Learning preferences from paired opposite-based semantics

DEFF Research Database (Denmark)

Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

2017-01-01

Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

Science.gov (United States)

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

A novel pseudo-complementary PNA G-C base pair

DEFF Research Database (Denmark)

Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

2011-01-01

Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Envisaging quantum transport phenomenon in a muddled base pair of DNA

Science.gov (United States)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

Science.gov (United States)

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

Science.gov (United States)

Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

2012-11-01

Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

International Nuclear Information System (INIS)

Mendel, D.; Dervan, P.B.

1987-01-01

Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

Evaluation of several two-step scoring functions based on linear interaction energy, effective ligand size, and empirical pair potentials for prediction of protein-ligand binding geometry and free energy.

Science.gov (United States)

Rahaman, Obaidur; Estrada, Trilce P; Doren, Douglas J; Taufer, Michela; Brooks, Charles L; Armen, Roger S

2011-09-26

The performances of several two-step scoring approaches for molecular docking were assessed for their ability to predict binding geometries and free energies. Two new scoring functions designed for "step 2 discrimination" were proposed and compared to our CHARMM implementation of the linear interaction energy (LIE) approach using the Generalized-Born with Molecular Volume (GBMV) implicit solvation model. A scoring function S1 was proposed by considering only "interacting" ligand atoms as the "effective size" of the ligand and extended to an empirical regression-based pair potential S2. The S1 and S2 scoring schemes were trained and 5-fold cross-validated on a diverse set of 259 protein-ligand complexes from the Ligand Protein Database (LPDB). The regression-based parameters for S1 and S2 also demonstrated reasonable transferability in the CSARdock 2010 benchmark using a new data set (NRC HiQ) of diverse protein-ligand complexes. The ability of the scoring functions to accurately predict ligand geometry was evaluated by calculating the discriminative power (DP) of the scoring functions to identify native poses. The parameters for the LIE scoring function with the optimal discriminative power (DP) for geometry (step 1 discrimination) were found to be very similar to the best-fit parameters for binding free energy over a large number of protein-ligand complexes (step 2 discrimination). Reasonable performance of the scoring functions in enrichment of active compounds in four different protein target classes established that the parameters for S1 and S2 provided reasonable accuracy and transferability. Additional analysis was performed to definitively separate scoring function performance from molecular weight effects. This analysis included the prediction of ligand binding efficiencies for a subset of the CSARdock NRC HiQ data set where the number of ligand heavy atoms ranged from 17 to 35. This range of ligand heavy atoms is where improved accuracy of predicted ligand

Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

Directory of Open Access Journals (Sweden)

Min Mao

2014-01-01

Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Energy hyperspace for stacking interaction in AU/AU dinucleotide step: Dispersion-corrected density functional theory study.

Science.gov (United States)

Mukherjee, Sanchita; Kailasam, Senthilkumar; Bansal, Manju; Bhattacharyya, Dhananjay

2014-01-01

Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014. Copyright © 2013 Wiley Periodicals, Inc.

Statistical deprojection of galaxy pairs

Science.gov (United States)

Nottale, Laurent; Chamaraux, Pierre

2018-06-01

Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

A two-step quantum secure direct communication protocol with hyperentanglement

International Nuclear Information System (INIS)

Gu Bin; Zhang Cheng-Yi; Huang Yu-Gai; Fang Xia

2011-01-01

We propose a two-step quantum secure direct communication (QSDC) protocol with hyperentanglement in both the spatial-mode and the polarization degrees of freedom of photon pairs which can in principle be produced with a beta barium borate crystal. The secret message can be encoded on the photon pairs with unitary operations in these two degrees of freedom independently. This QSDC protocol has a higher capacity than the original two-step QSDC protocol as each photon pair can carry 4 bits of information. Compared with the QSDC protocol based on hyperdense coding, this QSDC protocol has the immunity to Trojan horse attack strategies with the process for determining the number of the photons in each quantum signal as it is a one-way quantum communication protocol. (general)

Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

International Nuclear Information System (INIS)

Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

2009-01-01

The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

Two-step quantum direct communication protocol using the Einstein- Podolsky-Rosen pair block

CERN Document Server

Fu Guo Deng; Xiao Shu Liu; 10.1103/PhysRevA.68.042317

2003-01-01

A protocol for quantum secure direct communication using blocks of Einstein-Podolsky-Rosen (EPR) pairs is proposed. A set of ordered N EPR pairs is used as a data block for sending secret message directly. The ordered N EPR set is divided into two particle sequences, a checking sequence and a message-coding sequence. After transmitting the checking sequence, the two parties of communication check eavesdropping by measuring a fraction of particles randomly chosen, with random choice of two sets of measuring bases. After insuring the security of the quantum channel, the sender Alice encodes the secret message directly on the message-coding sequence and sends them to Bob. By combining the checking and message-coding sequences together, Bob is able to read out the encoded messages directly. The scheme is secure because an eavesdropper cannot get both sequences simultaneously. We also discuss issues in a noisy channel. (30 refs).

Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

Science.gov (United States)

Hirao, Ichiro; Kimoto, Michiko

2012-01-01

Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

Directory of Open Access Journals (Sweden)

Sergei Kuchin

2011-03-01

Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

One-step synthesis of DNA functionalized cadmium-free quantum dots and its application in FRET-based protein sensing

Energy Technology Data Exchange (ETDEWEB)

Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)

2017-03-08

DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.

Signature scheme based on bilinear pairs

Science.gov (United States)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

Triple helical DNA in a duplex context and base pair opening

Science.gov (United States)

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Accurate interaction energies of base pairing and base stacking. The final chapter

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

2005-01-01

Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

OpenAIRE

Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

2016-01-01

Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

Directory of Open Access Journals (Sweden)

Jiuqiang Han

2013-03-01

Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

Using an isomorphic problem pair to learn introductory physics: Transferring from a two-step problem to a three-step problem

Directory of Open Access Journals (Sweden)

Shih-Yin Lin

2013-10-01

Full Text Available In this study, we examine introductory physics students’ ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation in which they had to learn from a solved problem provided and take advantage of what they learned from it to solve another isomorphic problem (which we call the quiz problem. The solved problem provided has two subproblems while the quiz problem has three subproblems, which is known from previous research to be challenging for introductory students. In addition to the solved problem, students also received extra scaffolding supports that were intended to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. The data analysis suggests that students had great difficulty in transferring what they learned from a two-step problem to a three-step problem. Although most students were able to learn from the solved problem to some extent with the scaffolding provided and invoke the relevant principles in the quiz problem, they were not necessarily able to apply the principles correctly. We also conducted think-aloud interviews with six introductory students in order to understand in depth the difficulties they had and explore strategies to provide better scaffolding. The interviews suggest that students often superficially mapped the principles employed in the solved problem to the quiz problem without necessarily understanding the governing conditions underlying each principle and examining the applicability of the principle in the new situation in an in-depth manner. Findings suggest that more scaffolding is needed to help students in transferring from a two-step problem to a three-step problem and applying the physics principles appropriately. We outline a few

Using an isomorphic problem pair to learn introductory physics: Transferring from a two-step problem to a three-step problem

Science.gov (United States)

Lin, Shih-Yin; Singh, Chandralekha

2013-12-01

In this study, we examine introductory physics students’ ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation in which they had to learn from a solved problem provided and take advantage of what they learned from it to solve another isomorphic problem (which we call the quiz problem). The solved problem provided has two subproblems while the quiz problem has three subproblems, which is known from previous research to be challenging for introductory students. In addition to the solved problem, students also received extra scaffolding supports that were intended to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. The data analysis suggests that students had great difficulty in transferring what they learned from a two-step problem to a three-step problem. Although most students were able to learn from the solved problem to some extent with the scaffolding provided and invoke the relevant principles in the quiz problem, they were not necessarily able to apply the principles correctly. We also conducted think-aloud interviews with six introductory students in order to understand in depth the difficulties they had and explore strategies to provide better scaffolding. The interviews suggest that students often superficially mapped the principles employed in the solved problem to the quiz problem without necessarily understanding the governing conditions underlying each principle and examining the applicability of the principle in the new situation in an in-depth manner. Findings suggest that more scaffolding is needed to help students in transferring from a two-step problem to a three-step problem and applying the physics principles appropriately. We outline a few possible strategies

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

Science.gov (United States)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

DFT study on metal-mediated uracil base pair complexes

Directory of Open Access Journals (Sweden)

Ayhan Üngördü

2017-11-01

Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

KAUST Repository

Chawla, Mohit

2018-01-02

The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

Effects of Student Pairing and Public Review on Physical Activity during School Recess

Science.gov (United States)

Zerger, Heather M.; Miller, Bryon G.; Valbuena, Diego; Miltenberger, Raymond G.

2017-01-01

The purpose of this study was to evaluate the effects of student pairing and feedback during recess on children's step counts. During baseline, participants wore a sealed pedometer during recess. During intervention, we paired participants with higher step counts with participants with lower step counts. We encouraged teams to compete for the…

Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

International Nuclear Information System (INIS)

Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

1988-01-01

High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

Effects of noninstantaneous nonlinear processes on photon-pair generation by spontaneous four-wave mixing

DEFF Research Database (Denmark)

Koefoed, Jacob Gade; Christensen, Jesper Bjerge; Rottwitt, Karsten

2017-01-01

We present a general model, based on a Hamiltonian approach, for the joint quantum state of photon pairs generated through pulsed spontaneous four-wave mixing, including nonlinear phase modulation and a finite material response time. For the case of a silica fiber, it is found that the pair......-production rate depends weakly on the waveguide temperature, due to higher-order Raman scattering events, and more strongly on pump-pair frequency detuning. From the analytical model, a numerical scheme is derived, based on the well-known split-step method. This scheme allows computation of joint states where......-dependent change in quantum-mechanical purity may be observed in silica. This shows that Raman scattering not only introduces noise, but can also drastically change the spectral correlations in photon pairs when pumped with short pulses....

Micromechanics of base pair unzipping in the DNA duplex

International Nuclear Information System (INIS)

Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

2012-01-01

All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

Property (RD) for Hecke Pairs

International Nuclear Information System (INIS)

Shirbisheh, Vahid

2012-01-01

As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

Directory of Open Access Journals (Sweden)

Testiana Deni Wijayatiningsih

2017-04-01

Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

Science.gov (United States)

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

International Nuclear Information System (INIS)

Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

2005-01-01

The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

KAUST Repository

Chawla, Mohit

2015-06-27

Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

KAUST Repository

Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

2015-01-01

Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

Science.gov (United States)

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

OpenAIRE

Lang, Gregory I.; Murray, Andrew W.

2008-01-01

Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

International Nuclear Information System (INIS)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.

2012-01-01

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

Energy Technology Data Exchange (ETDEWEB)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)

2012-04-15

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

Science.gov (United States)

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

Science.gov (United States)

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

International Nuclear Information System (INIS)

Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

2011-01-01

Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

The Satellite Test of the Equivalence Principle (STEP)

Science.gov (United States)

2004-01-01

STEP will carry concentric test masses to Earth orbit to test a fundamental assumption underlying Einstein's theory of general relativity: that gravitational mass is equivalent to inertial mass. STEP is a 21st-century version of the test that Galileo is said to have performed by dropping a carnon ball and a musket ball simultaneously from the top of the Leaning Tower of Pisa to compare their accelerations. During the STEP experiment, four pairs of test masses will be falling around the Earth, and their accelerations will be measured by superconducting quantum interference devices (SQUIDS). The extended time sensitivity of the instruments will allow the measurements to be a million times more accurate than those made in modern ground-based tests.

Charge transfer in DNA: role of base pairing

Czech Academy of Sciences Publication Activity Database

Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

2009-01-01

Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

Photochemical selectivity in guanine-cytosine base-pair structures

Czech Academy of Sciences Publication Activity Database

Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

2005-01-01

Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

Science.gov (United States)

Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

2012-02-15

We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

NARCIS (Netherlands)

Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

2012-01-01

We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

Science.gov (United States)

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

Indian Academy of Sciences (India)

The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

Multi-step wrought processing of TiAl-based alloys

International Nuclear Information System (INIS)

Fuchs, G.E.

1997-04-01

Wrought processing will likely be needed for fabrication of a variety of TiAl-based alloy structural components. Laboratory and development work has usually relied on one-step forging to produce test material. Attempts to scale-up TiAl-based alloy processing has indicated that multi-step wrought processing is necessary. The purpose of this study was to examine potential multi-step processing routes, such as two-step isothermal forging and extrusion + isothermal forging. The effects of processing (I/M versus P/M), intermediate recrystallization heat treatments and processing route on the tensile and creep properties of Ti-48Al-2Nb-2Cr alloys were examined. The results of the testing were then compared to samples from the same heats of materials processed by one-step routes. Finally, by evaluating the effect of processing on microstructure and properties, optimized and potentially lower cost processing routes could be identified

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

Science.gov (United States)

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

Directory of Open Access Journals (Sweden)

Shu-ichi Nakano

2014-08-01

Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

An entropy-based improved k-top scoring pairs (TSP) method for ...

African Journals Online (AJOL)

An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

Experimental study of single-vertex $(e^{-}-e^{+})$ pair creation in a crystal

CERN Multimedia

2002-01-01

This experiment will study the newly predicted process of $e^{-}-e^{+}$ pair production by high energy photons incident along major axial direction of a single crystal. This process is based upon the well-known channeling properties of negatively charged particles along atomic rows of a crystal. The $e^{-}-e^{+}$ pair creation may proceed in a one-step process, without violating energy and momentum conversation laws, due to the lowering of the total energy of the channeled electron (Fig. 1). \\\\ \\\\ The pair creation rate should increase with increasing photon energies (above a threshold of a few GeV) and largely exceed the Bethe-Heitler process rate for photon energies of a few tens of GeV. It is also expected that the created particles share the photon energy nearly equally, in contrast with the rather flat energy distribution associated with the Bethe-Heitler process. \\\\ \\\\ The experimental set-up (Fig. 2) is designed for the study of those two features: photon energy dependence of the pair creation rate, an...

