WorldWideScience

Sample records for base pair step

  1. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    Science.gov (United States)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  2. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  3. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  4. Report on Pairing-based Cryptography

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  5. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  6. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    Science.gov (United States)

    (O’ Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  7. Understanding the kinetic mechanism of RNA single base pair formation.

    Science.gov (United States)

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-05

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model.

  8. Method for sequencing DNA base pairs

    Science.gov (United States)

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  9. Amplification of Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry

    Science.gov (United States)

    Islam, SK Firoz; Saha, Arijit

    2017-09-01

    Motivated by the recent experiments [Scientific Reports 6, 23051 (2016), 10.1038/srep23051; Phys. Rev. Lett. 114, 096602 (2015), 10.1103/PhysRevLett.114.096602], we theoretically investigate Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry. By considering the graphene-based superconductor as an entangler device, instead of normal [two-dimensional (2D)] BCS superconductor, we show that the Cooper pair splitting current mediated by the crossed Andreev process is amplified compared to its normal superconductor counterpart. This amplification is attributed to the strong suppression of the local normal Andreev reflection process (arising from the Cooper pair splitting) from the graphene-based superconductor to lead via the same quantum dot, in comparison to the usual 2D superconductor. Due to the vanishing density of states at the Dirac point of undoped graphene, a doped graphene-based superconductor is considered here and it is observed that Cooper pair splitting current is very insensitive to the doping level in comparison to the usual 2D superconductor. The transport process of nonlocal spin-entangled electrons also depends on the type of pairing, i.e., whether the electron-hole pairing is onsite, intersublattice or the combination of both. The intersublattice pairing of graphene causes the maximum nonlocal Cooper pair splitting current, whereas the presence of both pairings reduces the Cooper pair splitting current.

  10. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    WINTEC

    PDB files using RASMOL18 software. Hydrogen atoms were added to these base pairs using MOLDEN19 software. The sugar portions attached to base pairs in. RNA structures were removed, and C1′ atoms were respectively replaced by hydrogen atoms during model building. The change in base pair geometry on re-.

  11. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  12. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  13. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  14. Base pairing in RNA structures: A computational analysis

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  15. Photochemical selectivity in guanine–cytosine base-pair structures

    Science.gov (United States)

    Abo-Riziq, Ali; Grace, Louis; Nir, Eyal; Kabelac, Martin; Hobza, Pavel; de Vries, Mattanjah S.

    2005-01-01

    Prebiotic chemistry presumably took place before formation of an oxygen-rich atmosphere and thus under conditions of intense short wavelength UV irradiation. Therefore, the UV photochemical stability of the molecular building blocks of life may have been an important selective factor in determining the eventual chemical makeup of critical biomolecules. To investigate the role of UV irradiation in base-pairing we have studied guanine (G) and cytosine (C) base pairs in the absence of the RNA backbone. We distinguished base-pair structures by IR–UV hole-burning spectroscopy as well as by high-level correlated ab initio calculations. The Watson–Crick structure exhibits broad UV absorption, in stark contrast to other GC structures and other base-pair structures. This broad absorption may be explained by a rapid internal conversion that makes this specific base pair arrangement uniquely photochemically stable. PMID:15618394

  16. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  17. Probing the nature of hydrogen bonds in DNA base pairs.

    Science.gov (United States)

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  18. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  19. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  20. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  1. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  2. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  3. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    Science.gov (United States)

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  4. Characterization of the trans Watson-Crick GU base pair located in the catalytic core of the antigenomic HDV ribozyme.

    Directory of Open Access Journals (Sweden)

    Dominique Lévesque

    Full Text Available The HDV ribozyme's folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U(23 and G(28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U(23 and G(28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction.

  5. 1H NMR determination of base-pair lifetimes in oligonucleotides containing single base mismatches.

    Science.gov (United States)

    Bhattacharya, Pratip K; Cha, Julie; Barton, Jacqueline K

    2002-11-01

    Proton nuclear magnetic resonance (NMR) spectroscopy is employed to characterize the kinetics of base-pair opening in a series of 9mer duplexes containing different single base mismatches. The imino protons from the different mismatched, as well as fully matched, duplexes are assigned from the imino-imino region in the WATERGATE NOESY spectra. The exchange kinetics of the imino protons are measured from selective longitudinal relaxation times. In the limit of infinite exchange catalyst concentration, the exchange times of the mismatch imino protons extrapolate to much shorter lifetimes than are commonly observed for an isolated GC base pair. Different mismatches exhibit different orders of base-pair lifetimes, e.g. a TT mismatch has a shorter base-pair lifetime than a GG mismatch. The effect of the mismatch was observed up to a distance of two neighboring base pairs. This indicates that disruption in the duplex caused by the mismatch is quite localized. The overall order of base-pair lifetimes in the selected sequence context of the base pair is GC > GG > AA > CC > AT > TT. Interestingly, the fully matched AT base pair has a shorter base-pair lifetime relative to many of the mismatches. Thus, in any given base pair, the exchange lifetime can exhibit a strong dependence on sequence context. These findings may be relevant to the way mismatch recognition is accomplished by proteins and small molecules.

  6. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  7. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  8. Using an isomorphic problem pair to learn introductory physics: Transferring from a two-step problem to a three-step problem

    Directory of Open Access Journals (Sweden)

    Shih-Yin Lin

    2013-10-01

    Full Text Available In this study, we examine introductory physics students’ ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation in which they had to learn from a solved problem provided and take advantage of what they learned from it to solve another isomorphic problem (which we call the quiz problem. The solved problem provided has two subproblems while the quiz problem has three subproblems, which is known from previous research to be challenging for introductory students. In addition to the solved problem, students also received extra scaffolding supports that were intended to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. The data analysis suggests that students had great difficulty in transferring what they learned from a two-step problem to a three-step problem. Although most students were able to learn from the solved problem to some extent with the scaffolding provided and invoke the relevant principles in the quiz problem, they were not necessarily able to apply the principles correctly. We also conducted think-aloud interviews with six introductory students in order to understand in depth the difficulties they had and explore strategies to provide better scaffolding. The interviews suggest that students often superficially mapped the principles employed in the solved problem to the quiz problem without necessarily understanding the governing conditions underlying each principle and examining the applicability of the principle in the new situation in an in-depth manner. Findings suggest that more scaffolding is needed to help students in transferring from a two-step problem to a three-step problem and applying the physics principles appropriately. We outline a few

  9. Using an isomorphic problem pair to learn introductory physics: Transferring from a two-step problem to a three-step problem

    Science.gov (United States)

    Lin, Shih-Yin; Singh, Chandralekha

    2013-12-01

    In this study, we examine introductory physics students’ ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation in which they had to learn from a solved problem provided and take advantage of what they learned from it to solve another isomorphic problem (which we call the quiz problem). The solved problem provided has two subproblems while the quiz problem has three subproblems, which is known from previous research to be challenging for introductory students. In addition to the solved problem, students also received extra scaffolding supports that were intended to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. The data analysis suggests that students had great difficulty in transferring what they learned from a two-step problem to a three-step problem. Although most students were able to learn from the solved problem to some extent with the scaffolding provided and invoke the relevant principles in the quiz problem, they were not necessarily able to apply the principles correctly. We also conducted think-aloud interviews with six introductory students in order to understand in depth the difficulties they had and explore strategies to provide better scaffolding. The interviews suggest that students often superficially mapped the principles employed in the solved problem to the quiz problem without necessarily understanding the governing conditions underlying each principle and examining the applicability of the principle in the new situation in an in-depth manner. Findings suggest that more scaffolding is needed to help students in transferring from a two-step problem to a three-step problem and applying the physics principles appropriately. We outline a few possible strategies

  10. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey.

    Science.gov (United States)

    Zhou, Huiqing; Hintze, Bradley J; Kimsey, Isaac J; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S; Al-Hashimi, Hashim M

    2015-04-20

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson-Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1'-C1' distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1'-C1' distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5'-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    Science.gov (United States)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  12. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  13. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    Permanent link: http://www.ias.ac.in/article/fulltext/jcsc/125/01/0041-0049. Keywords. Ferrocene/Lewis acid; optical rotation; frustrated Lewis pairs; organoborane. Abstract. Optically active Lewis acids and Lewis pairs were synthesized and characterized by multinuclear NMR, UV/Vis spectroscopy and elemental analysis.

  14. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  15. Calculation of the Stabilization Energies of Oxidatively Damaged Guanine Base Pairs with Guanine

    Directory of Open Access Journals (Sweden)

    Hiroshi Miyazawa

    2012-06-01

    Full Text Available DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H-oxazolone (Oz, guanidinohydantoin (Gh/iminoallantoin (Ia and spiro-imino-dihydantoin (Sp are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  16. Monte-Carlo simulations of geminate electron-hole pair dissociation in a molecular heterojunction: a two-step dissociation mechanism

    International Nuclear Information System (INIS)

    Offermans, Ton; Meskers, Stefan C.J.; Janssen, Rene A.J.

    2005-01-01

    The Monte-Carlo simulations are used to investigate the dissociation of a Coulomb correlated charge pair at an idealized interface between an electron accepting and an electron donating molecular material. In the simulations the materials are represented by cubic lattices of sites, with site the energies spread according to Gaussian distributions. The influence of temperature, applied external fields, and the width of the Gaussian densities of states distribution for both the electron and the hole transporting material are investigated. The results show that the dissociation of geminate charge pairs is assisted by disorder and the results can be understood in terms of a two-step model. In the first step, the slow carrier in the most disordered material jumps away from the interface. In the following, second step, the reduced Coulombic attraction allows the faster carrier in the less disordered material to escape from the interface by thermally activated hopping. When the rate for geminate recombination at the interface is very low ( -1 ) the simulations predict a high yield for carrier collection, as observed experimentally. Comparison of the simulated and experimentally observed temperature dependence of the collection efficiency indicates that at low temperature dissociation of the geminate charge pairs may be one of the factors limiting the device performance

  17. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  18. Variable Step Size Maximum Correntropy Criteria Based Adaptive Filtering Algorithm

    Directory of Open Access Journals (Sweden)

    S. Radhika

    2016-04-01

    Full Text Available Maximum correntropy criterion (MCC based adaptive filters are found to be robust against impulsive interference. This paper proposes a novel MCC based adaptive filter with variable step size in order to obtain improved performance in terms of both convergence rate and steady state error with robustness against impulsive interference. The optimal variable step size is obtained by minimizing the Mean Square Deviation (MSD error from one iteration to the other. Simulation results in the context of a highly impulsive system identification scenario show that the proposed algorithm has faster convergence and lesser steady state error than the conventional MCC based adaptive filters.

  19. Genomic analysis of plant chromosomes based on meiotic pairing

    Directory of Open Access Journals (Sweden)

    Lisete Chamma Davide

    2007-12-01

    Full Text Available This review presents the principles and applications of classical genomic analysis, with emphasis on plant breeding. The main mathematical models used to estimate the preferential chromosome pairing in diploid or polyploid, interspecific or intergenera hybrids are presented and discussed, with special reference to the applications and studies for the definition of genome relationships among species of the Poaceae family.

  20. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...

  1. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  2. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... [Dixit SB, Mezei M and Beveridge DL 2012 Studies of base pair sequence effects on DNA salvation based on all-atom molecular dynamics simulations. J. Biosci. 37 399–421] DOI 10.1007/s12038-012-9223-5. 1. Introduction. Solvation plays an integral role in stabilizing the structure of the DNA molecule in ...

  3. Constructing an exposure chart: step by step (based on standard procedures)

    International Nuclear Information System (INIS)

    David, Jocelyn L; Cansino, Percedita T.; Taguibao, Angileo P.

    2000-01-01

    An exposure chart is very important in conducting radiographic inspection of materials. By using an accurate exposure chart, an inspector is able to avoid a trial and error way of determining correct time to expose a specimen, thereby producing a radiograph that has an acceptable density based on a standard. The chart gives the following information: x-ray machine model and brand, distance of the x-ray tube from the film, type and thickness of intensifying screens, film type, radiograph density, and film processing conditions. The methods of preparing an exposure chart are available in existing radiographic testing manuals. These described methods are presented in step by step procedures, covering the actual laboratory set-up, data gathering, computations, and transformation of derived data into Characteristic Curve and Exposure Chart

  4. Structures and stabilities of small DNA dumbbells with Watson-Crick and Hoogsteen base pairs.

    Science.gov (United States)

    Escaja, Nuria; Gómez-Pinto, Irene; Rico, Manuel; Pedroso, Enrique; González, Carlos

    2003-07-07

    The structures and stabilities of cyclic DNA octamers of different sequences have been studied by NMR and CD spectroscopy and by restrained molecular dynamics. At low oligonucleotide concentrations, some of these molecules form stable monomeric structures consisting of a short stem of two base pairs connected by two mini-loops of two residues. To our knowledge, these dumbbell-like structures are the smallest observed to date. The relative stabilities of these cyclic dumbbells have been established by studying their melting transitions. Dumbbells made up purely of GC stems are more stable than those consisting purely of AT base pairs. The order of the base pairs closing the loops also has an important effect on the stabilities of these structures. The NMR data indicate that there are significant differences between the solution structures of dumbbells with G-C base pairs in the stem compared to those with A-T base pairs. In the case of dumbbells with G-C base pairs, the residues in the stem form a short segment of a BDNA helix stabilized by two Watson-Crick base pairs. In contrast, in the case of d, the stem is formed by two A-T base pairs with the glycosidic angles of the adenine bases in a syn conformation, most probably forming Hoogsteen base pairs. Although the conformations of the loop residues are not very well defined, the thymine residues at the first position of the loop are observed to fold back into the minor groove of the stem.

  5. SIMULATION COMPARISON AND STEPS TO DO SIMULATION BY AUTOLISP (AUTOCAD) AND PRO-E FOR GEAR PAIR.

    OpenAIRE

    PRATIK A. SOLANKI; KALPESH P. PATEL; J.R.LIMBACHIYA

    2012-01-01

    This paper gives the basic idea of steps required for doing simulation in AutoCAD with the help of AutoLisp and Pro-Engineering. It includes the comparison between both methods. AutoCAD 2005 and Pro-E wildfireV4.0 used as software to do simulation (Animation).

  6. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    Science.gov (United States)

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  7. Using an Isomorphic Problem Pair to Learn Introductory Physics: Transferring from a Two-Step Problem to a Three-Step Problem

    Science.gov (United States)

    Lin, Shih-Yin; Singh, Chandralekha

    2013-01-01

    In this study, we examine introductory physics students' ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation…

  8. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... base pair sequence, both via direct interactions and indirectly via sequence preferences for ... Supplementary materials pertaining to this article are available on the Journal of Biosciences Website at http://www.ias.ac.in/jbiosci/ ..... trapped for fairly long times by current routine simulation lengths (~10 ns) but ...

  9. Extracurricular Activities in the Steps of Aim-Based Education

    Directory of Open Access Journals (Sweden)

    Yunus Yildiz

    2017-11-01

    Full Text Available Teachers and students’ competence applying the required steps in learning process takes paramount place depending on the aim-based education. Hence, by this study, it is aimed to enhance the students’ motivation by applying the right learning steps. In addition, this study facilitates teachers’ ability to make a decision about which methods, approaches and stage orders to follow confidently while teaching a foreign language to any learner. Consequently, it is emphasized that quality learning process needs motivation which may be provided by extracurricular activities.

  10. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Conducting Task-Based Interviews with Pairs of Children: Consensus, Conflict, Knowledge Construction and Turn Taking

    Science.gov (United States)

    Houssart, Jenny; Evens, Hilary

    2011-01-01

    This article explores theoretical and methodological issues associated with task-based interviews conducted with pairs of children. We explore different approaches to interviews from sociological, psychological and subject-based perspectives. Our interviews, concerning mathematical questions and carried out with pairs of 10 and 11-year-olds, are…

  12. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  13. Structural landscape of base pairs containing post-transcriptional modifications in RNA.

    Science.gov (United States)

    Seelam, Preethi P; Sharma, Purshotam; Mitra, Abhijit

    2017-06-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. © 2017 Seelam et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. Thermal neutral format based on the step technology

    Science.gov (United States)

    Almazan, P. Planas; Legal, J. L.

    1995-01-01

    The exchange of models is one of the most serious problems currently encountered in the practice of spacecraft thermal analysis. Essentially, the problem originates in the diversity of computing environments that are used across different sites, and the consequent proliferation of native tool formats. Furthermore, increasing pressure to reduce the development's life cycle time has originated a growing interest in the so-called spacecraft concurrent engineering. In this context, the realization of the interdependencies between different disciplines and the proper communication between them become critical issues. The use of a neutral format represents a step forward in addressing these problems. Such a means of communication is adopted by consensus. A neutral format is not directly tied to any specific tool and it is kept under stringent change control. Currently, most of the groups promoting exchange formats are contributing with their experience to STEP, the Standard for Exchange of Product Model Data, which is being developed under the auspices of the International Standards Organization (ISO 10303). This paper presents the different efforts made in Europe to provide the spacecraft thermal analysis community with a Thermal Neutral Format (TNF) based on STEP. Following an introduction with some background information, the paper presents the characteristics of the STEP standard. Later, the first efforts to produce a STEP Spacecraft Thermal Application Protocol are described. Finally, the paper presents the currently harmonized European activities that follow up and extend earlier work on the area.

  15. Fingerprint identification using SIFT-based minutia descriptors and improved all descriptor-pair matching.

    Science.gov (United States)

    Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

    2013-03-06

    The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  16. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  17. Paired fuzzy sets and other opposite-based models

    DEFF Research Database (Denmark)

    Montero, Javier; Gómez, Daniel; Tinguaro Rodríguez, J.

    2016-01-01

    In this paper we stress the relevance of those fuzzy models that impose a couple of simultaneous views in order to represent concepts. In particular, we point out that the basic model to start with should contain at least two somehow opposite valuations plus a number of neutral concepts that are ......In this paper we stress the relevance of those fuzzy models that impose a couple of simultaneous views in order to represent concepts. In particular, we point out that the basic model to start with should contain at least two somehow opposite valuations plus a number of neutral concepts...... that are generated from the semantic relationship between those two opposites. Such a basic model should be distinguished from some other similar approaches that can be found in the literature, and that may bring some difficulties in intuition, partially because of their denomination. The general term “paired fuzzy...

  18. Optical three-step binary-logic-gate-based MSD arithmetic

    Science.gov (United States)

    Fyath, R. S.; Alsaffar, A. A. W.; Alam, M. S.

    2003-11-01

    A three-step modified signed-digit (MSD) adder is proposed which can be optically implmented using binary logic gates. The proposed scheme depends on encoding each MSD digits into a pair of binary digits using a two-state and multi-position based encoding scheme. The design algorithm depends on constructing the addition truth table of binary-coded MSD numbers and then using Karnaugh map to achieve output minimization. The functions associated with the optical binary logic gates are achieved by simply programming the decoding masks of an optical shadow-casting logic system.

  19. Data-Based Predictive Control with Multirate Prediction Step

    Science.gov (United States)

    Barlow, Jonathan S.

    2010-01-01

    Data-based predictive control is an emerging control method that stems from Model Predictive Control (MPC). MPC computes current control action based on a prediction of the system output a number of time steps into the future and is generally derived from a known model of the system. Data-based predictive control has the advantage of deriving predictive models and controller gains from input-output data. Thus, a controller can be designed from the outputs of complex simulation code or a physical system where no explicit model exists. If the output data happens to be corrupted by periodic disturbances, the designed controller will also have the built-in ability to reject these disturbances without the need to know them. When data-based predictive control is implemented online, it becomes a version of adaptive control. One challenge of MPC is computational requirements increasing with prediction horizon length. This paper develops a closed-loop dynamic output feedback controller that minimizes a multi-step-ahead receding-horizon cost function with multirate prediction step. One result is a reduced influence of prediction horizon and the number of system outputs on the computational requirements of the controller. Another result is an emphasis on portions of the prediction window that are sampled more frequently. A third result is the ability to include more outputs in the feedback path than in the cost function.

  20. SU-F-J-66: Anatomy Deformation Based Comparison Between One-Step and Two-Step Optimization for Online ART

    International Nuclear Information System (INIS)

    Feng, Z; Yu, G; Qin, S; Li, D; Ma, C; Zhu, J; Yin, Y

    2016-01-01

    Purpose: This study investigated that how the quality of adapted plan was affected by inter-fractional anatomy deformation by using one-step and two-step optimization for on line adaptive radiotherapy (ART) procedure. Methods: 10 lung carcinoma patients were chosen randomly to produce IMRT plan by one-step and two-step algorithms respectively, and the prescribed dose was set as 60 Gy on the planning target volume (PTV) for all patients. To simulate inter-fractional target deformation, four specific cases were created by systematic anatomy variation; including target superior shift 0.5 cm, 0.3cm contraction, 0.3 cm expansion and 45-degree rotation. Based on these four anatomy deformation, adapted plan, regenerated plan and non-adapted plan were created to evaluate quality of adaptation. Adapted plans were generated automatically by using one-step and two-step algorithms respectively to optimize original plans, and regenerated plans were manually created by experience physicists. Non-adapted plans were produced by recalculating the dose distribution based on corresponding original plans. The deviations among these three plans were statistically analyzed by paired T-test. Results: In PTV superior shift case, adapted plans had significantly better PTV coverage by using two-step algorithm compared with one-step one, and meanwhile there was a significant difference of V95 by comparison with adapted and non-adapted plans (p=0.0025). In target contraction deformation, with almost same PTV coverage, the total lung received lower dose using one-step algorithm than two-step algorithm (p=0.0143,0.0126 for V20, Dmean respectively). In other two deformation cases, there were no significant differences observed by both two optimized algorithms. Conclusion: In geometry deformation such as target contraction, with comparable PTV coverage, one-step algorithm gave better OAR sparing than two-step algorithm. Reversely, the adaptation by using two-step algorithm had higher efficiency

  1. [Fourier Transform Spectrometer Based on Rotating Parallel-Mirror-Pair].

    Science.gov (United States)

    Zhao, Bao-wei; Xiangli, Bin; Cai, Qi-sheng; Lü, Qun-bo; Zhou, Jin-song

    2015-11-01

    In the temporally-modulated Fourier transform spectroscopy, the translational moving mirror is difficult to drive accurately, causing tilt and shear problems. While, a rotational moving mirror can solve these problems. A rotary Fourier transform spectrometer is recommanded in this paper. Its principle is analyzed and the optical path difference is deduced. Also, the constrains for engineering realization are presented. This spectrometer consists of one beamsplitter, two fixed mirrors, one rotating parallel mirror pair, a collimating lens, a collecting lens, and one detector. From it's principle, this spectrometer show a simple structure, and it is assembled and adjustmented easily because the two split light are interfered with each other after reflected through the same plane mirror; By calculating the expression of it's optical path difference, the spectrometer is easy to realize large optical path difference, meaning high spectral resolution; Through analyzing it's engineering design constraints and computer simulation, it is known that the spectrometer should get the high resolution sample by high-speed spinning motor, so it is easy to achieve precise motion control, good stability, fast measurement speed.

  2. A step-by-step guide to office-based sperm retrieval for obstructive azoospermia.

    Science.gov (United States)

    Coward, Robert M; Mills, Jesse N

    2017-08-01

    A variety of surgical options exists for sperm retrieval in the setting of obstructive azoospermia (OA). With appropriate preparation, the majority of these techniques can safely be performed in the office with local anesthesia and with or without monitored anesthesia care (MAC). The available techniques include percutaneous options such as percutaneous epididymal sperm aspiration (PESA) and testicular sperm aspiration (TESA), as well as open techniques that include testicular sperm extraction (TESE) and microsurgical epididymal sperm aspiration (MESA). In addition to providing a step-by-step description of each available approach, we introduce and describe a new technique for sperm retrieval for OA called minimally invasive epididymal sperm aspiration (MIESA). The MIESA utilizes a tiny keyhole incision, and the epididymis is exposed without testicular delivery. Epididymal aspiration is performed in the style of MESA, except using loupe magnification rather than an operating microscope. MIESA is a safe, office-based procedure in which millions of motile sperm can be retrieved for cryopreservation. While we prefer the MIESA technique for OA, there remain distinct advantages of each open and percutaneous approach. In the current era of assisted reproductive technology, sperm retrieval rates for OA should approach 100% regardless of the technique. This reference provides a roadmap for both advanced and novice male reproductive surgeons to guide them through every stage of sperm retrieval for OA, including preoperative evaluation, patient selection, procedural techniques, and complications. With the incredible advances in in vitro fertilization (IVF), combined with innovative surgical treatment for male factor infertility in recent years, OA is no longer a barrier for men to become biologic fathers.

  3. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  4. Investigation of Nascent Base Pair and Polymerase Behavior in the Presence of Mismatches in DNA Polymerase I Using Molecular Dynamics.

    Science.gov (United States)

    Yeager, Andrew; Humphries, Kathryn; Farmer, Ellen; Cline, Gene; Miller, Bill R

    2018-02-26

    Optimizing DNA polymerases for a broad range of tasks requires an understanding of the factors influencing polymerase fidelity, but many details of polymerase behavior remain unknown, especially in the presence of mismatched nascent base pairs. Using molecular dynamics, the large fragment of Bacillus stearothermophilus DNA polymerase I is simulated in the presence of all 16 possible standard nucleoside triphosphate-template (dNTP-dN) pairs, including four Watson-Crick pairs and 12 mismatches. The precatalytic steps of nucleotide addition from nucleotide insertion to immediately preceding catalysis are explored using three starting structures representing different stages of nucleotide addition. From these simulations, interactions between dNTPs and the DNA-protein complex formed by the polymerase are elucidated. Patterns of large-scale conformational shifts, classification of nucleotide pairs based on composition, and investigation of the roles of residues interacting with dNTPs are completed on 50+ μs of simulation. The role of molecular dynamics in studies of polymerase behavior is discussed.

  5. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson -Crick/Sugar Edge Subject RIV: BO - Biophysics

  6. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  7. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  8. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  9. INSURANCE CONTRACTS BASED ON INDICES, A STEP TOWARDS WEATHER DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Boton#537; Horia-Mircea

    2012-07-01

    Full Text Available The aim of this paper is to analyze the methodology of structuring an index based insurance contract. The weather has always been the biggest risk factor in agriculture, affecting all aspects of the economic sectors. In the developed countries of the world, there is a significant number of rain-dependent farmers. To gain insight into potential growth of weather markets in developed countries, we are going to analyze the case of India. In 2003, Basix microfinance company in Hyderabad and ICICI Lombard insurance company in Mumbai have launched a pilot weather insurance, which had as basic index phenomena for Mahahbubnagar district of Andhra Pradesh. Further detail can be found in the full-paper. In the paper we will enumerate the appropriate steps in the determining the necessity for the use of index based insurances. The appropriate stages are making a comparison between index based insurances and traditional insurances, and optimizing the use of weather indices in insurance contracts. In order for the contracts to be successful , the recommended steps are : developing a product based in an index, and after the we need to plan and implement the contract. In planning the implementation it is needed that we: identify the risks and areas where they manifest, then identify the best distribution channels; after this we can develop a prototype of the contract. The next step would the testing of the negotiability of the contract, then the contract is opened to be finalized. After this the index based insurance contract can be introduced to the market, but the program needs monitoring in order to insure its successfulness. In order for the market and contract to grow the necessary step are: having access to the necessary meteorological data, determine the optimal way of integrating the contract in the existing economical context, technical feasibility, property rights and the legal framework. In the end, the aim is to familiarize the literacy field and

  10. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  11. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...

  12. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    In keeping with this general trend, all the systems with only one hydrogen bond between the bases, on relaxed optimization, show huge RMS deviation and lead to significant improvements in their interaction energies. As expected, the hydrogen bonding patterns in their relaxed geometries are also very different from their ...

  13. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  14. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  15. Detection of base pair mismatches in duplex DNA and RNA oligonucleotides using electrospray mass spectrometry

    Science.gov (United States)

    Griffey, Richard H.; Greig, Michael J.

    1997-05-01

    The identify and location of base pair mismatches in non- covalent DNA:RNA duplexes are established using MS and MS-MS on a quadruple ion trap with electrospray ionization (ESI). MS-MS experiments on a 14mer duplex (D) with a single C:A base pair mismatch using lower activation energy results in selective cleavage of the mismatched A nucleobase, even in the presence of the wild-type duplex. The location of the mismatch base pair can be discerned via presence of the wild-type duplex. The location of the mismatch base pair can be discerned via selection of the (D-5H)5- ion and fragmentation of the backbone at that location in a n additional MS-MS experiment. Selective fragmentation is observed for C in a C-C mismatched base pair, which is very difficult to detect using chemical cleavage or E. coli mismatch binding protein. In an RNA:DNA duplex with a single base pair mismatch, the DNA base is removed without fragmentation of the RNA strand, greatly simplifying the interpretation of the resulting MS spectrum. A method is presented for detecting two DNA strands, for example a point mutation which generates an oncogenic phenotype, and the wild-type message. The results suggest that ESI-MS-MS may provide a rapid and selective method to identify and locate genetic mutations without the need for chemical degradation or protein binding followed by gel electrophoresis.

  16. Theory of nodal s ± -wave pairing symmetry in the Pu-based 115 superconductor family.

    Science.gov (United States)

    Das, Tanmoy; Zhu, Jian-Xin; Graf, Matthias J

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-Tc superconductors and predict the presence of a nodal s(±) wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface "hot-spots" in the inter-band scattering channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s(±) wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.

  17. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  18. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    Energy Technology Data Exchange (ETDEWEB)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart [Biodesign Institute, Arizona State University, Tempe, AZ 85287 (United States); Young, Michael [Department of Physics, Arizona State University, Tempe, AZ 85287 (United States)], E-mail: Stuart.Lindsay@asu.edu

    2009-05-06

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  19. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  20. Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

    2013-03-26

    Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

  1. On the Solvability of 2-pair Unicast Networks --- A Cut-based Characterization

    OpenAIRE

    Cai, K.; Letaief, K. B.; Fan, P.; Feng, R.

    2010-01-01

    In this paper, we propose a subnetwork decomposition/combination approach to investigate the single rate $2$-pair unicast problem. It is shown that the solvability of a $2$-pair unicast problem is completely determined by four specific link subsets, namely, $\\mathcal A_{1,1}$, $\\mathcal A_{2,2}$, $\\mathcal A_{1,2}$ and $\\mathcal A_{2,1}$ of its underlying network. As a result, an efficient cut-based algorithm to determine the solvability of a $2$-pair unicast problem is presented.

  2. Pairing susceptibility of iron-based superconductors within a two-layer Hubbard model

    Science.gov (United States)

    Wei, Dan; Wang, Jingyao; Wu, Yang; Liang, Ying; Ma, Tianxing

    2017-12-01

    By using the determinant quantum Monte Carlo method, we studied the dominant pairing susceptibility of iron-based superconductors within an extended Hubbard model, which describes the underlying electronic structure of both iron pnictides and iron chalcogenides. The extended Hubbard model is constructed by two iron layers, each of which forms two sublattices on a square structure. Although the coupling between the two layers has different effects on the behavior of pairings in iron pnictides and iron chalcogenides, our non-biased numerical simulations reveal that the pairing with Sxy symmetry dominates over the studied parameter for both materials.

  3. Steps towards a SAR-based wind atlas in the Baltic Sea

    DEFF Research Database (Denmark)

    Hasager, Charlotte Bay; Badger, Merete; Pena Diaz, Alfredo

    these years several offshore meteorological masts have been in operation. The first step was to assess the accuracy of SAR-based wind mapping in this region. We compared SAR-based wind maps retrieved from ANSWRS the APL/NOAA SAR Wind Retrieval System. The NOGAPS wind direction data were interpolated in space...... and time prior to input in CMOD-5. Around 900 collocated pairs of observations were found between the SAR-based wind maps and the 10 offshore meteorological masts. The statistical comparison on wind speed (direction) showed root mean square error 1.17 m/s (6.29°), bias of -0.25 m/s (7.75°), standard...... deviation of 1.88 m/s (20.11°), and linear correlation coefficient R2 of 0.783 (0.95°). The second step was estimation of the mean wind speed, the Weibull scale and shape parameters, and energy density based on over 1000 SAR-based wind maps for the Baltic Sea. The results were compared to the FINO-2...

  4. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    Science.gov (United States)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  5. From Understanding the Development Landscape of the Canonical Fate-Switch Pair to Constructing a Dynamic Landscape for Two-Step Neural Differentiation

    Science.gov (United States)

    2012-01-01

    Abstract Recent progress in stem cell biology, notably cell fate conversion, calls for novel theoretical understanding for cell differentiation. The existing qualitative concept of Waddington’s “epigenetic landscape” has attracted particular attention because it captures subsequent fate decision points, thus manifesting the hierarchical (“tree-like”) nature of cell fate diversification. Here, we generalized a recent work and explored such a developmental landscape for a two-gene fate decision circuit by integrating the underlying probability landscapes with different parameters (corresponding to distinct developmental stages). The change of entropy production rate along the parameter changes indicates which parameter changes can represent a normal developmental process while other parameters’ change can not. The transdifferentiation paths over the landscape under certain conditions reveal the possibility of a direct and reversible phenotypic conversion. As the intensity of noise increases, we found that the landscape becomes flatter and the dominant paths more straight, implying the importance of biological noise processing mechanism in development and reprogramming. We further extended the landscape of the one-step fate decision to that for two-step decisions in central nervous system (CNS) differentiation. A minimal network and dynamic model for CNS differentiation was firstly constructed where two three-gene motifs are coupled. We then implemented the SDEs (Stochastic Differentiation Equations) simulation for the validity of the network and model. By integrating the two landscapes for the two switch gene pairs, we constructed the two-step development landscape for CNS differentiation. Our work provides new insights into cellular differentiation and important clues for better reprogramming strategies. PMID:23300518

  6. From understanding the development landscape of the canonical fate-switch pair to constructing a dynamic landscape for two-step neural differentiation.

    Directory of Open Access Journals (Sweden)

    Xiaojie Qiu

    2012-12-01

    Full Text Available Recent progress in stem cell biology, notably cell fate conversion, calls for novel theoretical understanding for cell differentiation. The existing qualitative concept of Waddington's "epigenetic landscape" has attracted particular attention because it captures subsequent fate decision points, thus manifesting the hierarchical ("tree-like" nature of cell fate diversification. Here, we generalized a recent work and explored such a developmental landscape for a two-gene fate decision circuit by integrating the underlying probability landscapes with different parameters (corresponding to distinct developmental stages. The change of entropy production rate along the parameter changes indicates which parameter changes can represent a normal developmental process while other parameters' change can not. The transdifferentiation paths over the landscape under certain conditions reveal the possibility of a direct and reversible phenotypic conversion. As the intensity of noise increases, we found that the landscape becomes flatter and the dominant paths more straight, implying the importance of biological noise processing mechanism in development and reprogramming. We further extended the landscape of the one-step fate decision to that for two-step decisions in central nervous system (CNS differentiation. A minimal network and dynamic model for CNS differentiation was firstly constructed where two three-gene motifs are coupled. We then implemented the SDEs (Stochastic Differentiation Equations simulation for the validity of the network and model. By integrating the two landscapes for the two switch gene pairs, we constructed the two-step development landscape for CNS differentiation. Our work provides new insights into cellular differentiation and important clues for better reprogramming strategies.

  7. Vertebra segmentation based on two-step refinement.

    Science.gov (United States)

    Courbot, Jean-Baptiste; Rust, Edmond; Monfrini, Emmanuel; Collet, Christophe

    Knowledge of vertebra location, shape, and orientation is crucial in many medical applications such as orthopedics or interventional procedures. Computed tomography (CT) offers a high contrast between bone and soft tissues, but automatic vertebra segmentation remains difficult. Hence, the wide range of shapes, aging, and degenerative joint disease alterations as well as the variety of pathological cases encountered in an aging population make automatic segmentation sometimes challenging. Besides, daily practice implies a need for affordable computation time. This paper aims to present a new automated vertebra segmentation method (using a first bounding box for initialization) for CT 3D data which tackles these problems. This method is based on two consecutive steps. The first one is a new coarse-to-fine method efficiently reducing the data amount to obtain a coarse shape of the vertebra. The second step consists in a hidden Markov chain (HMC) segmentation using a specific volume transformation within a Bayesian framework. Our method does not introduce any prior on the expected shape of the vertebra within the bounding box and thus deals with the most frequent pathological cases encountered in daily practice. We experiment this method on a set of standard lumbar, thoracic, and cervical vertebrae and on a public dataset, on pathological cases, and in a simple integration example. Quantitative and qualitative results show that our method is robust to changes in shapes and luminance and provides correct segmentation with respect to pathological cases.

  8. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  9. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  10. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  11. Cytosine-Cytosine Base-Pair Mismatch and Chirality in Nucleotide Supramolecular Coordination Complexes.

    Science.gov (United States)

    Qiu, Qi-Ming; Zhou, Pei; Gu, Leilei; Hao, Liang; Liu, Minghua; Li, Hui

    2017-05-29

    The base-pair sequences are the foundation for the biological processes of DNA or RNA, and base-pair mismatch is very important to reveal genetic diseases and DNA rearrangements. However, the lack of well-defined structural information about base-pair mismatch is obstructing the investigation of this issue. The challenge is to crystallize the materials containing the base-pair mismatch. Engineering the small-molecule mimics or model is an effective strategy to solve this issue. Here, six cytidine-5'-monophosphate (CMP) and 2'-deoxycytidine-5'-monophosphate (dCMP) coordination polymers were reported containing cytosine-cytosine base-pair mismatch (i-motif), and their single-crystal structures and chiralities were studied. The precise control over the formation of the i-motif was demonstrated, in which the regulating of supramolecular interactions was achieved based on molecular design. In addition, the chiralities of these coordination polymers were investigated according to their crystal structures and solution- and solid-state circular dichroism spectroscopy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Algal-based, single-step treatment of urban wastewaters.

    Science.gov (United States)

    Henkanatte-Gedera, S M; Selvaratnam, T; Caskan, N; Nirmalakhandan, N; Van Voorhies, W; Lammers, Peter J

    2015-08-01

    Currently, urban wastewaters (UWW) laden with organic carbon (BOD) and nutrients (ammoniacal nitrogen, N, and phosphates, P) are treated in multi-stage, energy-intensive process trains to meet the mandated discharge standards. This study presents a single-step process based on mixotrophic metabolism for simultaneous removal of carbon and nutrients from UWWs. The proposed system is designed specifically for hot, arid environments utilizing an acidophilic, thermotolerant algal species, Galdieria sulphuraria, and an enclosed photobioreactor to limit evaporation. Removal rates of BOD, N, and P recorded in this study (14.93, 7.23, and 1.38 mg L(-1) d(-1), respectively) are comparable to literature reports. These results confirm that the mixotrophic system can reduce the energy costs associated with oxygen supply in current UWW treatment systems, and has the potential to generate more energy-rich biomass for net energy extraction from UWW. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Density functional MO calculation for stacked DNA base-pairs with backbones.

    Science.gov (United States)

    Kurita, N; Kobayashi, K

    2000-05-01

    In order to elucidate the effect of the sugar and phosphate backbones on the stable structure and electronic properties of stacked DNA base-pairs, we performed ab initio molecular orbital (MO) calculations based on the density functional theory and Slater-type basis set. As a model cluster for stacked base-pairs, we employed three isomers for the dimer unit of stacked guanine-cytosine pairs composed with backbones as well as base-pairs. These structures were fully optimized and their electronic properties were self-consistently investigated. By including the backbones, the difference in total energy among the isomers was largely enhanced, while the trend in relative stability was not changed. The effect of backbones on the electronic properties is remarkable: the MOs with the character of the PO4 parts of backbones appear just below the highest-occupied MO. This result indicates that the PO4 parts might play a rule as a reaction site in chemical processes concerning DNA. Therefore, we conclude that the DNA backbones are indispensable for investigating the stability and electronic properties of the stacked DNA base-pairs.

  14. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  15. Development of a one-step PCR assay with nine primer pairs for the detection of five diarrheagenic Escherichia coli types.

    Science.gov (United States)

    Oh, Kyung-Hwan; Kim, Soo-Bok; Park, Mi-Sun; Cho, Seung-Hak

    2014-06-28

    Certain Escherichia coli (E. coli) strains have the ability to cause diarrheal disease. Five types of diarrheagenic E. coli have been identified, including EHEC, ETEC, EPEC, EAEC, and EIEC. To detect these five diarrheagenic types rapidly, we developed a one-step multiplex PCR (MPPCR) assay using nine primer pairs to amplify nine virulence genes specific to the different virotypes, with each group being represented (i.e., stx1 and stx2 for EHEC, lt, sth, and stp for ETEC, eaeA and bfpA for EPEC, aggR for EAEC, and ipaH for EIEC). The PCR primers were constructed using MultAlin. The sensitivity and specificity of the constructed multiplex PCR primers were measured using DNA isolated from diarrheagenic E. coli strains representing each group. The limits of detection were as follows: 5 × 10(1) CFU/ml for EHEC, 5 × 10(3) CFU/ml for ETEC expressing lt and sth, 5 × 10(4) CFU/ml for ETEC expressing stp, 5 × 102 CFU/ml for EPEC, 5 × 10(4) CFU/ml for EAEC, and 5 × 10(2) CFU/ml for EIEC. To confirm the specificity, C. jejuni, C. perfringens, S. Typhimurium, V. parahaemolyticus, L. monocytogenes, Y. enterocolitica, B. cereus, and S. aureus were used as negative controls, and no amplification was obtained for these. Moreover, this kit was validated using 100 fecal samples from patients with diarrhea and 150 diarrheagenic E. coli strains isolated in Korea. In conclusion, the multiplex PCR assay developed in this study is very useful for the rapid and specific detection of five diarrheagenic E. coli types. This single-step assay will be useful as a rapid and economical method, as it reduces the cost and time required for the identification of diarrheagenic E. coli.

