligible children are enrolled between ages 3 and 5, are from minority communities, and are not obese. The principal site for the GROW intervention is local community recreation centers and libraries. The primary outcome is childhood body mass index (BMI) trajectory at the end of the three-year study period. In addition to other anthropometric measurements, mediators and moderators of growth are considered, including genetics, accelerometry, and diet recall. GROW is a staged intensity intervention, consisting of intensive, maintenance, and sustainability phases. Throughout the study, parents build skills in nutrition, physical activity, and parenting, concurrently forming new social networks. Participants are taught goal-setting, self-monitoring, and problem solving techniques to facilitate sustainable behavior change. The GROW curriculum uses low health literacy communication and social media to communicate key health messages. The control arm is administered to both control and intervention participants. By conducting this trial in public community centers, and by implementing a family-centered approach to sustainable healthy childhood growth, we aim to develop an exportable community-based intervention to address the expanding public health crisis of pediatric obesity. © 2013.

  13. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  14. SNARE motif: A common motif used by pathogens to manipulate membrane fusion

    Science.gov (United States)

    Wesolowski, Jordan

    2010-01-01

    To penetrate host cells through their membranes, pathogens use a variety of molecular components in which the presence of heptad repeat motifs seems to be a prevailing element. Heptad repeats are characterized by a pattern of seven, generally hydrophobic, residues. In order to initiate membrane fusion, viruses use glycoproteins-containing heptad repeats. These proteins are structurally and functionally similar to the SNARE proteins known to be involved in eukaryotic membrane fusion. SNAREs also display a heptad repeat motif called the “SNARE motif”. As bacterial genomes are being sequenced, microorganisms also appear to be carrying membrane proteins resembling eukaryotic SNAREs. This category of SNARE-like proteins might share similar functions and could be used by microorganisms to either promote or block membrane fusion. Such a recurrence across pathogenic organisms suggests that this architectural motif was evolutionarily selected because it most effectively ensures the survival of pathogens within the eukaryotic environment. PMID:21178463

  15. The regulation of ER export and Golgi retention of ST3Gal5 (GM3/GM4 synthase) and B4GalNAcT1 (GM2/GD2/GA2 synthase) by arginine/lysine-based motif adjacent to the transmembrane domain.

    Science.gov (United States)

    Uemura, Satoshi; Shishido, Fumi; Kashimura, Madoka; Inokuchi, Jin-ichi

    2015-12-01

    In the Golgi maturation model, the Golgi cisternae dynamically mature along a secretory pathway. In this dynamic process, glycosyltransferases are transported from the endoplasmic reticulum (ER) to the Golgi apparatus where they remain and function. The precise mechanism behind this maturation process remains unclear. We investigated two glycosyltransferases, ST3Gal5 (ST3G5) and B4GalNAcT1 (B4GN1), involved in ganglioside synthesis and examined their signal sequences for ER export and Golgi retention. Reports have suggested that the [R/K](X)[R/K] motif functions as an ER exporting signal; however, this signal sequence is insufficient in stably expressed, full-length ST3G5. Through further analysis, we have clarified that the (2)R(3)R(X)(5) (9)K(X)(3) (13)K sequence in ST3G5 is essential for ER export. We have named the sequence the R/K-based motif. On the other hand, for ER export of B4GN1, the homodimer formation in addition to the R/K-based motif is required for ER export suggesting the importance of unidentified lumenal side interaction. We found that ST3G5 R2A/R3A and K9A/K13A mutants localized not only in Golgi apparatus but also in endosomes. Furthermore, the amounts of mature type asparagine-linked (N)-glycans in ST3G5 R2A/R3A and K9A/K13A mutants were decreased compared with those in wild-type proteins, and the stability of the mutants was lower. These results suggest that the R/K-based motif is necessary for the Golgi retention of ST3G5 and that the retention is involved in the maturation of N-glycans and in stability. Thus, several basic amino acids located on the cytoplasmic tail of ST3G5 play important roles in both ER export and Golgi retention. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. MCAST: scanning for cis-regulatory motif clusters.

    Science.gov (United States)

    Grant, Charles E; Johnson, James; Bailey, Timothy L; Noble, William Stafford

    2016-04-15

    Precise regulatory control of genes, particularly in eukaryotes, frequently requires the joint action of multiple sequence-specific transcription factors. A cis-regulatory module (CRM) is a genomic locus that is responsible for gene regulation and that contains multiple transcription factor binding sites in close proximity. Given a collection of known transcription factor binding motifs, many bioinformatics methods have been proposed over the past 15 years for identifying within a genomic sequence candidate CRMs consisting of clusters of those motifs. The MCAST algorithm uses a hidden Markov model with a P-value-based scoring scheme to identify candidate CRMs. Here, we introduce a new version of MCAST that offers improved graphical output, a dynamic background model, statistical confidence estimates based on false discovery rate estimation and, most significantly, the ability to predict CRMs while taking into account epigenomic data such as DNase I sensitivity or histone modification data. We demonstrate the validity of MCAST's statistical confidence estimates and the utility of epigenomic priors in identifying CRMs. MCAST is part of the MEME Suite software toolkit. A web server and source code are available at http://meme-suite.org and http://alternate.meme-suite.org t.bailey@imb.uq.edu.au or william-noble@uw.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Motifs, themes and thematic maps of an integrated Saccharomyces cerevisiae interaction network