Constructing an exposure chart: step by step (based on standard procedures)

International Nuclear Information System (INIS)

David, Jocelyn L; Cansino, Percedita T.; Taguibao, Angileo P.

2000-01-01

An exposure chart is very important in conducting radiographic inspection of materials. By using an accurate exposure chart, an inspector is able to avoid a trial and error way of determining correct time to expose a specimen, thereby producing a radiograph that has an acceptable density based on a standard. The chart gives the following information: x-ray machine model and brand, distance of the x-ray tube from the film, type and thickness of intensifying screens, film type, radiograph density, and film processing conditions. The methods of preparing an exposure chart are available in existing radiographic testing manuals. These described methods are presented in step by step procedures, covering the actual laboratory set-up, data gathering, computations, and transformation of derived data into Characteristic Curve and Exposure Chart

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Compatibility of pedigree-based and marker-based relationship matrices for single-step genetic evaluation

DEFF Research Database (Denmark)

Christensen, Ole Fredslund

2012-01-01

Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker-based rel...

Performance of various density functionals for the hydrogen bonds in DNA base pairs

NARCIS (Netherlands)

van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

2006-01-01

We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

International Nuclear Information System (INIS)

Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

2012-01-01

We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

International Nuclear Information System (INIS)

Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

2012-01-01

Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

OpenAIRE

Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

2015-01-01

International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

2012-11-01

8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

Time series regression-based pairs trading in the Korean equities market

Science.gov (United States)

Kim, Saejoon; Heo, Jun

2017-07-01

Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

A rule of seven in Watson-Crick base-pairing of mismatched sequences.

Science.gov (United States)

Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

2012-05-13

Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

Performance of the Seven-step Procedure in Problem-based Hospitality Management Education

Directory of Open Access Journals (Sweden)

Wichard Zwaal

2016-12-01

Full Text Available The study focuses on the seven-step procedure (SSP in problem-based learning (PBL. The way students apply the seven-step procedure will help us understand how students work in a problem-based learning curriculum. So far, little is known about how students rate the performance and importance of the different steps, the amount of time they spend on each step and the perceived quality of execution of the procedure. A survey was administered to a sample of 101 students enrolled in a problem-based hospitality management program. Results show that students consider step 6 (Collect additional information outside the group to be most important. The highest performance-rating is for step two (Define the problem and the lowest for step four (Draw a systemic inventory of explanations from step three. Step seven is classified as low in performance and high in importance implicating urgent attention. The average amount of time spent on the seven steps is 133 minutes with the largest part of the time spent on self-study outside the group (42 minutes. The assessment of the execution of a set of specific guidelines (the Blue Card did not completely match with the overall performance ratings for the seven steps. The SSP could be improved by reducing the number of steps and incorporating more attention to group dynamics.

Data-Based Predictive Control with Multirate Prediction Step

Science.gov (United States)

Barlow, Jonathan S.

2010-01-01

Data-based predictive control is an emerging control method that stems from Model Predictive Control (MPC). MPC computes current control action based on a prediction of the system output a number of time steps into the future and is generally derived from a known model of the system. Data-based predictive control has the advantage of deriving predictive models and controller gains from input-output data. Thus, a controller can be designed from the outputs of complex simulation code or a physical system where no explicit model exists. If the output data happens to be corrupted by periodic disturbances, the designed controller will also have the built-in ability to reject these disturbances without the need to know them. When data-based predictive control is implemented online, it becomes a version of adaptive control. One challenge of MPC is computational requirements increasing with prediction horizon length. This paper develops a closed-loop dynamic output feedback controller that minimizes a multi-step-ahead receding-horizon cost function with multirate prediction step. One result is a reduced influence of prediction horizon and the number of system outputs on the computational requirements of the controller. Another result is an emphasis on portions of the prediction window that are sampled more frequently. A third result is the ability to include more outputs in the feedback path than in the cost function.

Prediction of plant promoters based on hexamers and random triplet pair analysis

Directory of Open Access Journals (Sweden)

Noman Nasimul

2011-06-01

Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

Science.gov (United States)

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

NARCIS (Netherlands)

Moddemeijer, R

In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

International Nuclear Information System (INIS)

Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

2016-01-01

Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

International Nuclear Information System (INIS)

Li, Ying; Wilson, W.D.; Zon, G.

1991-01-01

1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

Directory of Open Access Journals (Sweden)

Ji-Jian Chin

2014-01-01

Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

Science.gov (United States)

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Leszczynski, J.

2001-01-01

Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

Science.gov (United States)

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

Science.gov (United States)

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

Science.gov (United States)

Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

2013-02-12

We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

DEFF Research Database (Denmark)

Carli, Lorenzo; Genta, G; Cantatore, Angela

2011-01-01

3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

NARCIS (Netherlands)

Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

2000-01-01

Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

Construction of high-dimensional neural network potentials using environment-dependent atom pairs.

Science.gov (United States)

Jose, K V Jovan; Artrith, Nongnuch; Behler, Jörg

2012-05-21

An accurate determination of the potential energy is the crucial step in computer simulations of chemical processes, but using electronic structure methods on-the-fly in molecular dynamics (MD) is computationally too demanding for many systems. Constructing more efficient interatomic potentials becomes intricate with increasing dimensionality of the potential-energy surface (PES), and for numerous systems the accuracy that can be achieved is still not satisfying and far from the reliability of first-principles calculations. Feed-forward neural networks (NNs) have a very flexible functional form, and in recent years they have been shown to be an accurate tool to construct efficient PESs. High-dimensional NN potentials based on environment-dependent atomic energy contributions have been presented for a number of materials. Still, these potentials may be improved by a more detailed structural description, e.g., in form of atom pairs, which directly reflect the atomic interactions and take the chemical environment into account. We present an implementation of an NN method based on atom pairs, and its accuracy and performance are compared to the atom-based NN approach using two very different systems, the methanol molecule and metallic copper. We find that both types of NN potentials provide an excellent description of both PESs, with the pair-based method yielding a slightly higher accuracy making it a competitive alternative for addressing complex systems in MD simulations.

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

Energy Technology Data Exchange (ETDEWEB)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

2016-02-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

International Nuclear Information System (INIS)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

2016-01-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

Dye-sensitized solar cell with a pair of carbon-based electrodes

International Nuclear Information System (INIS)

Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

2012-01-01

We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

Single base pair mutation analysis by PNA directed PCR clamping

DEFF Research Database (Denmark)

Ørum, H.; Nielsen, P.E.; Egholm, M.

1993-01-01

A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

PandA : pairings and arithmetic

NARCIS (Netherlands)

Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

2014-01-01

This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

Science.gov (United States)

Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

2018-02-19

It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Studies of base pair sequence effects on DNA solvation based on all

Indian Academy of Sciences (India)

Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

Directory of Open Access Journals (Sweden)

Rie Kawai

2012-03-01

Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

Science.gov (United States)

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

Microprocessor-based stepping motor driver

International Nuclear Information System (INIS)

Halbig, J.K.; Klosterbuer, S.F.

1979-09-01

The Pion Generation for Medical Irradiations (PIGMI) program at the Los Alamos Scientific Laboratory requires a versatile stepping motor driver to do beam diagnostic measurements. A driver controlled by a microprocessor that can move eight stepping motors simultaneously was designed. The driver can monitor and respond to clockwise- and counterclockwise-limit switches, and it can monitor a 0- to 10-V dc position signal. The software controls start and stop ramping and maximum stepping rates. 2 figures, 1 table

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

International Nuclear Information System (INIS)

Makarashvili, V.; Wells, D. P.; Roy, A. K.

2009-01-01

Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

Classified one-step high-radix signed-digit arithmetic units

Science.gov (United States)

Cherri, Abdallah K.

1998-08-01

High-radix number systems enable higher information storage density, less complexity, fewer system components, and fewer cascaded gates and operations. A simple one-step fully parallel high-radix signed-digit arithmetic is proposed for parallel optical computing based on new joint spatial encodings. This reduces hardware requirements and improves throughput by reducing the space-bandwidth produce needed. The high-radix signed-digit arithmetic operations are based on classifying the neighboring input digit pairs into various groups to reduce the computation rules. A new joint spatial encoding technique is developed to present both the operands and the computation rules. This technique increases the spatial bandwidth product of the spatial light modulators of the system. An optical implementation of the proposed high-radix signed-digit arithmetic operations is also presented. It is shown that our one-step trinary signed-digit and quaternary signed-digit arithmetic units are much simpler and better than all previously reported high-radix signed-digit techniques.

Coherent chemical kinetics as quantum walks. II. Radical-pair reactions in Arabidopsis thaliana

Science.gov (United States)

Chia, A.; Górecka, A.; Kurzyński, P.; Paterek, T.; Kaszlikowski, D.

2016-03-01

We apply the quantum-walk approach proposed in the preceding paper [A. Chia et al., preceding paper, Phys. Rev. E 93, 032407 (2016), 10.1103/PhysRevE.93.032407] to a radical-pair reaction where realistic estimates for the intermediate transition rates are available. The well-known average hitting time from quantum walks can be adopted as a measure of how quickly the reaction occurs and we calculate this for varying degrees of dephasing in the radical pair. The time for the radical pair to react to a product is found to be independent of the amount of dephasing introduced, even in the limit of no dephasing where the transient population dynamics exhibits strong coherent oscillations. This can be seen to arise from the existence of a rate-limiting step in the reaction and we argue that in such examples, a purely classical model based on rate equations can be used for estimating the time scale of the reaction but not necessarily its population dynamics.

Low-cost addition-subtraction sequences for the final exponentiation computation in pairings

DEFF Research Database (Denmark)

Guzmán-Trampe, Juan E; Cruz-Cortéz, Nareli; Dominguez Perez, Luis

2014-01-01

In this paper, we address the problem of finding low cost addition–subtraction sequences for situations where a doubling step is significantly cheaper than a non-doubling one. One application of this setting appears in the computation of the final exponentiation step of the reduced Tate pairing d...

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

Science.gov (United States)

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

Transition from Sign-Reversed to Sign-Preserved Cooper-Pairing Symmetry in Sulfur-Doped Iron Selenide Superconductors.

Science.gov (United States)

Wang, Qisi; Park, J T; Feng, Yu; Shen, Yao; Hao, Yiqing; Pan, Bingying; Lynn, J W; Ivanov, A; Chi, Songxue; Matsuda, M; Cao, Huibo; Birgeneau, R J; Efremov, D V; Zhao, Jun

2016-05-13

An essential step toward elucidating the mechanism of superconductivity is to determine the sign or phase of the superconducting order parameter, as it is closely related to the pairing interaction. In conventional superconductors, the electron-phonon interaction induces attraction between electrons near the Fermi energy and results in a sign-preserved s-wave pairing. For high-temperature superconductors, including cuprates and iron-based superconductors, prevalent weak coupling theories suggest that the electron pairing is mediated by spin fluctuations which lead to repulsive interactions, and therefore that a sign-reversed pairing with an s_{±} or d-wave symmetry is favored. Here, by using magnetic neutron scattering, a phase sensitive probe of the superconducting gap, we report the observation of a transition from the sign-reversed to sign-preserved Cooper-pairing symmetry with insignificant changes in T_{c} in the S-doped iron selenide superconductors K_{x}Fe_{2-y}(Se_{1-z}S_{z})_{2}. We show that a rather sharp magnetic resonant mode well below the superconducting gap (2Δ) in the undoped sample (z=0) is replaced by a broad hump structure above 2Δ under 50% S doping. These results cannot be readily explained by simple spin fluctuation-exchange pairing theories and, therefore, multiple pairing channels are required to describe superconductivity in this system. Our findings may also yield a simple explanation for the sometimes contradictory data on the sign of the superconducting order parameter in iron-based materials.

Enriching step-based product information models to support product life-cycle activities

Science.gov (United States)

Sarigecili, Mehmet Ilteris

The representation and management of product information in its life-cycle requires standardized data exchange protocols. Standard for Exchange of Product Model Data (STEP) is such a standard that has been used widely by the industries. Even though STEP-based product models are well defined and syntactically correct, populating product data according to these models is not easy because they are too big and disorganized. Data exchange specifications (DEXs) and templates provide re-organized information models required in data exchange of specific activities for various businesses. DEXs show us it would be possible to organize STEP-based product models in order to support different engineering activities at various stages of product life-cycle. In this study, STEP-based models are enriched and organized to support two engineering activities: materials information declaration and tolerance analysis. Due to new environmental regulations, the substance and materials information in products have to be screened closely by manufacturing industries. This requires a fast, unambiguous and complete product information exchange between the members of a supply chain. Tolerance analysis activity, on the other hand, is used to verify the functional requirements of an assembly considering the worst case (i.e., maximum and minimum) conditions for the part/assembly dimensions. Another issue with STEP-based product models is that the semantics of product data are represented implicitly. Hence, it is difficult to interpret the semantics of data for different product life-cycle phases for various application domains. OntoSTEP, developed at NIST, provides semantically enriched product models in OWL. In this thesis, we would like to present how to interpret the GD & T specifications in STEP for tolerance analysis by utilizing OntoSTEP.

An Improved Method of Training Overcomplete Dictionary Pair

Directory of Open Access Journals (Sweden)

Zhuozheng Wang

2014-01-01

Full Text Available Training overcomplete dictionary pair is a critical step of the mainstream superresolution methods. For the high time complexity and susceptible to corruption characteristics of training dictionary, an improved method based on lifting wavelet transform and robust principal component analysis is reported. The high-frequency components of example images are estimated through wavelet coefficients of 3-tier lifting wavelet transform decomposition. Sparse coefficients are similar in multiframe images. Accordingly, the inexact augmented Lagrange multiplier method is employed to achieve robust principal component analysis in the process of imposing global constraints. Experiments reveal that the new algorithm not only reduces the time complexity preserving the clarity but also improves the robustness for the corrupted example images.