  16. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    Science.gov (United States)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  17. Flow-based market coupling. Stepping stone towards nodal pricing?

    International Nuclear Information System (INIS)

    Van der Welle, A.J.

    2012-07-01

    For achieving one internal energy market for electricity by 2014, market coupling is deployed to integrate national markets into regional markets and ultimately one European electricity market. The extent to which markets can be coupled depends on the available transmission capacities between countries. Since interconnections are congested from time to time, congestion management methods are deployed to divide the scarce available transmission capacities over market participants. For further optimization of the use of available transmission capacities while maintaining current security of supply levels, flow-based market coupling (FBMC) will be implemented in the CWE region by 2013. Although this is an important step forward, important hurdles for efficient congestion management remain. Hence, flow based market coupling is compared to nodal pricing, which is often considered as the most optimal solution from theoretical perspective. In the context of decarbonised power systems it is concluded that advantages of nodal pricing are likely to exceed its disadvantages, warranting further development of FBMC in the direction of nodal pricing.

  18. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  19. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  20. Long-read ChIA-PET for base-pair-resolution mapping of haplotype-specific chromatin interactions.

    Science.gov (United States)

    Li, Xingwang; Luo, Oscar Junhong; Wang, Ping; Zheng, Meizhen; Wang, Danjuan; Piecuch, Emaly; Zhu, Jacqueline Jufen; Tian, Simon Zhongyuan; Tang, Zhonghui; Li, Guoliang; Ruan, Yijun

    2017-05-01

    Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) is a robust method for capturing genome-wide chromatin interactions. Unlike other 3C-based methods, it includes a chromatin immunoprecipitation (ChIP) step that enriches for interactions mediated by specific target proteins. This unique feature allows ChIA-PET to provide the functional specificity and higher resolution needed to detect chromatin interactions, which chromosome conformation capture (3C)/Hi-C approaches have not achieved. The original ChIA-PET protocol generates short paired-end tags (2 × 20 base pairs (bp)) to detect two genomic loci that are far apart on linear chromosomes but are in spatial proximity in the folded genome. We have improved the original approach by developing long-read ChIA-PET, in which the length of the paired-end tags is increased (up to 2 × 250 bp). The longer PET reads not only improve the tag-mapping efficiency but also increase the probability of covering phased single-nucleotide polymorphisms (SNPs), which allows haplotype-specific chromatin interactions to be identified. Here, we provide the detailed protocol for long-read ChIA-PET that includes cell fixation and lysis, chromatin fragmentation by sonication, ChIP, proximity ligation with a bridge linker, Tn5 tagmentation, PCR amplification and high-throughput sequencing. For a well-trained molecular biologist, it typically takes 6 d from cell harvesting to the completion of library construction, up to a further 36 h for DNA sequencing and <20 h for processing of raw sequencing reads.

  1. Theoretical study of the scalar coupling constants across the noncovalent contacts in RNA base pairs: The cis- and trans-Watson-Crick/sugar edge base pair family

    Czech Academy of Sciences Publication Activity Database

    Vokáčová, Zuzana; Šponer, Jiří; Šponer, Judit E.; Sychrovský, Vladimír

    2007-01-01

    Roč. 111, č. 36 (2007), s. 10813-10824 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA203/05/0388; GA ČR(CZ) GA203/06/0420; GA AV ČR(CZ) IAA400550701; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : RNA base pairs * NMR spin-spin coupling constant * theoretical calculations Subject RIV: BO - Biophysics Impact factor: 4.086, year: 2007

  2. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  3. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  4. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  5. New ab initio based pair potential for accurate simulation of phase transitions in ZnO

    NARCIS (Netherlands)

    Wang, Shuaiwei; Fan, Zhaochuan; Koster, Rik S.; Fang, Changming; Van Huis, Marijn A.; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; Vlugt, Thijs J H

    2014-01-01

    A set of interatomic pair potentials is developed for ZnO based on the partially charged rigid ion model (PCRIM). The derivation of the potentials combines lattice inversion, empirical fitting, and ab initio energy surface fitting. We show that, despite the low number of parameters in this model

  6. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  7. Optimization of the pyridyl nucleobase scaffold for polymerase recognition and unnatural base pair replication

    Czech Academy of Sciences Publication Activity Database

    Hari, Y.; Hwang, G. T.; Leconte, A. M.; Joubert, Nicolas; Hocek, Michal; Romesberg, F. E.

    2008-01-01

    Roč. 9, č. 17 (2008), s. 2796-2799 ISSN 1439-4227 R&D Projects: GA MŠk LC512 Grant - others:NIH(US) GM60005 Institutional research plan: CEZ:AV0Z40550506 Keywords : pyridines * C-nucleosides * base-pairs * DNA polymerase * replication Subject RIV: CC - Organic Chemistry Impact factor: 3.322, year: 2008

  8. Spin wave mediated interaction as a mechanism of pairs formation in iron-based superconductors

    Science.gov (United States)

    Lima, Leonardo S.

    2018-03-01

    The spin wave mediated interaction between electrons has been proposed as mechanism to formation of electron pairs in iron-based superconductors. We employe the diagrammatic expansion to calculate the binding energy of electrons pairs mediated by spin wave. Therefore, we propose the coupling of electrons in high-temperature superconductors mediated by spin waves, since that is well known that this class of superconductors materials if relates with spin-1/2 two-dimensional antiferromagnets, where it is well known there be an interplay between antiferromagnetism 2D and high-temperature superconductivity.

  9. RNA Base Pairing Determines the Conformations of RNA Inside Spherical Viruses

    Science.gov (United States)

    Erdemci-Tandogan, Gonca; Orland, Henri; Zandi, Roya

    2017-11-01

    Many simple RNA viruses enclose their genetic material by a protein shell called the capsid. While the capsid structures are well characterized for most viruses, the structure of RNA inside the shells and the factors contributing to it remain poorly understood. We study the impact of base pairing on the conformations of RNA and find that it undergoes a swollen coil to globule continuous transition as a function of the strength of the pairing interaction. We also observe a first order transition and kink profile as a function of RNA length. All these transitions could explain the different RNA profiles observed inside viral shells.

  10. Practical Biostatistics A Friendly Step-by-Step Approach for Evidence-based Medicine

    CERN Document Server

    Suchmacher, Mendel

    2012-01-01

    Evidence-based medicine aims to apply the best available evidence gained from the scientific method to medical decision making. It is a practice that uses statistical analysis of scientific methods and outcomes to drive further experimentation and diagnosis. The profusion of evidence-based medicine in medical practice and clinical research has produced a need for life scientists and clinical researchers to assimilate biostatistics into their work to meet efficacy and practical standards. Practical Biostatistics provides researchers, medical professionals, and students with a friendly, practica

  11. Liquid crystal polymer substrate based wideband tapered step antenna

    Directory of Open Access Journals (Sweden)

    Boddapati Taraka Phani MADHAV

    2015-05-01

    Full Text Available Performance study of wideband tapered step antenna on liquid crystal polymer substrate material is presented. Bandwidth enhancement is achieved by adding step serrated ground on the front side of the model along with the radiating patch. The radiating patch seems to be the intersection of two half circles connected back to back. The lower half circle radius is more than upper half circle radius. Wideband tapered step antenna is designed on the liquid crystal polymer substrate (Ultralam 3850, εr = 2.9 with dimensions of 20×20×0.5 mm. Coplanar waveguide feeding is used in this model with feed line width of 2.6 mm and gap between feed line to ground plane of 0.5 mm.

  12. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  13. Performance of the Seven-Step Procedure in Problem-Based Hospitality Management Education

    Science.gov (United States)

    Zwaal, Wichard; Otting, Hans

    2016-01-01

    The study focuses on the seven-step procedure (SSP) in problem-based learning (PBL). The way students apply the seven-step procedure will help us understand how students work in a problem-based learning curriculum. So far, little is known about how students rate the performance and importance of the different steps, the amount of time they spend…

  14. Compatibility of pedigree-based and marker-based relationships for single-step genomic prediction

    DEFF Research Database (Denmark)

    Christensen, Ole Fredslund

    2012-01-01

    Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker-based rel......Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker...... that it may be important that a single-step method is based on a model conditional on the observed markers. When data are from routine evaluation systems, selection affects the allele frequencies, and therefore both observed markers and observed phenotypes contain information about allele frequencies...... alpha/2. The parameter alpha should be determined from the markers, but since there is selection in routine evaluation systems the phenotypes in principle also provide information about this parameter. The likelihood function used for inference contains two terms. The first term is the REML...

  15. Comparison of NIR FRET pairs for quantitative transferrin-based assay

    Science.gov (United States)

    Sinsuebphon, Nattawut; Bevington, Travis; Zhao, Lingling; Ken, Abe; Barroso, Margarida; Intes, Xavier

    2014-02-01

    Transferrin (Tfn) is commonly used as a drug delivery carrier for cancer treatment. Tfn cellular internalization can be observed by Förster resonance energy transfer (FRET), which occurs when two fluorophores - donor and acceptor - are a few nanometers apart. Donor fluorescence lifetime can be used to sense and quantify FRET occurrence. In FRET state, the donor is quenched leading to a significant reduction in its lifetime. In this study, donor and acceptor near-infrared (NIR) fluorophore-labeled Tfn were used to quantify cellular internalization in breast cancer cell line (T47D). Based on donor lifetime, quantum yield and spectral data, seven NIR FRET pairs were chosen for this comparison. Performance of the different NIR FRET pairs was evaluated in vitro in multiwell plate settings and by analyzing the relationship between quenched donor fraction and acceptor:donor ratio. Additionally, we performed brightness comparison between each pairs. Several parameters, such as brightness, lifetime, R0 and FRET donor population values are used to identify the most suitable NIR FRET pair for in vivo studies in preclinical settings.

  16. Computational reprogramming of homing endonuclease specificity at multiple adjacent base pairs.

    Science.gov (United States)

    Ashworth, Justin; Taylor, Gregory K; Havranek, James J; Quadri, S Arshiya; Stoddard, Barry L; Baker, David

    2010-09-01

    Site-specific homing endonucleases are capable of inducing gene conversion via homologous recombination. Reprogramming their cleavage specificities allows the targeting of specific biological sites for gene correction or conversion. We used computational protein design to alter the cleavage specificity of I-MsoI for three contiguous base pair substitutions, resulting in an endonuclease whose activity and specificity for its new site rival that of wild-type I-MsoI for the original site. Concerted design for all simultaneous substitutions was more successful than a modular approach against individual substitutions, highlighting the importance of context-dependent redesign and optimization of protein-DNA interactions. We then used computational design based on the crystal structure of the designed complex, which revealed significant unanticipated shifts in DNA conformation, to create an endonuclease that specifically cleaves a site with four contiguous base pair substitutions. Our results demonstrate that specificity switches for multiple concerted base pair substitutions can be computationally designed, and that iteration between design and structure determination provides a route to large scale reprogramming of specificity.

  17. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Single-Base Pair Genome Editing in Human Cells by Using Site-Specific Endonucleases

    Directory of Open Access Journals (Sweden)

    Hiroshi Ochiai

    2015-09-01

    Full Text Available Genome-wide association studies have identified numerous single-nucleotide polymorphisms (SNPs associated with human diseases or phenotypes. However, causal relationships between most SNPs and the associated disease have not been established, owing to technical challenges such as unavailability of suitable cell lines. Recently, efficient editing of a single base pair in the genome was achieved using programmable site-specific nucleases. This technique enables experimental confirmation of the causality between SNPs and disease, and is potentially valuable in clinical applications. In this review, I introduce the molecular basis and describe examples of single-base pair editing in human cells. I also discuss the challenges associated with the technique, as well as possible solutions.

  19. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens th...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  20. Investigation on traceability of 3D Scanning Electron Microscopy based on the Stereo Pair Technique

    DEFF Research Database (Denmark)

    Bariani, Paolo

    The scanning electron microscope (SEM) has a big potential as a metrology instrument for micro and nanotechnology due to its unique combination of three imaging properties: • Lateral ultimate resolution down to 2nm • Large range of possible magnification levels ranging from a few hundred times...... that addresses the performance of 3D topography calculation based on surface topography imaging using secondary electrons and the Stereo Pair Technique....

  1. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  2. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  3. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  4. Iron-based superconductors: Current status of materials and pairing mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Hosono, Hideo, E-mail: hosono@msl.titech.ac.jp [Materials and Structures Laboratory & Materials Research Center for Element Strategy, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama 226-8503 (Japan); Kuroki, Kazuhiko [Department of Physics, Graduate School of Science, Osaka University, Toyonaka, Osaka 560-0043 (Japan)

    2015-07-15

    Highlight: • An up-to-date review by the discoverer and a theoretical pioneer of iron-based superconductor. - Abstract: Since the discovery of high T{sub c} iron-based superconductors in early 2008, more than 15,000 papers have been published as a result of intensive research. This paper describes the current status of iron-based superconductors (IBSC) covering most up-to-date research progress along with the some background research, focusing on materials (bulk and thin film) and pairing mechanism.

  5. Novel search space updating heuristics-based genetic algorithm for optimizing medium-scale airline crew pairing problems

    Directory of Open Access Journals (Sweden)

    Nihan Cetin Demirel

    2017-01-01

    Full Text Available This study examines the crew pairing problem, which is one of the most comprehensive problems encountered in airline planning, to generate a set of crew pairings that has minimal cost, covers all flight legs and fulfils legal criteria. In addition, this study examines current research related to crew pairing optimization. The contribution of this study is developing heuristics based on an improved dynamic-based genetic algorithm, a deadhead-minimizing pairing search and a partial solution approach (less-costly alternative pairing search. This study proposes genetic algorithm variants and a memetic algorithm approach. In addition, computational results based on real-world data from a local airline company in Turkey are presented. The results demonstrate that the proposed approach can successfully handle medium sets of crew pairings and generate higher-quality solutions than previous methods.

  6. Student Opinions about the Seven-Step Procedure in Problem-Based Hospitality Management Education

    Science.gov (United States)

    Zwaal, Wichard; Otting, Hans

    2014-01-01

    This study investigates how hospitality management students appreciate the role and application of the seven-step procedure in problem-based learning. A survey was developed containing sections about personal characteristics, recall of the seven steps, overall report marks, and 30 statements about the seven-step procedure. The survey was…

  7. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis.

    Science.gov (United States)

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA.

  8. High efficient key-insulated attribute based encryption scheme without bilinear pairing operations.

    Science.gov (United States)

    Hong, Hanshu; Sun, Zhixin

    2016-01-01

    Attribute based encryption (ABE) has been widely applied for secure data protection in various data sharing systems. However, the efficiency of existing ABE schemes is not high enough since running encrypt and decrypt algorithms need frequent bilinear pairing operations, which may occupy too much computing resources on terminal devices. What's more, since different users may share the same attributes in the system, a single user's private key exposure will threaten the security and confidentiality of the whole system. Therefore, to further decrease the computation cost in attribute based cryptosystem as well as provide secure protection when key exposure happens, in this paper, we firstly propose a high efficient key-insulated ABE algorithm without pairings. The key-insulated mechanism guarantees both forward security and backward security when key exposure or user revocation happens. Besides, during the running of algorithms in our scheme, users and attribute authority needn't run any bilinear pairing operations, which will increase the efficiency to a large extent. The high efficiency and security analysis indicate that our scheme is more appropriate for secure protection in data sharing systems.

  9. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Science.gov (United States)

    2011-01-01

    Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA) and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA). In FDAFSA, adjacent triplet-pairs (hexamer sequences) were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs) were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM), a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better) with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies and random triplet-pair

  10. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  11. Performance of the Seven-step Procedure in Problem-based Hospitality Management Education

    Directory of Open Access Journals (Sweden)

    Wichard Zwaal

    2016-12-01

    Full Text Available The study focuses on the seven-step procedure (SSP in problem-based learning (PBL. The way students apply the seven-step procedure will help us understand how students work in a problem-based learning curriculum. So far, little is known about how students rate the performance and importance of the different steps, the amount of time they spend on each step and the perceived quality of execution of the procedure. A survey was administered to a sample of 101 students enrolled in a problem-based hospitality management program. Results show that students consider step 6 (Collect additional information outside the group to be most important. The highest performance-rating is for step two (Define the problem and the lowest for step four (Draw a systemic inventory of explanations from step three. Step seven is classified as low in performance and high in importance implicating urgent attention. The average amount of time spent on the seven steps is 133 minutes with the largest part of the time spent on self-study outside the group (42 minutes. The assessment of the execution of a set of specific guidelines (the Blue Card did not completely match with the overall performance ratings for the seven steps. The SSP could be improved by reducing the number of steps and incorporating more attention to group dynamics.

  12. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    Science.gov (United States)

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Pairs for Pairs: A Theoretical Base for Co-Therapy as a Nonsexist Process in Couple Counseling.

    Science.gov (United States)

    Reese-Dukes, Judson; Reese-Dukes, Carolyn

    1983-01-01

    Reviews contemporary literature which provides a theoretical base for female-male co-therapy teams as the most likely modality to mediate sex bias in couple counseling. An egalitarian co-therapy team can encourage change by modeling independent yet mutually supportive and facilitative roles. (JAC)

  14. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    Czech Academy of Sciences Publication Activity Database

    Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří

    2010-01-01

    Roč. 38, č. 1 (2010), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010

  15. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  16. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  17. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  18. Unconventional pairing originating from disconnected Fermi surfaces in the iron-based superconductor

    OpenAIRE

    Kuroki, Kazuhiko; Aoki, Hideo

    2009-01-01

    For the iron-based high $T_c$ superconductor LaFeAsO$_{1-x}$F$_x$, we construct a minimal model, where all of the five Fe $d$ bands turn out to be involved. We then investigate the origin of superconductivity with a five-band random-phase approximation by solving the Eliashberg equation. We conclude that the spin fluctuation modes arising from the nesting between the disconnected Fermi pockets realise, basically, an extended s-wave pairing, where the gap changes sign across the nesting vector.

  19. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  20. Theoretical study of metal ion binding in modified and natural cytosine-cytosine base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Sugiyama, K.; Ono, A.; Mulder, J.; Bickelhaupt, F. M.; Tanaka, Y.; Sychrovský, Vladimír; Guerra, C. F.

    2013-01-01

    Roč. 20, č. 1 (2013), s. 39-39 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] R&D Projects: GA ČR GAP205/10/0228; GA ČR(CZ) GAP304/10/1951; GA TA ČR TA01011165 Institutional support: RVO:61388963 Keywords : DFT * NMR * base pair * metal-mediated Subject RIV: CF - Physical ; Theoretical Chemistry

  1. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  2. Effects of osmolytes and macromolecular crowders on stable GAAA tetraloops and their preference for a CG closing base pair

    Directory of Open Access Journals (Sweden)

    Kaethe N. Leonard

    2018-02-01

    Full Text Available Osmolytes and macromolecular crowders have the potential to influence the stability of secondary structure motifs and alter preferences for conserved nucleic acid sequences in vivo. To further understand the cellular function of RNA we observed the effects of a model osmolyte, polyethylene glycol (PEG 200, and a model macromolecular crowding agent, PEG 8000, on the GAAA tetraloop motif. GAAA tetraloops are conserved, stable tetraloops, and are critical participants in RNA tertiary structure. They also have a thermodynamic preference for a CG closing base pair. The thermal denaturation of model hairpins containing GAAA loops was monitored using UV-Vis spectroscopy in the presence and absence of PEG 200 or PEG 8000. Both of the cosolutes tested influenced the thermodynamic preference for a CG base pair by destabilizing the loop with a CG closing base pair relative to the loop with a GC closing base pair. This result also extended to a related DNA triloop, which provides further evidence that the interactions between the loop and closing base pair are identical for the d(GCA triloop and the GAAA tetraloop. Our results suggest that in the presence of model PEG molecules, loops with a GC closing base pair may retain some preferential interactions with the cosolutes that are lost in the presence of the CG closing base pair. These results reveal that relatively small structural changes could influence how neutral cosolutes tune the stability and function of secondary structure motifs in vivo.

  3. UK provides "step increase" in funding for its science base

    CERN Multimedia

    1998-01-01

    The British government has come good on pre-election promises when this week, it agreed to inject an extra 700 million into the country's science base over the next three years. This extra funding is boosted by a further 400 million pounds from the Welcome Trust over the same period (1 page).

  4. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  5. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing.

    Science.gov (United States)

    Li, Sanshu; Breaker, Ronald R

    2013-03-01

    Thiamin pyrophosphate (TPP) riboswitches are found in organisms from all three domains of life. Examples in bacteria commonly repress gene expression by terminating transcription or by blocking ribosome binding, whereas most eukaryotic TPP riboswitches are predicted to regulate gene expression by modulating RNA splicing. Given the widespread distribution of eukaryotic TPP riboswitches and the diversity of their locations in precursor messenger RNAs (pre-mRNAs), we sought to examine the mechanism of alternative splicing regulation by a fungal TPP riboswitch from Neurospora crassa, which is mostly located in a large intron separating protein-coding exons. Our data reveal that this riboswitch uses a long-distance (∼530-nt separation) base-pairing interaction to regulate alternative splicing. Specifically, a portion of the TPP-binding aptamer can form a base-paired structure with a conserved sequence element (α) located near a 5' splice site, which greatly increases use of this 5' splice site and promotes gene expression. Comparative sequence analyses indicate that many fungal species carry a TPP riboswitch with similar intron architecture, and therefore the homologous genes in these fungi are likely to use the same mechanism. Our findings expand the scope of genetic control mechanisms relying on long-range RNA interactions to include riboswitches.

  7. A Bilinear Pairing-Based Dynamic Key Management and Authentication for Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Chin-Ling Chen

    2015-01-01

    Full Text Available In recent years, wireless sensor networks have been used in a variety of environments; a wireless network infrastructure, established to communicate and exchange information in a monitoring area, has also been applied in different environments. However, for sensitive applications, security is the paramount issue. In this paper, we propose using bilinear pairing to design dynamic key management and authentication scheme of the hierarchical sensor network. We use the dynamic key management and the pairing-based cryptography (PBC to establish the session key and the hash message authentication code (HMAC to support the mutual authentication between the sensors and the base station. In addition, we also embed the capability of the Global Positioning System (GPS to cluster nodes to find the best path of the sensor network. The proposed scheme can also provide the requisite security of the dynamic key management, mutual authentication, and session key protection. Our scheme can defend against impersonation attack, replay attack, wormhole attack, and message manipulation attack.

  8. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  9. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    Science.gov (United States)

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  10. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  11. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  12. Evaluating changes in matrix based, recovery-adjusted concentrations in paired data for pesticides in groundwater

    Science.gov (United States)

    Zimmerman, Tammy M.; Breen, Kevin J.

    2012-01-01

    Pesticide concentration data for waters from selected carbonate-rock aquifers in agricultural areas of Pennsylvania were collected in 1993–2009 for occurrence and distribution assessments. A set of 30 wells was visited once in 1993–1995 and again in 2008–2009 to assess concentration changes. The data include censored matched pairs (nondetections of a compound in one or both samples of a pair). A potentially improved approach for assessing concentration changes is presented where (i) concentrations are adjusted with models of matrix-spike recovery and (ii) area-wide temporal change is tested by use of the paired Prentice-Wilcoxon (PPW) statistical test. The PPW results for atrazine, simazine, metolachlor, prometon, and an atrazine degradate, deethylatrazine (DEA), are compared using recovery-adjusted and unadjusted concentrations. Results for adjusted compared with unadjusted concentrations in 2008–2009 compared with 1993–1995 were similar for atrazine and simazine (significant decrease; 95% confidence level) and metolachlor (no change) but differed for DEA (adjusted, decrease; unadjusted, increase) and prometon (adjusted, decrease; unadjusted, no change). The PPW results were different on recovery-adjusted compared with unadjusted concentrations. Not accounting for variability in recovery can mask a true change, misidentify a change when no true change exists, or assign a direction opposite of the true change in concentration that resulted from matrix influences on extraction and laboratory method performance. However, matrix-based models of recovery derived from a laboratory performance dataset from multiple studies for national assessment, as used herein, rather than time- and study-specific recoveries may introduce uncertainty in recovery adjustments for individual samples that should be considered in assessing change.

  13. Developing evidence-based librarianship: practical steps for implementation.

    Science.gov (United States)

    Crumley, Ellen; Koufogiannakis, Denise

    2002-06-01

    Evidence-based librarianship (EBL) is a relatively new concept for librarians. This paper lays out a practical framework for the implementation of EBL. A new way of thinking about research in librarianship is introduced using the well-built question process and the assignment of librarian research questions to one of six domains specific to librarianship. As a profession, librarianship tends to reflect more qualitative, social sciences/humanities in its research methods and study types which tend to be less rigorous and more prone to bias. Randomised controlled trials (RCT) do not have to be placed at the top of an evidence 'hierarchy' for librarianship. Instead, a more encompassing model reflecting librarianship as a whole and the kind of research likely to be done by librarians is proposed. 'Evidence' from a number of disciplines including health sciences, business and education can be utilized by librarians and applied to their practice. However, access to and availability of librarianship literature needs to be further studied. While using other disciplines (e.g. EBHC) as a model for EBL has been explored in the literature, the authors develop models unique to librarianship. While research has always been a minor focus in the profession, moving research into practice is becoming more important and librarians need to consider the issues surrounding research in order to move EBL forward.

  14. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing

    Science.gov (United States)

    Riedl, Jan; Ding, Yun; Fleming, Aaron M.; Burrows, Cynthia J.

    2015-01-01

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand. PMID:26542210

  15. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  16. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    Energy Technology Data Exchange (ETDEWEB)

    Palmero, F [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Archilla, J F R [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Hennig, D [Freie Universitaet Berlin, Fachbereich Physik, Arnimallee 14, 14195-Berlin (Germany); Romero, F R [Facultad de FIsica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain)

    2004-02-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder.

  17. GGIP: Structure and sequence-based GPCR-GPCR interaction pair predictor.

    Science.gov (United States)

    Nemoto, Wataru; Yamanishi, Yoshihiro; Limviphuvadh, Vachiranee; Saito, Akira; Toh, Hiroyuki

    2016-09-01

    G Protein-Coupled Receptors (GPCRs) are important pharmaceutical targets. More than 30% of currently marketed pharmaceutical medicines target GPCRs. Numerous studies have reported that GPCRs function not only as monomers but also as homo- or hetero-dimers or higher-order molecular complexes. Many GPCRs exert a wide variety of molecular functions by forming specific combinations of GPCR subtypes. In addition, some GPCRs are reportedly associated with diseases. GPCR oligomerization is now recognized as an important event in various biological phenomena, and many researchers are investigating this subject. We have developed a support vector machine (SVM)-based method to predict interacting pairs for GPCR oligomerization, by integrating the structure and sequence information of GPCRs. The performance of our method was evaluated by the Receiver Operating Characteristic (ROC) curve. The corresponding area under the curve was 0.938. As far as we know, this is the only prediction method for interacting pairs among GPCRs. Our method could accelerate the analyses of these interactions, and contribute to the elucidation of the global structures of the GPCR networks in membranes. Proteins 2016; 84:1224-1233. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Uncertain Risk Assessment of Knowledge Management: Based on Set Pair Analysis

    Directory of Open Access Journals (Sweden)

    Guibin Yang

    2016-01-01

    Full Text Available Since the knowledge resource becomes an important part of enterprise resources, the knowledge management risks could significantly affect the enterprise operation efficiency. Controlling knowledge management risks is one of the enterprise management tasks; the managers and researchers focus on how to effectively evaluate the risks. This paper aims to solve this problem and puts forward an evaluation model of the uncertain risks of knowledge management. Based on set pair theory, a model is established to identify the knowledge management risk. Through the concept of connection number, knowledge management risk is divided into five levels. Meanwhile, the development trend of knowledge management risk is classified into same tendency, equal tendency, and contrary tendency by the concept of set pair theory. The application of this model is empirically verified with Chinese enterprises. Through both static and dynamic evaluations of the knowledge management risk, this paper can effectively analyze risk development trend and provide decision support for the enterprise manager about the uncertain risks of knowledge management.

  19. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  20. Peptide tag/probe pairs based on the coordination chemistry for protein labeling.

    Science.gov (United States)

    Uchinomiya, Shohei; Ojida, Akio; Hamachi, Itaru

    2014-02-17

    Protein-labeling methods serve as essential tools for analyzing functions of proteins of interest under complicated biological conditions such as in live cells. These labeling methods are useful not only to fluorescently visualize proteins of interest in biological systems but also to conduct protein and cell analyses by harnessing the unique functions of molecular probes. Among the various labeling methods available, an appropriate binding pair consisting of a short peptide and a de novo designed small molecular probe has attracted attention because of its wide utility and versatility. Interestingly, most peptide tag/probe pairs exploit metal-ligand coordination interactions as the main binding force responsible for their association. Herein, we provide an overview of the recent progress of these coordination-chemistry-based protein-labeling methods and their applications for fluorescence imaging and functional analysis of cellular proteins, while highlighting our originally developed labeling methods. These successful examples clearly exemplify the utility and versatility of metal coordination chemistry in protein functional analysis.

  1. Osteochondral tissue engineering for total joint repair critical steps towards cell based constructs

    NARCIS (Netherlands)

    Hamann, D.

    2008-01-01

    This thesis identifies critical steps to be taken to develop osteochondral constructs. One of the most significant steps in cell-based tissue engineering (TE) is efficient and effective cell seeding. The application of multipotent mesenchymal stem cells (MSCs) is a major advantage for bone and

  2. Steps for Creating a Specialized Corpus and Developing an Annotated Frequency-Based Vocabulary List

    Science.gov (United States)

    Toriida, Marie-Claude

    2016-01-01

    This article provides introductory, step-by-step explanations of how to make a specialized corpus and an annotated frequency-based vocabulary list. One of my objectives is to help teachers, instructors, program administrators, and graduate students with little experience in this field be able to do so using free resources. Instructions are first…

  3. A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA

    Science.gov (United States)

    Kladwang, Wipapat; Cordero, Pablo; Das, Rhiju

    2011-01-01

    We present a rapid experimental strategy for inferring base pairs in structured RNAs via an information-rich extension of classic chemical mapping approaches. The mutate-and-map method, previously applied to a DNA/RNA helix, systematically searches for single mutations that enhance the chemical accessibility of base-pairing partners distant in sequence. To test this strategy for structured RNAs, we have carried out mutate-and-map measurements for a 35-nt hairpin, called the MedLoop RNA, embedded within an 80-nt sequence. We demonstrate the synthesis of all 105 single mutants of the MedLoop RNA sequence and present high-throughput DMS, CMCT, and SHAPE modification measurements for this library at single-nucleotide resolution. The resulting two-dimensional data reveal visually clear, punctate features corresponding to RNA base pair interactions as well as more complex features; these signals can be qualitatively rationalized by comparison to secondary structure predictions. Finally, we present an automated, sequence-blind analysis that permits the confident identification of nine of the 10 MedLoop RNA base pairs at single-nucleotide resolution, while discriminating against all 1460 false-positive base pairs. These results establish the accuracy and information content of the mutate-and-map strategy and support its feasibility for rapidly characterizing the base-pairing patterns of larger and more complex RNA systems. PMID:21239468

  4. One-step production of biodiesel from Nannochloropsis sp. on solid base Mg-Zr catalyst

    International Nuclear Information System (INIS)

    Li, Yuesong; Lian, Shuang; Tong, Dongmei; Song, Ruili; Yang, Wenyan; Fan, Yong; Qing, Renwei; Hu, Changwei

    2011-01-01

    Nannochloropsis sp., one kind of green microalgae cultivated autotrophically and axenically in laboratory, is used as raw material to produce biodiesel by one-step method in an amended reactor. The effects of several reaction parameters on transesterification over Mg-Zr solid base catalyst were investigated through both conventional method and one-step method. One-step method could give a higher yield of methyl ester than conventional two-step method, which demonstrates that the present one-step method is suitable for biodiesel production from the microalgae Nannochloropsis sp. Moreover, the present one-step method realizes the convenient in situ separation of catalyst from microalgae residue which can be easily used consequently, reducing the procedure units as well as the overall costs.

  5. Isolation breeds naivety: island living robs Australian varanid lizards of toad-toxin immunity via four-base-pair mutation.

    Science.gov (United States)

    Ujvari, Beata; Mun, Hee-chang; Conigrave, Arthur D; Bray, Alessandra; Osterkamp, Jens; Halling, Petter; Madsen, Thomas

    2013-01-01

    Since their introduction to the toad-free Australian continent cane toads (Bufo marinus) have caused a dramatic increase in naïve varanid mortality when these large lizards attempt to feed on this toxic amphibian. In contrast Asian-African varanids, which have coevolved with toads, are resistant to toad toxin. Toad toxins, such as Bufalin target the H1-H2 domain of the α(1) subunit of the sodium-potassium-ATPase enzyme. Sequencing of this domain revealed identical nucleotide sequences in four Asian as well as in three African varanids, and identical sequences in all 11 Australian varanids. However, compared to the Asian-African varanids, the Australian varanids showed four-base-pair substitutions, resulting in the alteration in three of the 12 amino acids representing the H1-H2 domain. The phenotypic effect of the substitutions was investigated in human embryonic kidney (HEK) 293 cells stably transfected with the Australian and the Asian-African H1-H2 domains. The transfections resulted in an approximate 3000-fold reduction in resistance to Bufalin in the Australian HEK293 cells compared to the Asian-African HEK293 cells, demonstrating the critical role of this minor mutation in providing Bufalin resistance. Our study hence presents a clear link between genotype and phenotype, a critical step in understanding the evolution of phenotypic diversity. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  6. Polysiloxane/Polystyrene Thermo-Responsive and Self-Healing Polymer Network via Lewis Acid-Lewis Base Pair Formation

    Directory of Open Access Journals (Sweden)

    Fernando Vidal

    2018-02-01

    Full Text Available The use of thermo-reversible Lewis Pair (LP interactions in the formation of transient polymer networks is still greatly underexplored. In this work, we describe the synthesis and characterization of polydimethylsiloxane/polystyrene (PDMS/PS blends that form dynamic Lewis acid-Lewis base adducts resulting in reversible crosslinks. Linear PS containing 10 mol % of di-2-thienylboryl pendant groups randomly distributed was obtained in a two-step one-pot functionalization reaction from silyl-functionalized PS, while ditelechelic PDMS with pyridyl groups at the chain-termini was directly obtained via thiol-ene “click” chemistry from commercially available vinyl-terminated PDMS. The resulting soft gels, formed after mixing solutions containing the PDMS and PS polymers, behave at room temperature as elastomeric solid-like materials with very high viscosity (47,300 Pa·s. We applied rheological measurements to study the thermal and time dependence of the viscoelastic moduli, and also assessed the reprocessability and self-healing behavior of the dry gel.

  7. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  8. A single base-pair deletion in the WFS1 gene causes Wolfram syndrome.

    Science.gov (United States)

    Pitt, Katherine; James, Chela; Kochar, Inderpal S; Kapoor, Akshay; Jain, Shilpi; Hussain, Khalid; Bennett, Kate

    2011-01-01

    Wolfram syndrome is a progressive neurodegenerative disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy and deafness). The majority of cases are caused by mutations in the WFS1 gene. WFS1 is located at 4p16.1 and encodes wolframin, a transmembrane endoplasmic reticulum (ER) protein involved in the negative regulation of ER stress signalling. To date, over 120 WFS1 mutations have been described. In this study, we report a consanguineous family with three siblings affected by Wolfram syndrome. A homozygous single base pair deletion (c.877delC, L293fsX303) was found in the WFS1 gene in all three affected siblings.

  9. Chemistry of stannylene-based Lewis pairs: dynamic tin coordination switching between donor and acceptor character.

    Science.gov (United States)

    Krebs, Kilian M; Freitag, Sarah; Schubert, Hartmut; Gerke, Birgit; Pöttgen, Rainer; Wesemann, Lars

    2015-03-16

    The coordination chemistry of cyclic stannylene-based intramolecular Lewis pairs is presented. The P→Sn adducts were treated with [Ni(COD)2] and [Pd(PCy3)2] (COD = 1,5-cyclooctadiene, PCy3 = tricyclohexylphosphine). In the isolated coordination compounds the stannylene moiety acts either as an acceptor or a donor ligand. Examples of a dynamic switch between these two coordination modes of the P-Sn ligand are illustrated and the structures in the solid state together with heteronuclear NMR spectroscopic findings are discussed. In the case of a Ni(0) complex, (119)Sn Mössbauer spectroscopy of the uncoordinated and coordinated phosphastannirane ligand is presented. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ∼30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  11. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  12. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  13. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    Science.gov (United States)

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  14. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    Directory of Open Access Journals (Sweden)

    Heng Yuan

    2015-12-01

    Full Text Available An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET. Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  15. A provably secure identity-based strong designated verifier proxy signature scheme from bilinear pairings

    Directory of Open Access Journals (Sweden)

    SK Hafizul Islam

    2014-01-01

    Full Text Available The proxy signature, a variant of the ordinary digital signature, has been an active research topic in recent years; it has many useful applications, including distributed systems and grid computing. Although many identity-based proxy signature schemes have been proposed in the literature, only a few proposals for identity-based strong designated verifier proxy signature (ID-SDVPS schemes are available. However, it has been found that most of the ID-SDVPS schemes that have been proposed to date are not efficient in terms of computation and security, and a computationally efficient and secured ID-SDVPS scheme using elliptic curve bilinear pairing has been proposed in this paper. The security of the scheme is mainly based on the hardness assumption of CDH and GBDH problems in the random oracle model, which is existentially unforgeable against different types of adversaries. Furthermore, the security of our scheme is simulated in the AVISPA (Automated Validation of Internet Security Protocols and Applications software, a widely used automated internet protocol validation tool, and the simulation results confirm strong security against both active and passive attacks. In addition, because of a high processing capability and supporting additional security features, the scheme is suitable for the environments in which less computational cost with strong security is required.

  16. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    Science.gov (United States)

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-01-01

    An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

  17. Novel H⁺-Ion Sensor Based on a Gated Lateral BJT Pair.

    Science.gov (United States)

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-12-23

    An H⁺-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H⁺-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  18. The steps to recovery program: Evaluation of a group-based intervention for older individuals receiving mental health services.

    Science.gov (United States)

    Flaherty-Jones, Graeme M; Carne, Alexandra S; Dexter-Smith, Sarah

    2016-03-01

    This study reports on the evaluation of a group-based intervention for older individuals receiving mental health services. A prospective cohort repeated-measure design was used for 48 participants who accessed secondary care mental health services for older people. Changes on the Recovery Assessment Scale (RAS), the Warwick-Edinburgh Mental Well-Being Scale (WEMWEBS), and a postevaluation questionnaire were analyzed. A paired sample t test examined changes in participant's scores on the WEMWEBS and RAS from baseline to postintervention. Participants qualitatively evaluated the Steps to Recovery group as having a positive effect on their recovery. Following involvement in this group intervention, participants reported improved mental well-being and recovery from mental health difficulty. These results suggest that the program has the potential to provide an accessible framework for developing recovery-orientated approaches in mental health care that can be delivered by care staff at all levels. (c) 2016 APA, all rights reserved).

  19. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  20. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  1. Adaptive step goals and rewards: a longitudinal growth model of daily steps for a smartphone-based walking intervention.

    Science.gov (United States)

    Korinek, Elizabeth V; Phatak, Sayali S; Martin, Cesar A; Freigoun, Mohammad T; Rivera, Daniel E; Adams, Marc A; Klasnja, Pedja; Buman, Matthew P; Hekler, Eric B

    2018-02-01

    Adaptive interventions are an emerging class of behavioral interventions that allow for individualized tailoring of intervention components over time to a person's evolving needs. The purpose of this study was to evaluate an adaptive step goal + reward intervention, grounded in Social Cognitive Theory delivered via a smartphone application (Just Walk), using a mixed modeling approach. Participants (N = 20) were overweight (mean BMI = 33.8 ± 6.82 kg/m 2 ), sedentary adults (90% female) interested in participating in a 14-week walking intervention. All participants received a Fitbit Zip that automatically synced with Just Walk to track daily steps. Step goals and expected points were delivered through the app every morning and were designed using a pseudo-random multisine algorithm that was a function of each participant's median baseline steps. Self-report measures were also collected each morning and evening via daily surveys administered through the app. The linear mixed effects model showed that, on average, participants significantly increased their daily steps by 2650 (t = 8.25, p model with a quadratic time variable indicated an inflection point for increasing steps near the midpoint of the intervention and this effect was significant (t 2  = -247, t = -5.01, p goal + rewards intervention using a smartphone app appears to be a feasible approach for increasing walking behavior in overweight adults. App satisfaction was high and participants enjoyed receiving variable goals each day. Future mHealth studies should consider the use of adaptive step goals + rewards in conjunction with other intervention components for increasing physical activity.

  2. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  3. Investigation to biodiesel production by the two-step homogeneous base-catalyzed transesterification.