    Directory of Open Access Journals (Sweden)

    Andrews Brenda

    2005-06-01

    Full Text Available Abstract Background Large-scale studies have revealed networks of various biological interaction types, such as protein-protein interaction, genetic interaction, transcriptional regulation, sequence homology, and expression correlation. Recurring patterns of interconnection, or 'network motifs', have revealed biological insights for networks containing either one or two types of interaction. Results To study more complex relationships involving multiple biological interaction types, we assembled an integrated Saccharomyces cerevisiae network in which nodes represent genes (or their protein products and differently colored links represent the aforementioned five biological interaction types. We examined three- and four-node interconnection patterns containing multiple interaction types and found many enriched multi-color network motifs. Furthermore, we showed that most of the motifs form 'network themes' – classes of higher-order recurring interconnection patterns that encompass multiple occurrences of network motifs. Network themes can be tied to specific biological phenomena and may represent more fundamental network design principles. Examples of network themes include a pair of protein complexes with many inter-complex genetic interactions – the 'compensatory complexes' theme. Thematic maps – networks rendered in terms of such themes – can simplify an otherwise confusing tangle of biological relationships. We show this by mapping the S. cerevisiae network in terms of two specific network themes. Conclusion Significantly enriched motifs in an integrated S. cerevisiae interaction network are often signatures of network themes, higher-order network structures that correspond to biological phenomena. Representing networks in terms of network themes provides a useful simplification of complex biological relationships.

  18. Genome wide identification of regulatory motifs in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Siggia Eric D

    2003-05-01

    Full Text Available Abstract Background To explain the vastly different phenotypes exhibited by the same organism under different conditions, it is essential that we understand how the organism's genes are coordinately regulated. While there are many excellent tools for predicting sequences encoding proteins or RNA genes, few algorithms exist to predict regulatory sequences on a genome wide scale with no prior information. Results To identify motifs involved in the control of transcription, an algorithm was developed that searches upstream of operons for improbably frequent dimers. The algorithm was applied to the B. subtilis genome, which is predicted to encode for approximately 200 DNA binding proteins. The dimers found to be over-represented could be clustered into 317 distinct groups, each thought to represent a class of motifs uniquely recognized by some transcription factor. For each cluster of dimers, a representative weight matrix was derived and scored over the regions upstream of the operons to predict the sites recognized by the cluster's factor, and a putative regulon of the operons immediately downstream of the sites was inferred. The distribution in number of operons per predicted regulon is comparable to that for well characterized transcription factors. The most highly over-represented dimers matched σA, the T-box, and σW sites. We have evidence to suggest that at least 52 of our clusters of dimers represent actual regulatory motifs, based on the groups' weight matrix matches to experimentally characterized sites, the functional similarity of the component operons of the groups' regulons, and the positional biases of the weight matrix matches. All predictions are assigned a significance value, and thresholds are set to avoid false positives. Where possible, we examine our false negatives, drawing examples from known regulatory motifs and regulons inferred from RNA expression data. Conclusions We have demonstrated that in the case of B. subtilis

  19. A framework for direct locating and conformational sampling of protein structural motifs.

    Science.gov (United States)

    Yu, Jianyong; Xiang, Leijun; Zhang, Weidong

    2011-05-01

    A specific treatment of recurrent structural motifs that represent the local bias information has been proven to be an important ingredient in de novo protein structure predication. Significant majority of methods for local structure are based on building blocks, which still suffer from its inherent discrete nature. Instead of using building blocks, this work presents a new protocol framework for local structural motifs prediction based on the direct locating along protein sequence and probabilistic sampling in a continuous (φ, ψ) space. The protein sequence was first scanned by an algorithm of sliding window with variable length of 7 to 19 residues, to match local segments to one of 82 motifs patterns in the fragment library. Identified segments were then labeled and modeled as the correlations of backbone torsion angles with mixture of bivariate cosine distributions in continuous (φ, ψ) space. 3D conformations of corresponding segments were finally sampled by using a backtrack algorithm to the hidden Markov model with single output of (φ, ψ). For local motifs in 50 proteins of testing set, about 62% of eight-residue segments located with high confidence value were predicted within 1.5 Å of their native structures by the method. Majority of local structural motifs were identified and sampled, which indicates the proposed protocol may at least serve as the foundation to obtain better protein tertiary structure prediction.

  20. Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences

    KAUST Repository

    Kalkatawi, Manal M.

    2011-11-15

    Motivation: Recognition of poly(A) signals in mRNA is relatively straightforward due to the presence of easily recognizable polyadenylic acid tail. However, the task of identifying poly(A) motifs in the primary genomic DNA sequence that correspond to poly(A) signals in mRNA is a far more challenging problem. Recognition of poly(A) signals is important for better gene annotation and understanding of t