Variable Step Size Maximum Correntropy Criteria Based Adaptive Filtering Algorithm

Directory of Open Access Journals (Sweden)

S. Radhika

2016-04-01

Full Text Available Maximum correntropy criterion (MCC based adaptive filters are found to be robust against impulsive interference. This paper proposes a novel MCC based adaptive filter with variable step size in order to obtain improved performance in terms of both convergence rate and steady state error with robustness against impulsive interference. The optimal variable step size is obtained by minimizing the Mean Square Deviation (MSD error from one iteration to the other. Simulation results in the context of a highly impulsive system identification scenario show that the proposed algorithm has faster convergence and lesser steady state error than the conventional MCC based adaptive filters.

Paired structures and other opposite-based models

DEFF Research Database (Denmark)

Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

2015-01-01

, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

International Nuclear Information System (INIS)

Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

2017-01-01

Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

Pair Negotiation When Developing English Speaking Tasks

Science.gov (United States)

Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena

2011-01-01

This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

DNA electronic circular dichroism on the inter-base pair scale

DEFF Research Database (Denmark)

Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

2015-01-01

A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

Science.gov (United States)

Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

2012-09-12

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

Directory of Open Access Journals (Sweden)

Das Tanmoy

2012-03-01

Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

Science.gov (United States)

Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

2012-12-01

A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

Split-step scheme for photon-pair generation through spontaneous four-wave mixing

DEFF Research Database (Denmark)

Koefoed, Jacob Gade; Christensen, Jesper Bjerge; Rottwitt, Karsten

2017-01-01

The rapid development of quantum information technology requires the ability to reliably create and distribute single photons [1]. Photon-pair production through spontaneous four-wave mixing (SpFWM) allows heralded single photons to be generated at communication wavelengths and in fiber, compatible...... with conventional communication systems, with small losses. Creating single photons in desired quantum states require careful design of waveguide structures. This is greatly facilitated by a general numerical approach as presented here. Additionally, such a numerical approach allows detailed analysis of real...... systems where all relevent effects are included....

Non-standard base pairing and stacked structures in methyl xanthine clusters

Czech Academy of Sciences Publication Activity Database

Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

2008-01-01

Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

NLO-QCD corrections to Higgs pair production in the MSSM

Energy Technology Data Exchange (ETDEWEB)

Agostini, A.; Degrassi, G. [Dipartimento di Matematica e Fisica, Università di Roma Tre, Via della Vasca Navale 84, I-00146 Rome (Italy); INFN, Sezione di Roma Tre, Via della Vasca Navale 84, I-00146 Rome (Italy); Gröber, R. [INFN, Sezione di Roma Tre, Via della Vasca Navale 84, I-00146 Rome (Italy); Slavich, P. [LPTHE, UPMC University Paris 06, Sorbonne Universités, 4 Place Jussieu, F-75252 Paris (France); LPTHE, CNRS, 4 Place Jussieu, F-75252 Paris (France)

2016-04-18

We take a step towards a complete NLO-QCD determination of the production of a pair of Higgs scalars in the MSSM. Exploiting a low-energy theorem that connects the Higgs-gluon interactions to the derivatives of the gluon self-energy, we obtain analytic results for the one- and two-loop squark contributions to Higgs pair production in the limit of vanishing external momenta. We find that the two-loop squark contributions can have non-negligible effects in MSSM scenarios with stop masses below the TeV scale. We also show how our results can be adapted to the case of Higgs pair production in the NMSSM.

Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

Science.gov (United States)

Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

2017-10-06

In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Optimal working pairs for solar adsorption cooling applications

International Nuclear Information System (INIS)

Allouhi, A.; Kousksou, T.; Jamil, A.; El Rhafiki, T.; Mourad, Y.; Zeraouli, Y.

2015-01-01

This article suggests a detailed comparison of 7 working pairs intended for use in solar adsorption cooling systems. The performance analysis was based on two indicators: adsorption capacity and solar coefficient of performance. Based on a reformed form of the Dubinin–Astakhov equation, a 3D graph was constructed to show the adsorbate concentration in the appropriate adsorbent as a first step to determine the adsorption capacity. A MATLAB program was developed to solve the system equation to predict the solar coefficient of performance for a typical summer day in a Moroccan city Fez. It was found that maximal adsorption capacity is obtained by activated carbon fibre/methanol (0.3406 kg kg −1 ) followed by activated carbon/methanol (0.2565 kg kg −1 ) and activated carbon/ethanol (0.2008 kg kg −1 ). At a condenser temperature of 25 °C, with an adsorbent mass of 20 kg, and an integrated collector-reactor configuration, the couple silica gel/water for air conditioning purpose can reach an SCOP of 0.3843. Activated carbon fibre/methanol is the following more efficient couple and can be used in the different cooling applications with an SCOP ranging from 0.1726 to 0.3287. Furthermore, adequate indicators are evaluated addressing the economic, environmental and safe aspects associated with each working pair. - Highlights: • 7 working pairs intended for use in solar adsorption cooling systems are compared. • A MATLAB program is used to predict the solar coefficient of performance. • Maximal adsorption capacity is obtained by activated carbon fibre/methanol

Microcomputer-based stepping-motor controller

International Nuclear Information System (INIS)

Johnson, K.

1983-04-01

A microcomputer-controlled stepping motor is described. A Motorola MC68701 microcomputer unit is interfaced to a Cybernetic CY500 stored-program controller that outputs through Motorola input/output isolation modules to the stepping motor. A complex multifunction controller with enhanced capabilities is thus available with a minimum number of parts

3D road marking reconstruction from street-level calibrated stereo pairs

Science.gov (United States)

Soheilian, Bahman; Paparoditis, Nicolas; Boldo, Didier

This paper presents an automatic approach to road marking reconstruction using stereo pairs acquired by a mobile mapping system in a dense urban area. Two types of road markings were studied: zebra crossings (crosswalks) and dashed lines. These two types of road markings consist of strips having known shape and size. These geometric specifications are used to constrain the recognition of strips. In both cases (i.e. zebra crossings and dashed lines), the reconstruction method consists of three main steps. The first step extracts edge points from the left and right images of a stereo pair and computes 3D linked edges using a matching process. The second step comprises a filtering process that uses the known geometric specifications of road marking objects. The goal is to preserve linked edges that can plausibly belong to road markings and to filter others out. The final step uses the remaining linked edges to fit a theoretical model to the data. The method developed has been used for processing a large number of images. Road markings are successfully and precisely reconstructed in dense urban areas under real traffic conditions.

An efficient single-step scheme for manipulating quantum information of two trapped ions beyond the Lamb-Dicke limit

International Nuclear Information System (INIS)

Wei, L.F.; Nori, Franco

2003-01-01

Based on the exact conditional quantum dynamics for a two-ion system, we propose an efficient single-step scheme for coherently manipulating quantum information of two trapped cold ions by using a pair of synchronous laser pulses. Neither the auxiliary atomic level nor the Lamb-Dicke approximation are needed

Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

International Nuclear Information System (INIS)

Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

2010-01-01

2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

Science.gov (United States)

Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

2013-01-01

Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

Evidence-based practice, step by step: critical appraisal of the evidence: part II: digging deeper--examining the "keeper" studies.

Science.gov (United States)

Fineout-Overholt, Ellen; Melnyk, Bernadette Mazurek; Stillwell, Susan B; Williamson, Kathleen M

2010-09-01

This is the sixth article in a series from the Arizona State University College of Nursing and Health Innovation's Center for the Advancement of Evidence-Based Practice. Evidence-based practice (EBP) is a problem-solving approach to the delivery of health care that integrates the best evidence from studies and patient care data with clinician expertise and patient preferences and values. When delivered in a context of caring and in a supportive organizational culture, the highest quality of care and best patient outcomes can be achieved. The purpose of this series is to give nurses the knowledge and skills they need to implement EBP consistently, one step at a time. Articles will appear every two months to allow you time to incorporate information as you work toward implementing EBP at your institution. Also, we've scheduled "Chat with the Authors" calls every few months to provide a direct line to the experts to help you resolve questions. Details about how to participate in the next call will be published with November's Evidence-Based Practice, Step by Step.

Efficient Implementation of the Pairing on Mobilephones Using BREW

Science.gov (United States)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

Science.gov (United States)

Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

2012-01-01

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

One Step Quantum Key Distribution Based on EPR Entanglement.

Science.gov (United States)

Li, Jian; Li, Na; Li, Lei-Lei; Wang, Tao

2016-06-30

A novel quantum key distribution protocol is presented, based on entanglement and dense coding and allowing asymptotically secure key distribution. Considering the storage time limit of quantum bits, a grouping quantum key distribution protocol is proposed, which overcomes the vulnerability of first protocol and improves the maneuverability. Moreover, a security analysis is given and a simple type of eavesdropper's attack would introduce at least an error rate of 46.875%. Compared with the "Ping-pong" protocol involving two steps, the proposed protocol does not need to store the qubit and only involves one step.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

Science.gov (United States)

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

Science.gov (United States)

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

Czech Academy of Sciences Publication Activity Database

Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

2012-01-01

Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

A sensitive short read homology search tool for paired-end read sequencing data.

Science.gov (United States)

Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai

2017-10-16

Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at https://sourceforge.net/projects/short-pair/ .

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Multi-pair states in electron–positron pair creation

Directory of Open Access Journals (Sweden)

Anton Wöllert

2016-09-01

Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Multi-pair states in electron–positron pair creation

Energy Technology Data Exchange (ETDEWEB)

Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

2016-09-10

Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Multi-pair states in electron–positron pair creation

International Nuclear Information System (INIS)

Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

2016-01-01

Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Student Opinions about the Seven-Step Procedure in Problem-Based Hospitality Management Education

Science.gov (United States)

Zwaal, Wichard; Otting, Hans

2014-01-01

This study investigates how hospitality management students appreciate the role and application of the seven-step procedure in problem-based learning. A survey was developed containing sections about personal characteristics, recall of the seven steps, overall report marks, and 30 statements about the seven-step procedure. The survey was…

Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

International Nuclear Information System (INIS)

Swasey, Steven M; Gwinn, Elisabeth G

2016-01-01

The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

Molecular dynamics based enhanced sampling of collective variables with very large time steps

Science.gov (United States)

Chen, Pei-Yang; Tuckerman, Mark E.

2018-01-01

Enhanced sampling techniques that target a set of collective variables and that use molecular dynamics as the driving engine have seen widespread application in the computational molecular sciences as a means to explore the free-energy landscapes of complex systems. The use of molecular dynamics as the fundamental driver of the sampling requires the introduction of a time step whose magnitude is limited by the fastest motions in a system. While standard multiple time-stepping methods allow larger time steps to be employed for the slower and computationally more expensive forces, the maximum achievable increase in time step is limited by resonance phenomena, which inextricably couple fast and slow motions. Recently, we introduced deterministic and stochastic resonance-free multiple time step algorithms for molecular dynamics that solve this resonance problem and allow ten- to twenty-fold gains in the large time step compared to standard multiple time step algorithms [P. Minary et al., Phys. Rev. Lett. 93, 150201 (2004); B. Leimkuhler et al., Mol. Phys. 111, 3579-3594 (2013)]. These methods are based on the imposition of isokinetic constraints that couple the physical system to Nosé-Hoover chains or Nosé-Hoover Langevin schemes. In this paper, we show how to adapt these methods for collective variable-based enhanced sampling techniques, specifically adiabatic free-energy dynamics/temperature-accelerated molecular dynamics, unified free-energy dynamics, and by extension, metadynamics, thus allowing simulations employing these methods to employ similarly very large time steps. The combination of resonance-free multiple time step integrators with free-energy-based enhanced sampling significantly improves the efficiency of conformational exploration.

Data-based control of a multi-step forming process

Science.gov (United States)

Schulte, R.; Frey, P.; Hildenbrand, P.; Vogel, M.; Betz, C.; Lechner, M.; Merklein, M.

2017-09-01

The fourth industrial revolution represents a new stage in the organization and management of the entire value chain. However, concerning the field of forming technology, the fourth industrial revolution has only arrived gradually until now. In order to make a valuable contribution to the digital factory the controlling of a multistage forming process was investigated. Within the framework of the investigation, an abstracted and transferable model is used to outline which data have to be collected, how an interface between the different forming machines can be designed tangible and which control tasks must be fulfilled. The goal of this investigation was to control the subsequent process step based on the data recorded in the first step. The investigated process chain links various metal forming processes, which are typical elements of a multi-step forming process. Data recorded in the first step of the process chain is analyzed and processed for an improved process control of the subsequent process. On the basis of the gained scientific knowledge, it is possible to make forming operations more robust and at the same time more flexible, and thus create the fundament for linking various production processes in an efficient way.

Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

Science.gov (United States)

2014-12-11

Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

Investigation to biodiesel production by the two-step homogeneous base-catalyzed transesterification.

Science.gov (United States)

Ye, Jianchu; Tu, Song; Sha, Yong

2010-10-01

For the two-step transesterification biodiesel production made from the sunflower oil, based on the kinetics model of the homogeneous base-catalyzed transesterification and the liquid-liquid phase equilibrium of the transesterification product, the total methanol/oil mole ratio, the total reaction time, and the split ratios of methanol and reaction time between the two reactors in the stage of the two-step reaction are determined quantitatively. In consideration of the transesterification intermediate product, both the traditional distillation separation process and the improved separation process of the two-step reaction product are investigated in detail by means of the rigorous process simulation. In comparison with the traditional distillation process, the improved separation process of the two-step reaction product has distinct advantage in the energy duty and equipment requirement due to replacement of the costly methanol-biodiesel distillation column. Copyright 2010 Elsevier Ltd. All rights reserved.