    Science.gov (United States)

    Ye, Jianchu; Tu, Song; Sha, Yong

    2010-10-01

    For the two-step transesterification biodiesel production made from the sunflower oil, based on the kinetics model of the homogeneous base-catalyzed transesterification and the liquid-liquid phase equilibrium of the transesterification product, the total methanol/oil mole ratio, the total reaction time, and the split ratios of methanol and reaction time between the two reactors in the stage of the two-step reaction are determined quantitatively. In consideration of the transesterification intermediate product, both the traditional distillation separation process and the improved separation process of the two-step reaction product are investigated in detail by means of the rigorous process simulation. In comparison with the traditional distillation process, the improved separation process of the two-step reaction product has distinct advantage in the energy duty and equipment requirement due to replacement of the costly methanol-biodiesel distillation column. Copyright 2010 Elsevier Ltd. All rights reserved.

  4. Enriching step-based product information models to support product life-cycle activities

    Science.gov (United States)

    Sarigecili, Mehmet Ilteris

    The representation and management of product information in its life-cycle requires standardized data exchange protocols. Standard for Exchange of Product Model Data (STEP) is such a standard that has been used widely by the industries. Even though STEP-based product models are well defined and syntactically correct, populating product data according to these models is not easy because they are too big and disorganized. Data exchange specifications (DEXs) and templates provide re-organized information models required in data exchange of specific activities for various businesses. DEXs show us it would be possible to organize STEP-based product models in order to support different engineering activities at various stages of product life-cycle. In this study, STEP-based models are enriched and organized to support two engineering activities: materials information declaration and tolerance analysis. Due to new environmental regulations, the substance and materials information in products have to be screened closely by manufacturing industries. This requires a fast, unambiguous and complete product information exchange between the members of a supply chain. Tolerance analysis activity, on the other hand, is used to verify the functional requirements of an assembly considering the worst case (i.e., maximum and minimum) conditions for the part/assembly dimensions. Another issue with STEP-based product models is that the semantics of product data are represented implicitly. Hence, it is difficult to interpret the semantics of data for different product life-cycle phases for various application domains. OntoSTEP, developed at NIST, provides semantically enriched product models in OWL. In this thesis, we would like to present how to interpret the GD & T specifications in STEP for tolerance analysis by utilizing OntoSTEP.

  5. A Control Method Based on Modal Transformation for Biped Robots to Climb Unknown Steps

    Science.gov (United States)

    Shimmyo, Shuhei; Nakazato, Miki; Mikami, Kei; Sato, Tomoya; Sakaino, Sho; Ohnishi, Kouhei

    This paper proposes a control method based on modal transformation for biped robots to climb unknown steps. This method is able to control the foot position of the biped robot and the ground reaction force acting in vertical direction when the biped robot climbs unknown steps in a double-support phase. The effectiveness of the proposed method is confirmed by simulation and experimental results.

  6. PID controller auto-tuning based on process step response and damping optimum criterion.

    Science.gov (United States)

    Pavković, Danijel; Polak, Siniša; Zorc, Davor

    2014-01-01

    This paper presents a novel method of PID controller tuning suitable for higher-order aperiodic processes and aimed at step response-based auto-tuning applications. The PID controller tuning is based on the identification of so-called n-th order lag (PTn) process model and application of damping optimum criterion, thus facilitating straightforward algebraic rules for the adjustment of both the closed-loop response speed and damping. The PTn model identification is based on the process step response, wherein the PTn model parameters are evaluated in a novel manner from the process step response equivalent dead-time and lag time constant. The effectiveness of the proposed PTn model parameter estimation procedure and the related damping optimum-based PID controller auto-tuning have been verified by means of extensive computer simulations. © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

  7. The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

    Science.gov (United States)

    Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

    2013-01-01

    This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

  8. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  9. Glyoxals as in vivo RNA structural probes of guanine base-pairing.

    Science.gov (United States)

    Mitchell, David; Ritchey, Laura E; Park, Hongmarn; Babitzke, Paul; Assmann, Sarah M; Bevilacqua, Philip C

    2018-01-01

    Elucidation of the folded structures that RNA forms in vivo is vital to understanding its functions. Chemical reagents that modify the Watson-Crick (WC) face of unprotected nucleobases are particularly useful in structure elucidation. Dimethyl sulfate penetrates cell membranes and informs on RNA base-pairing and secondary structure but only modifies the WC face of adenines and cytosines. We present glyoxal, methylglyoxal, and phenylglyoxal as potent in vivo reagents that target the WC face of guanines as well as cytosines and adenines. Tests on rice ( Oryza sativa) 5.8S rRNA in vitro read out by reverse transcription and gel electrophoresis demonstrate specific modification of almost all guanines in a time- and pH-dependent manner. Subsequent in vivo tests on rice, a eukaryote, and Bacillus subtilis and Escherichia coli , Gram-positive and Gram-negative bacteria, respectively, showed that all three reagents enter living cells without prior membrane permeabilization or pH adjustment of the surrounding media and specifically modify solvent-exposed guanine, cytosine, and adenine residues. © 2018 Mitchell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae)

    Science.gov (United States)

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-01-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae. PMID:27759763

  11. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae

    Directory of Open Access Journals (Sweden)

    Vanessa Bellini Bardella

    Full Text Available The subfamily Triatominae (Hemiptera, Reduviidae includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  12. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  13. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. Step-height standards based on the rapid formation of monolayer steps on the surface of layered crystals

    Energy Technology Data Exchange (ETDEWEB)

    Komonov, A.I. [Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences (ISP SBRAS), pr. Lavrentieva 13, Novosibirsk 630090 (Russian Federation); Prinz, V.Ya., E-mail: prinz@isp.nsc.ru [Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences (ISP SBRAS), pr. Lavrentieva 13, Novosibirsk 630090 (Russian Federation); Seleznev, V.A. [Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences (ISP SBRAS), pr. Lavrentieva 13, Novosibirsk 630090 (Russian Federation); Kokh, K.A. [Sobolev Institute of Geology and Mineralogy, Siberian Branch of the Russian Academy of Sciences (IGM SB RAS), pr. Koptyuga 3, Novosibirsk 630090 (Russian Federation); Shlegel, V.N. [Nikolaev Institute of Inorganic Chemistry, Siberian Branch of the Russian Academy of Sciences (NIIC SB RAS), pr. Lavrentieva 3, Novosibirsk 630090 (Russian Federation)

    2017-07-15

    Highlights: • Easily reproducible step-height standard for SPM calibrations was proposed. • Step-height standard is monolayer steps on the surface of layered single crystal. • Long-term change in surface morphology of Bi{sub 2}Se{sub 3} and ZnWO{sub 4} was investigated. • Conducting surface of Bi{sub 2}Se{sub 3} crystals appropriate for calibrating STM. • Ability of robust SPM calibrations under ambient conditions were demonstrated. - Abstract: Metrology is essential for nanotechnology, especially for structures and devices with feature sizes going down to nm. Scanning probe microscopes (SPMs) permits measurement of nanometer- and subnanometer-scale objects. Accuracy of size measurements performed using SPMs is largely defined by the accuracy of used calibration measures. In the present publication, we demonstrate that height standards of monolayer step (∼1 and ∼0.6 nm) can be easily prepared by cleaving Bi{sub 2}Se{sub 3} and ZnWO{sub 4} layered single crystals. It was shown that the conducting surface of Bi{sub 2}Se{sub 3} crystals offers height standard appropriate for calibrating STMs and for testing conductive SPM probes. Our AFM study of the morphology of freshly cleaved (0001) Bi{sub 2}Se{sub 3} surfaces proved that such surfaces remained atomically smooth during a period of at least half a year. The (010) surfaces of ZnWO{sub 4} crystals remained atomically smooth during one day, but already two days later an additional nanorelief of amplitude ∼0.3 nm appeared on those surfaces. This relief, however, did not further grow in height, and it did not hamper the calibration. Simplicity and the possibility of rapid fabrication of the step-height standards, as well as their high stability, make these standards available for a great, permanently growing number of users involved in 3D printing activities.

  16. Workplace based assessment: a step to promote competency based postgraduate training.

    Science.gov (United States)

    Singh, Tejinder; Modi, Jyoti Nath

    2013-06-08

    There has been an increasing emphasis on defining outcomes of medical education in terms of performance of trainees. This is a step beyond the description of outcomes in terms of competence that encompasses mostly potential abilities rather than the actual performance. The contextual adaptations and behavior judgments of the trainees are best assessed by a program of in-training assessment. Workplace based assessment (WPBA) is one of the modalities, which assesses the trainee in authentic settings. Though Postgraduate (PG) medical training in India is said to be competency-based, most institutions do not have any formative or in-training assessment program for the same. The two cardinal elements of WPBA are direct observation and conducted in work place in addition to provision of feedback to the trainee. The WPBA conforms to the highest (Level 4: Does) of Millers pyramid and also has the potential to assess at all four levels. Some of the tools used for WPBA are: Logbooks, Clinical Encounter Cards (CEC), mini-Clinical Evaluation Exercise (mini-CEX), Case based discussions, Direct Observation of Procedural Skills (DOPS), Multisource feedback (peers, co-workers, seniors, patients) etc. These can be documented in the form of a portfolio that provides a longitudinal view of experiences and progress of the trainee. The WPBA scores high on validity and educational impact by virtue of being based on direct observation in real situation and contextual feedback. The feasibility and acceptability is enhanced by making appropriate choices of tools, advance planning, building of mutual trust, and training of assessors. Given the established benefits of WPBA in shaping clinical learning, there is an imminent need for including this mode of assessment in our clinical training programs especially PG training.

  17. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  18. Predicting Bond Dissociation Energies of Transition-Metal Compounds by Multiconfiguration Pair-Density Functional Theory and Second-Order Perturbation Theory Based on Correlated Participating Orbitals and Separated Pairs.

    Science.gov (United States)

    Bao, Junwei Lucas; Odoh, Samuel O; Gagliardi, Laura; Truhlar, Donald G

    2017-02-14

    We study the performance of multiconfiguration pair-density functional theory (MC-PDFT) and multireference perturbation theory for the computation of the bond dissociation energies in 12 transition-metal-containing diatomic molecules and three small transition-metal-containing polyatomic molecules and in two transition-metal dimers. The first step is a multiconfiguration self-consistent-field calculation, for which two choices must be made: (i) the active space and (ii) its partition into subspaces, if the generalized active space formulation is used. In the present work, the active space is chosen systematically by using three correlated-participating-orbitals (CPO) schemes, and the partition is chosen by using the separated-pair (SP) approximation. Our calculations show that MC-PDFT generally has similar accuracy to CASPT2, and the active-space dependence of MC-PDFT is not very great for transition-metal-ligand bond dissociation energies. We also find that the SP approximation works very well, and in particular SP with the fully translated BLYP functional SP-ftBLYP is more accurate than CASPT2. SP greatly reduces the number of configuration state functions relative to CASSCF. For the cases of FeO and NiO with extended-CPO active space, for which complete active space calculations are unaffordable, SP calculations are not only affordable but also of satisfactory accuracy. All of the MC-PDFT results are significantly better than the corresponding results with broken-symmetry spin-unrestricted Kohn-Sham density functional theory. Finally we test a perturbation theory method based on the SP reference and find that it performs slightly worse than CASPT2 calculations, and for most cases of the nominal-CPO active space, the approximate SP perturbation theory calculations are less accurate than the much less expensive SP-PDFT calculations.

  19. Variable Step-Size Method Based on a Reference Separation System for Source Separation

    Directory of Open Access Journals (Sweden)

    Pengcheng Xu

    2015-01-01

    Full Text Available Traditional variable step-size methods are effective to solve the problem of choosing step-size in adaptive blind source separation process. But the initial setting of learning rate is vital, and the convergence speed is still low. This paper proposes a novel variable step-size method based on reference separation system for online blind source separation. The correlation between the estimated source signals and original source signals increases along with iteration. Therefore, we introduce a reference separation system to approximately estimate the correlation in terms of mean square error (MSE, which is utilized to update the step-size. The use of “minibatches” for the computation of MSE can reduce the complexity of the algorithm to some extent. Moreover, simulations demonstrate that the proposed method exhibits superior convergence and better steady-state performance over the fixed step-size method in the noise-free case, while converging faster than classical variable step-size methods in both stationary and nonstationary environments.

  20. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  1. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  2. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  3. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  4. A two-step filtering-based iterative image reconstruction method for interior tomography.

    Science.gov (United States)

    Zhang, Hanming; Li, Lei; Yan, Bin; Wang, Linyuan; Cai, Ailong; Hu, Guoen

    2016-10-06

    The optimization-based method that utilizes the additional sparse prior of region-of-interest (ROI) image, such as total variation, has been the subject of considerable research in problems of interior tomography reconstruction. One challenge for optimization-based iterative ROI image reconstruction is to build the relationship between ROI image and truncated projection data. When the reconstruction support region is smaller than the original object, an unsuitable representation of data fidelity may lead to bright truncation artifacts in the boundary region of field of view. In this work, we aim to develop an iterative reconstruction method to suppress the truncation artifacts and improve the image quality for direct ROI image reconstruction. A novel reconstruction approach is proposed based on an optimization problem involving a two-step filtering-based data fidelity. Data filtering is achieved in two steps: the first takes the derivative of projection data; in the second step, Hilbert filtering is applied in the differentiated data. Numerical simulations and real data reconstructions have been conducted to validate the new reconstruction method. Both qualitative and quantitative results indicate that, as theoretically expected, the proposed method brings reasonable performance in suppressing truncation artifacts and preserving detailed features. The presented local reconstruction method based on the two-step filtering strategy provides a simple and efficient approach for the iterative reconstruction from truncated projections.

  5. Testing for direct genetic effects using a screening step in family-based association studies

    Directory of Open Access Journals (Sweden)

    Sharon M Lutz

    2013-11-01

    Full Text Available In genome wide association studies (GWAS, families based studies tend to have less power to detect genetic associations than population based studies, such as case-control studies. This can be an issue when testing if genes in a family based GWAS have a direct effect on the phenotype of interest or if the genes act indirectly through a secondary phenotype. When multiple SNPs are tested for a direct effect in the family based study, a screening step can be used to minimize the burden of multiple comparisons in the causal analysis. We propose a 2-stage screening step that can be incorporated into the family based association test (FBAT approach similar to the conditional mean model approach in the VanSteen-algorithm [1]. Simulations demonstrate that the type 1 error is preserved and this method is advantageous when multiple markers are tested. This method is illustrated by an application to the Framingham Heart Study.

  6. Compatibility of pedigree-based and marker-based relationship matrices for single-step genetic evaluation

    DEFF Research Database (Denmark)

    Christensen, Ole Fredslund

    2012-01-01

    Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker...... that it may be important that a single-step method is based on a model conditional on the observed markers. When data are from routine evaluation systems, selection affects the allele frequencies, and therefore both observed markers and observed phenotypes contain information about allele frequencies...... the marker-based relationship matrix is constructed assuming all allele frequencies equal to 0.5 and the pedigree-based relationship matrix is constructed using the unusual assumption that animals in the base population are related and inbreed with relationship coefficient alpha and inbreeding coefficient...

  7. Seven-Step Problem-Based Learning in an Interaction Design Course

    Science.gov (United States)

    Schultz, Nette; Christensen, Hans Peter

    2004-01-01

    The objective in this paper is the implementation of the highly structured seven-step problem-based learning (PBL) procedure as part of the learning process in a human-computer interaction (HCI) design course at the Technical University of Denmark, taking into account the common learning processes in PBL and the interaction design process. These…

  8. Steps that count! A feasibility study of a pedometer-based, health ...

    African Journals Online (AJOL)

    We recommend a minimum of 150 participants in each group to account for loss to follow-up and to allow for subgroup analyses. .... to measure percentage body fat, based on the principles of bioelectrical impedance.[15] Blood .... intensity steps was assessed at baseline (week 1) and follow-up (week. 12) for both the IG and ...

  9. School-Based Intervention Strategies for School Phobia--A Ten-Step "Common Sense" Approach.

    Science.gov (United States)

    Want, Jerome H.

    1983-01-01

    Characteristic behaviors and personality features of school phobia (anxiety, willfulness, dependency, depression, and unrealistic self image) are described, and 10 steps in a school-based intervention approach are listed (including assessing the family constellation, preparing teachers for the student's return to school, and encouraging therapy…

  10. Students' Errors in Solving the Permutation and Combination Problems Based on Problem Solving Steps of Polya

    Science.gov (United States)

    Sukoriyanto; Nusantara, Toto; Subanji; Chandra, Tjang Daniel

    2016-01-01

    This article was written based on the results of a study evaluating students' errors in problem solving of permutation and combination in terms of problem solving steps according to Polya. Twenty-five students were asked to do four problems related to permutation and combination. The research results showed that the students still did a mistake in…

  11. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-05

    Jun 5, 2012 ... 1College of Computer Science and Technology, Jilin University, Key Laboratory of Symbol Computation and Knowledge ... 3Department of Information Engineering and Computer Science, University of Trento, Via Sommarive 14, 38050 – Povo ... disjoint top scoring pairs of genes as decision rules rather.

  12. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  13. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-05

    Jun 5, 2012 ... machine learning approach without any parameter. The classification rules of TSP contain only a pair of genes. Moreover, because in some datasets the classification rules of TSP classifier will change with the addition or deletion of training samples, Tan et al. (2005) proposed an improved method named ...

  14. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  15. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  16. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  17. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-01-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...... produced with this method were successfully applied in seamless genome editing. The fusion of two fragments by this method takes less than 0.5 day. The method is expected to facilitate various kinds of complex genetic engineering projects with enhanced efficiency....

  18. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing.

    Science.gov (United States)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-02-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products produced with this method were successfully applied in seamless genome editing. The fusion of two fragments by this method takes less than 0.5 day. The method is expected to facilitate various kinds of complex genetic engineering projects with enhanced efficiency.

  19. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  20. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Directory of Open Access Journals (Sweden)

    Jahn Andreas

    2011-07-01

    Full Text Available Abstract Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible.

  3. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  4. Effects of restrained sampling space and nonplanar amino groups on free-energy predictions for RNA with imino and sheared tandem GA base pairs flanked by GC, CG, iGiC or iCiG base pairs

    Czech Academy of Sciences Publication Activity Database

    Yildirim, I.; Stern, H.A.; Šponer, Jiří; Špačková, Naďa; Turner, D.H.

    2009-01-01

    Roč. 5, č. 8 (2009), s. 2088-2100 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA MŠk(CZ) LC06030 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : base pairs * NMR * amber force field Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  5. The influence of substituents and the environment on the NMR shielding constants of supramolecular complexes based on A-T and A-U base pairs

    NARCIS (Netherlands)

    Castro, Abril C.; Swart, Marcel; Guerra, Célia Fonseca

    2017-01-01

    In the present study, we have theoretically analyzed supramolecular complexes based on the Watson-Crick A-T and A-U base pairs using dispersion-corrected density functional theory (DFT). Hydrogen atoms H8 and/or H6 in the natural adenine and thymine/uracil bases were replaced, respectively, by

  6. Influence of gain fiber on dissipative soliton pairs in passively mode-locked fiber laser based on BP as a saturable absorber

    Science.gov (United States)

    Gao, Bo; Ma, Chunyang; Huo, Jiayu; Guo, Yubin; Sun, Tiegang; Wu, Ge

    2018-03-01

    We investigate the influence of gain fiber on dissipative soliton pairs in passively mode-locked (PML) fiber laser based on black phosphorus (BP) as a saturable absorber. Numerical simulations show that we can generate the dissipative soliton pairs in PML fiber laser when the gain fiber parameters (gain saturation energy and gain bandwidth) are in an appropriate dynamic range, and the dissipative soliton pairs become unstable once the range is exceeded. Then we analyze the dynamic evolution of the dissipative soliton pairs and the influence of gain fiber on the pulse separation, peak power, and single-pulse energy of the dissipative solitons pairs.

  7. Geometrical Alignment of Multiple Fabrication Steps for Rapid Prototyping of Microfluidic Paper-Based Analytical Devices.

    Science.gov (United States)

    Rahbar, Mohammad; Nesterenko, Pavel N; Paull, Brett; Macka, Mirek

    2017-11-21

    Three main fabrication steps for microfluidic paper-based analytical devices (μPADs) were fully integrated with accurate geometrical alignment between the individual steps in a simple and rapid manner. A wax printer for creating hydrophobic barriers was integrated with an inexpensive (ca. $300) electronic craft plotter/cutter for paper cutting, followed by colorimetric reagent deposition using technical pens. The principal shortcoming in the lack of accurate and precise alignment of the features created by these three individual fabrication steps was addressed in this work by developing appropriate alignment procedures during the multistep fabrication process. The wax printing step was geometrically aligned with the following cutting and plotting (deposition) steps in a highly accurate and precise manner using optical scanning function of the plotter/cutter based on registration marks printed on the paper using the wax printer and scanned by the plotter/cutter. The accuracy and precision of alignment in a two-dimensional plane were quantified by cutting and plotting cross-shaped features and measuring their center coordinates relative to wax printed reference lines. The average accuracy along the X- and Y-axis was 0.12 and 0.16 mm for cutting and 0.19 and 0.17 mm for plotting, respectively. The potential of this approach was demonstrated by fabricating μPADs for instrument-free determination of cobalt in waters using distance-based readout, with excellent precision (%RSD = 5.7) and detection limit (LOD) of 2.5 ng and 0.5 mg/L (mass and concentration LODs, respectively).

  8. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    Science.gov (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  9. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    Science.gov (United States)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  10. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  11. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  12. A pairing-free identity-based two-party authenticated key agreement protocol for secure and efficient communication

    Directory of Open Access Journals (Sweden)

    SK Hafizul Islam

    2017-01-01

    Full Text Available Recently, many identity-based two-party authenticated key agreement (ID-2PAKA protocols using elliptic curve cryptography (ECC have been proposed, however, these protocols do not provide adequate security and their computation costs are also relatively high due to bilinear pairing and map-to-point function. Moreover, they require many communication rounds for establishing the session key, and thus results in increased communication latency, which makes them unsuitable for real applications. This paper thus aims to propose a pairing-free ID-2PAKA protocol based on ECC that removes the security flaws of previous protocols. The proposed protocol helps two users to establish a common session key between them through an open network. The formal security analysis using BAN logic and the comparisons with other protocols are given, which demonstrated that our protocol is formally secure and thus, suitable for secure and efficient peer-to-peer communications.

  13. Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

    Science.gov (United States)

    Pinski, Peter; Neese, Frank

    2018-01-01

    Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

  14. Evaluation of full field automated photoelastic analysis based on phase stepping

    Science.gov (United States)

    Haake, S. J.; Wang, Z. F.; Patterson, E. A.

    A full-field automated polariscope designed for photoelastic analysis and based on the method of phase-stepping is described. The system is evaluated through the analysis of five different photoelastic models using both the automated system and using manual analysis employing the Tardy Compensation method. Models were chosen to provide a range of different fringe patterns, orders, and stress gradients and were: a disk in diametral compression, a constrained beam subject to a point load, a tensile plate with a central hole, a turbine blade, and a turbine disk slot. The repeatability of the full-field system was found to compare well with point by point systems. The worst isochromatic error was approximately 0.007 fringes, and the corresponding isoclinic error was 0.75. Results from the manual and automated methods showed good agreement. It is concluded that automated photoelastic analysis based on phase-stepping procedures offers a potentially accurate and reliable tool for stress analysts.

  15. A Method of MPPT Control Based on Power Variable Step-size in Photovoltaic Converter System

    Directory of Open Access Journals (Sweden)

    Xu Hui-xiang

    2016-01-01

    Full Text Available Since the disadvantage of traditional MPPT algorithms of variable step-size, proposed power tracking based on variable step-size with the advantage method of the constant-voltage and the perturb-observe (P&O[1-3]. The control strategy modify the problem of voltage fluctuation caused by perturb-observe method, at the same time, introducing the advantage of constant-voltage method and simplify the circuit topology. With the theoretical derivation, control the output power of photovoltaic modules to change the duty cycle of main switch. Achieve the maximum power stabilization output, reduce the volatility of energy loss effectively, and improve the inversion efficiency[3,4]. Given the result of experimental test based theoretical derivation and the curve of MPPT when the prototype work.

  16. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail: b6rgw@fantasy.plala.or.jp; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)

    2007-02-01

    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  17. Step-based cognitive virtual surgery simulation: an innovative approach to surgical education.

    Science.gov (United States)

    Oliker, Aaron; Napier, Zachary; Deluccia, Nicolette; Qualter, John; Sculli, Frank; Smith, Brandon; Stern, Carrie; Flores, Roberto; Hazen, Alexes; McCarthy, Joseph

    2012-01-01

    BioDigital Systems, LLC in collaboration with New York University Langone Medical Center Department of Reconstructive Plastic Surgery has created a complex, real-time, step-based simulation platform for plastic surgery education. These simulators combine live surgical footage, interactive 3D visualization, text labels, and voiceover as well as a high-yield, expert-approved testing mode to create a comprehensive virtual educational environment for the plastic surgery resident or physician.

  18. Multi-Step Deep Reactive Ion Etching Fabrication Process for Silicon-Based Terahertz Components

    Science.gov (United States)

    Jung-Kubiak, Cecile (Inventor); Reck, Theodore (Inventor); Chattopadhyay, Goutam (Inventor); Perez, Jose Vicente Siles (Inventor); Lin, Robert H. (Inventor); Mehdi, Imran (Inventor); Lee, Choonsup (Inventor); Cooper, Ken B. (Inventor); Peralta, Alejandro (Inventor)

    2016-01-01

    A multi-step silicon etching process has been developed to fabricate silicon-based terahertz (THz) waveguide components. This technique provides precise dimensional control across multiple etch depths with batch processing capabilities. Nonlinear and passive components such as mixers and multipliers waveguides, hybrids, OMTs and twists have been fabricated and integrated into a small silicon package. This fabrication technique enables a wafer-stacking architecture to provide ultra-compact multi-pixel receiver front-ends in the THz range.

  19. A Two Dimensional Overlapped Subaperture Polar Format Algorithm Based on Stepped-chirp Signal

    OpenAIRE

    Mao, Xinhua; Zhu, Daiyin; Nie, Xin; Zhu, Zhaoda

    2008-01-01

    In this work, a 2-D subaperture polar format algorithm (PFA) based on stepped-chirp signal is proposed. Instead of traditional pulse synthesis preprocessing, the presented method integrates the pulse synthesis process into the range subaperture processing. Meanwhile, due to the multi-resolution property of subaperture processing, this algorithm is able to compensate the space-variant phase error caused by the radar motion during the period of a pulse cluster. Point target simulation has valid...

  20. Data-based control of a multi-step forming process

    Science.gov (United States)

    Schulte, R.; Frey, P.; Hildenbrand, P.; Vogel, M.; Betz, C.; Lechner, M.; Merklein, M.

    2017-09-01

    The fourth industrial revolution represents a new stage in the organization and management of the entire value chain. However, concerning the field of forming technology, the fourth industrial revolution has only arrived gradually until now. In order to make a valuable contribution to the digital factory the controlling of a multistage forming process was investigated. Within the framework of the investigation, an abstracted and transferable model is used to outline which data have to be collected, how an interface between the different forming machines can be designed tangible and which control tasks must be fulfilled. The goal of this investigation was to control the subsequent process step based on the data recorded in the first step. The investigated process chain links various metal forming processes, which are typical elements of a multi-step forming process. Data recorded in the first step of the process chain is analyzed and processed for an improved process control of the subsequent process. On the basis of the gained scientific knowledge, it is possible to make forming operations more robust and at the same time more flexible, and thus create the fundament for linking various production processes in an efficient way.

  1. ARPES measurements of the superconducting gap of Fe-based superconductors and their implications to the pairing mechanism.

    Science.gov (United States)

    Richard, P; Qian, T; Ding, H

    2015-07-29

    Its direct momentum sensitivity confers to angle-resolved photoemission spectroscopy (ARPES) a unique perspective in investigating the superconducting gap of multi-band systems. In this review we discuss ARPES studies on the superconducting gap of high-temperature Fe-based superconductors. We show that while Fermi-surface-driven pairing mechanisms fail to provide a universal scheme for the Fe-based superconductors, theoretical approaches based on short-range interactions lead to a more robust and universal description of superconductivity in these materials. Our findings are also discussed in the broader context of unconventional superconductivity.

  2. Comparison of crossover and jab step start techniques for base stealing in baseball.

    Science.gov (United States)

    Miyanishi, Tomohisa; Endo, So; Nagahara, Ryu

    2017-11-01

    Base stealing is an important tactic for increasing the chance of scoring in baseball. This study aimed to compare the crossover step (CS) and jab step (JS) starts for base stealing start performance and to clarify the differences between CS and JS starts in terms of three-dimensional lower extremity joint kinetics. Twelve male baseball players performed CS and JS starts, during which their motion and the force they applied to the ground were simultaneously recorded using a motion-capture system and two force platforms. The results showed that the normalised average forward external power, the average forward-backward force exerted by the left leg, and the forward velocities of the whole body centre of gravity generated by both legs and the left leg were significantly higher for the JS start than for the CS start. Moreover, the positive work done by hip extension during the left leg push-off was two-times greater for the JS start than the CS start. In conclusion, this study has demonstrated that the jab step start may be the better technique for a base stealing start and that greater positive work produced by left hip extension is probably responsible for producing its larger forward ground reaction force.

  3. MHC-based patterns of social and extra-pair mate choice in the Seychelles warbler

    Science.gov (United States)

    Richardson, David S; Komdeur, Jan; Burke, Terry; von Schantz, Torbjörn

    2005-01-01

    The existence and nature of indirect genetic benefits to mate choice remain contentious. Major histocompatibility complex (MHC) genes, which play a vital role in determining pathogen resistance in vertebrates, may be the link between mate choice and the genetic inheritance of vigour in offspring. Studies have shown that MHC-dependent mate choice can occur in mammal and fish species, but little work has focused on the role of the MHC in birds. We tested for MHC-dependent mating patterns in the Seychelles warbler (Acrocephalus sechellensis). There was no influence of MHC class I exon 3 variation on the choice of social mate. However, females were more likely to obtain extra-pair paternity (EPP) when their social mate had low MHC diversity, and the MHC diversity of the extra-pair male was significantly higher than that of the cuckolded male. There was no evidence that females were mating disassortatively, or that they preferred males with an intermediate number of MHC bands. Overall, the results are consistent with the ‘good genes’ rather than the ‘genetic compatibility’ hypothesis. As female choice will result in offspring of higher MHC diversity, MHC-dependent EPP may provide indirect benefits in the Seychelles warbler if survival is positively linked to MHC diversity. PMID:15870038

  4. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  5. Understanding the role of base stacking in nucleic acids. MD and QM analysis of tandem GA base pairs in RNA duplexes

    Czech Academy of Sciences Publication Activity Database

    Morgado, C.A.; Svozil, D.; Turner, D.H.; Šponer, Jiří

    2012-01-01

    Roč. 14, č. 36 (2012), s. 12580-12591 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : GA base pairs * base stacking * RNA duplexes Subject RIV: BO - Biophysics Impact factor: 3.829, year: 2012

  6. A 3-Step Algorithm Using Region-Based Active Contours for Video Objects Detection

    Directory of Open Access Journals (Sweden)

    Stéphanie Jehan-Besson

    2002-06-01

    Full Text Available We propose a 3-step algorithm for the automatic detection of moving objects in video sequences using region-based active contours. First, we introduce a very full general framework for region-based active contours with a new Eulerian method to compute the evolution equation of the active contour from a criterion including both region-based and boundary-based terms. This framework can be easily adapted to various applications, thanks to the introduction of functions named descriptors of the different regions. With this new Eulerian method based on shape optimization principles, we can easily take into account the case of descriptors depending upon features globally attached to the regions. Second, we propose a 3-step algorithm for detection of moving objects, with a static or a mobile camera, using region-based active contours. The basic idea is to hierarchically associate temporal and spatial information. The active contour evolves with successively three sets of descriptors: a temporal one, and then two spatial ones. The third spatial descriptor takes advantage of the segmentation of the image in intensity homogeneous regions. User interaction is reduced to the choice of a few parameters at the beginning of the process. Some experimental results are supplied.

  7. A region-based two-step P300-based brain-computer interface for patients with amyotrophic lateral sclerosis.

    Science.gov (United States)

    Ikegami, Shiro; Takano, Kouji; Kondo, Kiyohiko; Saeki, Naokatsu; Kansaku, Kenji

    2014-11-01

    The P300-based brain-computer interface (BCI) is designed to help patients with motor disabilities to control their environment, and it has been used successfully in patients with amyotrophic lateral sclerosis (ALS). However, some ALS patients were unable to use the visual P300-BCI with the conventional row/column presentation. In this study, we evaluated the effect of a newly developed region-based two-step P300 speller, which has a larger flashing area than the conventional visual array. Seven ALS patients and seven age- and sex-matched able-bodied control subjects were required to input hiragana characters using our P300 BCI system. We prepared two types of input procedures, the conventional row/column (RC) speller and the two-step speller, and evaluated their online performance. The mean online accuracy of the ALS patients was 24% for the RC condition and 55% for the two-step condition. The accuracy of the control subjects was 71% and 83% for the RC and two-step condition, respectively. Accuracy in ALS patients was significantly lower than that in the control subjects, and the new visual stimuli significantly increased accuracy of ALS patients. Using the new speller, two ALS patients showed an initial accuracy sufficient for practical use (>70%). The other two ALS patients, who performed better in the first trial using the new speller, continued to experience the BCI system, and their mean accuracy increased to 92%. The two-step procedure for the visual P300 BCI system provided significantly increased accuracy for ALS patients compared with a conventional RC speller. The new region-based two-step P300 speller was effective in ALS patients, and the system may be beneficial to expand their range of activities. Copyright © 2014 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  8. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  9. Interrupt-Based Step-Counting to Extend Battery Life in an Activity Monitor

    Directory of Open Access Journals (Sweden)

    Seung Young Kim

    2016-01-01

    Full Text Available Most activity monitors use an accelerometer and gyroscope sensors to characterize the wearer’s physical activity. The monitor measures the motion by polling an accelerometer or gyroscope sensor or both every 20–30 ms and frequent polling affects the battery life of a wearable device. One of the key features of a commercial daily-activity monitoring device is longer battery life so that the user can keep track of his or her activity for a week or so without recharging the battery of the monitoring device. Many low-power approaches for a step-counting system use either a polling-based algorithm or an interrupt-based algorithm. In this paper, we propose a novel approach that uses the tap interrupt of an accelerometer to count steps while consuming low power. We compared the accuracy of step counting and measured system-level power consumption to a periodic sensor-reading algorithm. Our tap interrupt approach shows a battery lifetime that is 175% longer than that of a 30 ms polling method without gyroscope. The battery lifetime can be extended up to 863% with a gyroscope by putting both the processor and the gyroscope into sleep state during the majority of operation time.

  10. Two-Step Time of Arrival Estimation for Pulse-Based Ultra-Wideband Systems

    Directory of Open Access Journals (Sweden)

    H. Vincent Poor

    2008-05-01

    Full Text Available In cooperative localization systems, wireless nodes need to exchange accurate position-related information such as time-of-arrival (TOA and angle-of-arrival (AOA, in order to obtain accurate location information. One alternative for providing accurate position-related information is to use ultra-wideband (UWB signals. The high time resolution of UWB signals presents a potential for very accurate positioning based on TOA estimation. However, it is challenging to realize very accurate positioning systems in practical scenarios, due to both complexity/cost constraints and adverse channel conditions such as multipath propagation. In this paper, a two-step TOA estimation algorithm is proposed for UWB systems in order to provide accurate TOA estimation under practical constraints. In order to speed up the estimation process, the first step estimates a coarse TOA of the received signal based on received signal energy. Then, in the second step, the arrival time of the first signal path is estimated by considering a hypothesis testing approach. The proposed scheme uses low-rate correlation outputs and is able to perform accurate TOA estimation in reasonable time intervals. The simulation results are presented to analyze the performance of the estimator.

  11. Solar radiation concentrators paired with multijunction photoelectric converters in ground-based solar power plants (Part II)

    Science.gov (United States)

    Ionova, E. A.; Ulanov, M. V.; Davidyuk, N. Yu.; Sadchikov, N. A.

    2017-04-01

    The present work is devoted to determining the conditions of the joint operation of photoelectric converter-solar concentrator pairs, which are used in solar power plants with concentrators. Three-cascade photoconverters based on A3B5 materials with different distributions of solar radiation in spectral ranges are studied. Concentrators of solar radiation are designed as the Fresnel lenses with silicon-on-glass structure. Refractive lens profile fabricated on the basis of Wacker RT604 silicone rubber is characterized by significant changes in refractive index with temperature. The effect of geometric parameters of the Fresnel lenses and their operating temperature on characteristics of solar radiation concentration in specified spectral intervals have been examined. The parameters of concentrators being paired with a photoelectric converter, which may ensure the efficient functioning of the solar power plant, have been calculated.

  12. Effectiveness of a two-step population-based osteoporosis screening program using FRAX

    DEFF Research Database (Denmark)

    Rubin, K H; Rothmann, M J; Holmberg, T

    2018-01-01

    The Risk-stratified Osteoporosis Strategy Evaluation (ROSE) study investigated the effectiveness of a two-step screening program for osteoporosis in women. We found no overall reduction in fractures from systematic screening compared to the current case-finding strategy. The group of moderate......- to high-risk women, who accepted the invitation to DXA, seemed to benefit from the program. INTRODUCTION: The purpose of the ROSE study was to investigate the effectiveness of a two-step population-based osteoporosis screening program using the Fracture Risk Assessment Tool (FRAX) derived from a self......-administered questionnaire to select women for DXA scan. After the scanning, standard osteoporosis management according to Danish national guidelines was followed. METHODS: Participants were randomized to either screening or control group, and randomization was stratified according to age and area of residence. Inclusion...

  13. Investigating the Effectiveness of Teaching Methods Based on a Four-Step Constructivist Strategy

    Science.gov (United States)

    Çalik, Muammer; Ayas, Alipaşa; Coll, Richard K.

    2010-02-01

    This paper reports on an investigation of the effectiveness an intervention using several different methods for teaching solution chemistry. The teaching strategy comprised a four-step approach derived from a constructivist view of learning. A sample consisting of 44 students (18 boys and 26 girls) was selected purposively from two different Grade 9 classes in the city of Trabzon, Turkey. Data collection employed a purpose-designed `solution chemistry concept test', consisting of 17 items, with the quantitative data from the survey supported by qualitative interview data. The findings suggest that using different methods embedded within the four-step constructivist-based teaching strategy enables students to refute some alternative conceptions, but does not completely eliminate student alternative conceptions for solution chemistry.

  14. Silver-Mediated Base Pairs in DNA Incorporating Purines, 7-Deazapurines, and 8-Aza-7-deazapurines: Impact of Reduced Nucleobase Binding Sites and an Altered Glycosylation Position.

    Science.gov (United States)

    Zhao, Hang; Leonard, Peter; Guo, Xiurong; Yang, Haozhe; Seela, Frank

    2017-04-24

    Formation of silver-mediated DNA was studied with oligonucleotides incorporating 8-aza-7-deazapurine, 7-deazapurine, and purine nucleosides. The investigation was performed on non-self-complementary duplexes with one or two modifications and self-complementary duplexes with an alternating dA-dT motif. Homo base pairs as well as base pair mismatches of dA analogues with dC and Watson-Crick pairs with dT were studied by stoichiometric silver ion titration and T m measurements. N 8 -Glycosylated 8-aza-7-deazaadenine forms silver-ion-mediated base pairs capturing two silver ions (low silver content) whereas regularly glycosylated 8-aza-7-deazapurine, 7-deazapurine (c 7 A d ), and dA do not form comparable structures. Stable silver-mediated "dA-dC" base pair mismatches were detected for all nucleosides. Two silver ions per base pair are bound by 8-aza-7-deazapurine whereas c 7 A d binds only one silver ion. The situation is different when the equivalents of silver ions were increased to the number of total base pairs. Surprisingly, in 12-mer duplexes as well as in related 25-mer duplexes every base pair consumed one silver ion. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  16. One-step synthesis of DNA functionalized cadmium-free quantum dots and its application in FRET-based protein sensing

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)

    2017-03-08

    DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.

  17. Enhancing improved heuristic drift elimination for step-and-heading based pedestrian dead-reckoning systems.

    Science.gov (United States)

    Diez, Luis E; Bahillo, Alfonso; Bataineh, Safaa; Masegosa, Antonio D; Perallos, Asier

    2016-08-01

    Location based services can improve the quality of patient care and increase the efficiency of the healthcare systems. Among the different technologies that provide indoor positioning, inertial sensors based pedestrian dead-reckoning (PDR) is one of the more cost-effective solutions, but its performance is limited by drift problems. Regarding the heading drift, some heuristics make use of the building's dominant directions in order to reduce this problem. In this paper, we enhance the method known as improved heuristic drift elimination (iHDE) to be implemented in a Step-and-Heading (SHS) based PDR system, that allows to place the inertial sensors in almost any location of the user's body. Particularly, wrist-worn sensors will be used. Tests on synthetically generated and real data show that the iHDE method can be used in a SHS-based PDR without losing its heading drift reduction capability.