4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

Science.gov (United States)

2011-01-01

Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

International Nuclear Information System (INIS)

Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

2015-01-01

Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

Directory of Open Access Journals (Sweden)

Ye Zhi-Qiang

2011-08-01

Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

International Nuclear Information System (INIS)

Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

2014-01-01

The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

Science.gov (United States)

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Readout ASIC of pair-monitor for international linear collider

International Nuclear Information System (INIS)

Sato, Yutaro; Ikeda, Hirokazu; Ito, Kazutoshi; Miyamoto, Akiya; Nagamine, Tadashi; Sasaki, Rei; Takubo, Yosuke; Tauchi, Toshiaki; Yamamoto, Hitoshi

2010-01-01

The pair-monitor is a beam profile monitor at the interaction point of the international linear collider. A prototype of the readout ASIC for the pair-monitor has been designed and tested. Since the pair-monitor uses the hit distribution of electrons and positrons generated by the beam-crossing to measure the beam profile, the readout ASIC is designed to count the number of hits. In a prototype ASIC, 36 readout cells were implemented by TSMC 0.25-μm CMOS process. Each readout cell is equipped with an amplifier, comparator, 8-bit counter and 16 count-registers. By the operation test, all the ASIC component were confirmed to work correctly. As the next step, we develop the prototype ASIC with the silicon on insulator technology. It is produced with OKI 0.2-μm FD-SOI CMOS process.

Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

International Nuclear Information System (INIS)

Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

1995-01-01

For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Influence of nature, concentration and pH of buffer acid-base system on rate determining step of the electrochemiluminescence of Ru(bpy)32+ with tertiary aliphatic amines

International Nuclear Information System (INIS)

Pastore, Paolo; Badocco, Denis; Zanon, Francesco

2006-01-01

The electrogenerated chemiluminescence (ECL) of Ru(bpy) 3 2+ (bpy 2,2'-bipyridyl) with tertiary aliphatic amines as co-reactants, was theoretically and experimentally studied as a function of the pre-equilibria involved in the ammonium proton lost and in relation to the nature of the rate determining step. Transient potential steps were used with a 3-mm glassy carbon disk electrode or carbon fiber ultramicroelectrodes array to investigate emission behavior in a variety of aqueous solution types, containing phosphate, tartrate and phthalate acid-base systems at differing pH values. The emission of Ru(bpy) 3 2+ resulting from the reaction with n-tripropylamine (TPrA), tri-isobutylamine (TisoBuA), n-tributylamine (TBuA), methyl-di-n-propylamine (MeDPrA) and triethylamine (TEtA) in varying acid-base media was interpreted on the basis of the quoted pre-equilibria, ammonium pK a being known. The nature of the rate determining steps changes depending on pH. Above pH ∼ 5 the amine neutral radical formation is the rate determining step and, is independent of pH with rate constant close to 10 3 s -1 ; below pH ∼ 5 the rate determining step becomes the deprotonation of the ammonium ion, operated by different bases present in solution. Different amines in the same acid-base system showed analogous ECL behavior, conditioned by the chosen acid base system. A single amine in different acid-base systems showed different kinetic behaviors, due to the dissociation constants of the chosen buffers. The concentration of the acid-base system also played an important role and influenced emission intensity and shape. ECL emission were simulated by finite difference methods, implementing a previously proposed mechanism by including the relevant pre-equilibria. Simulation may also give estimates of the pK a values of the ammonium ions. An ion pair formation between R 3 N· + and the mostly charged species present in solution is hypothesized to explain the contradictory experimental

Using Analogy to Solve a Three-Step Physics Problem

Science.gov (United States)

Lin, Shih-Yin; Singh, Chandralekha

2010-10-01

In a companion paper, we discuss students' ability to take advantage of what they learn from a solved problem and transfer their learning to solve a quiz problem that has different surface features but the same underlying physics principles. Here, we discuss students' ability to perform analogical reasoning between another pair of problems. Both the problems can be solved using the same physics principles. However, the solved problem provided was a two-step problem (which can be solved by decomposing it into two sub-problems) while the quiz problem was a three-step problem. We find that it is challenging for students to extend what they learned from a two-step problem to solve a three-step problem.

Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

Science.gov (United States)

Mokhtari, D.; Fellah, M.; Allal, N. H.

2016-05-01

A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

Improved Full-Newton Step O(nL) Infeasible Interior-Point Method for Linear Optimization

OpenAIRE

Gu, G.; Mansouri, H.; Zangiabadi, M.; Bai, Y.Q.; Roos, C.

2009-01-01

We present several improvements of the full-Newton step infeasible interior-point method for linear optimization introduced by Roos (SIAM J. Optim. 16(4):1110–1136, 2006). Each main step of the method consists of a feasibility step and several centering steps. We use a more natural feasibility step, which targets the ?+-center of the next pair of perturbed problems. As for the centering steps, we apply a sharper quadratic convergence result, which leads to a slightly wider neighborhood for th...

PID controller auto-tuning based on process step response and damping optimum criterion.

Science.gov (United States)

Pavković, Danijel; Polak, Siniša; Zorc, Davor

2014-01-01

This paper presents a novel method of PID controller tuning suitable for higher-order aperiodic processes and aimed at step response-based auto-tuning applications. The PID controller tuning is based on the identification of so-called n-th order lag (PTn) process model and application of damping optimum criterion, thus facilitating straightforward algebraic rules for the adjustment of both the closed-loop response speed and damping. The PTn model identification is based on the process step response, wherein the PTn model parameters are evaluated in a novel manner from the process step response equivalent dead-time and lag time constant. The effectiveness of the proposed PTn model parameter estimation procedure and the related damping optimum-based PID controller auto-tuning have been verified by means of extensive computer simulations. © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

International Nuclear Information System (INIS)

Lee, K.M.; Marshall, A.G.

1987-01-01

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

Step-by-Step Simulation of Radiation Chemistry Using Green Functions for Diffusion-Influenced Reactions

Science.gov (United States)

Plante, Ianik; Cucinotta, Francis A.

2011-01-01

Radiolytic species are formed approximately 1 ps after the passage of ionizing radiation through matter. After their formation, they diffuse and chemically react with other radiolytic species and neighboring biological molecules, leading to various oxidative damage. Therefore, the simulation of radiation chemistry is of considerable importance to understand how radiolytic species damage biological molecules [1]. The step-by-step simulation of chemical reactions is difficult, because the radiolytic species are distributed non-homogeneously in the medium. Consequently, computational approaches based on Green functions for diffusion-influenced reactions should be used [2]. Recently, Green functions for more complex type of reactions have been published [3-4]. We have developed exact random variate generators of these Green functions [5], which will allow us to use them in radiation chemistry codes. Moreover, simulating chemistry using the Green functions is which is computationally very demanding, because the probabilities of reactions between each pair of particles should be evaluated at each timestep [2]. This kind of problem is well adapted for General Purpose Graphic Processing Units (GPGPU), which can handle a large number of similar calculations simultaneously. These new developments will allow us to include more complex reactions in chemistry codes, and to improve the calculation time. This code should be of importance to link radiation track structure simulations and DNA damage models.

Scanning tunneling microscope with a rotary piezoelectric stepping motor

Science.gov (United States)

Yakimov, V. N.

1996-02-01

A compact scanning tunneling microscope (STM) with a novel rotary piezoelectric stepping motor for coarse positioning has been developed. An inertial method for rotating of the rotor by the pair of piezoplates has been used in the piezomotor. Minimal angular step size was about several arcsec with the spindle working torque up to 1 N×cm. Design of the STM was noticeably simplified by utilization of the piezomotor with such small step size. A shaft eccentrically attached to the piezomotor spindle made it possible to push and pull back the cylindrical bush with the tubular piezoscanner. A linear step of coarse positioning was about 50 nm. STM resolution in vertical direction was better than 0.1 nm without an external vibration isolation.

Investigations into nuclear pairing

International Nuclear Information System (INIS)

Clark, R.M.

2006-01-01

This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

Sordaria, a model system to uncover links between meiotic pairing and recombination.

Science.gov (United States)

Zickler, Denise; Espagne, Eric

2016-06-01

The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.

Matched molecular pair-based data sets for computer-aided medicinal chemistry

Science.gov (United States)

Bajorath, Jürgen

2014-01-01

Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

Aerial robot intelligent control method based on back-stepping

Science.gov (United States)

Zhou, Jian; Xue, Qian

2018-05-01

The aerial robot is characterized as strong nonlinearity, high coupling and parameter uncertainty, a self-adaptive back-stepping control method based on neural network is proposed in this paper. The uncertain part of the aerial robot model is compensated online by the neural network of Cerebellum Model Articulation Controller and robust control items are designed to overcome the uncertainty error of the system during online learning. At the same time, particle swarm algorithm is used to optimize and fix parameters so as to improve the dynamic performance, and control law is obtained by the recursion of back-stepping regression. Simulation results show that the designed control law has desired attitude tracking performance and good robustness in case of uncertainties and large errors in the model parameters.

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Robust and unobtrusive algorithm based on position independence for step detection

Science.gov (United States)

Qiu, KeCheng; Li, MengYang; Luo, YiHan

2018-04-01

Running is becoming one of the most popular exercises among the people, monitoring steps can help users better understand their running process and improve exercise efficiency. In this paper, we design and implement a robust and unobtrusive algorithm based on position independence for step detection under real environment. It applies Butterworth filter to suppress high frequency interference and then employs the projection based on mathematics to transform system to solve the problem of unknown position of smartphone. Finally, using sliding window to suppress the false peak. The algorithm was tested for eight participants on the Android 7.0 platform. In our experiments, the results show that the proposed algorithm can achieve desired effect in spite of device pose.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

Science.gov (United States)

Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

2013-12-12

The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

Science.gov (United States)

Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

2017-09-01

Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

NARCIS (Netherlands)

Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

2013-01-01

Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

Two-step estimation procedures for inhomogeneous shot-noise Cox processes

DEFF Research Database (Denmark)

Prokesová, Michaela; Dvorák, Jirí; Jensen, Eva B. Vedel

In the present paper we develop several two-step estimation procedures for inhomogeneous shot-noise Cox processes. The intensity function is parametrized by the inhomogeneity parameters while the pair-correlation function is parametrized by the interaction parameters. The suggested procedures...

Extraction of Human Stepping Pattern Using Acceleration Sensors

Directory of Open Access Journals (Sweden)

Toyohira Takayuki

2017-01-01

Full Text Available Gait analysis plays an important role in characterizing individuals and each condition and gait analysis systems have been developed using various devices or instruments. However, most systems do not catch synchronous stepping actions between right foot and left foot. For obtaining a precise gait pattern, a synchronous walking sensing system is developed, in which a pair of acceleration and angular velocity sensors are attached to left and right shoes of a walking person and their data are transmitted to a PC through a wireless channel. Walking data from 19 persons of the age of 14 to 20 are acquired for walking analysis. Stepping time diagrams are extracted from the acquired data of right and left foot actions of stepping-off and-on the ground, and the time diagrams distinguish between an ordinary person and a person injured on left leg, and a stepping recovery process of the injured person is shown. Synchronous sensing of stepping action between right foot and left foot contributes to obtain precise stepping patterns.

Separation of photo-induced radical pair in cryptochrome to a functionally critical distance

DEFF Research Database (Denmark)

Solov'yov, Ilia; Domratcheva, Tatiana; Schulten, Klaus

2014-01-01

Cryptochrome is a blue light receptor that acts as a sensor for the geomagnetic field and assists many animals in long-range navigation. The magnetoreceptor function arises from light-induced formation of a radical pair through electron transfer between a flavin cofactor (FAD) and a triad...... of tryptophan residues. Here, this electron transfer is investigated by quantum chemical and classical molecular dynamics calculations. The results reveal how sequential electron transfer, assisted by rearrangement of polar side groups in the cryptochrome interior, can yield a FAD-Trp radical pair state...... step can overcome in speed both recombination (electron back-transfer) and proton transfer involving the radical pair reached after primary electron transfer....

Cryptosystem based on two-step phase-shifting interferometry and the RSA public-key encryption algorithm

Science.gov (United States)

Meng, X. F.; Peng, X.; Cai, L. Z.; Li, A. M.; Gao, Z.; Wang, Y. R.

2009-08-01

A hybrid cryptosystem is proposed, in which one image is encrypted to two interferograms with the aid of double random-phase encoding (DRPE) and two-step phase-shifting interferometry (2-PSI), then three pairs of public-private keys are utilized to encode and decode the session keys (geometrical parameters, the second random-phase mask) and interferograms. In the stage of decryption, the ciphered image can be decrypted by wavefront reconstruction, inverse Fresnel diffraction, and real amplitude normalization. This approach can successfully solve the problem of key management and dispatch, resulting in increased security strength. The feasibility of the proposed cryptosystem and its robustness against some types of attack are verified and analyzed by computer simulations.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Node-pair reliability of network systems with small distances between adjacent nodes

International Nuclear Information System (INIS)

Malinowski, Jacek

2007-01-01

A new method for computing the node-pair reliability of network systems modeled by random graphs with nodes arranged in sequence is presented. It is based on a recursive algorithm using the 'sliding window' technique, the window being composed of several consecutive nodes. In a single step, the connectivity probabilities for all nodes included in the window are found. Subsequently, the window is moved one node forward. This process is repeated until, in the last step, the window reaches the terminal node. The connectivity probabilities found at that point are used to compute the node-pair reliability of the network system considered. The algorithm is designed especially for graphs with small distances between adjacent nodes, where the distance between two nodes is defined as the absolute value of the difference between the nodes' numbers. The maximal distance between any two adjacent nodes is denoted by Γ(G), where G symbolizes a random graph. If Γ(G)=2 then the method can be applied for directed as well as undirected graphs whose nodes and edges are subject to failure. This is important in view of the fact that many algorithms computing network reliability are designed for graphs with failure-prone edges and reliable nodes. If Γ(G)=3 then the method's applicability is limited to undirected graphs with reliable nodes. The main asset of the presented algorithms is their low numerical complexity-O(n), where n denotes the number of nodes

Meraculous: De Novo Genome Assembly with Short Paired-End Reads

Energy Technology Data Exchange (ETDEWEB)

Chapman, Jarrod A.; Ho, Isaac; Sunkara, Sirisha; Luo, Shujun; Schroth, Gary P.; Rokhsar, Daniel S.; Salzberg, Steven L.

2011-08-18

We describe a new algorithm, meraculous, for whole genome assembly of deep paired-end short reads, and apply it to the assembly of a dataset of paired 75-bp Illumina reads derived from the 15.4 megabase genome of the haploid yeast Pichia stipitis. More than 95% of the genome is recovered, with no errors; half the assembled sequence is in contigs longer than 101 kilobases and in scaffolds longer than 269 kilobases. Incorporating fosmid ends recovers entire chromosomes. Meraculous relies on an efficient and conservative traversal of the subgraph of the k-mer (deBruijn) graph of oligonucleotides with unique high quality extensions in the dataset, avoiding an explicit error correction step as used in other short-read assemblers. A novel memory-efficient hashing scheme is introduced. The resulting contigs are ordered and oriented using paired reads separated by ~280 bp or ~3.2 kbp, and many gaps between contigs can be closed using paired-end placements. Practical issues with the dataset are described, and prospects for assembling larger genomes are discussed.

Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

International Nuclear Information System (INIS)

Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

2011-01-01

3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

Centromere pairing by a plasmid-encoded type I ParB protein

DEFF Research Database (Denmark)

Ringgaard, Simon; Löwe, Jan; Gerdes, Kenn

2007-01-01

The par2 locus of Escherichia coli plasmid pB171 encodes two trans-acting proteins, ParA and ParB, and two cis-acting sites, parC1 and parC2, to which ParB binds cooperatively. ParA is related to MinD and oscillates in helical structures and thereby positions ParB/parC-carrying plasmids regularly......, hence identifying the N terminus of ParB as a requirement for ParB-mediated centromere pairing. These observations suggest that centromere pairing is an important intermediate step in plasmid partitioning mediated by the common type I loci....

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

Science.gov (United States)

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effectiveness of "Step into Health" program in Qatar: a pedometer-based longitudinal study.

Science.gov (United States)

Al-Kuwari, Mohamed G; Al-Mohannadi, Abdulla S; Sayegh, Suzan

2017-11-01

This study examines the impact of a one-year pedometer-based intervention on increasing the physical activity level among adult population in Qatar. This longitudinal study was conducted over a one-year period and included a total of 268 adults aged between 18-64 years old. Data were extracted and used from the "Step into Health" (SIH) program, a community-based program launched in 2012, as an approach to improve physical activity in Qatar. Walking intervention encouraged members of SIH to accumulate 10,000 steps or more per day and monitor their progress through a pedometer supported by a self-monitoring online account and a reinforcement system. This study shows a significant increase in average daily steps from 3933±3240 steps/day at baseline into 7507±5416 steps/week at the 12th month (P<0.001). It was found that 18.6% of participants met the daily target of 10,000 steps or more; however, there was a considerable increase of 39.2% by the 12th month. Females showed an increase in their physical activity; still, they remain less active than males. It was found that non-Arabs subgroup were more active than Arabs. Interestingly, older members (≥50 years old) were more active throughout the study period. Pedometer program was found to be effective in increasing the level of physical activity among participants. A decline in physical activity has been observed during hot weather, while re-enforcement campaign had a positive impact on the number of steps/day.

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Flexible biodegradable citrate-based polymeric step-index optical fiber.

Science.gov (United States)

Shan, Dingying; Zhang, Chenji; Kalaba, Surge; Mehta, Nikhil; Kim, Gloria B; Liu, Zhiwen; Yang, Jian

2017-10-01

Implanting fiber optical waveguides into tissue or organs for light delivery and collection is among the most effective ways to overcome the issue of tissue turbidity, a long-standing obstacle for biomedical optical technologies. Here, we report a citrate-based material platform with engineerable opto-mechano-biological properties and demonstrate a new type of biodegradable, biocompatible, and low-loss step-index optical fiber for organ-scale light delivery and collection. By leveraging the rich designability and processibility of citrate-based biodegradable polymers, two exemplary biodegradable elastomers with a fine refractive index difference and yet matched mechanical properties and biodegradation profiles were developed. Furthermore, we developed a two-step fabrication method to fabricate flexible and low-loss (0.4 db/cm) optical fibers, and performed systematic characterizations to study optical, spectroscopic, mechanical, and biodegradable properties. In addition, we demonstrated the proof of concept of image transmission through the citrate-based polymeric optical fibers and conducted in vivo deep tissue light delivery and fluorescence sensing in a Sprague-Dawley (SD) rat, laying the groundwork for realizing future implantable devices for long-term implantation where deep-tissue light delivery, sensing and imaging are desired, such as cell, tissue, and scaffold imaging in regenerative medicine and in vivo optogenetic stimulation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Stepping to the Beat: Feasibility and Potential Efficacy of a Home-Based Auditory-Cued Step Training Program in Chronic Stroke

Directory of Open Access Journals (Sweden)

Rachel L. Wright

2017-08-01

Full Text Available BackgroundHemiparesis after stroke typically results in a reduced walking speed, an asymmetrical gait pattern and a reduced ability to make gait adjustments. The purpose of this pilot study was to investigate the feasibility and preliminary efficacy of home-based training involving auditory cueing of stepping in place.MethodsTwelve community-dwelling participants with chronic hemiparesis completed two 3-week blocks of home-based stepping to music overlaid with an auditory metronome. Tempo of the metronome was increased 5% each week. One 3-week block used a regular metronome, whereas the other 3-week block had phase shift perturbations randomly inserted to cue stepping adjustments.ResultsAll participants reported that they enjoyed training, with 75% completing all training blocks. No adverse events were reported. Walking speed, Timed Up and Go (TUG time and Dynamic Gait Index (DGI scores (median [inter-quartile range] significantly improved between baseline (speed = 0.61 [0.32, 0.85] m⋅s−1; TUG = 20.0 [16.0, 39.9] s; DGI = 14.5 [11.3, 15.8] and post stepping training (speed = 0.76 [0.39, 1.03] m⋅s−1; TUG = 16.3 [13.3, 35.1] s; DGI = 16.0 [14.0, 19.0] and was maintained at follow-up (speed = 0.75 [0.41, 1.03] m⋅s−1; TUG = 16.5 [12.9, 34.1] s; DGI = 16.5 [13.5, 19.8].ConclusionThis pilot study suggests that auditory-cued stepping conducted at home was feasible and well-tolerated by participants post-stroke, with improvements in walking and functional mobility. No differences were detected between regular and phase-shift training with the metronome at each assessment point.

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

Science.gov (United States)

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

One-step production of biodiesel from Nannochloropsis sp. on solid base Mg-Zr catalyst

International Nuclear Information System (INIS)

Li, Yuesong; Lian, Shuang; Tong, Dongmei; Song, Ruili; Yang, Wenyan; Fan, Yong; Qing, Renwei; Hu, Changwei

2011-01-01

Nannochloropsis sp., one kind of green microalgae cultivated autotrophically and axenically in laboratory, is used as raw material to produce biodiesel by one-step method in an amended reactor. The effects of several reaction parameters on transesterification over Mg-Zr solid base catalyst were investigated through both conventional method and one-step method. One-step method could give a higher yield of methyl ester than conventional two-step method, which demonstrates that the present one-step method is suitable for biodiesel production from the microalgae Nannochloropsis sp. Moreover, the present one-step method realizes the convenient in situ separation of catalyst from microalgae residue which can be easily used consequently, reducing the procedure units as well as the overall costs.

Ion-pair extraction of [3]histobadine from biological fluids

International Nuclear Information System (INIS)

Scasnar, V.

1997-01-01

A simple and specific radiometric assay was developed for determination of stobadine, a cardio protective drug, in the serum of experimental animals. It is based on a single extraction step of the radioactively labeled drug from serum into the benzene solution of dicarbolide of cobalt followed by the quantitation of the extracted radioactivity by using liquid scintillation counting. The extraction mechanism involves the ion-pair formation between the protonized molecule of stobadine and the hydrophobic, negatively charged molecule of dicarbollide of cobalt. The extraction of yield of stobadine from 1 ml of serum was 95% in the concentration range from 1 to 6000 ng/ml. The co extraction of metabolites was less than 5%. The assay was applied to determination of stobadine in serum of dogs and the data obtained were in good agreement with those obtained by high performance liquid chromatography. (author)

Are human mating preferences with respect to height reflected in actual pairings?

NARCIS (Netherlands)

Stulp, Gert; Buunk, Abraham P.; Pollet, Thomas V.; Nettle, Daniel; Verhulst, Simon

2013-01-01

Pair formation, acquiring a mate to form a reproductive unit, is a complex process. Mating preferences are a step in this process. However, due to constraining factors such as availability of mates, rival competition, and mutual mate choice, preferred characteristics may not be realised in the

Are Human Mating Preferences with Respect to Height Reflected in Actual Pairings?

NARCIS (Netherlands)

Stulp, G.; Buunk, A.P.; Pollet, T.V.; Nettle, D.; Verhulst, S.

2013-01-01

Pair formation, acquiring a mate to form a reproductive unit, is a complex process. Mating preferences are a step in this process. However, due to constraining factors such as availability of mates, rival competition, and mutual mate choice, preferred characteristics may not be realised in the

Steps that count! A feasibility study of a pedometer-based, health ...

African Journals Online (AJOL)

a large gap between the development of effective pedometer-based interventions and their ... [13] Using more cost-effective intervention strategies, such as ..... Abel M, Hannon J, Mullineaux D, Beighle A. Determination of step rate thresholds.

High-temperature morphology of stepped gold surfaces

International Nuclear Information System (INIS)

Bilalbegovic, G.; Tosatti, E.; Ercolessi, F.

1992-04-01

Molecular dynamics simulations with a classical many-body potential are used to study the high-temperature stability of stepped non-melting metal surfaces. We have studied in particular the Au(111) vicinal surfaces in the (M+1, M-1, M) family and the Au(100) vicinals in the (M, 1, 1) family. Some vicinal orientations close to the non-melting Au(111) surface become unstable close to the bulk melting temperature and facet into a mixture of crystalline (111) regions and localized surface-melted regions. On the contrary, we do not find high-temperature faceting for vicinals close to Au(100), also a non-melting surface. These (100) vicinal surfaces gradually disorder with disappearance of individual steps well below the bulk melting temperature. We have also studied the high-temperature stability of ledges formed by pairs of monoatomic steps of opposite sign on the Au(111) surface. It is found that these ledges attract each other, so that several of them merge into one larger ledge, whose edge steps then act as a nucleation site for surface melting. (author). 43 refs, 8 figs

Three-year randomized controlled clinical study of a one step universal adhesive and a two-step self-etch adhesive in Class II resin composite restorations

DEFF Research Database (Denmark)

van Dijken, Jan WV; Pallesen, Ulla

2017-01-01

Purpose: To evaluate in a randomized clinical evaluation the 3-year clinical durability of a one-step universal adhesive bonding system and compare it intraindividually with a 2-step self-etch adhesive in Class II restorations. Materials and Methods: Each of 57 participants (mean age 58.3 yr......) received at least two, as similar as possible, extended Class II restorations. The cavities in each of the 60 individual pairs of cavities were randomly distributed to the 1-step universal adhesive (All Bond Universal: AU) and the control 2-step self-etch adhesive (Optibond XTR: OX). A low shrinkage resin......) success rates (p>0.05). Annual failure rates were 1.8% and 2.6%, respectively.The main reason for failure was resin composite fracture. Conclusion: Class II resin composite restorations placed with a one-step universal adhesive showed good short time effectiveness....

EFEKTIVITAS PENGGUNAAN METODE THINK PAIR SHARE DALAM PEMBELAJARAN EKONOMI POKOK BAHASAN PEMBENTUKAN HARGA PASAR DI SMP

OpenAIRE

Joko Widodo

2007-01-01

The result of teaching-learning by using Think Pair Share method can improve the students’ activities. It can be seen from the steps to apply the Think Pair Share method that focused on student-centre. Think pair share learning has a simple structure, as a basic of the development ‘cooperative class’ which can help the learning process actively for students, thus it can improve the students’ study result. Students actively can show their ability to discuss and share and express the an...

Efektivitas Penggunaan Metode Think Pair Share Dalam Pembelajaran Ekonomi Pokok Bahasan Pembentukan Harga Pasar Di SMP

OpenAIRE

Widodo, Joko

2007-01-01

The result of teaching-learning by using Think Pair Share method can improve the students’ activities. It can be seen from the steps to apply the Think Pair Share method that focused on student-centre. Think pair share learning has a simple structure, as a basic of the development ‘cooperative class’ which can help the learning process actively for students, thus it can improve the students’ study result. Students actively can show their ability to discuss and share and express the an...

A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

Science.gov (United States)

Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

2013-10-01

A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

Simulation of Unique Pressure Changing Steps and Situations in Psa Processes

Science.gov (United States)

Ebner, Armin D.; Mehrotra, Amal; Knox, James C.; LeVan, Douglas; Ritter, James A.

2007-01-01

A more rigorous cyclic adsorption process simulator is being developed for use in the development and understanding of new and existing PSA processes. Unique features of this new version of the simulator that Ritter and co-workers have been developing for the past decade or so include: multiple absorbent layers in each bed, pressure drop in the column, valves for entering and exiting flows and predicting real-time pressurization and depressurization rates, ability to account for choked flow conditions, ability to pressurize and depressurize simultaneously from both ends of the columns, ability to equalize between multiple pairs of columns, ability to equalize simultaneously from both ends of pairs of columns, and ability to handle very large pressure ratios and hence velocities associated with deep vacuum systems. These changes to the simulator now provide for unique opportunities to study the effects of novel pressure changing steps and extreme process conditions on the performance of virtually any commercial or developmental PSA process. This presentation will provide an overview of the cyclic adsorption process simulator equations and algorithms used in the new adaptation. It will focus primarily on the novel pressure changing steps and their effects on the performance of a PSA system that epitomizes the extremes of PSA process design and operation. This PSA process is a sorbent-based atmosphere revitalization (SBAR) system that NASA is developing for new manned exploration vehicles. This SBAR system consists of a 2-bed 3-step 3-layer system that operates between atmospheric pressure and the vacuum of space, evacuates from both ends of the column simultaneously, experiences choked flow conditions during pressure changing steps, and experiences a continuously changing feed composition, as it removes metabolic CO2 and H20 from a closed and fixed volume, i.e., the spacecraft cabin. Important process performance indicators of this SBAR system are size, and the

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

Paired fuzzy sets

DEFF Research Database (Denmark)

Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

2015-01-01

In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

An Intelligent Model for Pairs Trading Using Genetic Algorithms.