  18. Is ad-hoc plan adaptation based on 2-Step IMRT feasible?

    International Nuclear Information System (INIS)

    Bratengeier, Klaus; Polat, Buelent; Gainey, Mark; Grewenig, Patricia; Meyer, Juergen; Flentje, Michael

    2009-01-01

    Background: The ability of a geometry-based method to expeditiously adapt a '2-Step' step and shoot IMRT plan was explored. Both changes of the geometry of target and organ at risk have to be balanced. A retrospective prostate planning study was performed to investigate the relative benefits of beam segment adaptation to the changes in target and organ at risk coverage. Methods: Four patients with six planning cases with extraordinarily large deformations of rectum and prostate were chosen for the study. A 9-field IMRT plan (A) using 2-Step IMRT segments was planned on an initial CT study. The plan had to fulfil all the requirements of a conventional high-quality step and shoot IMRT plan. To adapt to changes of the anatomy in a further CT data set, three approaches were considered: the original plan with optimized isocentre position (B), a newly optimized plan (C) and the original plan, adapted using the 2-Step IMRT optimization rules (D). DVH parameters were utilized for quantification of plan quality: D 99 for the CTV and the central planning target volume (PTV), D 95 for an outer PTV, V 95 , V 80 and V 50 for rectum and bladder. Results: The adapted plan (D) achieved almost the same target coverage as the newly optimized plan (C). Target coverage for plan B was poor and for the organs at risk, the rectum V 80 was slightly increased. The volume with more than 95% of the target dose (V 95 ) was 1.5 ± 1.5 cm 3 for the newly optimized plan (C), compared to 2.2 ± 1.3 cm 3 for the original plan (A) and 7.2 ± 4.8 cm 3 (B) on the first and the second CT, respectively. The adapted plan resulted in 4.3 ± 2.1 cm 3 (D), an intermediate dose load to the rectum. All other parameters were comparable for the newly optimized and the adapted plan. Conclusions: The first results for adaptation of interfractional changes using the 2-Step IMRT algorithm are encouraging. The plans were superior to plans with optimized isocentre position and only marginally inferior to a newly

  19. Base pairing and miscoding properties of 1,N(6)-ethenoadenine- and 3,N(4)-ethenocytosine-containing RNA oligonucleotides.

    Science.gov (United States)

    Calabretta, Alessandro; Leumann, Christian J

    2013-03-19

    Two RNA phosphoramidites containing the bases 1,N(6)-ethenoadenine (εA) and 3,N(4)-ethenocytosine (εC) were synthesized. These building blocks were incorporated into two 12-mer oligoribonucleotides for evaluation of the base pairing properties of these base lesions by UV melting curve (Tm) and circular dichroism measurements. The Tm data of the resulting duplexes with the etheno modifications opposing all natural bases showed a substantial destabilization compared to the corresponding natural duplexes, confirming their inability to form base pairs. The coding properties of these lesions were further investigated by introducing them into 31-mer oligonucleotides and assessing their ability to serve as templates in primer extension reactions with HIV, AMV, and MMLV reverse transcriptases (RT). Primer extension reactions showed complete arrest of the incorporation process using MMLV RT and AMV RT, while HIV RT preferentially incorporates dAMP opposite εA and dAMP as well as dTMP opposite εC. The properties of these RNA lesions are discussed in the context of its putative biological role.

  20. Two-step calibration method for multi-algorithm score-based face recognition systems by minimizing discrimination loss

    NARCIS (Netherlands)

    Susyanto, N.; Veldhuis, Raymond N.J.; Spreeuwers, Lieuwe Jan; Klaassen, C.A.J.

    2016-01-01

    We propose a new method for combining multi-algorithm score-based face recognition systems, which we call the two-step calibration method. Typically, algorithms for face recognition systems produce dependent scores. The two-step method is based on parametric copulas to handle this dependence. Its

  1. High-throughput quantification of palladium in water samples by ion pair based-surfactant assisted microextraction.

    Science.gov (United States)

    Yamini, Yadollah; Moradi, Morteza; Tahmasebi, Elham

    2012-05-30

    A novel method for the determination of palladium as a metal ion model was developed by ion pair based surfactant-assisted microextraction (IP-SAME) and inductively coupled plasma-optical detection (ICP-OES). In this methodology, a cationic surfactant was used in extraction process. It has two fundamental functions: (1) the formation of an emulsified phase and (2) the ion pair formation with Pd(II) in the presence of iodide ions and making PdI4(2-) extractable into organic phase (active microextraction). The effective parameters on the extraction recovery such as the types of extraction solvent and the surfactant, surfactant concentration, KI amount and HCl concentration of the sample were investigated and optimized. In the proposed approach, tetradecyl trimethyl ammonium bromide (TTAB) was used as emulsifier and ion pairing agent, and 1-octanol was selected as extraction solvent. Under the optimum conditions, the enhancement factor as large as 146 was obtained. The detection limit for palladium was 0.2 μg L(-1), and the relative standard deviation (RSD) was 4.1% (n=5, C=10.0 μg L(-1)). The proposed method was applied for extraction and determination of palladium in different water samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  3. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  4. Memory-based robust adaptive control of a variable length stepping nanomanipulator

    Science.gov (United States)

    Saeidpourazar, Reza; Jalili, Nader

    2007-04-01

    This paper presents the modeling and memory-based robust adaptive control of a variable length stepping nanomanipulator. A three degree of freedom (3DOF) nanomanipulator with revolute revolute prismatic (RRP) actuator structure, namely here MM3A, is utilized for a variety of nanomanipulation tasks. Unlike widely used Cartesian-structure nanomanipulators, the MM3A is equipped with revolute-piezoelectric actuators which result in outstanding performance for controlling the nanomanipulator's tip alignment during the nanomanipulation process. However, the RRP structure of the nanomanipulator introduces complicity in kinematic and dynamic equations of the system which needs to be addressed in order to control the nanomanipulation process. Dissimilar to the ordinary piezoelectric actuators which provide only a couple of micrometers working range, the piezoelectric actuators utilized in MM3A, namely Nanomotors, provide wide range of action (120° in revolute actuators and 12mm in prismatic actuator) with sub-nano scale precision (0.1 μrad in revolute actuators and 0.25 nm in prismatic actuator). This wide range of action combined with sub-nano scale precision is achieved using a special stick/slip moving principle of the Nanomotors. However, such stick/slip motion results in stepping movement of the MM3A. Hence, due to the RRP structure and stepping movement principle of the MM3A nanomanipulator, controller design for the nanomanipulation process is not a trivial task. In this paper, a novel memory-based robust adaptive controller is proposed to overcome these shortfalls. Following the development of the memory-based robust adaptive controller, numerical simulations of the proposed controller are preformed to demonstrate the positioning performance capability of the controller in nanomanipulation tasks.

  5. Nuclear mass predictions based on Bayesian neural network approach with pairing and shell effects

    Science.gov (United States)

    Niu, Z. M.; Liang, H. Z.

    2018-03-01

    Bayesian neural network (BNN) approach is employed to improve the nuclear mass predictions of various models. It is found that the noise error in the likelihood function plays an important role in the predictive performance of the BNN approach. By including a distribution for the noise error, an appropriate value can be found automatically in the sampling process, which optimizes the nuclear mass predictions. Furthermore, two quantities related to nuclear pairing and shell effects are added to the input layer in addition to the proton and mass numbers. As a result, the theoretical accuracies are significantly improved not only for nuclear masses but also for single-nucleon separation energies. Due to the inclusion of the shell effect, in the unknown region, the BNN approach predicts a similar shell-correction structure to that in the known region, e.g., the predictions of underestimation of nuclear mass around the magic numbers in the relativistic mean-field model. This manifests that better predictive performance can be achieved if more physical features are included in the BNN approach.

  6. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    Science.gov (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  7. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

    Science.gov (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

    2009-01-01

    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  8. A Study on the Storage Reliability of LSINS Based on Step-stress Accelerated Life Test

    Directory of Open Access Journals (Sweden)

    Teng Fei

    2015-01-01

    Full Text Available Based on the step-stress accelerated life test and the laser strap-down inertial navigation system, this paper studies the accelerated life model and the test method, provides the likelihood function, the likelihood equation and the two-order derivative when the stress level is k, evaluates the effectiveness of the method with the simulation test model established by MATLAB, applies the research findings in the storage reliability study of the XX laser strap-down inertial navigation system, and puts forward an effective evaluation method of the storage life of the inertial navigation system.

  9. Flexible biodegradable citrate-based polymeric step-index optical fiber.

    Science.gov (United States)

    Shan, Dingying; Zhang, Chenji; Kalaba, Surge; Mehta, Nikhil; Kim, Gloria B; Liu, Zhiwen; Yang, Jian

    2017-10-01

    Implanting fiber optical waveguides into tissue or organs for light delivery and collection is among the most effective ways to overcome the issue of tissue turbidity, a long-standing obstacle for biomedical optical technologies. Here, we report a citrate-based material platform with engineerable opto-mechano-biological properties and demonstrate a new type of biodegradable, biocompatible, and low-loss step-index optical fiber for organ-scale light delivery and collection. By leveraging the rich designability and processibility of citrate-based biodegradable polymers, two exemplary biodegradable elastomers with a fine refractive index difference and yet matched mechanical properties and biodegradation profiles were developed. Furthermore, we developed a two-step fabrication method to fabricate flexible and low-loss (0.4 db/cm) optical fibers, and performed systematic characterizations to study optical, spectroscopic, mechanical, and biodegradable properties. In addition, we demonstrated the proof of concept of image transmission through the citrate-based polymeric optical fibers and conducted in vivo deep tissue light delivery and fluorescence sensing in a Sprague-Dawley (SD) rat, laying the groundwork for realizing future implantable devices for long-term implantation where deep-tissue light delivery, sensing and imaging are desired, such as cell, tissue, and scaffold imaging in regenerative medicine and in vivo optogenetic stimulation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. "One-step" simplified electrochemical sensing of TATP based on its acid treatment.

    Science.gov (United States)

    Munoz, Rodrigo A A; Lu, Donglai; Cagan, Avi; Wang, Joseph

    2007-06-01

    A fast, simple and sensitive electrochemical method for sensing peroxide-based explosives based on their acid treatment is reported. The method relies on the high electrocatalytic activity of Prussian-blue (PB)-modified electrodes towards the acid-generated hydrogen peroxide in the harsh acidic medium (down to pH 0.3) used for releasing hydrogen peroxide. Such effective operation of PB electrochemical sensors in strongly acidic media eliminates the need for an additional neutralization step required in analogous peroxidase-based assays (due to acid-induced enzyme deactivation processes). Factors affecting the efficiency of the acid pre-treatment of triacetone triperoxide (TATP) have been examined and optimized to allow its sensitive measurement down to the 50 ng level within 60 s. Chronoamperometric detection of microgram amounts of solid TATP, following a one-minute acid mixing and placing a 20 microL droplet onto a disposable PB-modified screen-printed electrode is illustrated. Similar results were obtained for the peroxide explosive hexamethylene triperoxide diamine (HMTD). By greatly simplifying the analytical procedure, such an acid-operated "artificial peroxidase" electrocatalytic transducer holds great promise for designing "one-step", user-friendly, miniaturized, cost-effective devices for field screening of peroxide explosives.

  11. On analysis-based two-step interpolation methods for randomly sampled seismic data

    Science.gov (United States)

    Yang, Pengliang; Gao, Jinghuai; Chen, Wenchao

    2013-02-01

    Interpolating the missing traces of regularly or irregularly sampled seismic record is an exceedingly important issue in the geophysical community. Many modern acquisition and reconstruction methods are designed to exploit the transform domain sparsity of the few randomly recorded but informative seismic data using thresholding techniques. In this paper, to regularize randomly sampled seismic data, we introduce two accelerated, analysis-based two-step interpolation algorithms, the analysis-based FISTA (fast iterative shrinkage-thresholding algorithm) and the FPOCS (fast projection onto convex sets) algorithm from the IST (iterative shrinkage-thresholding) algorithm and the POCS (projection onto convex sets) algorithm. A MATLAB package is developed for the implementation of these thresholding-related interpolation methods. Based on this package, we compare the reconstruction performance of these algorithms, using synthetic and real seismic data. Combined with several thresholding strategies, the accelerated convergence of the proposed methods is also highlighted.

  12. First steps towards the realization of a double layer perceptron based on organic memristive devices

    Directory of Open Access Journals (Sweden)

    A. V. Emelyanov

    2016-11-01

    Full Text Available Memristors are widely considered as promising elements for the efficient implementation of synaptic weights in artificial neural networks (ANNs since they are resistors that keep memory of their previous conductive state. Whereas demonstrations of simple neural networks (e.g., a single-layer perceptron based on memristors already exist, the implementation of more complicated networks is more challenging and has yet to be reported. In this study, we demonstrate linearly nonseparable combinational logic classification (XOR logic task using a network implemented with CMOS-based neurons and organic memrisitive devices that constitutes the first step toward the realization of a double layer perceptron. We also show numerically the ability of such network to solve a principally analogue task which cannot be realized by digital devices. The obtained results prove the possibility to create a multilayer ANN based on memristive devices that paves the way for designing a more complex network such as the double layer perceptron.

  13. First steps towards the realization of a double layer perceptron based on organic memristive devices

    Science.gov (United States)

    Emelyanov, A. V.; Lapkin, D. A.; Demin, V. A.; Erokhin, V. V.; Battistoni, S.; Baldi, G.; Dimonte, A.; Korovin, A. N.; Iannotta, S.; Kashkarov, P. K.; Kovalchuk, M. V.

    2016-11-01

    Memristors are widely considered as promising elements for the efficient implementation of synaptic weights in artificial neural networks (ANNs) since they are resistors that keep memory of their previous conductive state. Whereas demonstrations of simple neural networks (e.g., a single-layer perceptron) based on memristors already exist, the implementation of more complicated networks is more challenging and has yet to be reported. In this study, we demonstrate linearly nonseparable combinational logic classification (XOR logic task) using a network implemented with CMOS-based neurons and organic memrisitive devices that constitutes the first step toward the realization of a double layer perceptron. We also show numerically the ability of such network to solve a principally analogue task which cannot be realized by digital devices. The obtained results prove the possibility to create a multilayer ANN based on memristive devices that paves the way for designing a more complex network such as the double layer perceptron.

  14. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  15. Trans Hoogsteen/sugar edge base pairing in RNA. Structures, energies, and stabilities from quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Mládek, Arnošt; Sharma, P.; Mitra, A.; Bhattacharyya, D.; Šponer, Jiří; Šponer, Judit E.

    2009-01-01

    Roč. 113, č. 6 (2009), s. 1743-1755 ISSN 1520-6106 R&D Projects: GA AV ČR(CZ) IAA400550701; GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) 1QS500040581; GA MŠk(CZ) LC06030 Grant - others:GA MŠk(CZ) LC512 Program:LC Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : quantum chemical calculations * base pairing * RNA Subject RIV: BO - Biophysics Impact factor: 3.471, year: 2009

  16. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  17. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. An FPGA-Based Multiple-Axis Velocity Controller and Stepping Motors Drives Design

    Directory of Open Access Journals (Sweden)

    Lai Chiu-Keng

    2016-01-01

    Full Text Available A Field Programmable Gate Array based system is a great hardware platform to support the implementation of hardware controllers such as PID controller and fuzzy controller. It is also programmed as hardware accelerator to speed up the mathematic calculation and greatly enhance the performance as applied to motor drive and motion control. Furthermore, the open structure of FPGA-based system is suitable for those designs with the ability of parallel processing or soft code processor embedded. In this paper, we apply the FPGA to a multi-axis velocity controller design. The developed system integrated three functions inside the FPGA chip, which are respectively the stepping motor drive, the multi-axis motion controller and the motion planning. Furthermore, an embedded controller with a soft code processor compatible to 8051 micro-control unit (MCU is built to handle the data transfer between the FPGA board and host PC. The MCU is also used to initialize the motion control and run the interpolator. The designed system is practically applied to a XYZ motion platform which is driven by stepping motors to verify its performance.

  19. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...... of their Danish host families. Based on their migratory status as au pairs, these young migrants must therefore negotiate the different moral and contractual rights and obligations that characterize the local and transnational family ties in which they are engaged. This study of Filipina au pair migration through...... pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...

  20. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    Science.gov (United States)

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  1. First Steps Toward Incorporating Image Based Diagnostics Into Particle Accelerator Control Systems Using Convolutional Neural Networks

    Energy Technology Data Exchange (ETDEWEB)

    Edelen, A. L.; Biedron, S. G.; Milton, S. V.; Edelen, J. P.

    2016-12-16

    At present, a variety of image-based diagnostics are used in particle accelerator systems. Often times, these are viewed by a human operator who then makes appropriate adjustments to the machine. Given recent advances in using convolutional neural networks (CNNs) for image processing, it should be possible to use image diagnostics directly in control routines (NN-based or otherwise). This is especially appealing for non-intercepting diagnostics that could run continuously during beam operation. Here, we show results of a first step toward implementing such a controller: our trained CNN can predict multiple simulated downstream beam parameters at the Fermilab Accelerator Science and Technology (FAST) facility's low energy beamline using simulated virtual cathode laser images, gun phases, and solenoid strengths.

  2. Electrochemical model of polyaniline-based memristor with mass transfer step

    International Nuclear Information System (INIS)

    Demin, V.A.; Erokhin, V.V.; Kashkarov, P.K.; Kovalchuk, M.V.

    2015-01-01

    The electrochemical organic memristor with polyaniline active layer is a stand-alone device designed and realized for reproduction of some synapse properties in the innovative electronic circuits, such as the new field-programmable gate arrays or the neuromorphic networks capable for learning. In this work a new theoretical model of the polyaniline memristor is presented. The developed model of organic memristor functioning was based on the detailed consideration of possible electrochemical processes occuring in the active zone of this device including the mass transfer step of ionic reactants. Results of the calculation have demonstrated not only the qualitative explanation of the characteristics observed in the experiment, but also quantitative similarities of the resultant current values. This model can establish a basis for the design and prediction of properties of more complicated circuits and systems (including stochastic ones) based on the organic memristive devices

  3. A model of hydrogen impact induced chemical erosion of carbon based on elementary reaction steps

    International Nuclear Information System (INIS)

    Wittmann, M.; Kueppers, J.

    1996-01-01

    Based on the elementary reaction steps for chemical erosion of carbon by hydrogen a model is developed which allows to calculate the amount of carbon erosion at a hydrogenated carbon surface under the impact of hydrogen ions and neutrals. Hydrogen ion and neutral flux energy distributions prevailing at target plates in the ASDEX upgrade experiment are chosen in the present calculation. The range of hydrogen particles in the target plates is calculated using TRIDYN code. Based upon the TRIDYN results the extent of the erosion reaction as a function of depth is estimated. The results show that both, target temperature and impinging particle flux energy distribution, determine the hydrogen flux density dependent erosion yield and the location of the erosion below the surface. (orig.)

  4. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  5. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  6. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  7. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  8. The Inquiry Based Science and Technology Education Program (IN-STEP): The Evaluation of the First Year

    Science.gov (United States)

    Corcoran, Thomas B.

    2008-01-01

    This is the first report on the evaluation of the Inquiry Based Science and Technology Education Program (IN-STEP), an innovative and ambitious science education initiative for lower secondary schools being undertaken by a public-private partnership in Thailand funded by MSD-Thailand, an affiliate of Merck & Co. IN-STEP is a public-private…

  9. Stepping to the Beat: Feasibility and Potential Efficacy of a Home-Based Auditory-Cued Step Training Program in Chronic Stroke

    Directory of Open Access Journals (Sweden)

    Rachel L. Wright

    2017-08-01

    Full Text Available BackgroundHemiparesis after stroke typically results in a reduced walking speed, an asymmetrical gait pattern and a reduced ability to make gait adjustments. The purpose of this pilot study was to investigate the feasibility and preliminary efficacy of home-based training involving auditory cueing of stepping in place.MethodsTwelve community-dwelling participants with chronic hemiparesis completed two 3-week blocks of home-based stepping to music overlaid with an auditory metronome. Tempo of the metronome was increased 5% each week. One 3-week block used a regular metronome, whereas the other 3-week block had phase shift perturbations randomly inserted to cue stepping adjustments.ResultsAll participants reported that they enjoyed training, with 75% completing all training blocks. No adverse events were reported. Walking speed, Timed Up and Go (TUG time and Dynamic Gait Index (DGI scores (median [inter-quartile range] significantly improved between baseline (speed = 0.61 [0.32, 0.85] m⋅s−1; TUG = 20.0 [16.0, 39.9] s; DGI = 14.5 [11.3, 15.8] and post stepping training (speed = 0.76 [0.39, 1.03] m⋅s−1; TUG = 16.3 [13.3, 35.1] s; DGI = 16.0 [14.0, 19.0] and was maintained at follow-up (speed = 0.75 [0.41, 1.03] m⋅s−1; TUG = 16.5 [12.9, 34.1] s; DGI = 16.5 [13.5, 19.8].ConclusionThis pilot study suggests that auditory-cued stepping conducted at home was feasible and well-tolerated by participants post-stroke, with improvements in walking and functional mobility. No differences were detected between regular and phase-shift training with the metronome at each assessment point.

  10. Healthy Steps Trial: Pedometer-Based Advice and Physical Activity for Low-Active Older Adults

    Science.gov (United States)

    Kolt, Gregory S.; Schofield, Grant M.; Kerse, Ngaire; Garrett, Nicholas; Ashton, Toni; Patel, Asmita

    2012-01-01

    PURPOSE We compared the effectiveness of 2 physical activity prescriptions delivered in primary care—the standard time-based Green Prescription and a pedometer step-based Green Prescription—on physical activity, body mass index (BMI), blood pressure, and quality of life in low-active older adults. METHODS We undertook a randomized controlled trial involving 330 low-active older adults (aged =65 years) recruited through their primary care physicians’ patient databases. Participants were randomized to either the pedometer step-based Green Prescription group (n = 165) or the standard Green Prescription group (n = 165). Both groups had a visit with the primary care practitioner and 3 telephone counseling sessions over 12 weeks aimed at increasing physical activity. Outcomes were the changes in physical activity (assessed with the Auckland Heart Study Physical Activity Questionnaire), blood pressure, BMI, quality of life (assessed with the 36-Item Short Form Health Survey), physical function status (assessed with the Short Physical Performance Battery), and falls over a 12-month period. RESULTS Of the patients invited to participate, 57% responded. At 12 months, leisure walking increased by 49.6 min/wk for the pedometer Green Prescription compared with 28.1 min/wk for the standard Green Prescription (P=.03). For both groups, there were significant increases across all physical activity domains at 3 months (end of intervention) that were largely maintained after 12 months of follow-up. BMI did not change in either group. Significant improvements in blood pressure were observed for both groups without any differences between them. CONCLUSIONS Pedometer use resulted in a greater increase in leisure walking without any impact on overall activity level. All participants increased physical activity, and on average, their blood pressure decreased over 12 months, although the clinical relevance is unknown. PMID:22585884

  11. Performance Analysis for Acoustic Echo Cancellation Systems based on Variable Step Size NLMS algorithms

    Science.gov (United States)

    Hegde, Rajeshwari; Balachandra, K.; Rao, Madhusudhan

    2011-12-01

    Acoustic echo cancellation is an essential signal enhancement tool in hands-free communication. Loudspeaker signals are picked up by a microphone and are fed back to the correspondent, resulting in an undesired echo. Nowadays, adaptive filtering techniques are typically employed to suppress this echo. In acoustic applications long filters need to be adapted for sufficient echo suppression. Classical adaptation schemes such as LMS are quite expensive for accurate echo path modeling in highly reverberating environments. In order to cope with dynamic signals, step-size μ is often normalized by taking it inversely proportional to the energy of x. This normalized version of LMS (NLMS) is typically used in practice. This paper discusses various variable step-size NLMS based algorithms which can be implemented in acoustic echo cancelling applications. The performance of these algorithms in terms of ERLE and NSEC curves are obtained and comparison between them is done. Also a simple and novel Double-Talk Detection scheme is proposed in this paper.

  12. Quaternion-Based Kalman Filter for AHRS Using an Adaptive-Step Gradient Descent Algorithm

    Directory of Open Access Journals (Sweden)

    Li Wang

    2015-09-01

    Full Text Available This paper presents a quaternion-based Kalman filter for real-time estimation of the orientation of a quadrotor. Quaternions are used to represent rotation relationship between navigation frame and body frame. Processing of a 3-axis accelerometer using Adaptive-Step Gradient Descent (ASGD produces a computed quaternion input to the Kalman filter. The step-size in GD is set in direct proportion to the physical orientation rate. Kalman filter combines 3-axis gyroscope and computed quaternion to determine pitch and roll angles. This combination overcomes linearization error of the measurement equations and reduces the calculation cost. 3-axis magnetometer is separated from ASGD to independently calculate yaw angle for Attitude Heading Reference System (AHRS. This AHRS algorithm is able to remove the magnetic distortion impact. Experiments are carried out in the small-size flight controller and the real world flying test shows the proposed AHRS algorithm is adequate for the real-time estimation of the orientation of a quadrotor.

  13. Development of SmartStep: an insole-based physical activity monitor.

    Science.gov (United States)

    Sazonov, Edward S; Hegde, Nagaraj; Tang, Wenlong

    2013-01-01

    In our previous research we developed a SmartShoe--a shoe based physical activity monitor that can reliably differentiate between major postures and activities, accurately estimate energy expenditure of individuals, measure temporal gait parameters, and estimate body weights. In this paper we present the development of the next stage of the SmartShoe evolution--SmartStep, a physical activity monitor that is fully integrated into an insole, maximizing convenience and social acceptance of the monitor. Encapsulating the sensors, Bluetooth Low Energy wireless interface and the energy source within an assembly repeatedly loaded with high forces created during ambulation presented new design challenges. In this preliminary study we tested the ability of the SmartStep to measure the pressure differences between static weight-bearing and non-weight-bearing activities (such as no load vs. sitting vs. standing) as well as capture pressure variations during walking. We also measured long-term stability of the sensors and insole assembly under cyclic loading in a mechanical testing system.

  14. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  15. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  16. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  17. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  18. A Three Step B2B Sales Model Based on Satisfaction Judgments

    DEFF Research Database (Denmark)

    Grünbaum, Niels Nolsøe

    2015-01-01

    . The insights produces can be applied for selling companies to craft close collaborative customer relationships in a systematic a d efficient way. The process of building customer relationships will be guided through actions that yields higher satisfaction judgments leading to loyal customers and finally...... companies’ perspective. The buying center members applied satisfaction dimension when forming satisfaction judgments. Moreover, the focus and importance of the identified satisfaction dimensions fluctuated pending on the phase of the buying process. Based on the findings a three step sales model is proposed...... comprising of 1. identification of the satisfaction dimensions the buying center members apply in the buying process. 2. identification of the fluctuation in importance of the satisfaction dimensions and finally 3. identification of the degree of expectations’ adjacent to the identified satisfaction...

  19. A Three Step B2B Sales Model Based on Satisfaction Judgments

    DEFF Research Database (Denmark)

    Grünbaum, Niels Nolsøe

    2015-01-01

    . The insights produces can be applied for selling companies to craft close collaborative customer relationships in a systematic ad efficient way. The process of building customer relationships will be guided through actions that yields higher satisfaction judgments leading to loyal customers and finally...... companies‘ perspective. The buying center members applied satisfaction dimension when forming satisfaction judgments. Moreover, the focus and importance of the identified satisfaction dimensions fluctuated pending on the phase of the buying process. Based on the findings a three step sales model is proposed...... comprising of 1. Identification of the satisfaction dimensions the buying center members apply in the buying process. 2. Identification of the fluctuation in importance of the satisfaction dimensions and finally 3. Identification of the degree of expectations‘ adjacent to the identified satisfaction...

  20. Development of a three dimensional circulation model based on fractional step method

    Directory of Open Access Journals (Sweden)

    Mazen Abualtayef

    2010-03-01

    Full Text Available A numerical model was developed for simulating a three-dimensional multilayer hydrodynamic and thermodynamic model in domains with irregular bottom topography. The model was designed for examining the interactions between flow and topography. The model was based on the three-dimensional Navier-Stokes equations and was solved using the fractional step method, which combines the finite difference method in the horizontal plane and the finite element method in the vertical plane. The numerical techniques were described and the model test and application were presented. For the model application to the northern part of Ariake Sea, the hydrodynamic and thermodynamic results were predicted. The numerically predicted amplitudes and phase angles were well consistent with the field observations.

  1. Harmonic suppressed coupled stepped-impedance resonator based dual-band tunable bandpass filter

    Directory of Open Access Journals (Sweden)

    Amarjit Kumar

    2017-10-01

    Full Text Available In this paper, a tunable dual-band bandpass filter (BPF based on a varactor-loaded coupled stepped-impedance resonator is presented. Transmission matrices techniques are employed to explain the working concept of proposed tunable BPF. For validating the proposed concept, a hardware prototype is fabricated and characterized. As per the measured results, when the center frequency of the lower band is tuning from 2.15 to 2.40 GHz, the upper band is fixed at 4.5 GHz; and when the center frequency of the upper band is tuning from 4.5 to 4.75 GHz, the lower passband almost remains constant at 2.25 GHz. Proposed tunable filter is capable of working at higher passband frequencies. Spurious harmonic suppression up to 15 GHz is demonstrated. Center frequency of dual-passband is tunable using only two dc control voltages.

  2. TWO-STEP ALGORITHM OF TRAINING INITIALIZATION FOR ACOUSTIC MODELS BASED ON DEEP NEURAL NETWORKS

    Directory of Open Access Journals (Sweden)

    I. P. Medennikov

    2016-03-01

    Full Text Available This paper presents a two-step initialization algorithm for training of acoustic models based on deep neural networks. The algorithm is focused on reducing the impact of the non-speech segments on the acoustic model training. The idea of the proposed algorithm is to reduce the percentage of non-speech examples in the training set. Effectiveness evaluation of the algorithm has been carried out on the example of English spontaneous telephone speech recognition (Switchboard. The application of the proposed algorithm has led to 3% relative word error rate reduction, compared with the training initialization by restricted Boltzmann machines. The results presented in the paper can be applied in the development of automatic speech recognition systems.

  3. Minimising complications in abdominoplasty: An approach based on the root cause analysis and focused preventive steps

    Directory of Open Access Journals (Sweden)

    Mohan Rangaswamy

    2013-01-01

    Full Text Available Significant complications still occur after abdominoplasty, the rate varies widely in different series. This variation suggests that there is a lot of scope for improvement. This paper reviews the various complications and also the technical improvements reported in the last 20 years. The root cause of each complication is analysed and preventive steps are suggested based on the literature and the author′s own personal series with very low complication rates. Proper case selection, risk stratified prophylaxis of thromboembolism, initial synchronous liposuction, flap elevation at the Scarpa fascia level, discontinuous incremental flap dissection, vascular preservation and obliteration of the sub-flap space by multiple sutures emerge as the strongest preventive factors. It is proposed that most of the complications of abdominoplasty are preventable and that it is possible to greatly enhance the aesthetic and safety profile of this surgery.

  4. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  5. Structure and reactivity of an Al/P-based frustrated Lewis pair bearing relatively small substituents at aluminium.

    Science.gov (United States)

    Pleschka, Damian; Layh, Marcus; Rogel, Friedhelm; Uhl, Werner

    2017-08-28

    Reaction of Mes 2 P─C≡C─Ph (Mes = mesityl) with dineopentylaluminium hydride afforded by hydroalumination a geminal Al/P-based frustrated Lewis pair (FLP; 4 ). Its steric shielding is relatively low, and its reactivity in various secondary reactions is less hindered by steric repulsion than observed for related compounds having bulkier groups attached to aluminium. FLP 4 yielded adducts with Me 3 C─NCO or benzaldehyde via the formation of Al-O and P-C bonds. Trimethylsilyl azide reacted with 4 under surprisingly mild conditions to afford a nitrene complex by spontaneous N 2 elimination below room temperature. A carbodiimide molecule was coordinated via one of the C=N bonds to form a five-membered AlCPNC heterocycle with an intact C=N bond in an exocyclic position. A very large molecule was obtained by the reaction of two equivalents of 4 with a bifunctional methylene-bridged phenylene isocyanate precursor.This article is part of the themed issue 'Frustrated Lewis pair chemistry'. © 2017 The Author(s).

  6. Multifactor-dimensionality reduction versus family-based association tests in detecting susceptibility loci in discordant sib-pair studies

    Science.gov (United States)

    Meng, Yan; Ma, Qianli; Yu, Yi; Farrell, John; Farrer, Lindsay A; Wilcox, Marsha A

    2005-01-01

    Complex diseases are generally thought to be under the influence of multiple, and possibly interacting, genes. Many association methods have been developed to identify susceptibility genes assuming a single-gene disease model, referred to as single-locus methods. Multilocus methods consider joint effects of multiple genes and environmental factors. One commonly used method for family-based association analysis is implemented in FBAT. The multifactor-dimensionality reduction method (MDR) is a multilocus method, which identifies multiple genetic loci associated with the occurrence of complex disease. Many studies of late onset complex diseases employ a discordant sib pairs design. We compared the FBAT and MDR in their ability to detect susceptibility loci using a discordant sib-pair dataset generated from the simulated data made available to participants in the Genetic Analysis Workshop 14. Using FBAT, we were able to identify the effect of one susceptibility locus. However, the finding was not statistically significant. We were not able to detect any of the interactions using this method. This is probably because the FBAT test is designed to find loci with major effects, not interactions. Using MDR, the best result we obtained identified two interactions. However, neither of these reached a level of statistical significance. This is mainly due to the heterogeneity of the disease trait and noise in the data. PMID:16451606

  7. Multifactor-dimensionality reduction versus family-based association tests in detecting susceptibility loci in discordant sib-pair studies.

    Science.gov (United States)

    Meng, Yan; Ma, Qianli; Yu, Yi; Farrell, John; Farrer, Lindsay A; Wilcox, Marsha A

    2005-12-30

    Complex diseases are generally thought to be under the influence of multiple, and possibly interacting, genes. Many association methods have been developed to identify susceptibility genes assuming a single-gene disease model, referred to as single-locus methods. Multilocus methods consider joint effects of multiple genes and environmental factors. One commonly used method for family-based association analysis is implemented in FBAT. The multifactor-dimensionality reduction method (MDR) is a multilocus method, which identifies multiple genetic loci associated with the occurrence of complex disease. Many studies of late onset complex diseases employ a discordant sib pairs design. We compared the FBAT and MDR in their ability to detect susceptibility loci using a discordant sib-pair dataset generated from the simulated data made available to participants in the Genetic Analysis Workshop 14. Using FBAT, we were able to identify the effect of one susceptibility locus. However, the finding was not statistically significant. We were not able to detect any of the interactions using this method. This is probably because the FBAT test is designed to find loci with major effects, not interactions. Using MDR, the best result we obtained identified two interactions. However, neither of these reached a level of statistical significance. This is mainly due to the heterogeneity of the disease trait and noise in the data.

  8. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  9. Demonstration of polarization sensitivity of emulsion-based pair conversion telescope for cosmic gamma-ray polarimetry

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, Keita, E-mail: ozaki@radix.h.kobe-u.ac.jp [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan); Takahashi, Satoru, E-mail: satoru@radix.h.kobe-u.ac.jp [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8602 (Japan); Aoki, Shigeki; Kamada, Keiki; Kaneyama, Taichi; Nakagawa, Ryo; Rokujo, Hiroki [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan)

    2016-10-11

    Linear polarization of high-energy gamma-rays (10MeV–100 GeV) can be detected by measuring the azimuthal angle of electron–positron pairs and observing the modulation of the azimuthal distribution. To demonstrate the gamma-ray polarization sensitivity of emulsion, we conducted a test using a polarized gamma-ray beam (0.8–2.4 GeV) at SPring-8/LEPS. Emulsion tracks were reconstructed using scanning data, and gamma-ray events were selected automatically. Using an optical microscope, out of the 2381 gamma-ray conversions that were observed, 1372 remained after event selection, on the azimuthal angle distribution of which we measured the modulation. From the distribution of the azimuthal angles of the selected events, a modulation factor of 0.21+0.11−0.09 was measured, from which the detection of a non-zero modulation was established with a significance of 3.06σ. This attractive polarimeter will be applied to the GRAINE project, a balloon-borne experiment that observes 10–100 GeV cosmic gamma-rays with an emulsion-based pair conversion telescope.

  10. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  11. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  12. Non-linguistic learning and aphasia: evidence from a paired associate and feedback-based task.

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory. Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success. In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Physicochemical Properties of Jatropha Oil-Based Polyol Produced by a Two Steps Method.

    Science.gov (United States)

    Saalah, Sariah; Abdullah, Luqman Chuah; Aung, Min Min; Biak, Dayang Radiah Awang; Basri, Mahiran; Jusoh, Emiliana Rose; Mamat, Suhaini

    2017-03-29

    A low cost, abundant, and renewable vegetable oil source has been gaining increasing attention due to its potential to be chemically modified to polyol and thence to become an alternative replacement for the petroleum-based polyol in polyurethane production. In this study, jatropha oil-based polyol (JOL) was synthesised from non-edible jatropha oil by a two steps process, namely epoxidation and oxirane ring opening. In the first step, the effect of the reaction temperature, the molar ratio of the oil double bond to formic acid, and the reaction time on the oxirane oxygen content (OOC) of the epoxidised jatropha oil (EJO) were investigated. It was found that 4.3% OOC could be achieved with a molar ratio of 1:0.6, a reaction temperature of 60 °C, and 4 h of reaction. Consequently, a series of polyols with hydroxyl numbers in the range of 138-217 mgKOH/g were produced by oxirane ring opening of EJOs, and the physicochemical and rheological properties were studied. Both the EJOs and the JOLs are liquid and have a number average molecular weight ( M n ) in the range of 834 to 1457 g/mol and 1349 to 2129 g/mol, respectively. The JOLs exhibited Newtonian behaviour, with a low viscosity of 430-970 mPas. Finally, the JOL with a hydroxyl number of 161 mgKOH/g was further used to synthesise aqueous polyurethane dispersion, and the urethane formation was successfully monitored by Fourier Transform Infrared (FTIR).

  14. Physicochemical Properties of Jatropha Oil-Based Polyol Produced by a Two Steps Method

    Directory of Open Access Journals (Sweden)

    Sariah Saalah

    2017-03-01

    Full Text Available A low cost, abundant, and renewable vegetable oil source has been gaining increasing attention due to its potential to be chemically modified to polyol and thence to become an alternative replacement for the petroleum-based polyol in polyurethane production. In this study, jatropha oil-based polyol (JOL was synthesised from non-edible jatropha oil by a two steps process, namely epoxidation and oxirane ring opening. In the first step, the effect of the reaction temperature, the molar ratio of the oil double bond to formic acid, and the reaction time on the oxirane oxygen content (OOC of the epoxidised jatropha oil (EJO were investigated. It was found that 4.3% OOC could be achieved with a molar ratio of 1:0.6, a reaction temperature of 60 °C, and 4 h of reaction. Consequently, a series of polyols with hydroxyl numbers in the range of 138–217 mgKOH/g were produced by oxirane ring opening of EJOs, and the physicochemical and rheological properties were studied. Both the EJOs and the JOLs are liquid and have a number average molecular weight (Mn in the range of 834 to 1457 g/mol and 1349 to 2129 g/mol, respectively. The JOLs exhibited Newtonian behaviour, with a low viscosity of 430–970 mPas. Finally, the JOL with a hydroxyl number of 161 mgKOH/g was further used to synthesise aqueous polyurethane dispersion, and the urethane formation was successfully monitored by Fourier Transform Infrared (FTIR.

  15. Electron pairing without superconductivity

    Science.gov (United States)

    Levy, Jeremy

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

  16. Alcoholics Anonymous and twelve-step recovery: a model based on social and cognitive neuroscience.

    Science.gov (United States)

    Galanter, Marc

    2014-01-01

    In the course of achieving abstinence from alcohol, longstanding members of Alcoholics Anonymous (AA) typically experience a change in their addiction-related attitudes and behaviors. These changes are reflective of physiologically grounded mechanisms which can be investigated within the disciplines of social and cognitive neuroscience. This article is designed to examine recent findings associated with these disciplines that may shed light on the mechanisms underlying this change. Literature review and hypothesis development. Pertinent aspects of the neural impact of drugs of abuse are summarized. After this, research regarding specific brain sites, elucidated primarily by imaging techniques, is reviewed relative to the following: Mirroring and mentalizing are described in relation to experimentally modeled studies on empathy and mutuality, which may parallel the experiences of social interaction and influence on AA members. Integration and retrieval of memories acquired in a setting like AA are described, and are related to studies on storytelling, models of self-schema development, and value formation. A model for ascription to a Higher Power is presented. The phenomena associated with AA reflect greater complexity than the empirical studies on which this article is based, and certainly require further elucidation. Despite this substantial limitation in currently available findings, there is heuristic value in considering the relationship between the brain-based and clinical phenomena described here. There are opportunities for the study of neuroscientific correlates of Twelve-Step-based recovery, and these can potentially enhance our understanding of related clinical phenomena. © American Academy of Addiction Psychiatry.

  17. One-step electrochemical deposition of Schiff base cobalt complex as effective water oxidation catalyst

    Science.gov (United States)

    Huang, Binbin; Wang, Yan; Zhan, Shuzhong; Ye, Jianshan

    2017-02-01

    Schiff base metal complexes have been applied in many fields, especially, a potential homogeneous catalyst for water splitting. However, the high overpotential, time consumed synthesis process and complicated working condition largely limit their application. In the present work, a one-step approach to fabricate Schiff base cobalt complex modified electrode is developed. Microrod clusters (MRC) and rough spherical particles (RSP) can be obtained on the ITO electrode through different electrochemical deposition condition. Both of the MRC and RSP present favorable activity for oxygen evolution reaction (OER) compared to the commercial Co3O4, taking an overpotential of 650 mV and 450 mV to drive appreciable catalytic current respectively. The highly active and stable RSP shows a Tafel plot of 84 mV dec-1 and negligible decrease of the current density for 12 h bulk electrolysis. The synthesis strategy of effective and stable catalyst in this work provide a simple method to fabricate heterogeneous OER catalyst with Schiff base metal complex.