Science.gov (United States)

Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

International Nuclear Information System (INIS)

Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

2003-01-01

Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Two-step calibration method for multi-algorithm score-based face recognition systems by minimizing discrimination loss

NARCIS (Netherlands)

Susyanto, N.; Veldhuis, R.N.J.; Spreeuwers, L.J.; Klaassen, C.A.J.; Fierrez, J.; Li, S.Z.; Ross, A.; Veldhuis, R.; Alonso-Fernandez, F.; Bigun, J.

2016-01-01

We propose a new method for combining multi-algorithm score-based face recognition systems, which we call the two-step calibration method. Typically, algorithms for face recognition systems produce dependent scores. The two-step method is based on parametric copulas to handle this dependence. Its

Probing the pairing interaction through two-neutron transfer reactions

Directory of Open Access Journals (Sweden)

Margueron J.

2012-12-01

Full Text Available The treatment of the pairing interaction in mean-field-based models is addressed. In particular, the possibility to use pair transfers as A tool to better constrain this interaction is discussed. First, pairing inter-actions with various density dependencies (surface/volume mixing are used in the microscopic Hartree-Fock-Bogoliubov + quasiparticle random-phase approximation model to generate the form factors to be used in reaction calculations. Cross sections for (p,t two-neutron transfer reactions are calculated in the one-step zero-range distorted-wave Born approximation for some Tin isotopes and for incident proton energies from 15 to 35 MeV. Three different surface/volume mixings of A zero-range density-dependent pairing interaction are employed in the microscopic calculations and the sensitivity of the cross sections to the different mixings is analyzed. Differences among the three different theoretical predictions are found espacially for the nucleus 136Sn and they are more important at the incident proton energy of 15 MeV. We thus indicate (p,t two-neutron transfer reactions with very neutron-rich Sn isotopes and at proton energies around 15 MeV as good experimental cases where the surface/volume mixing of the pairing interaction may be probed. In the second part of the manuscript, ground-state to ground-state transitions are investigated. Approximations made to estimate two-nucleon transfer probabilities in ground-state to ground-state transitions and the physical interpretation of these probabilities are discussed. Probabilities are often calculated by approximating both ground states of the initial nucleus A and of the final nucleus A±2 by the same quasiparticle vacuum. We analyze two improvements of this approach. First, the effect of using two different ground states with average numbers of particles A and A±2 is quantified. Second, by using projection techniques, the role of particle number restoration is analyzed. Our analysis

Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

Science.gov (United States)

Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

2014-07-30

Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

Science.gov (United States)

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

The NIST Step Class Library (Step Into the Future)

Science.gov (United States)

1990-09-01

Figure 6. Excerpt from a STEP exclange file based on the Geometry model 1be NIST STEP Class Libary Page 13 An issue of concern in this...Scheifler, R., Gettys, J., and Newman, P., X Window System: C Library and Protocol Reference. Digital Press, Bedford, Mass, 1988. [Schenck90] Schenck, D

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

Directory of Open Access Journals (Sweden)

Manjula Pandey

2014-03-01

Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

Directory of Open Access Journals (Sweden)

Gaosheng Luo

2014-01-01

Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS

Directory of Open Access Journals (Sweden)

Editorial Foreword

2015-12-01

Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain�

Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

Energy Technology Data Exchange (ETDEWEB)

Krueger, Thomas

2016-10-19

calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

Science.gov (United States)

Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

2014-10-01

We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

DIALIGN P: Fast pair-wise and multiple sequence alignment using parallel processors

Directory of Open Access Journals (Sweden)

Kaufmann Michael

2004-09-01

Full Text Available Abstract Background Parallel computing is frequently used to speed up computationally expensive tasks in Bioinformatics. Results Herein, a parallel version of the multi-alignment program DIALIGN is introduced. We propose two ways of dividing the program into independent sub-routines that can be run on different processors: (a pair-wise sequence alignments that are used as a first step to multiple alignment account for most of the CPU time in DIALIGN. Since alignments of different sequence pairs are completely independent of each other, they can be distributed to multiple processors without any effect on the resulting output alignments. (b For alignments of large genomic sequences, we use a heuristics by splitting up sequences into sub-sequences based on a previously introduced anchored alignment procedure. For our test sequences, this combined approach reduces the program running time of DIALIGN by up to 97%. Conclusions By distributing sub-routines to multiple processors, the running time of DIALIGN can be crucially improved. With these improvements, it is possible to apply the program in large-scale genomics and proteomics projects that were previously beyond its scope.

Investigating the role of ion-pair strategy in regulating nicotine release from patch: Mechanistic insights based on intermolecular interaction and mobility of pressure sensitive adhesive.

Science.gov (United States)

Li, Qiaoyun; Wan, Xiaocao; Liu, Chao; Fang, Liang

2018-07-01

The aim of this study was to prepare a drug-in-adhesive patch of nicotine (NIC) and use ion-pair strategy to regulate drug delivery rate. Moreover, the mechanism of how ion-pair strategy regulated drug release was elucidated at molecular level. Formulation factors including pressure sensitive adhesives (PSAs), drug loading and counter ions (C 4 , C 6 , C 8 , C 10 , and C 12 ) were screened. In vitro release experiment and in vitro transdermal experiment were conducted to determine the rate-limiting step in drug delivery process. FT-IR and molecular modeling were used to characterize the interaction between drug and PSA. Thermal analysis and rheology study were conducted to investigate the mobility variation of PSA. The optimized patch prepared with NIC-C 8 had the transdermal profile fairly close to that of the commercial product (p > 0.05). The release rate constants (k) of NIC, NIC-C 4 and NIC-C 10 were 21.1, 14.4 and 32.4, respectively. Different release rates of NIC ion-pair complexes were attributed to the dual effect of ion-pair strategy on drug release. On one hand, ion-pair strategy enhanced the interaction between drug and PSA, which inhibited drug release. On the other hand, using ion-pair strategy improved the mobility of PSA, which facilitated drug release. Drug release behavior was determined by combined effect of two aspects above. These conclusions provided a new idea for us to regulate drug release behavior from patch. Copyright © 2018 Elsevier B.V. All rights reserved.

CsI Calorimeter for a Compton-Pair Telescope

Science.gov (United States)

Grove, Eric J.

We propose to build and test a hodoscopic CsI(Tl) scintillating-crystal calorimeter for a medium-energy γ-ray Compton and pair telescope. The design and technical approach for this calorimeter relies deeply on heritage from the Fermi LAT CsI Calorimeter, but it dramatically improves the low-energy performance of that design by reading out the scintillation light with silicon photomultipliers (SiPMs), making the technology developed for Fermi applicable in the Compton regime. While such a hodoscopic calorimeter is useful for an entire class of medium-energy γ-ray telescope designs, we propose to build it explicitly to support beam tests and balloon flight of the Proto-ComPair telescope, the development and construction of which was funded in a four-year APRA program beginning in 2015 ("ComPair: Steps to a Medium Energy γ-ray Mission" with PI J. McEnery of GSFC). That award did not include funding for its CsI calorimeter subsystem, and this proposal is intended to cover that gap. ComPair is a MIDEX-class instrument concept to perform a high-sensitivity survey of the γ-ray sky from 0.5 MeV to 500 MeV. ComPair is designed to provide a dramatic increase in sensitivity relative to previous instruments in this energy range (predominantly INTEGRAL/SPI and Compton COMPTEL), with the same transformative sensitivity increase - and corresponding scientific return- that the Fermi Large Area Telescope provided relative to Compton EGRET. To enable transformative science over a broad range of MeV energies and with a wide field of view, ComPair is a combined Compton telescope and pair telescope employing a silicon-strip tracker (for Compton scattering and pair conversion and tracking) and a solid-state CdZnTe calorimeter (for Compton absorption) and CsI calorimeter (for pair calorimetry), surrounded by a plastic scintillator anti-coincidence detector. Under the current proposal, we will complete the detailed design, assembly, and test of the CsI calorimeter for the risk

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

Science.gov (United States)

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

OpenAIRE

Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

2016-01-01

It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

Czech Academy of Sciences Publication Activity Database

Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

2016-01-01

Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

Pair Negotiation When Developing English Speaking Tasks

Directory of Open Access Journals (Sweden)

Ingrid Liliana Bohórquez Suárez

2011-12-01

Full Text Available This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students’ negotiations: Establishing a connection with a partner to work with, proposing practical alternatives, refusing mates’ propositions, and making practical decisions. Moreover, we found that the constant performance of the process of negotiation provokes students to construct a sociolinguistic identity that allows agreements to emerge.

Generalized pairing strategies-a bridge from pairing strategies to colorings

Directory of Open Access Journals (Sweden)

Győrffy Lajos

2016-12-01

Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

Multi-user distribution of polarization entangled photon pairs

Energy Technology Data Exchange (ETDEWEB)

Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)

2015-10-14

We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.

Two-Step Time of Arrival Estimation for Pulse-Based Ultra-Wideband Systems

Directory of Open Access Journals (Sweden)

H. Vincent Poor

2008-05-01

Full Text Available In cooperative localization systems, wireless nodes need to exchange accurate position-related information such as time-of-arrival (TOA and angle-of-arrival (AOA, in order to obtain accurate location information. One alternative for providing accurate position-related information is to use ultra-wideband (UWB signals. The high time resolution of UWB signals presents a potential for very accurate positioning based on TOA estimation. However, it is challenging to realize very accurate positioning systems in practical scenarios, due to both complexity/cost constraints and adverse channel conditions such as multipath propagation. In this paper, a two-step TOA estimation algorithm is proposed for UWB systems in order to provide accurate TOA estimation under practical constraints. In order to speed up the estimation process, the first step estimates a coarse TOA of the received signal based on received signal energy. Then, in the second step, the arrival time of the first signal path is estimated by considering a hypothesis testing approach. The proposed scheme uses low-rate correlation outputs and is able to perform accurate TOA estimation in reasonable time intervals. The simulation results are presented to analyze the performance of the estimator.

Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

KAUST Repository

Basset, Jean-Marie

2016-06-09

The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

Combining automatic table classification and relationship extraction in extracting anticancer drug-side effect pairs from full-text articles.

Science.gov (United States)

Xu, Rong; Wang, QuanQiu

2015-02-01

Anticancer drug-associated side effect knowledge often exists in multiple heterogeneous and complementary data sources. A comprehensive anticancer drug-side effect (drug-SE) relationship knowledge base is important for computation-based drug target discovery, drug toxicity predication and drug repositioning. In this study, we present a two-step approach by combining table classification and relationship extraction to extract drug-SE pairs from a large number of high-profile oncological full-text articles. The data consists of 31,255 tables downloaded from the Journal of Oncology (JCO). We first trained a statistical classifier to classify tables into SE-related and -unrelated categories. We then extracted drug-SE pairs from SE-related tables. We compared drug side effect knowledge extracted from JCO tables to that derived from FDA drug labels. Finally, we systematically analyzed relationships between anti-cancer drug-associated side effects and drug-associated gene targets, metabolism genes, and disease indications. The statistical table classifier is effective in classifying tables into SE-related and -unrelated (precision: 0.711; recall: 0.941; F1: 0.810). We extracted a total of 26,918 drug-SE pairs from SE-related tables with a precision of 0.605, a recall of 0.460, and a F1 of 0.520. Drug-SE pairs extracted from JCO tables is largely complementary to those derived from FDA drug labels; as many as 84.7% of the pairs extracted from JCO tables have not been included a side effect database constructed from FDA drug labels. Side effects associated with anticancer drugs positively correlate with drug target genes, drug metabolism genes, and disease indications. Copyright © 2014 Elsevier Inc. All rights reserved.

Operator care and eco-concerned development of a fast, facile and economical assay for basic nitrogenous drugs based on simplified ion-pair mini-scale extraction using safer solvent combined with drop-based spectrophotometry.

Science.gov (United States)

Plianwong, Samarwadee; Sripattanaporn, Areerut; Waewsa-nga, Kwanrutai; Buacheen, Parin; Opanasopit, Praneet; Ngawhirunpat, Tanasait; Rojanarata, Theerasak

2012-08-30

A fast, facile, and economical assay for basic nitrogenous drugs has been developed based on the mini-scale extraction of the drug-dye ion pair complex combined with the use of safe-for-analyst and eco-friendlier organic extractant and drop-based micro-spectrophotometry. Instead of using large volume devices, the extraction was simply carried out in typical 1.5 mL microcentrifuge tubes along with the use of micropipettes for accurate transfer of liquids, vortex mixer for efficient partitioning of solutes and benchtop centrifuge for rapid phase separation. In the last step, back-extraction was performed by using the microvolume of acidic solution in order to concentrate the colored species into a confined aqueous microdrop and to keep the analyst away from unwanted contact and inhalation of organic solvents during the quantitation step which was achieved by using cuvetteless UV-vis micro-spectrophotometry without any prior dilutions. Using chlorpheniramine maleate as a representative analyte and n-butyl acetate as a less toxic and non-ozone depleting extractant, the miniaturized method was less laborious and much faster. It was accurate, precise and insensitive to the interferences from common excipients. Notably, it gave the assay results of drug in tablets and oral solution comparable to the large-scale pharmacopeial method while the consumption of organic solvents and the release of wastes were lowered by 200-400 folds. Copyright © 2012 Elsevier B.V. All rights reserved.

Influence of nature, concentration and pH of buffer acid-base system on rate determining step of the electrochemiluminescence of Ru(bpy){sub 3} {sup 2+} with tertiary aliphatic amines

Energy Technology Data Exchange (ETDEWEB)

Pastore, Paolo [Department of Chemical Sciences, University of Padova, Via Marzolo 1, 35131 Padova (Italy)]. E-mail: paolo.pastore@unipd.it; Badocco, Denis [Department of Chemical Sciences, University of Padova, Via Marzolo 1, 35131 Padova (Italy); Zanon, Francesco [Department of Chemical Sciences, University of Padova, Via Marzolo 1, 35131 Padova (Italy)

2006-07-28

The electrogenerated chemiluminescence (ECL) of Ru(bpy){sub 3} {sup 2+} (bpy 2,2'-bipyridyl) with tertiary aliphatic amines as co-reactants, was theoretically and experimentally studied as a function of the pre-equilibria involved in the ammonium proton lost and in relation to the nature of the rate determining step. Transient potential steps were used with a 3-mm glassy carbon disk electrode or carbon fiber ultramicroelectrodes array to investigate emission behavior in a variety of aqueous solution types, containing phosphate, tartrate and phthalate acid-base systems at differing pH values. The emission of Ru(bpy){sub 3} {sup 2+} resulting from the reaction with n-tripropylamine (TPrA), tri-isobutylamine (TisoBuA), n-tributylamine (TBuA), methyl-di-n-propylamine (MeDPrA) and triethylamine (TEtA) in varying acid-base media was interpreted on the basis of the quoted pre-equilibria, ammonium pK {sub a} being known. The nature of the rate determining steps changes depending on pH. Above pH {approx} 5 the amine neutral radical formation is the rate determining step and, is independent of pH with rate constant close to 10{sup 3} s{sup -1}; below pH {approx} 5 the rate determining step becomes the deprotonation of the ammonium ion, operated by different bases present in solution. Different amines in the same acid-base system showed analogous ECL behavior, conditioned by the chosen acid base system. A single amine in different acid-base systems showed different kinetic behaviors, due to the dissociation constants of the chosen buffers. The concentration of the acid-base system also played an important role and influenced emission intensity and shape. ECL emission were simulated by finite difference methods, implementing a previously proposed mechanism by including the relevant pre-equilibria. Simulation may also give estimates of the pK {sub a} values of the ammonium ions. An ion pair formation between R{sub 3}N{center_dot} {sup +} and the mostly charged species

[Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

Science.gov (United States)

Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

Science.gov (United States)

Mondal Roy, Sutapa

2018-08-01

The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

Energy Technology Data Exchange (ETDEWEB)

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)

2015-07-01

Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

Science.gov (United States)

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

2015-03-01

Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

Error-correcting pairs for a public-key cryptosystem

International Nuclear Information System (INIS)

Pellikaan, Ruud; Márquez-Corbella, Irene

2017-01-01

Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)

INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

Directory of Open Access Journals (Sweden)

Mudasir Mudasir

2010-06-01

Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

Science.gov (United States)

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ex situ investigation of the step bunching on crystal surfaces by atomic force microscopy

Science.gov (United States)

Krasinski, Mariusz J.

1997-07-01

We are describing ex situ observation of step bunching on the surfaces of solution grown potassium dihydrogen phosphate (KDP) and sodium chlorate monocrystals. The measurements have been done with the use of atomic force microscope. The use of this equipment allowed us to see directly the structure of macrosteps. Observation confirmed the existence of step pinning which is one of the proposed mechanisms of step bunching. Despite the very high resolution of AFM it was not possible to determine the nature of pinning point. The monatomic steps on KDP and sodium chlorate crystal surfaces are mainly one unit cell high what seems to be the result of the steps pairing. The origin of observed step pattern is discussed in frames of existing theories.

The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

Czech Academy of Sciences Publication Activity Database

Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

2002-01-01

Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2013-01-01

of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

English for au pairs the au pair's guide to learning English

CERN Document Server

Curtis, Lucy

2014-01-01

English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

2010-01-01

Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

Directory of Open Access Journals (Sweden)

Kateřina Klapilová

2014-01-01

Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

OpenAIRE

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

2014-01-01

Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

LiLEDDA: A Six-Step Forum-Based Netnographic Research Method for Nursing Science

Directory of Open Access Journals (Sweden)

MARTIN SALZMANN-ERIKSON

2012-01-01

Full Text Available Internet research methods in nursing science are less developed than in other sciences. We choose to present an approach to conducting nursing research on an internet-based forum. This paper presents LiLEDDA, a six-step forum-based netnographic research method for nursing science. The steps consist of: 1. Literature review and identification of the research question(s; 2. Locating the field(s online; 3. Ethical considerations; 4. Data gathering; 5. Data analysis and interpretation; and 6. Abstractions and trustworthiness. Traditional research approaches are limiting when studying non-normative and non-mainstream life-worlds and their cultures. We argue that it is timely to develop more up-to-date research methods and study designs applicable to nursing science that reflect social developments and human living conditions that tend to be increasingly online-based.

Comparison of crossover and jab step start techniques for base stealing in baseball.

Science.gov (United States)

Miyanishi, Tomohisa; Endo, So; Nagahara, Ryu

2017-11-01

Base stealing is an important tactic for increasing the chance of scoring in baseball. This study aimed to compare the crossover step (CS) and jab step (JS) starts for base stealing start performance and to clarify the differences between CS and JS starts in terms of three-dimensional lower extremity joint kinetics. Twelve male baseball players performed CS and JS starts, during which their motion and the force they applied to the ground were simultaneously recorded using a motion-capture system and two force platforms. The results showed that the normalised average forward external power, the average forward-backward force exerted by the left leg, and the forward velocities of the whole body centre of gravity generated by both legs and the left leg were significantly higher for the JS start than for the CS start. Moreover, the positive work done by hip extension during the left leg push-off was two-times greater for the JS start than the CS start. In conclusion, this study has demonstrated that the jab step start may be the better technique for a base stealing start and that greater positive work produced by left hip extension is probably responsible for producing its larger forward ground reaction force.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

Science.gov (United States)

Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

2016-02-22

We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

Science.gov (United States)

McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

2014-04-01

Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

NARCIS (Netherlands)

Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

2011-01-01

Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

Ion-pair extraction of [3H]stobadine from biological fluids

International Nuclear Information System (INIS)

Scasnar, V.

1998-01-01

A simple and specific radiometric assay was developed for the determination of stobadine, a cardioprotective drug, in the serum of experimental animals. The assay is based on a single extraction step of the radioactively labeled drug from serum into the benzene solution of dicarbolide of cobalt followed by quantitation of the extracted radioactivity by using liquid scintillation counting. The extraction mechanism involves the ion-pair formation between the protonized molecule of stobadine and the hydrophobic, negatively charged molecule of dicarbolide of cobalt. The extraction yield of stobadine from 1 ml of serum was 95% in the concentration range from 1 to 6000 ng/ml. The co-extraction of metabolites was less than 5%. The method was applied to the determination of stobadine in serum of dogs and the data obtained were in a good agreement with those obtained by high performance liquid chromatography. (author)

Thermodynamics of pairing phase transition in nuclei

International Nuclear Information System (INIS)

Karim, Afaque; Ahmad, Shakeb

2014-01-01

The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied

The bounded proof property via step algebras and step frames

NARCIS (Netherlands)

Bezhanishvili, N.; Ghilardi, Silvio

2013-01-01

We develop a semantic criterion for a specific rule-based calculus Ax axiomatizing a given logic L to have the so-called bounded proof property. This property is a kind of an analytic subformula property limiting the proof search space. Our main tools are one-step frames and one-step algebras. These

Action research: A practical step-by-step guide for Agricultural ...

African Journals Online (AJOL)

Based on the findings, the extensionists will be able to identify the action required to improve upon the existing situation. This calls for knowledge and skills in action oriented research. This paper provides simple, easy to follow, step-by-step guidelines which should be suitable for many situations in extension research ...

Free-Space Quantum Key Distribution with a High Generation Rate Potassium Titanyl Phosphate Waveguide Photon-Pair Source

Science.gov (United States)

Wilson, Jeffrey D.; Chaffee, Dalton W.; Wilson, Nathaniel C.; Lekki, John D.; Tokars, Roger P.; Pouch, John J.; Roberts, Tony D.; Battle, Philip; Floyd, Bertram M.; Lind, Alexander J.;

Ion-pair chromatography of nucleic acid derivatives

International Nuclear Information System (INIS)

Perrone, P.A.; Brown, P.R.

1985-01-01

Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

Science.gov (United States)

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

Directory of Open Access Journals (Sweden)

Maréchal Eric

2005-03-01

Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

A multicore based parallel image registration method.

Science.gov (United States)

Yang, Lin; Gong, Leiguang; Zhang, Hong; Nosher, John L; Foran, David J

2009-01-01

Image registration is a crucial step for many image-assisted clinical applications such as surgery planning and treatment evaluation. In this paper we proposed a landmark based nonlinear image registration algorithm for matching 2D image pairs. The algorithm was shown to be effective and robust under conditions of large deformations. In landmark based registration, the most important step is establishing the correspondence among the selected landmark points. This usually requires an extensive search which is often computationally expensive. We introduced a nonregular data partition algorithm using the K-means clustering algorithm to group the landmarks based on the number of available processing cores. The step optimizes the memory usage and data transfer. We have tested our method using IBM Cell Broadband Engine (Cell/B.E.) platform.

Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

Energy Technology Data Exchange (ETDEWEB)

Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

2017-08-15

The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

International Nuclear Information System (INIS)

Straehle, U.; Klock, G.; Schuetz, G.

1987-01-01

To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Affine pairings on ARM

NARCIS (Netherlands)

Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

2013-01-01

We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

Adiabatic pair creation in heavy-ion and laser fields

International Nuclear Information System (INIS)

Pickl, P.; Durr, D.

2008-01-01

The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)

Mahonian pairs

OpenAIRE

Sagan, Bruce E.; Savage, Carla D.

2012-01-01

We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

Science.gov (United States)

Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

2017-12-01

We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

Lax pairs: a novel type of separability

International Nuclear Information System (INIS)

Fokas, A S

2009-01-01

An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)

2-Step IMAT and 2-Step IMRT in three dimensions

International Nuclear Information System (INIS)

Bratengeier, Klaus

2005-01-01

In two dimensions, 2-Step Intensity Modulated Arc Therapy (2-Step IMAT) and 2-Step Intensity Modulated Radiation Therapy (IMRT) were shown to be powerful methods for the optimization of plans with organs at risk (OAR) (partially) surrounded by a target volume (PTV). In three dimensions, some additional boundary conditions have to be considered to establish 2-Step IMAT as an optimization method. A further aim was to create rules for ad hoc adaptations of an IMRT plan to a daily changing PTV-OAR constellation. As a test model, a cylindrically symmetric PTV-OAR combination was used. The centrally placed OAR can adapt arbitrary diameters with different gap widths toward the PTV. Along the rotation axis the OAR diameter can vary, the OAR can even vanish at some axis positions, leaving a circular PTV. The width and weight of the second segment were the free parameters to optimize. The objective function f to minimize was the root of the integral of the squared difference of the dose in the target volume and a reference dose. For the problem, two local minima exist. Therefore, as a secondary criteria, the magnitude of hot and cold spots were taken into account. As a result, the solution with a larger segment width was recommended. From plane to plane for varying radii of PTV and OAR and for different gaps between them, different sets of weights and widths were optimal. Because only one weight for one segment shall be used for all planes (respectively leaf pairs), a strategy for complex three-dimensional (3-D) cases was established to choose a global weight. In a second step, a suitable segment width was chosen, minimizing f for this global weight. The concept was demonstrated in a planning study for a cylindrically symmetric example with a large range of different radii of an OAR along the patient axis. The method is discussed for some classes of tumor/organ at risk combinations. Noncylindrically symmetric cases were treated exemplarily. The product of width and weight of

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

International Nuclear Information System (INIS)

Gao, X.; Patel, D.J.

1988-01-01

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

MIDAS robust trend estimator for accurate GPS station velocities without step detection

Science.gov (United States)

Blewitt, Geoffrey; Kreemer, Corné; Hammond, William C.; Gazeaux, Julien

2016-03-01

Automatic estimation of velocities from GPS coordinate time series is becoming required to cope with the exponentially increasing flood of available data, but problems detectable to the human eye are often overlooked. This motivates us to find an automatic and accurate estimator of trend that is resistant to common problems such as step discontinuities, outliers, seasonality, skewness, and heteroscedasticity. Developed here, Median Interannual Difference Adjusted for Skewness (MIDAS) is a variant of the Theil-Sen median trend estimator, for which the ordinary version is the median of slopes vij = (xj-xi)/(tj-ti) computed between all data pairs i > j. For normally distributed data, Theil-Sen and least squares trend estimates are statistically identical, but unlike least squares, Theil-Sen is resistant to undetected data problems. To mitigate both seasonality and step discontinuities, MIDAS selects data pairs separated by 1 year. This condition is relaxed for time series with gaps so that all data are used. Slopes from data pairs spanning a step function produce one-sided outliers that can bias the median. To reduce bias, MIDAS removes outliers and recomputes the median. MIDAS also computes a robust and realistic estimate of trend uncertainty. Statistical tests using GPS data in the rigid North American plate interior show ±0.23 mm/yr root-mean-square (RMS) accuracy in horizontal velocity. In blind tests using synthetic data, MIDAS velocities have an RMS accuracy of ±0.33 mm/yr horizontal, ±1.1 mm/yr up, with a 5th percentile range smaller than all 20 automatic estimators tested. Considering its general nature, MIDAS has the potential for broader application in the geosciences.

Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability

Directory of Open Access Journals (Sweden)

Yanli Ren

2017-01-01

Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.