  18. Angle Control-Based Multi-Terminal Out-of-Step Protection System

    Directory of Open Access Journals (Sweden)

    Antans Sauhats

    2017-03-01

    Full Text Available From time to time a sequence of unexpected and overlapping contingencies may lead to power system angular instability and even blackouts if not addressed adequately by means of an out-of-step (OOS protection system. The motivation of the paper is an attempt to develop a workable prototype of the OOS protection system. The deficiencies of the protection currently used in the Latvian Power System network are highlighted and a new protection structure is proposed. The protection system comprises of several strategically located terminals, exchanging information in real time by means of a communication network. The OOS condition detection method is based on system-wide generation sources, electromotive forces, vectors, and angle control. The network splitting decision is based on generator coherence evaluation. Protection terminals determine online the groups of coherent generators and choose the splitting boundary from a predefined transmission lines (TLs cut sets list. The protection system structure, algorithm of operation, and possible IEC 61850 communication standard-based implementation are described.

  19. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  20. A Stereo Pair Based Method for Contactless Evaluation of the Human Breathing Pattern

    Directory of Open Access Journals (Sweden)

    V. S. Gnatiuk

    2015-01-01

    Full Text Available The development of contactless monitoring methods of human vital signs is an important goal for modern medicine. The particular relevance of this issue appears with the control of the patient at home on their own, for example, to estimate the parameters of breathing during sleep, quality assessment and identification of various kinds of sleep disorders, such as, for example, sleep apnea disorder (a condition, which is characterized by the cessation of pulmonary ventilation more than for 10 seconds and fall of blood oxygen saturation.In this article we have implemented and tested an algorithm for non-contact monitoring of breathing pattern by two entrenched webcams aimed at the person. The algorithm is based on using the methods of computer vision and processing of video sequences.Authors pay particular attention to disparity map construction approaches and improving the signal / noise ratio by a combination of known functions comparing the intensity of pixels: AD - a function of absolute differences, and Census function, comparing bit strings of investigated image regions.An important role in the noise minimization plays a simple, but effective assumption for aggregation, the gist of which is that pixels having similar intensity belong to the same structures in the image, and hence have a similar disparity. The variability of input parameters of the method and the ability to adjust the number of iterations provide accurate disparity maps for the input image of almost any quality (testing was conducted for webcams CBR CW 833M.The main result of this approach is the breathing profile based on the reconstructed depth maps, reflecting the respiration rate of the person under examination and presenting data on the amplitude variations of his chest.The main difference of the proposed method from other publications is a high accuracy and the breath profile calculation in real-time. It was achieved through OpenCL technology and parallel computations

  1. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    organisms. Furthermore, secondary structures closely similar to phylogenetically proven models can be inferred from the T. thermophila data. Analysis of the snRNA sequences identifies three potential snRNA-snRNA base-pairing interactions, all of which are consistent with available phylogenetic data. Two......We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  2. A novel 3670-base pair mitochondrial DNA deletion resulting in multi-systemic manifestations in a child.

    Science.gov (United States)

    Liu, Hsin-Ming; Tsai, Li-Ping; Chien, Yin-Hsiu; Wu, Jia-Feng; Weng, Wen-Chin; Peng, Shinn-Forng; Wu, En-Ting; Huang, Pei-Hsin; Lee, Wang-Tso; Tsai, I-Jun; Hwu, Wuh-Liang; Lee, Ni-Chung

    2012-08-01

    Mitochondrial DNA (mtDNA) deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility) that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297) was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected. Copyright © 2012. Published by Elsevier B.V.

  3. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  4. Dielectrophoresis-based multi-step nanowire assembly on a flexible superstrate

    Science.gov (United States)

    Wang, Xin; Chen, Ke; Liu, Linbo; Xiang, Nan; Ni, Zhonghua

    2018-01-01

    Nanowire assembly based on dielectrophoresis (DEP) could be a useful and efficient tool for fabricating nanowire-based devices. Although there have been extensive reports on the DEP nanowire assembly, the new approaches that make DEP more facile and affordable are still desirable. Herein, we present an approach using the reusable electrodes to assemble silver nanowires onto a removable, independent polyethylene terephthalate (PET) film. The PET film is placed on the reusable electrodes, and a sinusoidal AC voltage is applied to the electrodes to induce DEP force for nanowire assembly upon the flexible film. We explore the influences of voltage, frequency and film thickness on nanowire assembly and further realize the assembly of silver nanowire arrays. In addition, the induced electric field is rotated in two consecutive steps to assemble the rectangular mesh-like nanowire networks. This reusable and facile approach for DEP nanowire assembly could provide a low-cost, precise, rapid and convenient tool for applications in the fields of flexible electronics.

  5. A six step approach for developing computer based assessment in medical education.

    Science.gov (United States)

    Hassanien, Mohammed Ahmed; Al-Hayani, Abdulmoneam; Abu-Kamer, Rasha; Almazrooa, Adnan

    2013-01-01

    Assessment, which entails the systematic evaluation of student learning, is an integral part of any educational process. Computer-based assessment (CBA) techniques provide a valuable resource to students seeking to evaluate their academic progress through instantaneous, personalized feedback. CBA reduces examination, grading and reviewing workloads and facilitates training. This paper describes a six step approach for developing CBA in higher education and evaluates student perceptions of computer-based summative assessment at the College of Medicine, King Abdulaziz University. A set of questionnaires were distributed to 341 third year medical students (161 female and 180 male) immediately after examinations in order to assess the adequacy of the system for the exam program. The respondents expressed high satisfaction with the first Saudi experience of CBA for final examinations. However, about 50% of them preferred the use of a pilot CBA before its formal application; hence, many did not recommend its use for future examinations. Both male and female respondents reported that the range of advantages offered by CBA outweighed any disadvantages. Further studies are required to monitor the extended employment of CBA technology for larger classes and for a variety of subjects at universities.

  6. Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.

    Science.gov (United States)

    Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan

    2017-09-26

    Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.

  7. A novel multimodal chromatography based single step purification process for efficient manufacturing of an E. coli based biotherapeutic protein product.

    Science.gov (United States)

    Bhambure, Rahul; Gupta, Darpan; Rathore, Anurag S

    2013-11-01

    Methionine oxidized, reduced and fMet forms of a native recombinant protein product are often the critical product variants which are associated with proteins expressed as bacterial inclusion bodies in E. coli. Such product variants differ from native protein in their structural and functional aspects, and may lead to loss of biological activity and immunogenic response in patients. This investigation focuses on evaluation of multimodal chromatography for selective removal of these product variants using recombinant human granulocyte colony stimulating factor (GCSF) as the model protein. Unique selectivity in separation of closely related product variants was obtained using combined pH and salt based elution gradients in hydrophobic charge induction chromatography. Simultaneous removal of process related impurities was also achieved in flow-through leading to single step purification process for the GCSF. Results indicate that the product recovery of up to 90.0% can be obtained with purity levels of greater than 99.0%. Binding the target protein at pHbased elution gradient and removal of the host cell impurities in flow-through are the key novel features of the developed multimodal chromatographic purification step. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Operator care and eco-concerned development of a fast, facile and economical assay for basic nitrogenous drugs based on simplified ion-pair mini-scale extraction using safer solvent combined with drop-based spectrophotometry.

    Science.gov (United States)

    Plianwong, Samarwadee; Sripattanaporn, Areerut; Waewsa-nga, Kwanrutai; Buacheen, Parin; Opanasopit, Praneet; Ngawhirunpat, Tanasait; Rojanarata, Theerasak

    2012-08-30

    A fast, facile, and economical assay for basic nitrogenous drugs has been developed based on the mini-scale extraction of the drug-dye ion pair complex combined with the use of safe-for-analyst and eco-friendlier organic extractant and drop-based micro-spectrophotometry. Instead of using large volume devices, the extraction was simply carried out in typical 1.5 mL microcentrifuge tubes along with the use of micropipettes for accurate transfer of liquids, vortex mixer for efficient partitioning of solutes and benchtop centrifuge for rapid phase separation. In the last step, back-extraction was performed by using the microvolume of acidic solution in order to concentrate the colored species into a confined aqueous microdrop and to keep the analyst away from unwanted contact and inhalation of organic solvents during the quantitation step which was achieved by using cuvetteless UV-vis micro-spectrophotometry without any prior dilutions. Using chlorpheniramine maleate as a representative analyte and n-butyl acetate as a less toxic and non-ozone depleting extractant, the miniaturized method was less laborious and much faster. It was accurate, precise and insensitive to the interferences from common excipients. Notably, it gave the assay results of drug in tablets and oral solution comparable to the large-scale pharmacopeial method while the consumption of organic solvents and the release of wastes were lowered by 200-400 folds. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Deconstructing Chronic Low Back Pain in the Older Adult-Step by Step Evidence and Expert-Based Recommendations for Evaluation and Treatment: Part II: Myofascial Pain.

    Science.gov (United States)

    Lisi, Anthony J; Breuer, Paula; Gallagher, Rollin M; Rodriguez, Eric; Rossi, Michelle I; Schmader, Kenneth; Scholten, Joel D; Weiner, Debra K

    2015-07-01

    To present an algorithm of sequential treatment options for managing myofascial pain (MP) in older adults, along with a representative clinical case. A modified Delphi process was used to synthesize evidence-based recommendations. A multidisciplinary expert panel developed the algorithm, which was subsequently refined through an iterative process of input from a primary care physician panel. We present an algorithm and supportive materials to help guide the care of older adults with MP, an important contributor to chronic low back pain (CLBP). Addressing any perpetuating factors should be the first step of managing MP. Patients should be educated on self-care approaches, home exercise, and the use of safe analgesics when indicated. Trigger point deactivation can be accomplished by manual therapy, injection therapy, dry needling, and/or acupuncture. The algorithm presented gives a structured approach to guide primary care providers in planning treatment for patients with MP as a contributor to CLBP. Wiley Periodicals, Inc.

  10. Algorithm of axial fuel optimization based in progressive steps of turned search

    International Nuclear Information System (INIS)

    Martin del Campo, C.; Francois, J.L.

    2003-01-01

    The development of an algorithm for the axial optimization of fuel of boiling water reactors (BWR) is presented. The algorithm is based in a serial optimizations process in the one that the best solution in each stage is the starting point of the following stage. The objective function of each stage adapts to orient the search toward better values of one or two parameters leaving the rest like restrictions. Conform to it advances in those optimization stages, it is increased the fineness of the evaluation of the investigated designs. The algorithm is based on three stages, in the first one are used Genetic algorithms and in the two following Tabu Search. The objective function of the first stage it looks for to minimize the average enrichment of the one it assembles and to fulfill with the generation of specified energy for the operation cycle besides not violating none of the limits of the design base. In the following stages the objective function looks for to minimize the power factor peak (PPF) and to maximize the margin of shutdown (SDM), having as restrictions the one average enrichment obtained for the best design in the first stage and those other restrictions. The third stage, very similar to the previous one, it begins with the design of the previous stage but it carries out a search of the margin of shutdown to different exhibition steps with calculations in three dimensions (3D). An application to the case of the design of the fresh assemble for the fourth fuel reload of the Unit 1 reactor of the Laguna Verde power plant (U1-CLV) is presented. The obtained results show an advance in the handling of optimization methods and in the construction of the objective functions that should be used for the different design stages of the fuel assemblies. (Author)

  11. Mechanism of thermal renaturation and hybridization of nucleic acids: Kramers' process and universality in Watson-Crick base pairing.

    Science.gov (United States)

    Sikorav, Jean-Louis; Orland, Henri; Braslau, Alan

    2009-03-26

    Renaturation and hybridization reactions lead to the pairing of complementary single-stranded nucleic acids. We present here a theoretical investigation of the mechanism of these reactions in vitro under thermal conditions (dilute solutions of single-stranded chains, in the presence of molar concentrations of monovalent salts and at elevated temperatures). The mechanism follows a Kramers' process, whereby the complementary chains overcome a potential barrier through Brownian motion. The barrier originates from a single rate-limiting nucleation event in which the first complementary base pairs are formed. The reaction then proceeds through a fast growth of the double helix. For the DNA of bacteriophages T7, T4, and phiX174, as well as for Escherichia coli DNA, the bimolecular rate k2 of the reaction increases as a power law of the average degree of polymerization of the reacting single-strands: k2 is proportional to alpha. This relationship holds for 100 < or = 50,000 with an experimentally determined exponent alpha = 0.51 +/- 0.01. The length dependence results from a thermodynamic excluded-volume effect. The reacting single-stranded chains are predicted to be in universal good solvent conditions, and the scaling law is determined by the relevant equilibrium monomer contact probability. The value theoretically predicted for the exponent is alpha = 1 - nutheta2, where nu is Flory's swelling exponent (nu approximately equal 0.588), and theta2 is a critical exponent introduced by des Cloizeaux (theta2 approximately equal 0.82), yielding alpha = 0.52 +/- 0.01, in agreement with the experimental results.

  12. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    IAS Admin

    The fundamental concept of Lewis acid–base interactions have played a substantial role in the progress of chemistry and enriched its understanding, most significantly in the evolution of coordination compounds. In the last 7 years, the chemistry of Lewis Pairs (i.e., acids and bases) has witnessed a different.

  13. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash

    2017-01-01

    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  14. Evaluating Machine Learning-Based Automated Personalized Daily Step Goals Delivered Through a Mobile Phone App: Randomized Controlled Trial.

    Science.gov (United States)

    Zhou, Mo; Fukuoka, Yoshimi; Mintz, Yonatan; Goldberg, Ken; Kaminsky, Philip; Flowers, Elena; Aswani, Anil

    2018-01-25

    Growing evidence shows that fixed, nonpersonalized daily step goals can discourage individuals, resulting in unchanged or even reduced physical activity. The aim of this randomized controlled trial (RCT) was to evaluate the efficacy of an automated mobile phone-based personalized and adaptive goal-setting intervention using machine learning as compared with an active control with steady daily step goals of 10,000. In this 10-week RCT, 64 participants were recruited via email announcements and were required to attend an initial in-person session. The participants were randomized into either the intervention or active control group with a one-to-one ratio after a run-in period for data collection. A study-developed mobile phone app (which delivers daily step goals using push notifications and allows real-time physical activity monitoring) was installed on each participant's mobile phone, and participants were asked to keep their phone in a pocket throughout the entire day. Through the app, the intervention group received fully automated adaptively personalized daily step goals, and the control group received constant step goals of 10,000 steps per day. Daily step count was objectively measured by the study-developed mobile phone app. The mean (SD) age of participants was 41.1 (11.3) years, and 83% (53/64) of participants were female. The baseline demographics between the 2 groups were similar (P>.05). Participants in the intervention group (n=34) had a decrease in mean (SD) daily step count of 390 (490) steps between run-in and 10 weeks, compared with a decrease of 1350 (420) steps among control participants (n=30; P=.03). The net difference in daily steps between the groups was 960 steps (95% CI 90-1830 steps). Both groups had a decrease in daily step count between run-in and 10 weeks because interventions were also provided during run-in and no natural baseline was collected. The results showed the short-term efficacy of this intervention, which should be formally

  15. Inorganic metallodielectric materials fabricated using two single-step methods based on the Tollen's process.

    Science.gov (United States)

    Peterson, Molly S M; Bouwman, Jason; Chen, Aiqing; Deutsch, Miriam

    2007-02-01

    Two methods for preparing polycrystalline silver shells on colloidal silica spheres are reported. These do not include the use of organic ligands or metal seeding steps and are based on the Tollen's process for silvering glass. Reaction parameters such as temperature and reactant concentrations are adjusted to slow the reaction kinetics, which we find leads to preferential silver growth on the spheres. The resulting shells are polycrystalline and granular, showing highly uniform sphere coverage. Surface morphologies range from sparsely interconnected grains for shells approximately 20 nm thick, to complete (yet porous) shells of interconnected silver clusters which are up to approximately 140 nm in thickness. The extinction spectra of the core-shell materials are markedly different from those of smooth continuous shells, showing clear evidence that the granular shell geometry influences the plasmon resonance of the composite system. Spheres coated with shells 20-40 nm thick are also suitable for colloidal crystallization. Monolayers of self-assembled spheres with long-range ordering are demonstrated.

  16. Simulation and experiment of the static FTIR based on micro multi-step mirrors

    Science.gov (United States)

    Liang, Jingqiu; Liang, Zhong-zhu; Lv, Jin-guang; Fu, Jian-guo; Zheng, Ying; Feng, Cong; Wang, Wei-biao; Zhu, Wan-bin; Yao, Jin-song; Zhang, Jun

    2011-08-01

    In recent years, Fourier transform spectrometer (FTS) with small size and low mass is required in many applications with growing need for real-time and small platform spectral detection. In this paper, a micro Fourier transform infrared spectrometer (μFTIR) based on spatial modulation mode was designed. This spectrometer has the advantages of high stability and simplified configuration. It also promises optical path differences (OPD) with high precision, as MOEMS technology is used in manufacturing the key components. The simulation and the experiments with regard to this FTIR configuration have been done. Firstly, the diffraction effect of the micro multi-step mirrors (MMSMs) is studied. We discuss the influence to the reversed spectrum by different mirror widths and different diffraction distances. Secondly, we simulate and analyze the influence of the source solid angle to the spectral resolution. Thirdly, we set up the theoretical model of the collimation error which is mainly from the defocus of the optical system and analyze the result caused by the collimation error. Fourthly, a new discrete Fourier transform arithmetic using least-squares cosines progression (LSCP) is proposed which can reconstruct the spectrum with nonuniform sampled signals. Finally, the MMSMs are fabricated used the MOEMS technology and the structural parameters are tested.

  17. Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands.

    Science.gov (United States)

    de Almeida, José M M M; Vasconcelos, Helena; Jorge, Pedro A S; Coelho, Luis

    2018-04-20

    It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR) with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO₂) substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS) and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency.

  18. One-step synthesis of natural silk sericin-based microcapsules with bionic structures.

    Science.gov (United States)

    Liu, Zhaogang; Cai, Yurong; Jia, Yaru; Liu, Lin; Kong, Xiangdong; Kundu, Subhas C; Yao, Juming

    2014-10-01

    Different techniques are being developed for fabricating microcapsules; it is still a challenge to fabricate them in an efficient and environment-friendly process. Here, a one-step green route to synthesize silk protein sericin-based microcapsules without any assistance of organic solvents is reported. By carefully changing the concentration of calcium ions accompanied with stirring, the morphology of the microcapsules can easily be regulated to form either discoidal, biconcave, cocoon-like, or tubular structures. The chelation of Ca(2+) and shearing force from agitation may induce the conformational transformation of sericin, which possibly results in the formation of microcapsules through the self-assembly of the protein subsequently. The as-prepared cocoon-like microcapsules exhibit pH-dependent stability. A potential application of microcapsules being fabricated from natural water-soluble silk protein sericin for controlled bioactive molecules loading and release system by a pH-triggered manner is quite feasible. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Two Paired "Le Chatelier" Reactions

    Science.gov (United States)

    Cawley, John J.

    1995-07-01

    We have created a two-week, two hour-per-week cyclic experiment, which pairs two reactions. These reactions, the acid catalyzed esterification to yield n-amyl acetate and the base catalyzed hydrolysis of n-amyl acetate are intended to serve as a first and last experiment respectively, of the second-semester laboratory for liberal arts students. Because of time constraints, we have modified these experiments so that no distillation is performed as a purification step. The notion of achieving yields beyond the equilibrium value is discussed in terms of the pragmatics of removing one of the products of an equilibrium. Because of this "Le Chatelier" aspect of each reaction, each of them may be pushed in practicality to completion, which is well beyond the equilibrium value expectation. Because of the cycle, the chemistry may be done on a scale well beyond the microscale approach with little loss of material.

  20. Multi-step wind speed forecasting based on a hybrid forecasting architecture and an improved bat algorithm

    International Nuclear Information System (INIS)

    Xiao, Liye; Qian, Feng; Shao, Wei

    2017-01-01

    Highlights: • Propose a hybrid architecture based on a modified bat algorithm for multi-step wind speed forecasting. • Improve the accuracy of multi-step wind speed forecasting. • Modify bat algorithm with CG to improve optimized performance. - Abstract: As one of the most promising sustainable energy sources, wind energy plays an important role in energy development because of its cleanliness without causing pollution. Generally, wind speed forecasting, which has an essential influence on wind power systems, is regarded as a challenging task. Analyses based on single-step wind speed forecasting have been widely used, but their results are insufficient in ensuring the reliability and controllability of wind power systems. In this paper, a new forecasting architecture based on decomposing algorithms and modified neural networks is successfully developed for multi-step wind speed forecasting. Four different hybrid models are contained in this architecture, and to further improve the forecasting performance, a modified bat algorithm (BA) with the conjugate gradient (CG) method is developed to optimize the initial weights between layers and thresholds of the hidden layer of neural networks. To investigate the forecasting abilities of the four models, the wind speed data collected from four different wind power stations in Penglai, China, were used as a case study. The numerical experiments showed that the hybrid model including the singular spectrum analysis and general regression neural network with CG-BA (SSA-CG-BA-GRNN) achieved the most accurate forecasting results in one-step to three-step wind speed forecasting.

  1. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality.

    Science.gov (United States)

    Renapurkar, Rahul D; Primak, Andrew; Azok, Joseph; Lempel, Jason; Tandon, Yasmeen; Bullen, Jennifer; Dong, Frank; Karim, Wadih; Graham, Ruffin

    2017-08-01

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair ("switched" cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the "switched" cohort was 1.3 mGy (95% CI 1.2, 1.4; p quality. • Attenuation-based kV pair selection in dual energy examination is feasible. • It can offer radiation dose reduction to approximately 50% of patients. • Approximate 15% reduction in radiation dose was achieved using this technique. • The image quality is not compromised by use of attenuation-based kV pair selection.

  2. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  3. Investigating the role of ion-pair strategy in regulating nicotine release from patch: Mechanistic insights based on intermolecular interaction and mobility of pressure sensitive adhesive.

    Science.gov (United States)

    Li, Qiaoyun; Wan, Xiaocao; Liu, Chao; Fang, Liang

    2018-04-05

    The aim of this study was to prepare a drug-in-adhesive patch of nicotine (NIC) and use ion-pair strategy to regulate drug delivery rate. Moreover, the mechanism of how ion-pair strategy regulated drug release was elucidated at molecular level. Formulation factors including pressure sensitive adhesives (PSAs), drug loading and counter ions (C 4 , C 6 , C 8 , C 10 , and C 12 ) were screened. In vitro release experiment and in vitro transdermal experiment were conducted to determine the rate-limiting step in drug delivery process. FT-IR and molecular modeling were used to characterize the interaction between drug and PSA. Thermal analysis and rheology study were conducted to investigate the mobility variation of PSA. The optimized patch prepared with NIC-C 8 had the transdermal profile fairly close to that of the commercial product (p > 0.05). The release rate constants (k) of NIC, NIC-C 4 and NIC-C 10 were 21.1, 14.4 and 32.4, respectively. Different release rates of NIC ion-pair complexes were attributed to the dual effect of ion-pair strategy on drug release. On one hand, ion-pair strategy enhanced the interaction between drug and PSA, which inhibited drug release. On the other hand, using ion-pair strategy improved the mobility of PSA, which facilitated drug release. Drug release behavior was determined by combined effect of two aspects above. These conclusions provided a new idea for us to regulate drug release behavior from patch. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Stepped Fault Line Selection Method Based on Spectral Kurtosis and Relative Energy Entropy of Small Current to Ground System

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang

    2014-01-01

    Full Text Available This paper proposes a stepped selection method based on spectral kurtosis relative energy entropy. Firstly, the length and type of window function are set; then when fault occurs, enter step 1: the polarity of first half-wave extremes is analyzed; if the ratios of extremes between neighboring lines are positive, the bus bar is the fault line, else, the SK relative energy entropies are calculated, and then enter step 2: if the obtained entropy multiple is bigger than the threshold or equal to the threshold, the overhead line of max entropy corresponding is the fault line, if not, enter step 3: the line of max entropy corresponding is the fault line. At last, the applicability of the proposed algorithm is presented, and the comparison results are discussed.

  5. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  7. Planning of step-stress accelerated degradation test based on the inverse Gaussian process

    International Nuclear Information System (INIS)

    Wang, Huan; Wang, Guan-jun; Duan, Feng-jun

    2016-01-01

    The step-stress accelerated degradation test (SSADT) is a useful tool for assessing the lifetime distribution of highly reliable or expensive product. Some efficient SSADT plans have been proposed when the underlying degradation follows the Wiener process or Gamma process. However, how to design an efficient SSADT plan for the inverse Gaussian (IG) process is still a problem to be solved. The aim of this paper is to provide an optimal SSADT plan for the IG degradation process. A cumulative exposure model for the SSADT is adopted, in which the product degradation path depends only on the current stress level and the degradation accumulated, and has nothing to do with the way of accumulation. Under the constraint of the total experimental budget, some design variables are optimized by minimizing the asymptotic variance of the estimated p-quantile of the lifetime distribution of the product. Finally, we use the proposed method to deal with the optimal SSADT design for a type of electrical connector based on a set of stress relaxation data. The sensitivity and stability of the SSADT plan are studied, and we find that the optimal test plan is quite robust for a moderate departure from the values of the parameters. - Highlights: • We propose an optimal SSADT plan for the IG degradation process. • A CE model is assumed in describing the degradation path of the SSADT. • The asymptotic variance of the estimated p-quantile is used as the objective function. • A set of stress relaxation data is analyzed and used for illustration of our method.

  8. Next Step for STEP

    Energy Technology Data Exchange (ETDEWEB)

    Wood, Claire [CTSI; Bremner, Brenda [CTSI

    2013-08-09

    The Siletz Tribal Energy Program (STEP), housed in the Tribe’s Planning Department, will hire a data entry coordinator to collect, enter, analyze and store all the current and future energy efficiency and renewable energy data pertaining to administrative structures the tribe owns and operates and for homes in which tribal members live. The proposed data entry coordinator will conduct an energy options analysis in collaboration with the rest of the Siletz Tribal Energy Program and Planning Department staff. An energy options analysis will result in a thorough understanding of tribal energy resources and consumption, if energy efficiency and conservation measures being implemented are having the desired effect, analysis of tribal energy loads (current and future energy consumption), and evaluation of local and commercial energy supply options. A literature search will also be conducted. In order to educate additional tribal members about renewable energy, we will send four tribal members to be trained to install and maintain solar panels, solar hot water heaters, wind turbines and/or micro-hydro.

  9. Cryptosystem based on two-step phase-shifting interferometry and the RSA public-key encryption algorithm

    Science.gov (United States)

    Meng, X. F.; Peng, X.; Cai, L. Z.; Li, A. M.; Gao, Z.; Wang, Y. R.

    2009-08-01

    A hybrid cryptosystem is proposed, in which one image is encrypted to two interferograms with the aid of double random-phase encoding (DRPE) and two-step phase-shifting interferometry (2-PSI), then three pairs of public-private keys are utilized to encode and decode the session keys (geometrical parameters, the second random-phase mask) and interferograms. In the stage of decryption, the ciphered image can be decrypted by wavefront reconstruction, inverse Fresnel diffraction, and real amplitude normalization. This approach can successfully solve the problem of key management and dispatch, resulting in increased security strength. The feasibility of the proposed cryptosystem and its robustness against some types of attack are verified and analyzed by computer simulations.

  10. Differentiation between solid-ankle cushioned heel and energy storage and return prosthetic foot based on step-to-step transition cost

    NARCIS (Netherlands)

    Wezenberg, Daphne; Cutti, Andrea G.; Bruno, Antonino; Houdijk, Han

    2014-01-01

    Decreased push-off power by the prosthetic foot and inadequate roll-over shape of the foot have been shown to increase the energy dissipated during the step-to-step transition in human walking. The aim of this study was to determine whether energy storage and return (ESAR) feet are able to reduce

  11. A novel accelerometry-based algorithm for the detection of step durations over short episodes of gait in healthy elderly.

    Science.gov (United States)

    Micó-Amigo, M Encarna; Kingma, Idsart; Ainsworth, Erik; Walgaard, Stefan; Niessen, Martijn; van Lummel, Rob C; van Dieën, Jaap H

    2016-04-19

    The assessment of short episodes of gait is clinically relevant and easily implemented, especially given limited space and time requirements. BFS (body-fixed-sensors) are small, lightweight and easy to wear sensors, which allow the assessment of gait at relative low cost and with low interference. Thus, the assessment with BFS of short episodes of gait, extracted from dailylife physical activity or measured in a standardised and supervised setting, may add value in the study of gait quality of the elderly. The aim of this study was to evaluate the accuracy of a novel algorithm based on acceleration signals recorded at different human locations (lower back and heels) for the detection of step durations over short episodes of gait in healthy elderly subjects. Twenty healthy elderly subjects (73.7 ± 7.9 years old) walked twice a distance of 5 m, wearing a BFS on the lower back, and on the outside of each heel. Moreover, an optoelectronic three-dimensional (3D) motion tracking system was used to detect step durations. A novel algorithm is presented for the detection of step durations from low-back and heel acceleration signals separately. The accuracy of the algorithm was assessed by comparing absolute differences in step duration between the three methods: step detection from the optoelectronic 3D motion tracking system, step detection from the application of the novel algorithm to low-back accelerations, and step detection from the application of the novel algorithm to heel accelerations. The proposed algorithm successfully detected all the steps, without false positives and without false negatives. Absolute average differences in step duration within trials and across subjects were calculated for each comparison, between low-back accelerations and the optoelectronic system were on average 22.4 ± 7.6 ms (4.0 ± 1.3 % of average step duration), between heel accelerations and the optoelectronic system were on average 20.7 ± 11.8 ms (3.7 ± 1.9 %), and between low

  12. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3' untranslated region (3'-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  13. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Igor Ruiz de los Mozos

    Full Text Available The presence of regulatory sequences in the 3' untranslated region (3'-UTR of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  14. Modulation of Interparticle Distance in Discrete Gold Nanoparticle Dimers and Trimers by DNA Single-Base Pairing.

    Science.gov (United States)

    Akiyama, Yoshitsugu; Shikagawa, Hiroto; Kanayama, Naoki; Takarada, Tohru; Maeda, Mizuo

    2015-07-01

    Self-assembled structures of metallic nanoparticles with dynamically changeable interparticle distance hold promise for the regulation of collective physical properties. This paper describes gold nanoparticle dimers and trimers that exhibit spontaneous and reversible changes in interparticle distance. To exploit this property, a gold nanoparticle is modified with precisely one long DNA strand and approximately five short DNA strands. The long DNA serves to align the nanoparticles on a template DNA via hybridization, while the short DNAs function to induce the interparticle distance changes. The obtained dimer and trimer are characterized with gel electrophoresis, dynamic light scattering measurements, and transmission electron microscopy (TEM). When the complementary short DNA is added to form the fully matched duplexes on the particle surface in the presence of MgCl2 , spontaneous reduction of the interparticle distance is observed with TEM and cryo-electron microscopy. By contrast, when the terminal-mismatched DNA is added, no structural change occurs under the same conditions. Therefore, the single base pairing/unpairing at the outermost surface of the nanoparticle impacts the interparticle distance. This unique feature could be applied to the regulation of structures and properties of various DNA-functionalized nanoparticle assemblies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Whole genome sequencing reveals a 7 base-pair deletion in DMD exon 42 in a dog with muscular dystrophy.

    Science.gov (United States)

    Nghiem, Peter P; Bello, Luca; Balog-Alvarez, Cindy; López, Sara Mata; Bettis, Amanda; Barnett, Heather; Hernandez, Briana; Schatzberg, Scott J; Piercy, Richard J; Kornegay, Joe N

    2017-04-01

    Dystrophin is a key cytoskeletal protein coded by the Duchenne muscular dystrophy (DMD) gene located on the X-chromosome. Truncating mutations in the DMD gene cause loss of dystrophin and the classical DMD clinical syndrome. Spontaneous DMD gene mutations and associated phenotypes occur in several other species. The mdx mouse model and the golden retriever muscular dystrophy (GRMD) canine model have been used extensively to study DMD disease pathogenesis and show efficacy and side effects of putative treatments. Certain DMD gene mutations in high-risk, the so-called hot spot areas can be particularly helpful in modeling molecular therapies. Identification of specific mutations has been greatly enhanced by new genomic methods. Whole genome, next generation sequencing (WGS) has been recently used to define DMD patient mutations, but has not been used in dystrophic dogs. A dystrophin-deficient Cavalier King Charles Spaniel (CKCS) dog was evaluated at the functional, histopathological, biochemical, and molecular level. The affected dog's phenotype was compared to the previously reported canine dystrophinopathies. WGS was then used to detect a 7 base pair deletion in DMD exon 42 (c.6051-6057delTCTCAAT mRNA), predicting a frameshift in gene transcription and truncation of dystrophin protein translation. The deletion was confirmed with conventional PCR and Sanger sequencing. This mutation is in a secondary DMD gene hotspot area distinct from the one identified earlier at the 5' donor splice site of intron 50 in the CKCS breed.

  16. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang

    2018-02-01

    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  17. 19-base pair deletion polymorphism of the dihydrofolate reductase (DHFR gene: maternal risk of Down syndrome and folate metabolism

    Directory of Open Access Journals (Sweden)

    Cristiani Cortez Mendes

    Full Text Available CONTEXT AND OBJECTIVE: Polymorphisms in genes involved in folate metabolism may modulate the maternal risk of Down syndrome (DS. This study evaluated the influence of a 19-base pair (bp deletion polymorphism in intron-1 of the dihydrofolate reductase (DHFR gene on the maternal risk of DS, and investigated the association between this polymorphism and variations in the concentrations of serum folate and plasma homocysteine (Hcy and plasma methylmalonic acid (MMA. DESIGN AND SETTING: Analytical cross-sectional study carried out at Faculdade de Medicina de São José do Rio Preto (Famerp. METHODS: 105 mothers of individuals with free trisomy of chromosome 21, and 184 control mothers were evaluated. Molecular analysis on the polymorphism was performed using the polymerase chain reaction (PCR through differences in the sizes of fragments. Folate was quantified by means of chemiluminescence, and Hcy and MMA by means of liquid chromatography and sequential mass spectrometry. RESULTS: There was no difference between the groups in relation to allele and genotype frequencies (P = 0.44; P = 0.69, respectively. The folate, Hcy and MMA concentrations did not differ significantly between the groups, in relation to genotypes (P > 0.05. CONCLUSIONS: The 19-bp deletion polymorphism of DHFR gene was not a maternal risk factor for DS and was not related to variations in the concentrations of serum folate and plasma Hcy and MMA in the study population.

  18. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  19. Differences in chemosensitivity between primary and paired metastatic lung cancer tissues: In vitro analysis based on the collagen gel droplet embedded culture drug test (CD-DST).

    Science.gov (United States)

    Higashiyama, Masahiko; Okami, Jiro; Maeda, Jun; Tokunaga, Toshiteru; Fujiwara, Ayako; Kodama, Ken; Imamura, Fumio; Kobayashi, Hisayuki

    2012-02-01

    To elucidate the differences in chemosensitivity to anticancer drugs between primary and metastatic lesions in non-small cell lung cancer (NSCLC) patients, we examined the in vitro chemosensitivities of surgically resected NSCLC tissues. A total of 32 specimens were enrolled: 26 specimens of primary lesions paired with metastases in the lymph node, 3 specimens of primary lesions paired with metastases in the adrenal gland, and 3 specimens of primary lesions paired with metastases in the lung. The collagen gel droplet embedded culture drug test (CD-DST) was applied to examine the sensitivity of the tissues to anticancer drugs, including cisplatin, gemcitabine, vinorelbine, docetaxel and 5-fluorouracil. The degree of in vitro sensitivity to each anticancer drug varied between the primary and metastatic lesions. The sensitivity of the paired metastatic lesions was significantly lower than that of the primary lesions only for gemcitabine (P=0.029), vinorelbine (P=0.012), and docetaxel (P=0.009). The incidence of cases diagnosed as CD-DST-sensitive among the paired metastatic lesions was significantly lower than that for the primary lesions for vinorelbine (P=0.035) or docetaxel (P=0.022). The difference in the sensitivity to gemcitabine between the primary and paired non-lymphatic metastases was clearer than that between the primary lesion and paired lymph node metastases. The sensitivities of the paired metastatic lesions to some anticancer drugs were significantly lower than those of the primary lesions. When performing chemotherapy based on CD-DST data using primary tumors from patients with postoperative recurrence, an appropriate regimen can be selected by carefully considering these differences.

  20. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  1. G.T wobble base-pairing in Z-DNA at 1.0 A atomic resolution: the crystal structure of d(CGCGTG).

    OpenAIRE

    Ho, P S; Frederick, C A; Quigley, G J; van der Marel, G A; van Boom, J H; Wang, A H; Rich, A

    1985-01-01

    The DNA oligomer d(CGCGTG) crystallizes as a Z-DNA double helix containing two guanine-thymine base pair mismatches of the wobble type. The crystal diffracts to 1 A resolution and the structure has been solved and refined. At this resolution, a large amount of information is revealed about the organization of the water molecules in the lattice generally and more specifically around the wobble base pairs. By comparing this structure with the analogous high resolution structure of d(CGCGCG) we ...

  2. Stepping Forward Action for Biped Robot Based on Acceleration Control of the Center of Mass

    Science.gov (United States)

    Suzuki, Kazuki; Tasaki, Go; Shibata, Masaaki

    In this paper, we propose a novel approach for stepping forward action of biped robot with minimum kicking force. In walking or starting to walk, the general biped robot kicks the ground with its own hind leg as well as human being does. The condition of the ground often restricts the gait because of stiffness, slipperiness and so on. In order to surmount the difficulty on stepping forward action, we introduce the redundant legged biped robot, which has 4 degree-of-freedoms on each leg. Our robot enables to move its tip position and its center of mass (COM) position independently. Controlling COM acceleration without moving its tip position realizes the stepping forward action with little kicking force. The physical experimental results show the significant validity of the proposed approach.

  3. Numerical research of dynamic characteristics in tower solar cavity receiver based on step-change radiation flux

    Science.gov (United States)

    Chen, Zhengwei; Wang, Yueshe; Hao, Yun; Wang, Qizhi

    2013-07-01

    The solar cavity receiver is an important light-energy to thermal-energy convector in the tower solar thermal power plant system. The heat flux in the inner surface of the cavity will show the characteristics of non-continuous step change especially in non-normal and transient weather conditions, which may result in a continuous dynamic variation of the characteristic parameters. Therefore, the research of dynamic characteristics of the receiver plays a very important role in the operation and the control safely in solar cavity receiver system. In this paper, based on the non-continuous step change of radiation flux, a non-linear dynamic model is put forward to obtain the effects of the non-continuous step change radiation flux and step change feed water flow on the receiver performance by sequential modular approach. The subject investigated in our study is a 1MW solar power station constructed in Yanqing County, Beijing. This study has obtained the dynamic responses of the characteristic parameters in the cavity receiver, such as drum pressure, drum water level, main steam flow and main steam enthalpy under step change radiation flux. And the influence law of step-change feed water flow to the dynamic characteristics in the receiver also has been analyzed. The results have a reference value for the safe operation and the control in solar cavity receiver system.

  4. Theoretical study on absorption and emission spectra of size-expanded Janus-type AT nucleobases and effect of base pairing.

    Science.gov (United States)

    Liu, Hongxia; Song, Qixia; Liu, Jianhua; Li, Yan; Wang, Haijun

    2014-01-01

    Fluorescent nucleoside analogues have attracted much attention in studying the structure and dynamics of nucleic acids in recent years. In the present work, we design benzo- and naphtha-expanded Janus AT base analogues, using DFT, TDDFT, and CIS methods to investigate the structural and optical properties of the Janus AT base analogues (termed as J-AT, xJ-AT, yyJ-AT, BF, xBF and yyBF), and also consider the effect of base pairing. The results show that the Janus AT base analogues can pair with T and A simultaneously to form stable H-bonded WC base pairs. The ground state structure of J-AT is similar to BF, the size expansion is 2.42Å for the x-Janus AT bases and 4.86Å for the yy-Janus AT bases. The excited state geometries of J-AT and BF change dramatically, while the other bases are similar to the ground state geometries. The lowest excited singlet transitions of the Janus AT base analogues are predicted to be of ππ(*) character and mainly dominated by the configuration HOMO-LUMO. The maximum absorption wavelengths of size expansion Janus AT base analogues are greatly red shifted compared with J-AT (or BF). BF, xBF and yyJ-AT have larger oscillator strengths than J-AT, xJ-AT and yyBF. The emission wavelengths of the Janus AT base analogues also exhibit red shifts from x-Janus AT bases to yy-Janus AT bases. However, the emission wavelengths of J-AT and BF change greatly, which are coincident with the structures observed in the excited state geometries. With regard to the WC base pairs, the B3LYP functional reveals that the lowest energy transitions of some base pairs are charge transfer excitation, while the other base pairs are local excitation. The CAM-B3LYP functional predicts that all the lowest transitions are localized on the Janus AT bases, and show good agreement with the results of the M062X functional. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  6. A Systematic, Inquiry-Based 7-Step Virtual Worlds Teacher Training

    Science.gov (United States)

    Nussli, Natalie Christina; Oh, Kevin

    2015-01-01

    Eighteen special education teachers explored one prominent example of three-dimensional virtual worlds, namely Second Life. This study aimed to (a) determine their perception of the effectiveness of a systematic 7-Step Virtual Worlds Teacher Training workshop in terms of enabling them to make informed decisions about the usability of virtual…

  7. Taking Steps Together: A Family- and Community-Based Obesity Intervention for Urban, Multiethnic Children

    Science.gov (United States)

    Anderson, John D.; Newby, Rachel; Kehm, Rebecca; Barland, Patricia; Hearst, Mary O.

    2015-01-01

    Objectives: Successful childhood obesity intervention models that build sustainable behavioral change are needed, particularly in low-income, ethnic minority communities disparately affected by this problem. Method: Families were referred to Taking Steps Together (TST) by their primary care provider if at least one child had a body mass index…

  8. A three-step reconstruction method for fluorescence molecular tomography based on compressive sensing

    DEFF Research Database (Denmark)

    Zhu, Yansong; Jha, Abhinav K.; Dreyer, Jakob K.

    2017-01-01

    effects could be exploited, traditional compressive-sensing methods cannot be directly applied as the system matrix in FMT is highly coherent. To overcome these issues, we propose and assess a three-step reconstruction method. First, truncated singular value decomposition is applied on the data to reduce...... considerable promise and will be tested using more realistic simulations and experimental setups....

  9. A facile two-step dipping process based on two silica systems for a superhydrophobic surface.

    Science.gov (United States)

    Li, Xiaoguang; Shen, Jun

    2011-10-14

    A silica microsphere suspension and a silica sol are employed in a two-step dipping process for the preparation of a superhydrophobic surface. It's not only a facile way to achieve the lotus effect, but can also create a multi-functional surface with different wetabilities, adhesive forces and transparencies. This journal is © The Royal Society of Chemistry 2011

  10. Multi-step Attack Modelling and Simulation (MsAMS) Framework based on Mobile Ambients

    NARCIS (Netherlands)

    Nunes Leal Franqueira, V.; Lopes, R H C; van Eck, Pascal

    Attackers take advantage of any security breach to penetrate an organisation perimeter and exploit hosts as stepping stones to reach valuable assets, deeper in the network. The exploitation of hosts is possible not only when vulnerabilities in commercial off-the-shelf (COTS) software components are

  11. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  12. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. A Dimensionality Reduction-Based Multi-Step Clustering Method for Robust Vessel Trajectory Analysis

    Directory of Open Access Journals (Sweden)

    Huanhuan Li

    2017-08-01

    Full Text Available The Shipboard Automatic Identification System (AIS is crucial for navigation safety and maritime surveillance, data mining and pattern analysis of AIS information have attracted considerable attention in terms of both basic research and practical applications. Clustering of spatio-temporal AIS trajectories can be used to identify abnormal patterns and mine customary route data for transportation safety. Thus, the capacities of navigation safety and maritime traffic monitoring could be enhanced correspondingly. However, trajectory clustering is often sensitive to undesirable outliers and is essentially more complex compared with traditional point clustering. To overcome this limitation, a multi-step trajectory clustering method is proposed in this paper for robust AIS trajectory clustering. In particular, the Dynamic Time Warping (DTW, a similarity measurement method, is introduced in the first step to measure the distances between different trajectories. The calculated distances, inversely proportional to the similarities, constitute a distance matrix in the second step. Furthermore, as a widely-used dimensional reduction method, Principal Component Analysis (PCA is exploited to decompose the obtained distance matrix. In particular, the top k principal components with above 95% accumulative contribution rate are extracted by PCA, and the number of the centers k is chosen. The k centers are found by the improved center automatically selection algorithm. In the last step, the improved center clustering algorithm with k clusters is implemented on the distance matrix to achieve the final AIS trajectory clustering results. In order to improve the accuracy of the proposed multi-step clustering algorithm, an automatic algorithm for choosing the k clusters is developed according to the similarity distance. Numerous experiments on realistic AIS trajectory datasets in the bridge area waterway and Mississippi River have been implemented to compare our

  14. A Dimensionality Reduction-Based Multi-Step Clustering Method for Robust Vessel Trajectory Analysis.

    Science.gov (United States)

    Li, Huanhuan; Liu, Jingxian; Liu, Ryan Wen; Xiong, Naixue; Wu, Kefeng; Kim, Tai-Hoon

    2017-08-04

    The Shipboard Automatic Identification System (AIS) is crucial for navigation safety and maritime surveillance, data mining and pattern analysis of AIS information have attracted considerable attention in terms of both basic research and practical applications. Clustering of spatio-temporal AIS trajectories can be used to identify abnormal patterns and mine customary route data for transportation safety. Thus, the capacities of navigation safety and maritime traffic monitoring could be enhanced correspondingly. However, trajectory clustering is often sensitive to undesirable outliers and is essentially more complex compared with traditional point clustering. To overcome this limitation, a multi-step trajectory clustering method is proposed in this paper for robust AIS trajectory clustering. In particular, the Dynamic Time Warping (DTW), a similarity measurement method, is introduced in the first step to measure the distances between different trajectories. The calculated distances, inversely proportional to the similarities, constitute a distance matrix in the second step. Furthermore, as a widely-used dimensional reduction method, Principal Component Analysis (PCA) is exploited to decompose the obtained distance matrix. In particular, the top k principal components with above 95% accumulative contribution rate are extracted by PCA, and the number of the centers k is chosen. The k centers are found by the improved center automatically selection algorithm. In the last step, the improved center clustering algorithm with k clusters is implemented on the distance matrix to achieve the final AIS trajectory clustering results. In order to improve the accuracy of the proposed multi-step clustering algorithm, an automatic algorithm for choosing the k clusters is developed according to the similarity distance. Numerous experiments on realistic AIS trajectory datasets in the bridge area waterway and Mississippi River have been implemented to compare our proposed method with

  15. Life Cost Based FMEA Manual: A Step by Step Guide to Carrying Out a Cost-based Failure Modes and Effects Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Rhee, Seung; Spencer, Cherrill; /Stanford U. /SLAC

    2009-01-23

    definition of detection difficulty (D) is how well the organization controls the development process. Another definition relates to the detectability of a particular failure in the product when it is in the hands of the customer. The former asks 'What is the chance of catching the problem before we give it to the customer'? The latter asks 'What is the chance of the customer catching the problem before the problem results in a catastrophic failure?' (Palady, 1995) These differing definitions confuse the FMEA users when one tries to determine detection difficulty. Are we trying to measure how easy it is to detect where a failure has occurred or when it has occurred? Or are we trying to measure how easy or difficult it is to prevent failures? Ordinal scale variables are used to rank-order industries such as, hotels, restaurants, and movies (Note that a 4 star hotel is not necessarily twice as good as a 2 star hotel). Ordinal values preserve rank in a group of items, but the distance between the values cannot be measured since a distance function does not exist. Thus, the product or sum of ordinal variables loses its rank since each parameter has different scales. The RPN is a product of 3 independent ordinal variables, it can indicate that some failure types are 'worse' than others, but give no quantitative indication of their relative effects. To resolve the ambiguity of measuring detection difficulty and the irrational logic of multiplying 3 ordinal indices, a new methodology was created to overcome these shortcomings, Life Cost-Based FMEA. Life Cost-Based FMEA measures failure/risk in terms of monetary cost. Cost is a universal parameter that can be easily related to severity by engineers and others. Thus, failure cost can be estimated using the following simplest form: Expected Failure Cost = {sup n}{Sigma}{sub i=1}p{sub i}c{sub i}, p: Probability of a particular failure occurring; c: Monetary cost associated with that particular failure; and

  16. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  17. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Enhancement of galaxy overdensity around quasar pairs at z < 3.6 based on the Hyper Suprime-Cam Subaru Strategic Program Survey

    Science.gov (United States)

    Onoue, Masafusa; Kashikawa, Nobunari; Uchiyama, Hisakazu; Akiyama, Masayuki; Harikane, Yuichi; Imanishi, Masatoshi; Komiyama, Yutaka; Matsuoka, Yoshiki; Nagao, Tohru; Nishizawa, Atsushi J.; Oguri, Masamune; Ouchi, Masami; Tanaka, Masayuki; Toba, Yoshiki; Toshikawa, Jun

    2018-01-01

    We investigate the galaxy overdensity around proto-cluster scale quasar pairs at high (z > 3) and low (z ˜ 1) redshift based on the unprecedentedly wide and deep optical survey of the Hyper Suprime-Cam Subaru Strategic Program (HSC-SSP). Using the first-year survey data covering effectively ˜121 deg2 with the 5σ depth of i ˜ 26.4 and the SDSS DR12Q catalog, we find two luminous pairs at z ˜ 3.3 and 3.6 which reside in >5σ overdensity regions of g-dropout galaxies at i R⊥ = 1.75 and 1.04 proper Mpc (pMpc), and their velocity offsets are ΔV = 692 and 1448 km s-1, respectively. This result is in clear contrast to the average z ˜ 4 quasar environments as discussed in Uchiyama et al. (2018, PASJ 70, S32) and implies that the quasar activities of the pair members are triggered via major mergers in proto-clusters, unlike the vast majority of isolated quasars in general fields that may turn on via non-merger events such as bar and disk instabilities. At z ˜ 1, we find 37 pairs with R⊥ 4σ) regions. Thanks to the large sample size, we find statistical evidence that this excess is unique to the pair environments when compared to single-quasar and randomly selected galaxy environments at the same redshift range. Moreover, there are nine small-scale (R⊥ < 1 pMpc) pairs, two of which are found to reside in cluster fields. Our results demonstrate that <2 pMpc scale quasar pairs at both redshift ranges tend to occur in massive haloes, although perhaps not the most massive ones, and that they are useful in searching for rare density peaks.

  19. Direct Taxation in the Eu: The Common Corporate Tax Base as the Next Sub-Step towards Harmonization

    Directory of Open Access Journals (Sweden)

    Norbert Herzig

    2011-12-01

    Full Text Available This paper analyzes the Common Corporate Tax Base (CCTB as an interim alternative to the proposal of a Council directive on a Common Consolidated Corporate Tax Base (CCCTB. The CCCTB concept does not only include common rules for determining the tax base like the CCTB but also the steps of consolidation and subsequent formula apportionment. Therefore, the paper starts by showing that particularly these second and third steps of the CCCTB project meet fierce political opposition from several Member States and do leave leeway for tax planning. Afterwards, the CCCTB proposal's approach to common rules for determining the tax base is evaluated, i.e. tested for its suitability as a point of departure for drafting a CCTB. Finally, various other aspects of the proposal are examined in light of a CCTB without consolidation.

  20. Gemcitabine, Pyrrologemcitabine, and 2'-Fluoro-2'-Deoxycytidines: Synthesis, Physical Properties, and Impact of Sugar Fluorination on Silver Ion Mediated Base Pairing.

    Science.gov (United States)

    Guo, Xiurong; Leonard, Peter; Ingale, Sachin A; Seela, Frank

    2017-12-14

    The stability of silver-mediated "dC-dC" base pairs relies not only on the structure of the nucleobase, but is also sensitive to structural modification of the sugar moiety. 2'-Fluorinated 2'-deoxycytidines with fluorine atoms in the arabino (up) and ribo (down) configuration as well as with geminal fluorine substitution (anticancer drug gemcitabine) and the novel fluorescent phenylpyrrolo-gemcitabine ( ph PyrGem) have been synthesized. All the nucleosides display the recognition face of naturally occurring 2'-deoxycytidine. The nucleosides were converted into phosphoramidites and incorporated into 12-mer oligonucleotides by solid-phase synthesis. The addition of silver ions to DNA duplexes with a fluorine-modified "dC-dC" pair near the central position led to significant duplex stabilization. The increase in stability was higher for duplexes with fluorinated sugar residues than for those with an unchanged 2'-deoxyribose moiety. Similar observations were made for "dC-dT" pairs and to a minor extent for "dC-dA" pairs. The increase in silver ion mediated base-pair stability was reversed by annulation of a pyrrole ring to the cytosine moiety, as shown for 2'-fluorinated ph PyrGem in comparison with phenylpyrrolo-dC ( ph PyrdC). This phenomenon results from stereoelectronic effects induced by fluoro substitution, which are transmitted from the sugar moiety to the silver ion mediated base pairs. The extent of the effect depends on the number of fluorine substituents, their configuration, and the structure of the nucleobase. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Deconstructing chronic low back pain in the older adult--Step by step evidence and expert-based recommendations for evaluation and treatment part III: Fibromyalgia syndrome.

    Science.gov (United States)

    Fatemi, Gita; Fang, Meika A; Breuer, Paula; Cherniak, Paul E; Gentili, Angela; Hanlon, Joseph T; Karp, Jordan F; Morone, Natalia E; Rodriguez, Eric; Rossi, Michelle I; Schmader, Kenneth; Weiner, Debra K

    2015-09-01

    To present the third in a series of articles designed to deconstruct chronic low back pain (CLBP) in older adults. The series presents CLBP as a syndrome, a final common pathway for the expression of multiple contributors rather than a disease localized exclusively to the lumbosacral spine. Each article addresses one of 12 important contributors to pain and disability in older adults with CLBP. This article focuses on fibromyalgia syndrome (FMS). A modified Delphi approach was used to create the evaluation and treatment algorithm, the table discussing the rationale behind each of the algorithm components, and the stepped-care drug recommendations. The team involved in the creation of these materials consisted of a principal investigator, a 5-member content expert panel, and a 9-member primary care panel. The evaluation and treatment recommendations were based on availability of medications and other resources within the Veterans Health Administration (VHA) facilities. However, non-VHA panelists were also involved in the development of these materials, which can be applied to both VA and civilian settings. The illustrative clinical case was taken from the clinical practice of the principal investigator. Following expert consultations and a review of the literature, we developed an evaluation and treatment algorithm with supporting materials to aid in the care of older adults with CLBP who have concomitant FMS. A case is presented that demonstrates the complexity of pain evaluation and management in older patients with CLBP and concomitant FMS. Recognition of FMS as a common contributor to CLBP in older adults and initiating treatment targeting both FMS and CLBP may lead to improved outcomes in pain and disability. Wiley Periodicals, Inc.

  2. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Non-Watson-Crick base pairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 20, č. 6 (2003), s. 986 ISSN 0739-1102. [Albany 2003: Conversation 13. 17.06.2003-21.06.2003, Albany] Institutional research plan: CEZ:AV0Z5004920 Keywords : non- Watson -Crick base pairs * Loop E * RNA Subject RIV: BO - Biophysics

  4. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  5. High-current pulse electron accelerators based on stepped forming lines

    CERN Document Server

    Gordeev, V S; Filipov, V O; Petrov, A N; Gridasov, A P

    2001-01-01

    There presented is a brief review of I-3000, STRAUS, STRAUS-2 and LIA-10M accelerators produced in VNIEF over the period from 1981 to 1994. All the installations function in the mode of single pulses. Their distinction consists in using the systems of forming high-voltage pulses on the basis of stepped forming lines. Such installations formed of line sections of a similar electrical length with a stepped character of impedance variance provide a high efficiency and as a result of wave processes increase for a several time the output voltage as compared to the charge voltage of lines. The limiting energy of accelerated electrons for the created accelerators lies within the range from 2.3 to 25 MeV, beam current amplitude - from 20 to 50 kA, current pulse width at half-height - from 16 to 40 ns. The basic characteristics of each accelerator are presented.

  6. A Novel Low-Ringing Monocycle Picosecond Pulse Generator Based on Step Recovery Diode

    Science.gov (United States)

    Zhou, Jianming; Yang, Xiao; Lu, Qiuyuan; Liu, Fan

    2015-01-01

    This paper presents a high-performance low-ringing ultra-wideband monocycle picosecond pulse generator, formed using a step recovery diode (SRD), simulated in ADS software and generated through experimentation. The pulse generator comprises three parts, a step recovery diode, a field-effect transistor and a Schottky diode, used to eliminate the positive and negative ringing of pulse. Simulated results validate the design. Measured results indicate an output waveform of 1.88 peak-to-peak amplitude and 307ps pulse duration with a minimal ringing of -22.5 dB, providing good symmetry and low level of ringing. A high degree of coordination between the simulated and measured results is achieved. PMID:26308450

  7. Multi-step-prediction of chaotic time series based on co-evolutionary recurrent neural network

    International Nuclear Information System (INIS)

    Ma Qianli; Zheng Qilun; Peng Hong; Qin Jiangwei; Zhong Tanwei

    2008-01-01

    This paper proposes a co-evolutionary recurrent neural network (CERNN) for the multi-step-prediction of chaotic time series, it estimates the proper parameters of phase space reconstruction and optimizes the structure of recurrent neural networks by co-evolutionary strategy. The searching space was separated into two subspaces and the individuals are trained in a parallel computational procedure. It can dynamically combine the embedding method with the capability of recurrent neural network to incorporate past experience due to internal recurrence. The effectiveness of CERNN is evaluated by using three benchmark chaotic time series data sets: the Lorenz series, Mackey-Glass series and real-world sun spot series. The simulation results show that CERNN improves the performances of multi-step-prediction of chaotic time series

  8. Class-Wide Access to a Commercial Step 1 Question Bank During Preclinical Organ-Based Modules: A Pilot Project.

    Science.gov (United States)

    Baños, James H; Pepin, Mark E; Van Wagoner, Nicholas

    2018-03-01

    The authors examined the usefulness of a commercially available Step 1 question bank as a formative academic support tool throughout organ-based modules in an integrated preclinical medical curriculum. The authors also determined the extent to which correlation between question bank utilization and academic metrics varied with Medical College Admission Test (MCAT) scores. In 2015, a cohort of 185 first-year medical students at University of Alabama School of Medicine were provided with 18-month full access to a commercially available Step 1 question bank of over 2,100 items throughout organ-based modules, although there were no requirements for use. Data on student use of the question bank were collected via an online administrative portal. Relationships between question bank utilization and academic outcomes including exams, module grades, and United States Medical Licensing Examination (USMLE) Step 1 were determined using multiple linear regression. MCAT scores and number of items attempted in the question bank significantly predicted all academic measures, with question bank utilization as the stronger predictor. The association between question bank utilization and academic outcome was stronger for individuals with lower MCAT scores. The findings elucidate a novel academic support mechanism that, for some programs, may help bridge the gap between holistic and mission-based admissions practices and a residency match process that places a premium on USMLE exam scores. Distributed formative use of USMLE Step 1 practice questions may be of value as an academic support tool that benefits all students, but particularly those entering with lower MCAT scores.

  9. Single step hydrothermal based synthesis of M(II)Sb2O6 (M = Cd ...

    Indian Academy of Sciences (India)

    Abstract. Experiments involving single step hydrothermal reactions of the divalent metal (Zn2+, Cd2+, Pb2+,. Cu2+, Ni2+ and Mn2+) salts with ilmenite NaSbO3 yielded pure divalent antimonates in the case of CdSb2O6 crys- tallizing in the PbSb2O6 type structure and ZnSb2O6 crystallizing in the trirutile structure type.

  10. FIRST STEPS TOWARDS AN INTEGRATED CITYGML-BASED 3D MODEL OF VIENNA

    Directory of Open Access Journals (Sweden)

    G. Agugiaro

    2016-06-01

    This paper reports about the experiences done so far, it describes the test area and the available data sources, it shows and exemplifies the data integration issues, the strategies developed to solve them in order to obtain the integrated 3D city model. The first results as well as some comments about their quality and limitations are presented, together with the discussion regarding the next steps and some planned improvements.

  11. Pair-Bonded Humans Conform to Sexual Stereotypes in Web-Based Advertisements for Extra-Marital Partners

    Directory of Open Access Journals (Sweden)

    Trish C. Kelley

    2010-10-01

    Full Text Available Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those stereotypes. Our findings thus provide further evidence that human mating behavior is highly constrained by fundamental biological differences between males and females.

  12. Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

    Science.gov (United States)

    Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

    2017-12-01

    We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

  13. Selection of optimal spawning pairs to maintain genetic variation among captive populations of Acipenseridae based on the polymorphism of microsatellite loci

    Directory of Open Access Journals (Sweden)

    Kaczmarczyk Dariusz

    2016-06-01

    Full Text Available The American paddlefish, Polyodon spathula (Walbaum, is an endangered acipenserid fish. Its wild populations are supplemented with stocking material that is obtained by conducting artificial spawning in aquaculture conditions. When fish are bred in captivity, it is important to select breeding pairs that will produce the most genetically diverse progeny, since this permits maintaining the fitness of wild populations. Breeding pairs of land animals are selected successfully based on the polymorphism of their microsatellite loci. This theoretical paper asks how to adapt this technique to fish so that American paddlefish spawners can be paired with the aim of producing restocking material in aquaculture that maintains genetic variation. To test our calculating techniques, we used actual data on the polymorphism of the microsatellites from paddlefish broodstock at the Pogorze fish farm (Poland. The data enabled us to do calculations that showed which spawner pairs would create the most genetically diverse offspring and how to assemble sets of spawning pairs that would be best for maintaining genetic variation. The method presented in this paper can be used for breeding fish in aquaculture to help conserve species. It could also be used in a computer program which would automate calculations and present them in easy-to-read tables and graphs.

  14. DNA recognition by the SwaI restriction endonuclease involves unusual distortion of an 8 base pair A:T-rich target.

    Science.gov (United States)

    Shen, Betty W; Heiter, Daniel F; Lunnen, Keith D; Wilson, Geoffrey G; Stoddard, Barry L

    2017-02-17

    R.SwaI, a Type IIP restriction endonuclease, recognizes a palindromic eight base pair (bp) symmetric sequence, 5΄-ATTTAAAT-3΄, and cleaves that target at its center to generate blunt-ended DNA fragments. Here, we report three crystal structures of SwaI: unbound enzyme, a DNA-bound complex with calcium ions; and a DNA-bound, fully cleaved complex with magnesium ions. We compare these structures to two structurally similar ‘PD-D/ExK’ restriction endonucleases (EcoRV and HincII) that also generate blunt-ended products, and to a structurally distinct enzyme (the HNH endonuclease PacI) that also recognizes an 8-bp target site consisting solely of A:T base pairs. Binding by SwaI induces an extreme bend in the target sequence accompanied by un-pairing and re-ordering of its central A:T base pairs. This result is reminiscent of a more dramatic target deformation previously described for PacI, implying that long A:T-rich target sites might display structural or dynamic behaviors that play a significant role in endonuclease recognition and cleavage.

  15. Cooper pairs in atomic nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Pittel, S. [Bartol Research Institute and Department of Physics and Astronomy, University of Delaware, Newark, 19716 Delaware (United States); Dussel, G. G. [Departamento de Fisica J.J. Giambiagi, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Dukelsky, J.; Sarriguren, P. [Instituto de Estructura de la Materia, CSIC, Serrano 123, 28006 Madrid (Spain)

    2008-12-15

    We describe recent efforts to study Cooper pairs in atomic nuclei. We consider a self-consistent Hartree Fock mean field for the even Sm isotopes and compare results based on three treatments of pairing correlations: a BCS treatment, a number-projected BCS treatment and an exact treatment using the Richardson Ansatz. Significant differences are seen in the pairing correlation energies. Furthermore, because it does not average over the properties of the fermion pairs, the Richardson solution permits a more meaningful definition of the Cooper wave function and of the fraction of pairs that are collective. Our results confirm that only a few pairs near the Fermi surface in realistic atomic nuclei are collective. (Author)

  16. A randomized controlled pilot study of home-based step training in older people using videogame technology.

    Directory of Open Access Journals (Sweden)

    Daniel Schoene

    Full Text Available BACKGROUND: Stepping impairments are associated with physical and cognitive decline in older adults and increased fall risk. Exercise interventions can reduce fall risk, but adherence is often low. A new exergame involving step training may provide an enjoyable exercise alternative for preventing falls in older people. PURPOSE: To assess the feasibility and safety of unsupervised, home-based step pad training and determine the effectiveness of this intervention on stepping performance and associated fall risk in older people. DESIGN: Single-blinded two-arm randomized controlled trial comparing step pad training with control (no-intervention. SETTING/PARTICIPANTS: Thirty-seven older adults residing in independent-living units of a retirement village in Sydney, Australia. INTERVENTION: Intervention group (IG participants were provided with a computerized step pad system connected to their TVs and played a step game as often as they liked (with a recommended dose of 2-3 sessions per week for 15-20 minutes each for eight weeks. In addition, IG participants were asked to complete a choice stepping reaction time (CSRT task once each week. MAIN OUTCOME MEASURES: CSRT, the Physiological Profile Assessment (PPA, neuropsychological and functional mobility measures were assessed at baseline and eight week follow-up. RESULTS: Thirty-two participants completed the study (86.5%. IG participants played a median 2.75 sessions/week and no adverse events were reported. Compared to the control group, the IG significantly improved their CSRT (F31,1 = 18.203, p<.001, PPA composite scores (F31,1 = 12.706, p = 0.001, as well as the postural sway (F31,1 = 4.226, p = 0.049 and contrast sensitivity (F31,1 = 4.415, p = 0.044 PPA sub-component scores. In addition, the IG improved significantly in their dual-task ability as assessed by a timed up and go test/verbal fluency task (F31,1 = 4.226, p = 0.049. CONCLUSIONS: Step pad training can

  17. Comparison of SIFT and SURF based DEM extraction approaches on a GEOEYE-1 satellite stereo-pair

    Science.gov (United States)

    Daliakopoulos, Ioannis; Tsanis, Ioannis

    2014-05-01

    A MATLAB module for Digital Elevation Model (DEM) extraction from Very High Resolution (VHR) satellite stereo-pair imagery is used to compare the efficiency of two well established feature detection and description algorithms. A procedure for parallel processing of cascading image tiles is used for handling the large datasets requirements of VHR satellite imagery. Scale-Invariant Feature Transform (SIFT) and Speeded Up Robust Features (SURF) algorithms are used to detect potentially tentative feature matches in the members of the stereo-pair. The resulting feature pairs are filtered using the RANdom SAmple Consensus (RANSAC) algorithm by using a variable distance threshold. Finally, tentative feature matches are converted to point cloud ground coordinates for DEM generation. A 0.5 m × 0.5 m Geoeye-1 stereo-pair acquired over an area of 25 km2 in the island of Crete, Greece is used as input for the module. The resulting 2 m × 2 m DEMs has superior detail over previously developed 2 m and 5 m DEMs that are used as reference, and yields a Root Mean Square Error (RMSE) of about 1 m compared to ground truth measurements. Results suggest that SURF's superior runtime performance outweighs the slightly better feature quality attained with SIFT.

  18. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    Science.gov (United States)

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  19. Stepping Stones to Resiliency following a community-based two-generation Canadian preschool programme.

    Science.gov (United States)

    Ginn, Carla S; Benzies, Karen M; Keown, Leslie Anne; Raffin Bouchal, Shelley; Thurston, Wilfreda E Billlie

    2018-05-01

    Early intervention programmes are designed to address complex inequities for Canadian families living with low income, affecting social relationships, well-being and mental health. However, there is limited understanding of resiliency and change in families living with low income over time. We conducted a mixed methods study with recent immigrant, other Canadian-born, and Aboriginal families living with low income, who attended a two-generation preschool programme (CUPS One World) between 2002 and 2008. The aim of this study was to develop an understanding of the processes of change. We included 134 children and their caregivers living with low income, and experiencing mental health problems, addiction or social isolation. Children's receptive language, a proxy for school readiness, was measured at programme intake, exit, and age 10 years using the Peabody Picture Vocabulary Test 3rd Edition (PPVT-III). In Phase I (quantitative), we identified children with receptive language scores in the top and bottom 25th percentile, informing participant selection for Phase II. In Phase II (qualitative), we engaged in constructivist grounded theory to explore experiences of 14 biological mothers, after their children (n = 25) reached age 10 years. Interviews were conducted between June and September 2015. The core category, Stepping Stones to Resiliency, encompassed Perceptions of Family, Moving Forward, Achieving Goals, and Completely Different. Perceptions of Family influenced families' capabilities to move across the Stepping Stones to Resiliency. Stepping Stones to Resiliency provides a lens from which to view others in their daily challenges to break free of painful intergenerational cycles. It is a reminder of our struggle, our shared humanness, and that movement towards resiliency is more difficult for some than others. Our findings challenge traditional episodic, biomedical treatment paradigms for low-income families also experiencing intergenerational cycles of

  20. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    Science.gov (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  1. An improved algorithm to convert CAD model to MCNP geometry model based on STEP file

    International Nuclear Information System (INIS)

    Zhou, Qingguo; Yang, Jiaming; Wu, Jiong; Tian, Yanshan; Wang, Junqiong; Jiang, Hai; Li, Kuan-Ching

    2015-01-01

    Highlights: • Fully exploits common features of cells, making the processing efficient. • Accurately provide the cell position. • Flexible to add new parameters in the structure. • Application of novel structure in INP file processing, conveniently evaluate cell location. - Abstract: MCNP (Monte Carlo N-Particle Transport Code) is a general-purpose Monte Carlo N-Particle code that can be used for neutron, photon, electron, or coupled neutron/photon/electron transport. Its input file, the INP file, has the characteristics of complicated form and is error-prone when describing geometric models. Due to this, a conversion algorithm that can solve the problem by converting general geometric model to MCNP model during MCNP aided modeling is highly needed. In this paper, we revised and incorporated a number of improvements over our previous work (Yang et al., 2013), which was proposed and targeted after STEP file and INP file were analyzed. Results of experiments show that the revised algorithm is more applicable and efficient than previous work, with the optimized extraction of geometry and topology information of the STEP file, as well as the production efficiency of output INP file. This proposed research is promising, and serves as valuable reference for the majority of researchers involved with MCNP-related researches

  2. LifeSteps: An Evidence-based Health Promotion Program for Underserved Populations – A Community Service Learning Approach

    Directory of Open Access Journals (Sweden)

    Melanie Austin-McCain

    2015-04-01

    Full Text Available Chronic diseases are the most common, costly, and preventable of all health problems in the United States. Chronic diseases represent the leading causes of death and are experienced at higher rates by minority populations (CDC, 2012. Innovative community-based health promotion programs are recommended that meet the diverse needs of underserved populations (Yeary, et al., 2011. LifeSteps is being developed as an evidence-based health promotion program focusing on health and wellness, a domain area defined within the Occupational Therapy Practice Framework (OTPF, 2008. LifeSteps will utilize a client-centered approach to coach individuals in making health behavior changes. Fieldwork and service-learning components are incorporated integrating clinical practice, academic study, and collaboration with community providers. Program evaluation measures based on the Transtheoretical Model (TTM have been identified to address all phases of program planning. The LifeSteps health promotion program aligns with local, national, and international objectives and addresses the need for programs that meet the diverse needs of underserved populations. Occupational therapists are in a unique position for implementing community-based interventions that promote health and contribute to a healthier society.

  3. An unstructured finite volume solver for two phase water/vapour flows based on an elliptic oriented fractional step method

    International Nuclear Information System (INIS)

    Mechitoua, N.; Boucker, M.; Lavieville, J.; Pigny, S.; Serre, G.

    2003-01-01

    Based on experience gained at EDF and Cea, a more general and robust 3-dimensional (3D) multiphase flow solver has been being currently developed for over three years. This solver, based on an elliptic oriented fractional step approach, is able to simulate multicomponent/multiphase flows. Discretization follows a 3D full unstructured finite volume approach, with a collocated arrangement of all variables. The non linear behaviour between pressure and volume fractions and a symmetric treatment of all fields are taken into account in the iterative procedure, within the time step. It greatly enforces the realizability of volume fractions (i.e 0 < α < 1), without artificial numerical needs. Applications to widespread test cases as static sedimentation, water hammer and phase separation are shown to assess the accuracy and the robustness of the flow solver in different flow conditions, encountered in nuclear reactors pipes. (authors)

  4. Influence of carboxylic ion-pairing reagents on retention of peptides in thin-layer chromatography systems with C18 silica-based adsorbents.

    Science.gov (United States)

    Gwarda, Radosław Ł; Aletańska-Kozak, Monika; Klimek-Turek, Anna; Ziajko-Jankowska, Agnieszka; Matosiuk, Dariusz; Dzido, Tadeusz H

    2016-04-01

    One of the main problems related to chromatography of peptides concerns adverse interactions of their strong basic groups with free silanol groups of the silica based stationary phase. Influence of type and concentration of ion-pairing regents on peptide retention in reversed-phase high-performance liquid chromatography (RP-HPLC) systems has been discussed before. Here we present influence of these mobile phase additives on retention of some peptide standards in high-performance thin-layer chromatography (HPTLC) systems with C18 silica-based adsorbents. We prove, that due to different characteristic of adsorbents used in both techniques (RP HPLC and HPTLC), influence of ion-pairing reagents on retention of basic and/or amphoteric compounds also may be quite different. C18 silica-based HPTLC adsorbents provide more complex mechanism of retention and should be rather considered as mixed-mode adsorbents. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Solar array stepping to minimize array excitation

    Science.gov (United States)

    Bhat, Mahabaleshwar K. P. (Inventor); Liu, Tung Y. (Inventor); Plescia, Carl T. (Inventor)

    1989-01-01

    Mechanical oscillations of a mechanism containing a stepper motor, such as a solar-array powered spacecraft, are reduced and minimized by the execution of step movements in pairs of steps, the period between steps being equal to one-half of the period of torsional oscillation of the mechanism. Each pair of steps is repeated at needed intervals to maintain desired continuous movement of the portion of elements to be moved, such as the solar array of a spacecraft. In order to account for uncertainty as well as slow change in the period of torsional oscillation, a command unit may be provided for varying the interval between steps in a pair.

  6. Street based self-employment : a poverty trap or a stepping stone for migrant youth in Africa?

    OpenAIRE

    Bezu, Sosina; Holden, Stein Terje

    2015-01-01

    A significant percentage of youth in urban Africa is employed in the informal sector. The informal sector is more accessible than the formal sector for people with low human and financial capital, such as youth migrants from rural areas. But the sector is also generally considered to provide a subsistence livelihood. This study examines whether street based selfemployment in Africa offer a stepping stone towards a better livelihood or an urban poverty trap for youth migrants. The ana...

  7. The Healthy Steps Study: A randomized controlled trial of a pedometer-based Green Prescription for older adults. Trial protocol

    OpenAIRE

    Kolt, Gregory S; Schofield, Grant M; Kerse, Ngaire; Garrett, Nicholas; Schluter, Philip J; Ashton, Toni; Patel, Asmita

    2009-01-01

    Abstract Background Graded health benefits of physical activity have been demonstrated for the reduction of coronary heart disease, some cancers, and type-2 diabetes, and for injury reduction and improvements in mental health. Older adults are particularly at risk of physical inactivity, and would greatly benefit from successful targeted physical activity interventions. Methods/Design The Healthy Steps study is a 12-month randomized controlled trial comparing the efficacy of a pedometer-based...

  8. Use of a problem-based learning exercise to teach the lean 8-step problem-solving method.

    Science.gov (United States)

    Tovar, Elizabeth G; Warshawsky, Nora

    2015-01-01

    Doctor of nursing practice (DNP) graduates must be prepared to lead quality improvement (QI) initiatives in health care settings; however, effective and feasible teaching strategies pose a challenge for many DNP program faculties. This article describes a successful and practical problem-based learning exercise for students to work through the QI process using the Lean 8-step problem-solving method. Suggestions for faculty and recommendations for future activities are discussed.

  9. Evaluation of the citizenship evidence-based probation supervision programme using a stepped wedge cluster randomized controlled trial

    OpenAIRE

    Pearson, Dominic; McDougall, Cynthia; Kanaan, Mona; Torgerson, David; Bowles, Roger

    2016-01-01

    This study evaluated a Risk-Need-Responsivity (RNR) evidence-based offender supervision programme, Citizenship, using a randomised controlled trial (RCT). Citizenship has a cognitive-behavioural basis and focuses on education, increasing motivation to change, and community integration. The RCT Is a stepped wedge cluster randomised design which has rarely been used in criminal justice and overcomes some ethical objections to RCT implementation. Participants were all medium- and high-risk offen...

  10. A robust method for the reconstruction of disparity maps based on multilevel processing of stereo color image pairs

    Science.gov (United States)

    Kravchenko, V. F.; Ponomaryov, V. I.; Pustovoit, V. I.; Sadovnychiy, S. N.

    2017-08-01

    A novel method for the reconstruction of disparity maps (DMs) with robust properties to nonideal registration conditions, reflections, and noise in stereo color image pairs has been substantiated for the first time. The novel approach proposes a scheme for image DM reconstruction where Jaccard distance metric is used as a proximity criterion in stereo image pair matching. A physical interpretation of the method that allows the quality of the formed DMs to be improved significantly is given. A processing block diagram has been developed in accordance with the novel approach. Simulations of the novel DM reconstruction method have shown an advantage of the proposed DM reconstruction scheme in terms of generally recognized criteria, such as the structural similarity index measure and the bad matching pixels, and when visually comparing the formed DMs.

  11. Solar radiation concentrators paired with multijunction photoelectric converters in ground-based solar power plants (part I)

    Science.gov (United States)

    Ionova, E. A.; Ulanov, M. V.; Davidyuk, N. Yu.; Sadchikov, N. A.

    2016-12-01

    We have developed a method for determining parameters of radiation concentrator in solar power plants. To estimate the efficiency of concentrators in the form of Fresnel lenses in setups with three-junction photoelectric converters, the concept of the efficiency of the concentrator-photoelectric converter pair has been introduced. We have proposed a method for calculating the refracting profile of concentrators taking into account the dispersion relation for the refractive index and its variations with temperature for the material of the refracting profile of the concentrator (Wacker RT604 silicone compound). The results of calculation make it possible to achieve the maximal efficiency of the concentrator-photoelectric converter pair in the presence of chromatic aberrations in the optical system of solar radiation concentration.

  12. High Performance Non-enzymatic Glucose Sensor Based on One-Step Electrodeposited Nickel Sulfide.

    Science.gov (United States)

    Kannan, Padmanathan Karthick; Rout, Chandra Sekhar

    2015-06-22

    Nanostructured NiS thin film was prepared by a one-step electrodeposition method and the structural, morphological characteristics of the as-prepared films were analyzed by X-ray diffractometry (XRD), field emission scanning electron microscopy (FESEM) and energy dispersive X-ray analysis (EDAX). The electrocatalytic activity of NiS thin film towards glucose oxidation was investigated by fabricating a non-enzymatic glucose sensor and the sensor performance was studied by cyclic voltammetry (CV) and amperometry. The fabricated sensor showed excellent sensitivity and low detection limit with values of 7.43 μA μM(-1)  cm(-2) and 0.32 μM, respectively, and a response time of <8 s. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Industrial Process Identification and Control Design Step-test and Relay-experiment-based Methods

    CERN Document Server

    Liu, Tao

    2012-01-01

      Industrial Process Identification and Control Design is devoted to advanced identification and control methods for the operation of continuous-time processes both with and without time delay, in industrial and chemical engineering practice.   The simple and practical step- or relay-feedback test is employed when applying the proposed identification techniques, which are classified in terms of common industrial process type: open-loop stable; integrating; and unstable, respectively. Correspondingly, control system design and tuning models that follow are presented for single-input-single-output processes.   Furthermore, new two-degree-of-freedom control strategies and cascade control system design methods are explored with reference to independently-improving, set-point tracking and load disturbance rejection. Decoupling, multi-loop, and decentralized control techniques for the operation of multiple-input-multiple-output processes are also detailed. Perfect tracking of a desire output trajectory is realiz...

  14. Practical Design Guidelines of qZSI Based Step-Up DC/DC Converter

    Science.gov (United States)

    Zakis, Janis; Vinnikov, Dmitri; Roasto, Indrek; Jalakas, Tanel

    2010-01-01

    This paper presents some design guidelines for a new voltage fed step-up DC/DC isolated converter. The most significant advantage of proposed converter is voltage buck-boost operation on single stage. The most promising application for proposed converter is in the field of distributed power generation e.g. fuel cells or photovoltaic. The most sensitive issues - such as power losses caused by high currents in the input side of converter and high transient overvoltages across the inverter bridge caused by stray inductances were discussed and solved. The proposals and recommendations to overcome these issues are given in the paper. The Selection and design guidelines of converter elements are proposed and explained. The prototype of proposed converter was built and experimentally tested. Some results are presented and evaluated.

  15. A single-step lithography system based on an enhanced robotic adhesive dispenser.

    Science.gov (United States)

    Xing, Jiyao; Rong, Weibin; Sun, Ding; Wang, Lefeng; Sun, Lining

    2016-09-01

    In the paper, we present a single-step lithography system whereby the robotically controlled micro-extrusion of resist adhesive onto a substrate surface to directly create resist adhesive patterns of interest. This system is modified from a robotic adhesive dispenser by shrinking the aperture of the nozzle to a few micrometers aiming to realize patterns at microscale. From experimental investigation, it is found that working factors including writing speed, working time, and applied pressure can be adopted to conveniently regulate the feature size (the width of the line features and the diameter of the dot features). To test its functionality, the system was used to pattern line features on silicon dioxide (SiO 2 ) and generate an array of square-like silicon microstructure by combining with wet etching. It provides a simple and flexible alternative tool to facilitate the development of microfabrication.

  16. Usability of an internet-based platform (Next.Step) for adolescent weight management.

    Science.gov (United States)

    Sousa, Pedro; Fonseca, Helena; Gaspar, Pedro; Gaspar, Filomena

    2015-01-01

    The current study evaluates the usability perception of an e-therapeutic platform (supported by electronic processes and communication), aiming to promote the behavior change and to improve the adolescent health status through increased and interactive contact between the adolescent and the clinical staff. This was a correlational study with a sample of 48 adolescents (12-18 years) who attended a Pediatric Obesity Clinic between January and August of 2012. Participants were invited to access, during 24 weeks, the e-therapeutic multidisciplinary platform (Next.Step) in addition to the standard treatment program. A usability questionnaire was administered and the platform performance and utilization indicators were analyzed. The users' perception of satisfaction, efficiency, and effectiveness regarding the Next.Step platform was clearly positive. However, only 54.17% of the enrolled adolescents accessed the platform, with a mean task-completion rate of 14.55% (SD=18.853). The higher the number of the platform consulted resources, the greater the tendency to enjoy the platform, to consider it exciting and quick, to consider that the time spent in it was useful, to consider the access to information easy, and to login easier. Post-intervention assessment revealed a significant reduction in anthropometric and behavioral variables, including body mass index z-score, waist circumference percentile, hip circumference, and weekly screen time. These results highlight the importance of information and communication technologies in the health information access and the healthcare provision. Despite the limited adherence rate, platform users expressed a positive overall perception of its usability and presented a positive anthropometric and behavioral progress. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  17. Usability of an internet-based platform (Next.Step for adolescent weight management

    Directory of Open Access Journals (Sweden)

    Pedro Sousa

    2015-02-01

    Full Text Available OBJECTIVE: The current study evaluates the usability perception of an e-therapeutic platform (supported by electronic processes and communication, aiming to promote the behavior change and to improve the adolescent health status through increased and interactive contact between the adolescent and the clinical staff. METHODS: This was a correlational study with a sample of 48 adolescents (12-18 years who attended a Pediatric Obesity Clinic between January and August of 2012. Participants were invited to access, during 24 weeks, the e-therapeutic multidisciplinary platform (Next.Step in addition to the standard treatment program. A usability questionnaire was administered and the platform performance and utilization indicators were analyzed. RESULTS: The users' perception of satisfaction, efficiency, and effectiveness regarding the Next.Step platform was clearly positive. However, only 54.17% of the enrolled adolescents accessed the platform, with a mean task-completion rate of 14.55% (SD = 18.853. The higher the number of the platform consulted resources, the greater the tendency to enjoy the platform, to consider it exciting and quick, to consider that the time spent in it was useful, to consider the access to information easy, and to login easier. Post-intervention assessment revealed a significant reduction in anthropometric and behavioral variables, including body mass index z-score, waist circumference percentile, hip circumference, and weekly screen time. CONCLUSION: These results highlight the importance of information and communication technologies in the health information access and the healthcare provision. Despite the limited adherence rate, platform users expressed a positive overall perception of its usability and presented a positive anthropometric and behavioral progress.

  18. Multiple-Step Injection Molding for Fibrin-Based Tissue-Engineered Heart Valves.

    Science.gov (United States)

    Weber, Miriam; Gonzalez de Torre, Israel; Moreira, Ricardo; Frese, Julia; Oedekoven, Caroline; Alonso, Matilde; Rodriguez Cabello, Carlos J; Jockenhoevel, Stefan; Mela, Petra

    2015-08-01

    Heart valves are elaborate and highly heterogeneous structures of the circulatory system. Despite the well accepted relationship between the structural and mechanical anisotropy and the optimal function of the valves, most approaches to create tissue-engineered heart valves (TEHVs) do not try to mimic this complexity and rely on one homogenous combination of cells and materials for the whole construct. The aim of this study was to establish an easy and versatile method to introduce spatial diversity into a heart valve fibrin scaffold. We developed a multiple-step injection molding process that enables the fabrication of TEHVs with heterogeneous composition (cell/scaffold material) of wall and leaflets without the need of gluing or suturing components together, with the leaflets firmly connected to the wall. The integrity of the valves and their functionality was proved by either opening/closing cycles in a bioreactor (proof of principle without cells) or with continuous stimulation over 2 weeks. We demonstrated the potential of the method by the two-step molding of the wall and the leaflets containing different cell lines. Immunohistology after stimulation confirmed tissue formation and demonstrated the localization of the different cell types. Furthermore, we showed the proof of principle fabrication of valves using different materials for wall (fibrin) and leaflets (hybrid gel of fibrin/elastin-like recombinamer) and with layered leaflets. The method is easy to implement, does not require special facilities, and can be reproduced in any tissue-engineering lab. While it has been demonstrated here with fibrin, it can easily be extended to other hydrogels.

  19. A One-Step PCR-Based Assay to Evaluate the Efficiency and Precision of Genomic DNA-Editing Tools

    Directory of Open Access Journals (Sweden)

    Diego Germini

    2017-06-01

    Full Text Available Despite rapid progress, many problems and limitations persist and limit the applicability of gene-editing techniques. Making use of meganucleases, TALENs, or CRISPR/Cas9-based tools requires an initial step of pre-screening to determine the efficiency and specificity of the designed tools. This step remains time consuming and material consuming. Here we propose a simple, cheap, reliable, time-saving, and highly sensitive method to evaluate a given gene-editing tool based on its capacity to induce chromosomal translocations when combined with a reference engineered nuclease. In the proposed technique, designated engineered nuclease-induced translocations (ENIT, a plasmid coding for the DNA-editing tool to be tested is co-transfected into carefully chosen target cells along with that for an engineered nuclease of known specificity and efficiency. If the new enzyme efficiently cuts within the desired region, then specific chromosomal translocations will be generated between the two targeted genomic regions and be readily detectable by a one-step PCR or qPCR assay. The PCR product thus obtained can be directly sequenced, thereby determining the exact position of the double-strand breaks induced by the gene-editing tools. As a proof of concept, ENIT was successfully tested in different cell types and with different meganucleases, TALENs, and CRISPR/Cas9-based editing tools.

  20. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  1. [Pharmacokinetic research strategies of compatibilities and synergistic effects of classical Danshen herb pairs based on pharmacokinetics of "Danshen-Bingpian" and "Danshen-Honghua"].

    Science.gov (United States)

    Zhang, Cui-Ying; Ren, Wei-Guang

    2017-06-01

    Herb pairs are usual clinical compatibility forms and one of compound prescription sources in Chinese medicine. Pharmacokinetic research in vivo is one of the important items in elucidating the mechanism for synergistic and attenuated mechanisms of herb pairs. The paper comprehensively summarized and systemized the pharmacokinetic researches of marker-ingredients about Danshen-Honghua and Danshen-Bingpian in order to elucidate the rationality and scientificity of herb pairs and provide some feasible suggestions on the pharmacokinetics of drugs in the future. In view of complicated system of Traditional Chinese medicines and a chemical system that is not separated from its natural state, comparative pharmacokinetic researches on marker-ingredients from the herb pairs are reasonable to elucidate the synergistic and attenuated mechanisms of monarch-subjects compatible herbs and monarch-guide compatible herbs. Such pharmacokinetic research can better explain the mechanism of drug compatibility, while the pharmacokinetic researches based on the monomer chemical compositions and marker-ingredients that have been separated from complex chemical environment of traditional Chinese Medicine are still unreasonable and should be discussed deeply. Copyright© by the Chinese Pharmaceutical Association.

  2. Influence of fermentation and other processing steps on the folate content of a traditional African cereal-based fermented food.

    Science.gov (United States)

    Saubade, Fabien; Hemery, Youna M; Rochette, Isabelle; Guyot, Jean-Pierre; Humblot, Christèle

    2018-02-02

    Folate deficiency can cause a number of diseases including neural tube defects and megaloblastic anemia, and still occurs in both developed and developing countries. Cereal-based food products are staple foods in many countries, and may therefore be useful sources of folate. The production of folate by microorganisms has been demonstrated in some cereal-based fermented foods, but has never been studied in a traditional African cereal based food spontaneously fermented. The microbiota of ben-saalga, a pearl-millet based fermented porridge frequently consumed in Burkina Faso, has a good genetic potential for the synthesis of folate, but the folate content of ben-saalga is rather low, suggesting that folate is lost during the different processing steps. The aim of this study was therefore to monitor changes in folate content during the different steps of preparing ben-saalga, from pearl-millet grains to porridge. Traditional processing involves seven different steps: washing, soaking, grinding, kneading, sieving, (spontaneous) fermentation, and cooking. Two type of porridge were prepared, one using a process adapted from the traditional process, the other a modified process based on fermentation by backslopping. Dry matter and total folate contents were measured at each step, and a mass balance assessment was performed to follow folate losses and gains. Folate production was observed during the soaking of pearl-millet grains (+26% to +79%), but the folate content of sieved batters (2.5 to 3.4μg/100g fresh weight) was drastically lower than that of milled soaked grains (17.3 to 19.4μg/100g FW). The final folate content of the porridges was very low (1.5 to 2.4μg/100g FW). The fermentation had no significant impact on folate content, whatever the duration and the process used. This study led to a better understanding of the impact on folate of the different processing steps involved in the preparation of ben-saalga. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Steps in Moving Evidence-Based Health Informatics from Theory to Practice.

    Science.gov (United States)

    Rigby, Michael; Magrabi, Farah; Scott, Philip; Doupi, Persephone; Hypponen, Hannele; Ammenwerth, Elske

    2016-10-01

    To demonstrate and promote the importance of applying a scientific process to health IT design and implementation, and of basing this on research principles and techniques. A review by international experts linked to the IMIA Working Group on Technology Assessment and Quality Development. Four approaches are presented, linking to the creation of national professional expectations, adherence to research-based standards, quality assurance approaches to ensure safety, and scientific measurement of impact. Solely marketing- and aspiration-based approaches to health informatics applications are no longer ethical or acceptable when scientifically grounded evidence-based approaches are available and in use.

  4. The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli.

    Science.gov (United States)

    Beisel, Chase L; Storz, Gisela

    2011-02-04

    Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base-pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse nonpreferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multioutput feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base-pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Ring-dot-shaped multilayer piezoelectric step-down transformers using PZT-based ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Insung; Joo, Hyeonkyu; Song, Jaesung; Jeong, Soonjong; Kim, Minsoo [Korea Electrotechnology Research Institute, Changwon (Korea, Republic of)

    2010-10-15

    In this study, multilayer piezo stack transformers for switching mode power supply (SMPS) application were manufactured using 0.01Pb(Ni{sub 1/3}Nb{sub 2/3})O{sub 3} - 0.08Pb(Mn{sub 1/3}Nb{sub 2/3})O{sub 3} - 0.91Pb(Zr{sub 0.505}Ti{sub 0.495})O{sub 3} (PNN-PMN-PZT) ceramics. The voltage ratio of a multilayer piezo stack transformer showed a maximum at the resonance frequency of the input and then increased with increasing load resistance. The efficiency of the multilayer piezo stack transformer showed its highest value at around the matching load. The output power increased with increasing input voltage. The temperature of the multilayer piezo stack transformer increased with increasing output power and load resistance. The manufactured multilayer piezo stack transformer could be used up to 5 W at a resonance frequency of 70.25 kHz for SMPS application because the temperature rise from room temperature is believed to about 20 .deg. C and because the transformer is electrically stable. The newly-developed ring-dot-type step-down multilayer piezo stack transformer shows possible applications as SMPS for electronic power sources with excellent input-to-output properties.

  6. One step gold (bio)functionalisation based on CS{sub 2}-amine reaction

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Ines [Centro de Quimica e Bioquimica, Faculdade de Ciencias da Universidade de Lisboa, Ed. C8, Campo Grande, 1749-016 Lisboa (Portugal); Cascalheira, Antonio C. [Lumisense, Lda, Campus Faculdade de Ciencias da Universidade de Lisboa, Ed. ICAT, Campo Grande, 1749-016 Lisboa (Portugal); Viana, Ana S., E-mail: anaviana@fc.ul.p [Centro de Quimica e Bioquimica, Faculdade de Ciencias da Universidade de Lisboa, Ed. C8, Campo Grande, 1749-016 Lisboa (Portugal)

    2010-12-01

    Dithiocarbamates have been regarded as alternative anchor groups to thiols on gold surfaces, and claimed to be formed in situ through the reaction between secondary amines and carbon disulphide. In this paper, we further exploit this methodology for a convenient one step biomolecule immobilisation onto gold surfaces. First, the reactivity between CS{sub 2} and electroactive compounds containing amines, primary (dopamine), secondary (epinephrine), and an amino acid (tryptophan) has been investigated by electrochemical methods. Cyclic voltammetric characterisation of the modified electrodes confirmed the immobilisation of all the target compounds, allowing the estimation of their surface concentration. The best result was obtained with epinephrine, a secondary amine, for which a typical quasi-reversible behaviour of surface confined electroactive species could be clearly depicted. Electrochemical reductive desorption studies enabled to infer on the extent of the reaction and on the relative stability of the generated monolayers. Bio-functionalisation studies have been accomplished through the reaction of CS{sub 2} with glucose oxidase in aqueous medium, and the catalytic activity of the immobilised enzyme was evaluated towards glucose, by electrochemical methods in the presence of a redox mediator. Scanning tunnelling microscopy (STM) and Atomic force microscopy (AFM) were used respectively, to characterize the gold electrodes and Glucose Oxidase coverage and distribution on the modified surfaces.

  7. Managing chronic pathologies with a stepped mHealth-based approach in clinical psychology and medicine

    Directory of Open Access Journals (Sweden)

    Gianluca eCastelnuovo

    2015-04-01

    Full Text Available Chronic diseases and conditions typically require long-term monitoring and treatment protocols both in traditional settings and in out-patient frameworks. The economic burden of chronic conditions is a key challenge and new and mobile technologies could offer good solutions. mHealth could be considered an evolution of ehealth and could be defined as the practice of medicine and public health supported by mobile communication devices. mHealth approach could overcome limitations linked with the traditional, restricted and highly expensive in-patient treatment of many chronic pathologies. Possible applications include stepped mHealth approach, where patients can be monitored and treated in their everyday contexts. Unfortunately, many barriers for the spread of mHealth are still present. Due the significant impact of psychosocial factors on disease evolution, psychotherapies have to be included into the chronic disease protocols. Existing psychological theories of health behavior change have to be adapted to the new technological contexts and requirements. In conclusion, clinical psychology and medicine have to face the chronic care management challenge in both traditional and mHealth settings.

  8. Do not Lose Your Students in Large Lectures: A Five-Step Paper-Based Model to Foster Students’ Participation

    Directory of Open Access Journals (Sweden)

    Mona Hassan Aburahma

    2015-07-01

    Full Text Available Like most of the pharmacy colleges in developing countries with high population growth, public pharmacy colleges in Egypt are experiencing a significant increase in students’ enrollment annually due to the large youth population, accompanied with the keenness of students to join pharmacy colleges as a step to a better future career. In this context, large lectures represent a popular approach for teaching the students as economic and logistic constraints prevent splitting them into smaller groups. Nevertheless, the impact of large lectures in relation to student learning has been widely questioned due to their educational limitations, which are related to the passive role the students maintain in lectures. Despite the reported feebleness underlying large lectures and lecturing in general, large lectures will likely continue to be taught in the same format in these countries. Accordingly, to soften the negative impacts of large lectures, this article describes a simple and feasible 5-step paper-based model to transform lectures from a passive information delivery space into an active learning environment. This model mainly suits educational establishments with financial constraints, nevertheless, it can be applied in lectures presented in any educational environment to improve active participation of students. The components and the expected advantages of employing the 5-step paper-based model in large lectures as well as its limitations and ways to overcome them are presented briefly. The impact of applying this model on students’ engagement and learning is currently being investigated.

  9. Do not Lose Your Students in Large Lectures: A Five-Step Paper-Based Model to Foster Students’ Participation

    Science.gov (United States)

    Aburahma, Mona Hassan

    2015-01-01

    Like most of the pharmacy colleges in developing countries with high population growth, public pharmacy colleges in Egypt are experiencing a significant increase in students’ enrollment annually due to the large youth population, accompanied with the keenness of students to join pharmacy colleges as a step to a better future career. In this context, large lectures represent a popular approach for teaching the students as economic and logistic constraints prevent splitting them into smaller groups. Nevertheless, the impact of large lectures in relation to student learning has been widely questioned due to their educational limitations, which are related to the passive role the students maintain in lectures. Despite the reported feebleness underlying large lectures and lecturing in general, large lectures will likely continue to be taught in the same format in these countries. Accordingly, to soften the negative impacts of large lectures, this article describes a simple and feasible 5-step paper-based model to transform lectures from a passive information delivery space into an active learning environment. This model mainly suits educational establishments with financial constraints, nevertheless, it can be applied in lectures presented in any educational environment to improve active participation of students. The components and the expected advantages of employing the 5-step paper-based model in large lectures as well as its limitations and ways to overcome them are presented briefly. The impact of applying this model on students’ engagement and learning is currently being investigated. PMID:28975906

  10. Do not Lose Your Students in Large Lectures: A Five-Step Paper-Based Model to Foster Students' Participation.

    Science.gov (United States)

    Aburahma, Mona Hassan

    2015-07-27

    Like most of the pharmacy colleges in developing countries with high population growth, public pharmacy colleges in Egypt are experiencing a significant increase in students' enrollment annually due to the large youth population, accompanied with the keenness of students to join pharmacy colleges as a step to a better future career. In this context, large lectures represent a popular approach for teaching the students as economic and logistic constraints prevent splitting them into smaller groups. Nevertheless, the impact of large lectures in relation to student learning has been widely questioned due to their educational limitations, which are related to the passive role the students maintain in lectures. Despite the reported feebleness underlying large lectures and lecturing in general, large lectures will likely continue to be taught in the same format in these countries. Accordingly, to soften the negative impacts of large lectures, this article describes a simple and feasible 5-step paper-based model to transform lectures from a passive information delivery space into an active learning environment. This model mainly suits educational establishments with financial constraints, nevertheless, it can be applied in lectures presented in any educational environment to improve active participation of students. The components and the expected advantages of employing the 5-step paper-based model in large lectures as well as its limitations and ways to overcome them are presented briefly. The impact of applying this model on students' engagement and learning is currently being investigated.

  11. Developing School Heads as Instructional Leaders in School-Based Assessment: Challenges and Next Steps

    Science.gov (United States)

    Lingam, Govinda Ishwar; Lingam, Narsamma

    2016-01-01

    The study explored challenges faced by school leaders in the Pacific nation of Solomon Islands in school-based assessment, and the adequacy of an assessment course to prepare them. A questionnaire including both open and closed-ended questions elicited relevant data from the school leaders. Modelling best practices in school-based assessment was…

  12. Adaptive back-stepping pitch angle control for wind turbine based on a new electro-hydraulic pitch system

    Science.gov (United States)

    Yin, Xiu-xing; Lin, Yong-gang; Li, Wei; Gu, Ya-jing; Lei, Peng-fei; Liu, Hong-wei

    2015-11-01

    A new electro-hydraulic pitch system is proposed to smooth the output power and drive-train torque fluctuations for wind turbine. This new pitch system employs a servo-valve-controlled hydraulic motor to enhance pitch control performances. This pitch system is represented by a state-space model with parametric uncertainties and nonlinearities. An adaptive back-stepping pitch angle controller is synthesised based on this state-space model to accurately achieve the desired pitch angle control regardless of such uncertainties and nonlinearities. This pitch angle controller includes a back-stepping procedure and an adaption law to deal with such uncertainties and nonlinearities and hence to improve the final pitch control performances. The proposed pitch system and the designed pitch angle controller have been validated for achievable and efficient power and torque regulation performances by comparative experimental results under various operating conditions.

  13. Design and Development of a Two-Color Emissive FRET Pair Based on a Photostable Fluorescent Deoxyuridine Donor Presenting a Mega-Stokes Shift.

    Science.gov (United States)

    Barthes, Nicolas P F; Gavvala, Krishna; Bonhomme, Dominique; Dabert-Gay, Anne Sophie; Debayle, Delphine; Mély, Yves; Michel, Benoît Y; Burger, Alain

    2016-11-18

    We report the synthesis and site-specific incorporation in oligodeoxynucleotides (ODNs) of an emissive deoxyuridine analog electronically conjugated on its C5-position with a 3-methoxychromone moiety acting as a fluorophore. When incorporated in ODNs, this fluorescent deoxyuridine analog exhibits remarkable photostability and good quantum yields. This deoxyuridine analog also displays a mega-Stokes shift, which allows for its use as an efficient donor for FRET-based studies when paired with the yellow emissive indocarbocyanine Cy3 acceptor.

  14. On the role of the cis Hoogsteen:sugar-edge family of base pairs in platforms and triplets-quantum chemical insights into RNA structural biology

    Czech Academy of Sciences Publication Activity Database

    Sharma, P.; Šponer, Judit E.; Šponer, Jiří; Sharma, S.; Bhattacharyya, D.; Mitra, A.

    2010-01-01

    Roč. 114, č. 9 (2010), s. 3307-3320 ISSN 1520-6106 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairs * cis Hoogsteen/Sugar edge Subject RIV: BO - Biophysics Impact factor: 3.603, year: 2010

  15. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  16. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  17. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations

    Science.gov (United States)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.

    2018-02-01

    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  18. Evidence of weak pair coupling in the penetration depth of bi-based high-Tc superconductors

    International Nuclear Information System (INIS)

    Thompson, J.R.; Sun, Yang Ren; Ossandon, J.G.; Christen, D.K.; Chakoumakos, B.C.; Sales, B.C.; Kerchner, H.R.; Sonder, E.

    1990-01-01

    The magnetic penetration depth λ(T) has been investigated in Bi(Pb)SrCaCuO high-T c compounds having 2- and 3-layers of copper-oxygen per unit cell. Studies of the magnetization in the vortex state were employed and the results were compared with weak and strong coupling calculations. The temperature dependence of λ is described well by BCS theory in the clean limit, giving evidence for weak pair coupling in this family of materials. For the short component of the λ tensor, we obtain values of 292 and 220 nm (T = 0) for Bi-2212 and (BiPb)-2223, respectively

  19. The Effect of Think-Pair-Share-Write Based on Hybrid Learning on Metakognitive Skills, Creative Thinking and Cognitive Learning at SMA Negeri 3 Malang

    Directory of Open Access Journals (Sweden)

    Ika Yulianti Siregar

    2017-07-01

    Full Text Available The results of biology learning observation show that there are many constraints during the learning process in the class and consultation meeting between teacher and students. The think-pair-share-write based on hybrid learning was conducted to analyze the effect on metacognitive skills, creative thinking and learning outcomes. The research design was quasi experiment with pretest-posttest non-equivalent control group design. The independent variable is think-pair-share-write based on Hybrid learning model, while the dependent variables are metacognitive skills, creative thinking, and cognitive learning outcomes. Metacognitive skills are measured by using metacognitive rubrics. Creative thinking skills and cognitive learning outcomes are measured by using a description test. The data were taken by conducting pretest and posttest. The hypothesis test used was anakova with level of significance 0,05 (P <0,05, as the test result was significant then the test was continued to LSD. Before the anakova test, normality and homogeneity test were performed. The results showed that think-pair-share-write based on Hybrid Learning significantly affecting: 1 the metacognitive skills with F arithmetic of 183,472 and Sig. 0,000; 2 the creative thinking skill with F value of 325,111 and Sig. 0,000; 3 the cognitive learning outcomes with F arithmetic of 175.068 and Sig. 0,000.

  20. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)

    2016-09-15

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  1. A tilt-pair based method for assigning the projection directions of randomly oriented single-particle molecules.

    Science.gov (United States)

    Ueno, Yutaka; Mine, Shouhei; Kawasaki, Kazunori

    2015-04-01

    In this article, we describe an improved method to assign the projection angle for averaged images using tilt-pair images for three-dimensional reconstructions from randomly oriented single-particle molecular images. Our study addressed the so-called 'initial volume problem' in the single-particle reconstruction, which involves estimation of projection angles of the particle images. The projected images of the particles in different tilt observations were mixed and averaged for the characteristic views. After the ranking of these group average images in terms of reliable tilt angle information, mutual tilt angles between images are assigned from the constituent tilt-pair information. Then, multiples of the conical tilt series are made and merged to construct a network graph of the particle images in terms of projection angles, which are optimized for the three-dimensional reconstruction. We developed the method with images of a synthetic object and applied it to a single-particle image data set of the purified deacetylase from archaea. With the introduction of low-angle tilt observations to minimize unfavorable imaging conditions due to tilting, the results demonstrated reasonable reconstruction models without imposing symmetry to the structure. This method also guides its users to discriminate particle images of different conformational state of the molecule. © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    International Nuclear Information System (INIS)

    Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian

    2016-01-01

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers

  3. Multi-step dimensionality reduction and semi-supervised graph-based tumor classification using gene expression data.

    Science.gov (United States)

    Gui, Jie; Wang, Shu-Lin; Lei, Ying-Ke

    2010-11-01

    Both supervised methods and unsupervised methods have been widely used to solve the tumor classification problem based on gene expression profiles. This paper introduces a semi-supervised graph-based method for tumor classification. Feature extraction plays a key role in tumor classification based on gene expression profiles, and can greatly improve the performance of a classifier. In this paper we propose a novel multi-step dimensionality reduction method for extracting tumor-related features. First the Wilcoxon rank-sum test is used for gene selection. Then gene ranking and discrete cosine transform are combined with principal component analysis for feature extraction. Finally, the performance is evaluated by semi-supervised learning algorithms. To show the validity of the proposed method, we apply it to classify four tumor datasets involving various human normal and tumor tissue samples. The experimental results show that the proposed method is efficient and feasible. Compared with other methods, our method can achieve relatively higher prediction accuracy. Particularly, it is found that semi-supervised method is superior to support vector machines in classification performance. The proposed approach can effectively improve the performance of tumor classification based on gene expression profiles. This work is a meaningful attempt to explore and apply multi-step dimensionality reduction and semi-supervised learning methods in the field of tumor classification. Considering the high classification accuracy, there should be much room for the application of multi-step dimensionality reduction and semi-supervised learning methods to perform tumor classification. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. A proposed adaptive step size perturbation and observation maximum power point tracking algorithm based on photovoltaic system modeling

    Science.gov (United States)

    Huang, Yu

    Solar energy becomes one of the major alternative renewable energy options for its huge abundance and accessibility. Due to the intermittent nature, the high demand of Maximum Power Point Tracking (MPPT) techniques exists when a Photovoltaic (PV) system is used to extract energy from the sunlight. This thesis proposed an advanced Perturbation and Observation (P&O) algorithm aiming for relatively practical circumstances. Firstly, a practical PV system model is studied with determining the series and shunt resistances which are neglected in some research. Moreover, in this proposed algorithm, the duty ratio of a boost DC-DC converter is the object of the perturbation deploying input impedance conversion to achieve working voltage adjustment. Based on the control strategy, the adaptive duty ratio step size P&O algorithm is proposed with major modifications made for sharp insolation change as well as low insolation scenarios. Matlab/Simulink simulation for PV model, boost converter control strategy and various MPPT process is conducted step by step. The proposed adaptive P&O algorithm is validated by the simulation results and detail analysis of sharp insolation changes, low insolation condition and continuous insolation variation.

  6. A stepwise model for simulation-based curriculum development for clinical skills, a modification of the six-step approach.

    Science.gov (United States)

    Khamis, Nehal N; Satava, Richard M; Alnassar, Sami A; Kern, David E

    2016-01-01

    Despite the rapid growth in the use of simulation in health professions education, courses vary considerably in quality. Many do not integrate efficiently into an overall school/program curriculum or conform to academic accreditation requirements. Moreover, some of the guidelines for simulation design are specialty specific. We designed a model that integrates best practices for effective simulation-based training and a modification of Kern et al.'s 6-step approach for curriculum development. We invited international simulation and health professions education experts to complete a questionnaire evaluating the model. We reviewed comments and suggested modifications from respondents and reached consensus on a revised version of the model. We recruited 17 simulation and education experts. They expressed a consensus on the seven proposed curricular steps: problem identification and general needs assessment, targeted needs assessment, goals and objectives, educational strategies, individual assessment/feedback, program evaluation, and implementation. We received several suggestions for descriptors that applied the steps to simulation, leading to some revisions in the model. We have developed a model that integrates principles of curriculum development and simulation design that is applicable across specialties. Its use could lead to high-quality simulation courses that integrate efficiently into an overall curriculum.

  7. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning.

    Science.gov (United States)

    Koh, Jansen; Dubrowski, Adam

    2016-06-19

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician's lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning.

  8. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

    Science.gov (United States)

    Koh, Jansen

    2016-01-01

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  9. Knowledge Based Artificial Augmentation Intelligence Technology: Next Step in Academic Instructional Tools for Distance Learning

    Science.gov (United States)

    Crowe, Dale; LaPierre, Martin; Kebritchi, Mansureh

    2017-01-01

    With augmented intelligence/knowledge based system (KBS) it is now possible to develop distance learning applications to support both curriculum and administrative tasks. Instructional designers and information technology (IT) professionals are now moving from the programmable systems era that started in the 1950s to the cognitive computing era.…

  10. KRAS mutation screening by chip-based DNA hybridization--a further step towards personalized oncology.

    Science.gov (United States)

    Steinbach, Christine; Steinbrücker, Carolin; Pollok, Sibyll; Walther, Katharina; Clement, Joachim H; Chen, Yuan; Petersen, Iver; Cialla-May, Dana; Weber, Karina; Popp, Jürgen

    2015-04-21

    The use of predictive biomarkers can help to improve therapeutic options for the individual cancer patient. For the treatment of colon cancer patients with anti-EGFR-based drugs, the KRAS mutation status has to be determined to pre-select responders that will benefit from this medication. Amongst others, array-based tests have been established for profiling of the KRAS mutation status. Within this article we describe an on-chip hybridization technique to screen therapeutic relevant KRAS codon 12 mutations. The DNA chip-based platform enables the reliable discrimination of selected mutations by allele-specific hybridization. Here, silver deposits represent robust endpoint signals that allow for a simple naked eye rating. With the here presented assay concept a precise identification of heterozygous and homozygous KRAS mutations, even against a background of up to 95% wild-type DNA, was realizable. The applicability of the test was successfully proven for various cancer cell lines as well as clinical tumour samples. Thus, the chip-based DNA hybridization technique seems to be a promising tool for KRAS mutation analysis to further improve personalized cancer treatment.

  11. The PICO Game: An Innovative Strategy for Teaching Step 1 in Evidence-Based Practice.

    Science.gov (United States)

    Milner, Kerry A; Cosme, Sheryl

    2017-12-01

    This column shares the best evidence-based strategies and innovative ideas on how to facilitate the learning and implementation of EBP principles and processes by clinicians as well as nursing and interprofessional students. Guidelines for submission are available at https://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1741-6787. © 2017 Sigma Theta Tau International.

  12. Identification of Mine-Shaped Objects based on an Efficient Phase Stepped-Frequency Radar Approach

    DEFF Research Database (Denmark)

    Sørensen, Helge Bjarup Dissing; Jakobsen, Kaj Bjarne; Nymann, Ole

    1997-01-01

    a radar probe is moved automatically to measure in each grid point a set of reflection coefficients from which phase and amplitude information are extracted. Based on a simple processing of the phase information, quarternary image and template cross-correlation a successful detection of metal- and non-metal...

  13. Evidence-Based Treatments for Borderline Personality Disorder: Implementation, Integration, and Stepped Care.

    Science.gov (United States)

    Choi-Kain, Lois W; Albert, Elizabeth B; Gunderson, John G

    2016-01-01

    After participating in this activity, learners should be better able to:• Evaluate evidence-based therapies for borderline personality disorder Several manualized psychotherapies for treating borderline personality disorder (BPD) have been validated in randomized, controlled trials. Most of these approaches are highly specialized, offering different formulation of BPD and different mechanisms by which recovery is made possible. Mental health clinicians are challenged by the degree of specialization and clinical resources that these approaches require in their empirically validated adherent forms. While these effective treatments have renewed optimism for the treatment of BPD, clinicians may feel limited in their ability to offer any of them or may integrate an eclectic assortment of features from the different treatments. This article will evaluate four major evidence-based treatments for BPD-dialectical behavioral therapy, mentalization-based treatment, transference-focused psychotherapy, and General Psychiatric Management-and possible modes of implementation in adherent and integrative forms. Models of implementing these diverse treatment approaches will be evaluated, and the potential advantages of combining evidence-based treatments will be discussed, along with some cautionary notes. A proposal for providing stepwise care through assessment of clinical severity will be presented as a means of achieving system-wide changes and greater access to care.

  14. Steps that count! A feasibility study of a pedometer-based ...

    African Journals Online (AJOL)

    JD Pillay, TL Kolbe-Alexander, KI Proper, W van Mechelen, EV Lambert ... To examine the feasibility of a 10-week pedometer-based intervention complemented by regular motivational messages, to increase ambulatory PA; and to determine the minimum sample size required for a randomised, controlled trial (RCT).

  15. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  16. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    Science.gov (United States)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  17. Success rate evaluation of clinical governance implementation in teaching hospitals in Kerman (Iran) based on nine steps of Karsh's model.

    Science.gov (United States)

    Vali, Leila; Mastaneh, Zahra; Mouseli, Ali; Kardanmoghadam, Vida; Kamali, Sodabeh

    2017-07-01

    One of the ways to improve the quality of services in the health system is through clinical governance. This method aims to create a framework for clinical services providers to be accountable in return for continuing improvement of quality and maintaining standards of services. To evaluate the success rate of clinical governance implementation in Kerman teaching hospitals based on 9 steps of Karsh's Model. This cross-sectional study was conducted in 2015 on 94 people including chief executive officers (CEOs), nursing managers, clinical governance managers and experts, head nurses and nurses. The required data were collected through a researcher-made questionnaire containing 38 questions with three-point Likert Scale (good, moderate, and weak). The Karsh's Model consists of nine steps including top management commitment to change, accountability for change, creating a structured approach for change, training, pilot implementation, communication, feedback, simulation, and end-user participation. Data analysis using descriptive statistics and Mann-Whitney-Wilcoxon test was done by SPSS software version 16. About 81.9 % of respondents were female and 74.5 have a Bachelor of Nursing (BN) degree. In general, the status of clinical governance implementation in studied hospitals based on 9 steps of the model was 44 % (moderate). A significant relationship was observed among accountability and organizational position (p=0.0012) and field of study (p=0.000). Also, there were significant relationships between structure-based approach and organizational position (p=0.007), communication and demographic characteristics (p=0.000), and end-user participation with organizational position (p=0.03). Clinical governance should be implemented by correct needs assessment and participation of all stakeholders, to ensure its enforcement in practice, and to enhance the quality of services.

  18. DNA Bipedal Motor Achieves a Large Number of Steps Due to Operation Using Microfluidics-Based Interface.

    Science.gov (United States)

    Tomov, Toma E; Tsukanov, Roman; Glick, Yair; Berger, Yaron; Liber, Miran; Avrahami, Dorit; Gerber, Doron; Nir, Eyal

    2017-04-25

    Realization of bioinspired molecular machines that can perform many and diverse operations in response to external chemical commands is a major goal in nanotechnology, but current molecular machines respond to only a few sequential commands. Lack of effective methods for introduction and removal of command compounds and low efficiencies of the reactions involved are major reasons for the limited performance. We introduce here a user interface based on a microfluidics device and single-molecule fluorescence spectroscopy that allows efficient introduction and removal of chemical commands and enables detailed study of the reaction mechanisms involved in the operation of synthetic molecular machines. The microfluidics provided 64 consecutive DNA strand commands to a DNA-based motor system immobilized inside the microfluidics, driving a bipedal walker to perform 32 steps on a DNA origami track. The microfluidics enabled removal of redundant strands, resulting in a 6-fold increase in processivity relative to an identical motor operated without strand removal and significantly more operations than previously reported for user-controlled DNA nanomachines. In the motor operated without strand removal, redundant strands interfere with motor operation and reduce its performance. The microfluidics also enabled computer control of motor direction and speed. Furthermore, analysis of the reaction kinetics and motor performance in the absence of redundant strands, made possible by the microfluidics, enabled accurate modeling of the walker processivity. This enabled identification of dynamic boundaries and provided an explanation, based on the "trap state" mechanism, for why the motor did not perform an even larger number of steps. This understanding is very important for the development of future motors with significantly improved performance. Our universal interface enables two-way communication between user and molecular machine and, relying on concepts similar to that of solid

  19. First Steps towards Evidence-Based Preventive Home Visits: Experiences Gathered in a Swedish Municipality

    Directory of Open Access Journals (Sweden)

    Charlotte Löfqvist

    2012-01-01

    Full Text Available The purpose of preventive home visits is to promote overall health and wellbeing in old age. The aim of this paper was to describe the process of the development of evidence-based preventive home visits, targeting independent community-living older persons. The evidence base was generated from published studies and practical experiences. The results demonstrate that preventive home visits should be directed to persons 80 years old and older and involve various professional competences. The visits should be personalized, lead to concrete interventions, and be followed up. The health areas assessed should derive from a broad perspective and include social, psychological, and medical aspects. Core components in the protocol developed in this study captured physical, medical, psychosocial, and environmental aspects. Results of a pilot study showed that the protocol validly identified health risks among older people with different levels of ADL dependence.

  20. Supramolecular hydrogel capsules based on PEG: a step toward degradable biomaterials with rational design.

    Science.gov (United States)

    Rossow, Torsten; Bayer, Sebastian; Albrecht, Ralf; Tzschucke, C Christoph; Seiffert, Sebastian

    2013-09-01

    Supramolecular microgel capsules based on polyethylene glycol (PEG) are a promising class of soft particulate scaffolds with tailored properties. An approach to fabricate such particles with exquisite control by droplet-based microfluidics is presented. Linear PEG precursor polymers that carry bipyridine moieties on both chain termini are gelled by complexation to iron(II) ions. To investigate the biocompatibility of the microgels, living mammalian cells are encapsulated within them. The microgel elasticity is controlled by using PEG precursors of different molecular weights at different concentrations and the influence of these parameters on the cell viabilities, which can be optimized to exceed 90% is studied. Reversion of the supramolecular polymer cross-linking allows the microcapsules to be degraded at mild conditions with no effect on the viability of the encapsulated and released cells. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Present and next steps of the JAERI superconducting rf linac based FEL program

    International Nuclear Information System (INIS)

    Minehara, E.J.; Yamauchi, T.; Sugimoto, M.

    2000-01-01

    The JAERI superconducting rf linac based FEL has successfully been lased to produce a 0.3 kW FEL light and 100 kW or larger electron beam output in quasi continuous wave operation in 1999. The 1 kW class output as our present program goal will be achieved to improve the optical out coupling method in the FEL optical resonator, the electron gun, and the electron beam optics in the JAERI FEL driver. As our next 5 year program goal is the 100 kW class FEL light and a few tens MW class electron beam output in average, quasi continuous wave operation of the light and electron beam will be planned in the JAERI superconducting rf linac based FEL facility. Conceptual design options needed for such a very high power operation and shorter wavelength light sources will be discussed to improve and to upgrade the exciting facility. (author)

  2. A Two Dimensional Overlapped Subaperture Polar Format Algorithm Based on Stepped-chirp Signal.

    Science.gov (United States)

    Mao, Xinhua; Zhu, Daiyin; Nie, Xin; Zhu, Zhaoda

    2008-05-26

    In this work, a 2-D subaperture polar format algorithm (PFA) based on steppedchirp signal is proposed. Instead of traditional pulse synthesis preprocessing, the presented method integrates the pulse synthesis process into the range subaperture processing. Meanwhile, due to the multi-resolution property of subaperture processing, this algorithm is able to compensate the space-variant phase error caused by the radar motion during the period of a pulse cluster. Point target simulation has validated the presented algorithm.

  3. A Two Dimensional Overlapped Subaperture Polar Format Algorithm Based on Stepped-chirp Signal

    Directory of Open Access Journals (Sweden)

    Zhaoda Zhu

    2008-05-01

    Full Text Available In this work, a 2-D subaperture polar format algorithm (PFA based on steppedchirp signal is proposed. Instead of traditional pulse synthesis preprocessing, the presented method integrates the pulse synthesis process into the range subaperture processing. Meanwhile, due to the multi-resolution property of subaperture processing, this algorithm is able to compensate the space-variant phase error caused by the radar motion during the period of a pulse cluster. Point target simulation has validated the presented algorithm.

  4. Single step hydrothermal based synthesis of M(II)Sb2O6 (M = Cd ...

    Indian Academy of Sciences (India)

    1987) and CoSb2O6 (Reimers and Greedan 1989) could be prepared at temperatures 1273, 1173 and 1323 K, respec- tively. Herein, we detail the results of our investigation based on hydrothermal reaction of the ilmenite NaSbO3 with the divalent metal salt solutions for the successful synthesis of. CdSb2O6 and ZnSb2O6.

  5. Initial steps of the base excision repair pathway within the nuclear architecture

    International Nuclear Information System (INIS)

    Amouroux, R.

    2009-09-01

    Oxidative stress induced lesions threaten aerobic organisms by representing a major cause of genomic instability. A common product of guanine oxidation, 8-oxo-guanine (8- oxoG) is particularly mutagenic by provoking G to T transversions. Removal of oxidised bases from DNA is initiated by the recognition and excision of the damaged base by a DNA glycosylase, initiating the base excision repair (BER) pathway. In mammals, 8-oxoG is processed by the 8-oxoG-DNA-glycosylase I (OGG1), which biochemical mechanisms has been well characterised in vitro. However how and where this enzyme finds the modified base within the complex chromatin architecture is not yet understood. We show that upon induction of 8-oxoG, OGG1, together with at least two other proteins involved in BER, is recruited from a soluble fraction to chromatin. Formation kinetics of this patches correlates with 8-oxoG excision, suggesting a direct link between presence of this chromatin-associated complexes and 8-oxoG repair. More precisely, these repair patches are specifically directed to euchromatin regions, and completely excluded from heterochromatin regions. Inducing of artificial chromatin compaction results in a complete inhibition of the in vivo repair of 8-oxoG, probably by impeding the access of OGG1 to the lesion. Using OGG1 mutants, we show that OGG1 direct recognition of 8-oxoG did not trigger its re-localisation to the chromatin. We conclude that in response to the induction of oxidative DNA damage, the DNA glycosylase is actively recruited to regions of open chromatin allowing the access of the BER machinery to the lesions. (author)

  6. A One-Step-Ahead Smoothing-Based Joint Ensemble Kalman Filter for State-Parameter Estimation of Hydrological Models

    KAUST Repository

    El Gharamti, Mohamad

    2015-11-26

    The ensemble Kalman filter (EnKF) recursively integrates field data into simulation models to obtain a better characterization of the model’s state and parameters. These are generally estimated following a state-parameters joint augmentation strategy. In this study, we introduce a new smoothing-based joint EnKF scheme, in which we introduce a one-step-ahead smoothing of the state before updating the parameters. Numerical experiments are performed with a two-dimensional synthetic subsurface contaminant transport model. The improved performance of the proposed joint EnKF scheme compared to the standard joint EnKF compensates for the modest increase in the computational cost.

  7. Biocatalytic conversion of methane to methanol as a key step for development of methane-based biorefineries.

    Science.gov (United States)

    Hwang, In Yeub; Lee, Seung Hwan; Choi, Yoo Seong; Park, Si Jae; Na, Jeong Geol; Chang, In Seop; Kim, Choongik; Kim, Hyun Cheol; Kim, Yong Hwan; Lee, Jin Won; Lee, Eun Yeol

    2014-12-28

    Methane is considered as a next-generation carbon feedstock owing to the vast reserves of natural and shale gas. Methane can be converted to methanol by various methods, which in turn can be used as a starting chemical for the production of value-added chemicals using existing chemical conversion processes. Methane monooxygenase is the key enzyme that catalyzes the addition of oxygen to methane. Methanotrophic bacteria can transform methane to methanol by inhibiting methanol dehydrogenase. In this paper, we review the recent progress made on the biocatalytic conversion of methane to methanol as a key step for methane-based refinery systems and discuss future prospects for this technology.

  8. [Mechanism of treatment effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats based on metabolomic approach].

    Science.gov (United States)

    Cao, Hui-Ting; Zhu, Hua-Xu; Zhang, Qi-Chun; Guo, Li-Wei

    2017-06-01

    The metabolic effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats was studied by using metabolomic method. The rat model of ischemia reperfusion injury induced by introduction of transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Ultra high performance liquid chromatography-series four pole time of flight mass spectrometry method(UPLC-Q-TOF/MS), Markerlynx software, and principal component analysis and partial least-squares discriminant analysis were used to analyze the different endogenous metabolites among the urine samples of sham rats, cerebral ischemia model rats, Huanglian groups (HL), Huangqin groups (HQ) and Huanglian-Huangqin herb pairs groups (LQ) was achieved, combined with accurate information about the endogenous metabolites level and secondary fragment ions, retrieval and identification of possible biological markers, metabolic pathway which build in MetPA database. The 20 potential biomarkers were found in the urine of rats with cerebral ischemia, which mainly involved in the neurotransmitter regulation, amino acid metabolism, energy metabolism, lipid metabolism and so on. Those metabolic pathways were disturbed in cerebral ischemia model rats, the principal component analysis showed that the normal and cerebral ischemia model is clearly distinguished, and the compound can be given to the normal state of change after HL, HQ, LQ administration. This study index the interpretation of cerebral ischemia rat metabolism group and mechanism, the embodiment of metabonomics can reflect the physiological and metabolic state, which can better reflect the traditional Chinese medicine as a whole view, system view and the features of multi ingredient synergistic or antagonistic effects. Copyright© by the Chinese Pharmaceutical Association.

  9. A commuter-based two-step floating catchment area method for measuring spatial accessibility of daycare centers.

    Science.gov (United States)

    Fransen, Koos; Neutens, Tijs; De Maeyer, Philippe; Deruyter, Greet

    2015-03-01

    This paper puts forward a commuter-based version of the two-step floating catchment area (2SFCA) method, which has gained acceptance in studies on spatial health care accessibility. Current implementations of the 2SFCA method are static in that they consider centroid-based night-time representations of the population. The proposed enhancement to the 2SFCA approach addresses this limitation by accounting for trip-chaining behavior. The presented method is illustrated in a case study of accessibility of daycare centers in the province East Flanders in Belgium. The results show significant spatial differences in accessibility between the original and commuter-based version of the 2SFCA (CB2SFCA). They highlight the importance of giving heed to more complex travel behavior in cases where the need for detailed accessibility calculations is apparent. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Architecture based on the integration of intermolecular G-quadruplex structure with sticky-end pairing and colorimetric detection of DNA hybridization.

    Science.gov (United States)

    Li, Hongbo; Wu, Zai-Sheng; Shen, Zhifa; Shen, Guoli; Yu, Ruqin

    2014-02-21

    An interesting discovery is reported in that G-rich hairpin-based recognition probes can self-assemble into a nano-architecture based on the integration of an intermolecular G-quadruplex structure with the sticky-end pairing effect in the presence of target DNAs. Moreover, GNPs modified with partly complementary DNAs can intensively aggregate by hybridization-based intercalation between intermolecular G-quadruplexes, indicating an inspiring assembly mechanism and a powerful colorimetric DNA detection. The proposed intermolecular G-quadruplex-integrated sticky-end pairing assembly (called GISA)-based colorimetric system allows a specific and quantitative assay of p53 DNA with a linear range of more than two orders of magnitude and a detection limit of 0.2 nM, suggesting a considerably improved analytical performance. And more to the point, the discrimination of single-base mismatched target DNAs can be easily conducted via visual observation. The successful development of the present colorimetric system, especially the GISA-based aggregation mechanism of GNPs is different from traditional approaches, and offers a critical insight into the dependence of the GNP aggregation on the structural properties of oligonucleotides, opening a good way to design colorimetric sensing probes and DNA nanostructure.

  11. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    Science.gov (United States)

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  12. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  13. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  14. A versatile one-step CRISPR-Cas9 based approach to plasmid-curing

    DEFF Research Database (Denmark)

    Lauritsen, Ida; Porse, Andreas; Sommer, Morten Otto Alexander

    2017-01-01

    tool enabling rapid removal of plasmids from bacterial cells is lacking. Results Based on replicon abundance and sequence conservation analysis, we show that the vast majority of bacterial cloning and expression vectors share sequence similarities that allow for broad CRISPR-Cas9 targeting. We have...... widely used for expression and engineering purposes. By virtue of the CRISPR-Cas9 targeting, our platform is highly expandable and can be applied in a broad host context. We exemplify the wide applicability of our system in Gram-negative bacteria by demonstrating the successful application in both...

  15. Specification of a STEP Based Reference Model for Exchange of Robotics Models

    DEFF Research Database (Denmark)

    Haenisch, Jochen; Kroszynski, Uri; Ludwig, Arnold

    combining geometric, dynamic, process and robot specific data.The growing need for accurate information about manufacturing data (models of robots and other mechanisms) in diverse industrial applications has initiated ESPRIT Project 6457: InterRob. Besides the topics associated with standards for industrial...... of pilot processor programs are based. The processors allow for the exchange of product data models between Analysis systems (e.g. ADAMS), CAD systems (e.g. CATIA, BRAVO), Simulation and off-line programming systems (e.g. GRASP, KISMET, ROPSIM)....

  16. Achieving the Desired Transformation: Thoughts on Next Steps for Outcomes-Based Medical Education.

    Science.gov (United States)

    Holmboe, Eric S; Batalden, Paul

    2015-09-01

    Since the introduction of the outcomes-based medical education (OBME) movement, progress toward implementation has been active but challenging. Much of the angst and criticism has been directed at the approaches to assessment that are associated with outcomes-based or competency frameworks, particularly defining the outcomes. In addition, these changes to graduate medical education (GME) are concomitant with major change in health care systems--specifically, changes to increase quality and safety while reducing cost. Every sector, from medical education to health care delivery and financing, is in the midst of substantial change and disruption.The recent release of the Institute of Medicine's report on the financing and governance of GME highlights the urgent need to accelerate the transformation of medical education. One source of continued tension within the medical education community arises from the assumption that the much-needed increases in value and improvement in health care can be achieved by holding the current educational structures and architecture of learning in place while concomitantly withdrawing resources. The authors of this Perspective seek to reframe the important and necessary debate surrounding the current challenges to implementing OBME. Building on recent change and service theories (e.g., Theory U and coproduction), they propose several areas of redirection, including reexamination of curricular models and greater involvement of learners, teachers, and regulators in cocreating new training models, to help facilitate the desired transformation in medical education.

  17. Deconstructing Chronic Low Back Pain in the Older Adult: Step by Step Evidence and Expert-Based Recommendations for Evaluation and Treatment

    Science.gov (United States)

    Carley, Joseph A.; Karp, Jordan F.; Gentili, Angela; Marcum, Zachary A.; Reid, M. Carrington; Rodriguez, Eric; Rossi, Michelle I.; Shega, Joseph; Thielke, Stephen; Weiner, Debra K.

    2016-01-01

    Objective To present the fourth in a series of articles designed to deconstruct chronic low back pain (CLBP) in older adults. The series presents CLBP as a syndrome, a final common pathway for the expression of multiple contributors rather than a disease localized exclusively to the lumbosacral spine. Each article addresses one of twelve important contributors to pain and disability in older adults with CLBP. This article focuses on depression. Methods The evaluation and treatment algorithm, a table articulating the rationale for the individual algorithm components, and stepped-care drug recommendations were developed using a modified Delphi approach. The Principal Investigator, a three-member content expert panel, and a nine-member primary care panel were involved in the iterative development of these materials. The algorithm was developed keeping in mind medications and other resources available within Veterans Health Administration (VHA) facilities. As panelists were not exclusive to the VHA, the materials can be applied in both VHA and civilian settings. The illustrative clinical case was taken from one of the contributor’s clinical practice. Results We present an algorithm and supportive materials to help guide the care of older adults with depression, an important contributor to CLBP. The case illustrates an example of a complex clinical presentation in which depression was an important contributor to symptoms and disability in an older adult with CLBP. Conclusions Depression is common and should be evaluated routinely in the older adult with CLBP so that appropriately targeted treatments can be planned and implemented. PMID:26539754

  18. Deconstructing Chronic Low Back Pain in the Older Adult-Step by Step Evidence and Expert-Based Recommendations for Evaluation and Treatment. Part VI: Lumbar Spinal Stenosis.

    Science.gov (United States)

    Fritz, Julie M; Rundell, Sean D; Dougherty, Paul; Gentili, Angela; Kochersberger, Gary; Morone, Natalia E; Naga Raja, Srinivasa; Rodriguez, Eric; Rossi, Michelle I; Shega, Joseph; Sowa, Gwendolyn; Weiner, Debra K

    2016-03-01

    . To present the sixth in a series of articles designed to deconstruct chronic low back pain (CLBP) in older adults. This article focuses on the evaluation and management of lumbar spinal stenosis (LSS), the most common condition for which older adults undergo spinal surgery. . The evaluation and treatment algorithm, a table articulating the rationale for the individual algorithm components, and stepped-care drug recommendations were developed using a modified Delphi approach. The Principal Investigator, a five-member content expert panel and a nine-member primary care panel were involved in the iterative development of these materials. The illustrative clinical case was taken from the clinical practice of a contributor's colleague (SR). . We present an algorithm and supportive materials to help guide the care of older adults with LSS, a condition that occurs not uncommonly in those with CLBP. The case illustrates the importance of function-focused management and a rational approach to conservative care. . Lumbar spinal stenosis exists not uncommonly in older adults with CLBP and management often can be accomplished without surgery. Treatment should address all conditions in addition to LSS contributing to pain and disability. © 2016 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. sTarPicker: a method for efficient prediction of bacterial sRNA targets based on a two-step model for hybridization.

    Directory of Open Access Journals (Sweden)

    Xiaomin Ying

    Full Text Available BACKGROUND: Bacterial sRNAs are a class of small regulatory RNAs involved in regulation of expression of a variety of genes. Most sRNAs act in trans via base-pairing with target mRNAs, leading to repression or activation of translation or mRNA degradation. To date, more than 1,000 sRNAs have been identified. However, direct targets have been identified for only approximately 50 of these sRNAs. Computational predictions can provide candidates for target validation, thereby increasing the speed of sRNA target identification. Although several methods have been developed, target prediction for bacterial sRNAs remains challenging. RESULTS: Here, we propose a novel method for sRNA target prediction, termed sTarPicker, which was based on a two-step model for hybridization between an sRNA and an mRNA target. This method first selects stable duplexes after screening all possible duplexes between the sRNA and the potential mRNA target. Next, hybridization between the sRNA and the target is extended to span the entire binding site. Finally, quantitative predictions are produced with an ensemble classifier generated using machine-learning methods. In calculations to determine the hybridization energies of seed regions and binding regions, both thermodynamic stability and site accessibility of the sRNAs and targets were considered. Comparisons with the existing methods showed that sTarPicker performed best in both performance of target prediction and accuracy of the predicted binding sites. CONCLUSIONS: sTarPicker can predict bacterial sRNA targets with higher efficiency and determine the exact locations of the interactions with a higher accuracy than competing programs. sTarPicker is available at http://ccb.bmi.ac.cn/starpicker/.

  20. Prevalence and correlates of diabetes mellitus in Malawi: population-based national NCD STEPS survey.

    Science.gov (United States)

    Msyamboza, Kelias Phiri; Mvula, Chimwemwe J; Kathyola, Damson

    2014-05-12

    Previously considered as a disease of the affluent, west or urban people and not of public health importance, diabetes mellitus is increasingly becoming a significant cause of morbidity and mortality in sub-Saharan Africa. However, population-based data to inform prevention, treatment and control are lacking. Using the WHO STEPwise approach to chronic disease risk factor surveillance, a population-based, nationwide cross-sectional survey was conducted between July and September 2009 on participants aged 25-64 years. A multi-stage cluster sample design and weighting were used to produce a national representative data for that age range. Detailed findings on the magnitude of diabetes mellitus and impaired fasting blood glucose are presented in this paper. Fasting blood glucose measurement was conducted on 3056 participants (70.2% females, 87.9% from rural areas). The age- sex standardised population-based mean fasting blood glucose was 4.3 mmol/L (95% CI 4.1-4.4 mmol/L) with no significant differences by age, sex and location (urban/rural). The overall prevalence of impaired fasting blood glucose was 4.2% (95% CI 3.0%-5.4%). Prevalence of impaired blood glucose was higher in men than in women, 5.7% (95% CI 3.9%-7.5%) vs 2.7% (95% CI 1.6%- 3.8%), p prevalence of raised fasting blood glucose or currently on medication for diabetes was 5.6% (95% CI 2.6%- 8.5%). Although the prevalence of diabetes was higher in men than women, 6.5% (95% CI 2.6%-10.3%) vs 4.7% (95% CI 2.4%-7.0%), in rural than urban, 5.4% (95% CI 2.4%-8.4%) vs 4.4% (95% CI 2.8%-5.9%) and in males in rural than males in urban, 6.9% (95% CI 2.8%-11.0%) vs 3.2% (95% CI 0.1%-6.3%), the differences were not statistically significant, p > 0.05. Compared to previous estimates, prevalence of diabetes increased from prevalence of impaired fasting blood glucose and diabetes mellitus call for the implementation of primary healthcare approaches such as the WHO package for essential non-communicable diseases

  1. One step shift towards flexible supercapacitors based on carbon nanotubes - A review

    Energy Technology Data Exchange (ETDEWEB)

    Yar, A., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Dennis, J. O., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Mohamed, N. M., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Mumtaz, A., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Irshad, M. I., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com [Department of Fundamental and Applied Sciences, Universiti Teknologi PETRONAS (Malaysia); Ahmad, F., E-mail: ahmad-1234farooq@yahoo.com [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS (Malaysia)

    2014-10-24

    Supercapacitors have emerged as prominent energy storage devices that offer high energy density compared to conventional capacitors and high power density which is not found in batteries. Carbon nanotubes (CNTs) because of their high surface area and tremendous electrical properties are used as electrode material for supercapacitors. In this review we focused on the factors like surface area, role of the electrolyte and techniques adopted to improve performance of CNTs based supercapacitors. The supercapacitors are widely tested in liquid electrolytes which are normally hazardous in nature, toxic, flammable and their leakage has safety concerns. This review also focuses on research which is replacing these unsafe electrolytes by solid electrolytes with the combination of low cost CNTs deposited flexible supports for supercapacitors.

  2. LISA Pathfinder: An important first step towards a space-based gravitational wave observatory

    Science.gov (United States)

    Thorpe, James

    2017-08-01

    ESA's LISA Pathfinder mission was launched on Dec 3rd, 2015 and completed earlier this Summer. During this relatively short mission, Pathfinder at its two science payloads, Europe's LISA Technology Package and NASA's Disturbance Reduction System, demonstrated several techniques and technologies that enable development of a future space-based gravitational wave observatory. Most notably, Pathfinder demonstrated that the technique of drag-free flight could be utilized to place a test mass in near-perfect free-fall, with residual accelerations at the femto-g level in the milliHertz band. Additionally, technologies such as precision bonded optical structures for metrology, micropropulsion systems, and non-contact charge control, were successfully tested, retiring risk for LISA. In this talk, I will present an overview of Pathfinder's results to date and some perspective on how this success will be leveraged into realizing LISA.

  3. GNSS troposphere tomography based on two-step reconstructions using GPS observations and COSMIC profiles

    Directory of Open Access Journals (Sweden)

    P. Xia

    2013-10-01

    Full Text Available Traditionally, balloon-based radiosonde soundings are used to study the spatial distribution of atmospheric water vapour. However, this approach cannot be frequently employed due to its high cost. In contrast, GPS tomography technique can obtain water vapour in a high temporal resolution. In the tomography technique, an iterative or non-iterative reconstruction algorithm is usually utilised to overcome rank deficiency of observation equations for water vapour inversion. However, the single iterative or non-iterative reconstruction algorithm has their limitations. For instance, the iterative reconstruction algorithm requires accurate initial values of water vapour while the non-iterative reconstruction algorithm needs proper constraint conditions. To overcome these drawbacks, we present a combined iterative and non-iterative reconstruction approach for the three-dimensional (3-D water vapour inversion using GPS observations and COSMIC profiles. In this approach, the non-iterative reconstruction algorithm is first used to estimate water vapour density based on a priori water vapour information derived from COSMIC radio occultation data. The estimates are then employed as initial values in the iterative reconstruction algorithm. The largest advantage of this approach is that precise initial values of water vapour density that are essential in the iterative reconstruction algorithm can be obtained. This combined reconstruction algorithm (CRA is evaluated using 10-day GPS observations in Hong Kong and COSMIC profiles. The test results indicate that the water vapor accuracy from CRA is 16 and 14% higher than that of iterative and non-iterative reconstruction approaches, respectively. In addition, the tomography results obtained from the CRA are further validated using radiosonde data. Results indicate that water vapour densities derived from the CRA agree with radiosonde results very well at altitudes above 2.5 km. The average RMS value of their

  4. Abundance and composition of indigenous bacterial communities in a multi-step biofiltration-based drinking water treatment plant.

    Science.gov (United States)

    Lautenschlager, Karin; Hwang, Chiachi; Ling, Fangqiong; Liu, Wen-Tso; Boon, Nico; Köster, Oliver; Egli, Thomas; Hammes, Frederik

    2014-10-01

    Indigenous bacterial communities are essential for biofiltration processes in drinking water treatment systems. In this study, we examined the microbial community composition and abundance of three different biofilter types (rapid sand, granular activated carbon, and slow sand filters) and their respective effluents in a full-scale, multi-step treatment plant (Zürich, CH). Detailed analysis of organic carbon degradation underpinned biodegradation as the primary function of the biofilter biomass. The biomass was present in concentrations ranging between 2-5 × 10(15) cells/m(3) in all filters but was phylogenetically, enzymatically and metabolically diverse. Based on 16S rRNA gene-based 454 pyrosequencing analysis for microbial community composition, similar microbial taxa (predominantly Proteobacteria, Planctomycetes, Acidobacteria, Bacteriodetes, Nitrospira and Chloroflexi) were present in all biofilters and in their respective effluents, but the ratio of microbial taxa was different in each filter type. This change was also reflected in the cluster analysis, which revealed a change of 50-60% in microbial community composition between the different filter types. This study documents the direct influence of the filter biomass on the microbial community composition of the final drinking water, particularly when the water is distributed without post-disinfection. The results provide new insights on the complexity of indigenous bacteria colonizing drinking water systems, especially in different biofilters of a multi-step treatment plant. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Generation of postured voxel-based human models for the study of step voltage excited by lightning current

    Science.gov (United States)

    Gao, J.; Munteanu, I.; Müller, W. F. O.; Weiland, T.

    2011-07-01

    With the development of medical technique and computational electromagnetics, high resolution anatomic human models have already been widely developed and used in computation of electromagnetic fields induced in human body. Although these so called voxel-based human models are powerful tools for research on electromagnetic safety, their unchangeable standing posture makes it impossible to simulate a realistic scenario in which people have a lot of different postures. This paper describes a poser program package which was developed as an improved version of the free-from deformation technique to overcome this problem. It can set rotation angles of different human joints and then deform the original human model to make it have different postures. The original whole-body human model can be deformed smoothly, continuity of internal tissues and organs is maintained and the mass of different tissues and organs can be conserved in a reasonable level. As a typical application of the postured human models, this paper also studies the effect of the step voltage due to a lightning strike on the human body. Two voxel-based human body models with standing and walking posture were developed and integrated into simulation models to compute the current density distribution in the human body shocked by the step voltage. In order to speed up the transient simulation, the reduced c technique was used, leading to a speedup factor of around 20. The error introduced by the reduced c technique is discussed and simulation results are presented in detail.

  6. Marginal microleakage of class V resin-based composite restorations bonded with six one-step self-etch systems

    Directory of Open Access Journals (Sweden)

    Alfonso Sánchez-Ayala

    2013-06-01

    Full Text Available This study compared the microleakage of class V restorations bonded with various one-step self-etching adhesives. Seventy class V resin-based composite restorations were prepared on the buccal and lingual surfaces of 35 premolars, by using: Clearfil S 3 Bond, G-Bond, iBond, One Coat 7.0, OptiBond All-In-One, or Xeno IV. The Adper Single Bond etch-and-rinse two-step adhesive was employed as a control. Specimens were thermocycled for 500 cycles in separate water baths at 5°C and 55°C and loaded under 40 to 70 N for 50,000 cycles. Marginal microleakage was measured based on the penetration of a tracer agent. Although the control showed no microleakage at the enamel margins, there were no differences between groups (p = 0.06. None of the adhesives avoided microleakage at the dentin margins, and they displayed similar performances (p = 0.76. When both margins were compared, iBond® presented higher microleakage (p < 0.05 at the enamel margins (median, 1.00; Q3–Q1, 1.25–0.00 compared to the dentin margins (median, 0.00; Q3–Q1, 0.25–0.00. The study adhesives showed similar abilities to seal the margins of class V restorations, except for iBond®, which presented lower performance at the enamel margin.

  7. A Two-Step Segmentation Method for Breast Ultrasound Masses Based on Multi-resolution Analysis.

    Science.gov (United States)

    Rodrigues, Rafael; Braz, Rui; Pereira, Manuela; Moutinho, José; Pinheiro, Antonio M G

    2015-06-01

    Breast ultrasound images have several attractive properties that make them an interesting tool in breast cancer detection. However, their intrinsic high noise rate and low contrast turn mass detection and segmentation into a challenging task. In this article, a fully automated two-stage breast mass segmentation approach is proposed. In the initial stage, ultrasound images are segmented using support vector machine or discriminant analysis pixel classification with a multiresolution pixel descriptor. The features are extracted using non-linear diffusion, bandpass filtering and scale-variant mean curvature measures. A set of heuristic rules complement the initial segmentation stage, selecting the region of interest in a fully automated manner. In the second segmentation stage, refined segmentation of the area retrieved in the first stage is attempted, using two different techniques. The AdaBoost algorithm uses a descriptor based on scale-variant curvature measures and non-linear diffusion of the original image at lower scales, to improve the spatial accuracy of the ROI. Active contours use the segmentation results from the first stage as initial contours. Results for both proposed segmentation paths were promising, with normalized Dice similarity coefficients of 0.824 for AdaBoost and 0.813 for active contours. Recall rates were 79.6% for AdaBoost and 77.8% for active contours, whereas the precision rate was 89.3% for both methods. Copyright © 2015 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  8. Baby steps: The expanding financial base of local government in Ireland

    Directory of Open Access Journals (Sweden)

    Considine John

    2015-08-01

    Full Text Available There are two essential elements to this paper. In the first instance, we explore the specific details of revenue and expenditure trends for local authorities over the last decade. The analysis is framed against a longer-term political context of forty years which focuses especially on the weakness of local government in Ireland. Despite an official narrative of financial overdependence on central government, the comparative examination of budgetary records of local authorities reveals considerable diversity in both the revenue and expenditure patterns of authorities across the state. While some authorities are heavily reliant on central government funding, others have a much stronger base of local funding, and indeed the financial crisis since 2008 may have increased these differences. The second dimension to the research is an exploration of the impact of the great recession from 2008 on local government finance in Ireland. Using a framework of new institutionalism, we identify the crisis as another critical moment for local government. We consider the political, economic and administrative variables which have brought local government to a financial crossroads, and we explore the potential for long-lasting financial change in local government, as well as speculating on the nature and outcome of that change.

  9. Comparative Study of One-Step Cross-Linked Electrospun Chitosan-Based Membranes

    Directory of Open Access Journals (Sweden)

    Yanet E. Aguirre-Chagala

    2017-01-01

    Full Text Available Chitosan membranes are widely applied for tissue engineering; however, a major drawback is their low resistance in aqueous phases and therefore the structure collapses impeding their long-term use. Although there is extensive research, because of chitosan’s importance as a biomaterial, studies involving chitosan-based membranes are still needed. Herein, a detailed investigation of diverse chemical routes to cross-link fibers in situ by electrospinning process is described. In case of using genipin as cross-linker, a close relationship with the content and the mean diameter values is reported, suggesting a crucial effect over the design of nanostructures. Also, the physical resistance is enhanced for the combination of two types of methods, such as chemical and physical methods. Cross-linked fibers upon exposure to long wave ultraviolet A (UVA light change their morphology, but not their chemical composition. When they are incubated in aqueous phase for 70 days, they show an extensive improvement of their macrostructural integrity which makes them attractive candidates for tissue engineering application. As a result, the thermal properties of these materials reveal less crystallinity and higher temperature of degradation.

  10. Jump step - a community based participatory approach to physical activity & mental wellness.

    Science.gov (United States)

    Sims-Gould, Joanie; Vazirian, Sara; Li, Neville; Remick, Ronald; Khan, Karim

    2017-08-31

    There is a physical inactivity pandemic around the world despite the known benefits of engaging in physical activity. This is true for individuals who would receive notable benefits from physical activity, in particular those with mood disorders. In this study, we explored the factors that facilitate and impede engagement in physical activity for individuals with a mood disorder. The intent was to understand the key features of a community based physical activity program for these individuals. We recruited and interviewed 24 participants older than 18 with Major Depressive Disorder or Bipolar II. The interviews were conducted by peer researchers. The interviews were transcribed and analyzed using NVivo 10™. Thematic analysis was used to analyze the data. The facilitators to physical activity include being socially connected with family and friends, building a routine in daily life, and exposure to nature. The barriers to physical activity include the inability to build a routine owing to a mood disorder, and high cost. The ideal exercise program comprises a variety of light-to-moderate activities, offers the opportunity to connect with other participants with a mood disorder, and brings participants to nature. The average age of our participants was 52 which could have influenced the preferred level of intensity. The individuals in this study felt that the key features of a physical activity program for individuals with a mood disorder must utilize a social network approach, take into account the preferences of potential participants, and incorporate nature (both green and blue spaces) as a health promotion resource.

  11. Key Roles of Lewis Acid-base Pairs on ZnxZryOz in Direct Ethanol/Acetone to Isobutene Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Junming; Baylon, Rebecca A.; Liu, Changjun; Mei, Donghai; Martin, Kevin J.; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-20

    The effects of surface acidity on the cascade ethanol-to-isobutene conversion were studied using ZnxZryOz catalysts. The ethanol-to-isobutene reaction was found to be limited by the secondary reaction of the key intermediate, acetone, namely the acetone-to-isobutene reaction. Although the catalysts with coexisting Brønsted acidity could catalyze the rate-limiting acetone-to-isobutene reaction, the presence of Brønsted acidity is also detrimental. First, secondary isobutene isomerization is favored, producing a mixture of butene isomers. Second, undesired polymerization and coke formation prevail, leading to rapid catalyst deactivation. Most importantly, both steady-state and kinetic reaction studies as well as FTIR analysis of adsorbed acetone-d6 and D2O unambiguously showed that a highly active and selective nature of balanced Lewis acid-base pairs was masked by the coexisting Brønsted acidity in the aldolization and self-deoxygenation of acetone to isobutene. As a result, ZnxZryOz catalysts with only Lewis acid-base pairs were discovered, on which nearly a theoretical selectivity to isobutene (~88.9%) was successfully achieved, which has never been reported before. Moreover, the absence of Brønsted acidity in such ZnxZryOz catalysts also eliminates the side isobutene isomerization and undesired polymerization/coke reactions, resulting in the production of high purity isobutene with significantly improved catalyst stability (< 2% activity loss after 200 h time-on-stream). This work not only demonstrates a balanced Lewis acid-base pair for the highly active and selective cascade ethanol-to-isobutene reaction, but also sheds light on the rational design of selective and robust acid-base catalyst for C-C coupling via aldolization reaction.

  12. The Healthy Steps Study: A randomized controlled trial of a pedometer-based Green Prescription for older adults. Trial protocol

    Directory of Open Access Journals (Sweden)

    Schluter Philip J

    2009-11-01

    Full Text Available Abstract Background Graded health benefits of physical activity have been demonstrated for the reduction of coronary heart disease, some cancers, and type-2 diabetes, and for injury reduction and improvements in mental health. Older adults are particularly at risk of physical inactivity, and would greatly benefit from successful targeted physical activity interventions. Methods/Design The Healthy Steps study is a 12-month randomized controlled trial comparing the efficacy of a pedometer-based Green Prescription with the conventional time-based Green Prescription in increasing and maintaining physical activity levels in low-active adults over 65 years of age. The Green Prescription interventions involve a primary care physical activity prescription with 3 follow-up telephone counselling sessions delivered by trained physical activity counsellors over 3 months. Those in the pedometer group received a pedometer and counselling based around increasing steps that can be monitored on the pedometer, while those in the standard Green Prescription group received counselling using time-based goals. Baseline, 3 month (end of intervention, and 12 month measures were assessed in face-to-face home visits with outcomes measures being physical activity (Auckland Heart Study Physical Activity Questionnaire, quality of life (SF-36 and EQ-5D, depressive symptoms (Geriatric Depression Scale, blood pressure, weight status, functional status (gait speed, chair stands, and tandem balance test and falls and adverse events (self-report. Utilisation of health services was assessed for the economic evaluation carried out alongside this trial. As well, a process evaluation of the interventions and an examination of barriers and motives for physical activity in the sample were conducted. The perceptions of primary care physicians in relation to delivering physical activity counselling were also assessed. Discussion The findings from the Healthy Steps trial are due in late

  13. The healthy steps study: a randomized controlled trial of a pedometer-based green prescription for older adults. Trial protocol.

    Science.gov (United States)

    Kolt, Gregory S; Schofield, Grant M; Kerse, Ngaire; Garrett, Nicholas; Schluter, Philip J; Ashton, Toni; Patel, Asmita

    2009-11-01

    Graded health benefits of physical activity have been demonstrated for the reduction of coronary heart disease, some cancers, and type-2 diabetes, and for injury reduction and improvements in mental health. Older adults are particularly at risk of physical inactivity, and would greatly benefit from successful targeted physical activity interventions. The Healthy Steps study is a 12-month randomized controlled trial comparing the efficacy of a pedometer-based Green Prescription with the conventional time-based Green Prescription in increasing and maintaining physical activity levels in low-active adults over 65 years of age. The Green Prescription interventions involve a primary care physical activity prescription with 3 follow-up telephone counselling sessions delivered by trained physical activity counsellors over 3 months. Those in the pedometer group received a pedometer and counselling based around increasing steps that can be monitored on the pedometer, while those in the standard Green Prescription group received counselling using time-based goals. Baseline, 3 month (end of intervention), and 12 month measures were assessed in face-to-face home visits with outcomes measures being physical activity (Auckland Heart Study Physical Activity Questionnaire), quality of life (SF-36 and EQ-5D), depressive symptoms (Geriatric Depression Scale), blood pressure, weight status, functional status (gait speed, chair stands, and tandem balance test) and falls and adverse events (self-report). Utilisation of health services was assessed for the economic evaluation carried out alongside this trial. As well, a process evaluation of the interventions and an examination of barriers and motives for physical activity in the sample were conducted. The perceptions of primary care physicians in relation to delivering physical activity counselling were also assessed. The findings from the Healthy Steps trial are due in late 2009. If successful in improving physical activity in older

  14. A Knowledge-Based Step Length Estimation Method Based on Fuzzy Logic and Multi-Sensor Fusion Algorithms for a Pedestrian Dead Reckoning System

    Directory of Open Access Journals (Sweden)

    Ying-Chih Lai

    2016-05-01

    Full Text Available The demand for pedestrian navigation has increased along with the rapid progress in mobile and wearable devices. This study develops an accurate and usable Step Length Estimation (SLE method for a Pedestrian Dead Reckoning (PDR system with features including a wide range of step lengths, a self-contained system, and real-time computing, based on the multi-sensor fusion and Fuzzy Logic (FL algorithms. The wide-range SLE developed in this study was achieved by using a knowledge-based method to model the walking patterns of the user. The input variables of the FL are step strength and frequency, and the output is the estimated step length. Moreover, a waist-mounted sensor module has been developed using low-cost inertial sensors. Since low-cost sensors suffer from various errors, a calibration procedure has been utilized to improve accuracy. The proposed PDR scheme in this study demonstrates its ability to be implemented on waist-mounted devices in real time and is suitable for the indoor and outdoor environments considered in this study without the need for map information or any pre-installed infrastructure. The experiment results show that the maximum distance error was within 1.2% of 116.51 m in an indoor environment and was 1.78% of 385.2 m in an outdoor environment.

  15. Modified Three-Step Search Block Matching Motion Estimation and Weighted Finite Automata based Fractal Video Compression

    Directory of Open Access Journals (Sweden)

    Shailesh Kamble

    2017-08-01

    Full Text Available The major challenge with fractal image/video coding technique is that, it requires more encoding time. Therefore, how to reduce the encoding time is the research component remains in the fractal coding. Block matching motion estimation algorithms are used, to reduce the computations performed in the process of encoding. The objective of the proposed work is to develop an approach for video coding using modified three step search (MTSS block matching algorithm and weighted finite automata (WFA coding with a specific focus on reducing the encoding time. The MTSS block matching algorithm are used for computing motion vectors between the two frames i.e. displacement of pixels and WFA is used for the coding as it behaves like the Fractal Coding (FC. WFA represents an image (frame or motion compensated prediction error based on the idea of fractal that the image has self-similarity in itself. The self-similarity is sought from the symmetry of an image, so the encoding algorithm divides an image into multi-levels of quad-tree segmentations and creates an automaton from the sub-images. The proposed MTSS block matching algorithm is based on the combination of rectangular and hexagonal search pattern and compared with the existing New Three-Step Search (NTSS, Three-Step Search (TSS, and Efficient Three-Step Search (ETSS block matching estimation algorithm. The performance of the proposed MTSS block matching algorithm is evaluated on the basis of performance evaluation parameters i.e. mean absolute difference (MAD and average search points required per frame. Mean of absolute difference (MAD distortion function is used as the block distortion measure (BDM. Finally, developed approaches namely, MTSS and WFA, MTSS and FC, and Plane FC (applied on every frame are compared with each other. The experimentations are carried out on the standard uncompressed video databases, namely, akiyo, bus, mobile, suzie, traffic, football, soccer, ice etc. Developed

  16. Alu pair exclusions in the human genome

    Directory of Open Access Journals (Sweden)

    Cook George W

    2011-09-01

    Full Text Available Abstract Background The human genome contains approximately one million Alu elements which comprise more than 10% of human DNA by mass. Alu elements possess direction, and are distributed almost equally in positive and negative strand orientations throughout the genome. Previously, it has been shown that closely spaced Alu pairs in opposing orientation (inverted pairs are found less frequently than Alu pairs having the same orientation (direct pairs. However, this imbalance has only been investigated for Alu pairs separated by 650 or fewer base pairs (bp in a study conducted prior to the completion of the draft human genome sequence. Results We performed a comprehensive analysis of all (> 800,000 full-length Alu elements in the human genome. This large sample size permits detection of small differences in the ratio between inverted and direct Alu pairs (I:D. We have discovered a significant depression in the full-length Alu pair I:D ratio that extends to repeat pairs separated by ≤ 350,000 bp. Within this imbalance bubble (those Alu pairs separated by ≤ 350,000 bp, direct pairs outnumber inverted pairs. Using PCR, we experimentally verified several examples of inverted Alu pair exclusions that were caused by deletions. Conclusions Over 50 million full-length Alu pairs reside within the I:D imbalance bubble. Their collective impact may represent one source of Alu element-related human genomic instability that has not been previously characterized.

  17. Coherence length determination of meso-meso linked porphyrin arrays based on forward-backward pair trajectory analysis.

    Science.gov (United States)

    Lee, Myeongwon; Kim, Heeyoung; Kim, Dongho; Sim, Eunji

    2008-06-12

    We investigated the excitation energy transfer process of meso-meso linked zinc(II) porphyrin arrays using the on-the-fly filtered propagator path integral method. Details of the dynamics such as coherence length of a porphyrin array are estimated by analysis of the characteristics of forward-backward pair trajectories. Upon examination of the convergence of the reduced density matrix with respect to the subset of Hilbert space trajectories, we determine the number of porphyrin units that form collective coherent states, that is, the coherence length. Simulation results show that the coherence length of zinc(II) porphyrin arrays is up to 4 units, which agrees excellently with experimental observations. On the other hand, the energy bias provided by the energy-accepting 5,15-bisphenylethynylated zinc(II) porphyrin reduces the degree of coherence which becomes negligible for an array with more than for porphyrin units. Considering conformational inhomogeneity, we found that the experimentally determined coherence length is the result of electronic and environmental influence rather than the structure disorder. Temperature dependence is also discussed.

  18. In vivo dynamics of enterovirus protease revealed by fluorescence resonance emission transfer (FRET) based on a novel FRET pair

    International Nuclear Information System (INIS)

    Hsu, Y.-Y.; Liu, Y.-N.; Wang Wenyen; Kao, Fu-Jen; Kung, S.-H.

    2007-01-01

    An in vivo protease assay suitable for analysis by fluorescence resonance energy transfer (FRET) was developed on the basis of a novel FRET pair. The specifically designed fusion substrate consists of green fluorescent protein 2 (GFP 2 )-peptide-red fluorescent protein 2 (DsRed2), with a cleavage motif for the enterovirus 2A protease (2A pro ) embedded within the peptide region. FRET can be readily visualized in real-time from cells expressing the fusion substrate until a proteolytic cleavage by 2A pro from the input virus. The level of FRET decay is a function of the amount and infection duration of the inoculated virus as measured by a fluorometer assay. The FRET biosensor also responded well to other related enteroviruses but not to a phylogenetically distant virus. Western blot analysis confirmed the physical cleavage of the fusion substrate upon the infections. The study provides proof of principle for applying the FRET technology to diagnostics, screening procedures, and cell biological research

  19. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  20. Investigation on the traceability of three dimensional scanning electron microscope measurements based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Bariani, Paolo; De Chiffre, Leonardo; Hansen, Hans Nørgaard

    2005-01-01

    -dimensional topography of the type C roughness standards showed good agreement with the nominal profile wavelength values. An investigation was carried out concerning the traceability of dimensional measurements performed with the scanning electron microscope (SEM) using reconstruction of surface topography through......An investigation was carried out concerning the traceability of dimensional measurements performed with the scanning electron microscope (SEM) using reconstruction of surface topography through stereo-photogrammetry. A theoretical description of the effects that the main instrumental variables...... in the vertical plane using two ISO 5436 type C roughness standards. Results from magnification calibration and tilt angle measurement were used for calculating the theoretical uncertainty on the vertical elevation. Experimental deviations measured on gauge-block steps showed slightly bigger values than those...