Pair-correlations in swimmer suspensions

Science.gov (United States)

Nambiar, Sankalp; Subramanian, Ganesh

2017-11-01

Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

Carbon monoxide activation via O-bound CO using decamethylscandocinium-hydridoborate ion pairs.

Science.gov (United States)

Berkefeld, Andreas; Piers, Warren E; Parvez, Masood; Castro, Ludovic; Maron, Laurent; Eisenstein, Odile

2012-07-04

Ion pairs [Cp*(2)Sc](+)[HB(p-C(6)F(4)R)(3)](-) (R = F, 1-F; R = H, 1-H) were prepared and shown to be unreactive toward D(2) and α-olefins, leading to the conclusion that no back-transfer of hydride from boron to scandium occurs. Nevertheless, reaction with CO is observed to yield two products, both ion pairs of the [Cp*(2)Sc](+) cation with formylborate (2-R) and borataepoxide (3-R) counteranions. DFT calculations show that these products arise from the carbonyl adduct of the [Cp*(2)Sc](+) in which the CO is bonded to scandium through the oxygen atom, not the carbon atom. The formylborate 2-R is formed in a two-step process initiated by an abstraction of the hydride by the carbon end of an O-bound CO, which forms an η(2)-formyl intermediate that adds, in a second step, the borane at the carbon. The borataepoxide 3-R is suggested to result from an isomerization of 2-R. This unprecedented reaction represents a new way to activate CO via a reaction channel emanating from the ephemeral isocarbonyl isomer of the CO adduct.

Testing for direct genetic effects using a screening step in family-based association studies

Directory of Open Access Journals (Sweden)

Sharon M Lutz

2013-11-01

Full Text Available In genome wide association studies (GWAS, families based studies tend to have less power to detect genetic associations than population based studies, such as case-control studies. This can be an issue when testing if genes in a family based GWAS have a direct effect on the phenotype of interest or if the genes act indirectly through a secondary phenotype. When multiple SNPs are tested for a direct effect in the family based study, a screening step can be used to minimize the burden of multiple comparisons in the causal analysis. We propose a 2-stage screening step that can be incorporated into the family based association test (FBAT approach similar to the conditional mean model approach in the VanSteen-algorithm [1]. Simulations demonstrate that the type 1 error is preserved and this method is advantageous when multiple markers are tested. This method is illustrated by an application to the Framingham Heart Study.

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

Ponderomotive effects in multiphoton pair production

Science.gov (United States)

Kohlfürst, Christian; Alkofer, Reinhard

2018-02-01

The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

Multi-step wind speed forecasting based on a hybrid forecasting architecture and an improved bat algorithm

International Nuclear Information System (INIS)

Xiao, Liye; Qian, Feng; Shao, Wei

2017-01-01

Highlights: • Propose a hybrid architecture based on a modified bat algorithm for multi-step wind speed forecasting. • Improve the accuracy of multi-step wind speed forecasting. • Modify bat algorithm with CG to improve optimized performance. - Abstract: As one of the most promising sustainable energy sources, wind energy plays an important role in energy development because of its cleanliness without causing pollution. Generally, wind speed forecasting, which has an essential influence on wind power systems, is regarded as a challenging task. Analyses based on single-step wind speed forecasting have been widely used, but their results are insufficient in ensuring the reliability and controllability of wind power systems. In this paper, a new forecasting architecture based on decomposing algorithms and modified neural networks is successfully developed for multi-step wind speed forecasting. Four different hybrid models are contained in this architecture, and to further improve the forecasting performance, a modified bat algorithm (BA) with the conjugate gradient (CG) method is developed to optimize the initial weights between layers and thresholds of the hidden layer of neural networks. To investigate the forecasting abilities of the four models, the wind speed data collected from four different wind power stations in Penglai, China, were used as a case study. The numerical experiments showed that the hybrid model including the singular spectrum analysis and general regression neural network with CG-BA (SSA-CG-BA-GRNN) achieved the most accurate forecasting results in one-step to three-step wind speed forecasting.

Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

Science.gov (United States)

Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

2018-01-01

We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

Lewis Acid Pairs for the Activation of Biomass-derived Oxygenates in Aqueous Media

Energy Technology Data Exchange (ETDEWEB)

Roman, Yuriy [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)

2015-09-14

The objective of this project is to understand the mechanistic aspects behind the cooperative activation of oxygenates by catalytic pairs in aqueous media. Specifically, we will investigate how the reactivity of a solid Lewis acid can be modulated by pairing the active site with other catalytic sites at the molecular level, with the ultimate goal of enhancing activation of targeted functional groups. Although unusual catalytic properties have been attributed to the cooperative effects promoted by such catalytic pairs, virtually no studies exist detailing the use heterogeneous water-tolerant Lewis pairs. A main goal of this work is to devise rational pathways for the synthesis of porous heterogeneous catalysts featuring isolated Lewis pairs that are active in the transformation of biomass-derived oxygenates in the presence of bulk water. Achieving this technical goal will require closely linking advanced synthesis techniques; detailed kinetic and mechanistic investigations; strict thermodynamic arguments; and comprehensive characterization studies of both materials and reaction intermediates. For the last performance period (2014-2015), two technical aims were pursued: 1) C-C coupling using Lewis acid and base pairs in Lewis acidic zeolites. Tin-, zirconium-, and hafnium containing zeolites (e.g., Sn-, Zr-, and Hf-Beta) are versatile solid Lewis acids that selectively activate carbonyl functional groups. In this aim, we demonstrate that these zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. 2) One-pot synthesis of MWW zeolite nanosheets for activation of bulky substrates. Through

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

Science.gov (United States)

Gajewski, Andrzej; Kolenderski, Piotr L.

2016-10-01

There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

Pair correlations in nuclei

International Nuclear Information System (INIS)

Shimizu, Yoshifumi

2009-01-01

Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

Analysis of transmission lines loaded with pairs of coupled resonant elements and application to sensors

International Nuclear Information System (INIS)

Naqui, J.; Su, L.; Mata, J.; Martín, F.

2015-01-01

This paper is focused on the analysis of transmission lines loaded with pairs of magnetically coupled resonators. We have considered two different structures: (i) a microstrip line loaded with pairs of stepped impedance resonators (SIRs), and (ii) a coplanar waveguide (CPW) transmission line loaded with pairs of split ring resonators (SRRs). In both cases, the line exhibits a single resonance frequency (transmission zero) if the resonators are identical (symmetric structure with regard to the line axis), and this resonance is different to the one of the line loaded with a single resonator due to inter-resonator coupling. If the structures are asymmetric, inter-resonator coupling enhances the distance between the two split resonance frequencies that arise. In spite that the considered lines and loading resonators are very different and are described by different lumped element equivalent circuit models, the phenomenology associated to the effects of coupling is exactly the same, and the resonance frequencies are given by identical expressions. The reported lumped element circuit models of both structures are validated by comparing the circuit simulations with extracted parameters with both electromagnetic simulations and experimental data. These structures can be useful for the implementation of microwave sensors based on symmetry properties. - Highlights: • Magnetic-coupling between resonant elements affects transmission properties. • Inter-resonant coupling enhances the distance of two resonant frequencies. • The structures are useful for sensors and comparators, etc

Experimental many-pairs nonlocality

Science.gov (United States)

Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

2017-08-01

Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

CORROSION AND SURFACE PROTECTION IN MACHINE MATERIALS FRICTION HAVE DIFFERENT SURFACE PAIRS EXPERIMENTAL INVESTIGATION OF FACTORS

Directory of Open Access Journals (Sweden)

Senai YALCINKAYA

2017-05-01

Full Text Available Friction force, normal force, linear change. The normal force varies with the loads on the friction object. In order to determine the friction force and the friction coefficient, the friction object and the friction speed are used. The experimental work was carried out in three stages. In the first stage, the effect of normal force on the friction force was studied. In the second step, the friction force of the friction surface area is influenced. The effect of the change of the shear rate in step 3 on the friction force was investigated. At the last stage, the experimental study of the effect of the material selection on the friction force was made and it was seen that the aluminum / brass surface pair had the smallest friction coefficient as a result of the opening. The greatest coefficient of friction is found in the pair of glass / felt objects.

Au pair trajectories

DEFF Research Database (Denmark)

Dalgas, Karina Märcher

2015-01-01

pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

International Nuclear Information System (INIS)

Takeuchi, Shin

2005-01-01

A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

A 3-Step Algorithm Using Region-Based Active Contours for Video Objects Detection

Directory of Open Access Journals (Sweden)

Stéphanie Jehan-Besson

2002-06-01

Full Text Available We propose a 3-step algorithm for the automatic detection of moving objects in video sequences using region-based active contours. First, we introduce a very full general framework for region-based active contours with a new Eulerian method to compute the evolution equation of the active contour from a criterion including both region-based and boundary-based terms. This framework can be easily adapted to various applications, thanks to the introduction of functions named descriptors of the different regions. With this new Eulerian method based on shape optimization principles, we can easily take into account the case of descriptors depending upon features globally attached to the regions. Second, we propose a 3-step algorithm for detection of moving objects, with a static or a mobile camera, using region-based active contours. The basic idea is to hierarchically associate temporal and spatial information. The active contour evolves with successively three sets of descriptors: a temporal one, and then two spatial ones. The third spatial descriptor takes advantage of the segmentation of the image in intensity homogeneous regions. User interaction is reduced to the choice of a few parameters at the beginning of the process. Some experimental results are supplied.

Transverse Momentum Distributions for Heavy Quark Pairs

OpenAIRE

Berger, Edmond L.; Meng, Ruibin

1993-01-01

We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

Isominkowskian theory of Cooper Pairs in superconductors

International Nuclear Information System (INIS)

Animalu, A.O.E.

1993-01-01

Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs

A Danish population-based twin study on autism spectrum disorders

DEFF Research Database (Denmark)

Nordenbaek, Claudia; Jorgensen, Meta; Kyvik, Kirsten Ohm

2014-01-01

Genetic epidemiological studies of Autism Spectrum Disorders (ASDs) based on twin pairs ascertained from the population and thoroughly assessed to obtain a high degree of diagnostic validity are few. All twin pairs aged 3-14 years in the nationwide Danish Twin Registry were approached. A three......-step procedure was used. Five items from the "Child Behaviour Checklist" (CBCL) were used in the first screening phase, while screening in the second phase included the "Social and Communication Questionnaire" and the "Autism Spectrum Screening Questionnaire". The final clinical assessment was based on "gold...

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

Science.gov (United States)

Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

Influence of step complexity and presentation style on step performance of computerized emergency operating procedures

Energy Technology Data Exchange (ETDEWEB)

Xu Song [Department of Industrial Engineering, Tsinghua University, Beijing 100084 (China); Li Zhizhong [Department of Industrial Engineering, Tsinghua University, Beijing 100084 (China)], E-mail: zzli@tsinghua.edu.cn; Song Fei; Luo Wei; Zhao Qianyi; Salvendy, Gavriel [Department of Industrial Engineering, Tsinghua University, Beijing 100084 (China)

2009-02-15

With the development of information technology, computerized emergency operating procedures (EOPs) are taking the place of paper-based ones. However, ergonomics issues of computerized EOPs have not been studied adequately since the industrial practice is quite limited yet. This study examined the influence of step complexity and presentation style of EOPs on step performance. A simulated computerized EOP system was developed in two presentation styles: Style A: one- and two-dimensional flowcharts combination; Style B: two-dimensional flowchart and success logic tree combination. Step complexity was quantified by a complexity measure model based on an entropy concept. Forty subjects participated in the experiment of EOP execution using the simulated system. The results of data analysis on the experiment data indicate that step complexity and presentation style could significantly influence step performance (both step error rate and operation time). Regression models were also developed. The regression analysis results imply that operation time of a step could be well predicted by step complexity while step error rate could only partly predicted by it. The result of a questionnaire investigation implies that step error rate was influenced not only by the operation task itself but also by other human factors. These findings may be useful for the design and assessment of computerized EOPs.

Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

DEFF Research Database (Denmark)

Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

2009-01-01

We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

Directory of Open Access Journals (Sweden)

Y. Chen

2015-11-01

Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

Graph-based surface reconstruction from stereo pairs using image segmentation

Science.gov (United States)

Bleyer, Michael; Gelautz, Margrit

2005-01-01

This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

Single-flavour and two-flavour pairing in three-flavour quark matter

International Nuclear Information System (INIS)

Alford, Mark G; Cowan, Greig A

2006-01-01

We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities

Simulation-based investigation of the paired-gear method in cod-end selectivity studies

DEFF Research Database (Denmark)

Herrmann, Bent; Frandsen, Rikke; Holst, René

2007-01-01

In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

Science.gov (United States)

Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

2015-03-28

A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

Harnessing the landscape of microbial culture media to predict new organism–media pairings

Science.gov (United States)

Oberhardt, Matthew A.; Zarecki, Raphy; Gronow, Sabine; Lang, Elke; Klenk, Hans-Peter; Gophna, Uri; Ruppin, Eytan

2015-01-01

Culturing microorganisms is a critical step in understanding and utilizing microbial life. Here we map the landscape of existing culture media by extracting natural-language media recipes into a Known Media Database (KOMODO), which includes >18,000 strain–media combinations, >3300 media variants and compound concentrations (the entire collection of the Leibniz Institute DSMZ repository). Using KOMODO, we show that although media are usually tuned for individual strains using biologically common salts, trace metals and vitamins/cofactors are the most differentiating components between defined media of strains within a genus. We leverage KOMODO to predict new organism–media pairings using a transitivity property (74% growth in new in vitro experiments) and a phylogeny-based collaborative filtering tool (83% growth in new in vitro experiments and stronger growth on predicted well-scored versus poorly scored media). These resources are integrated into a web-based platform that predicts media given an organism's 16S rDNA sequence, facilitating future cultivation efforts. PMID:26460590

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

Science.gov (United States)

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Quantum mechanics versus local realism and a recent EPR experiment on K/sup 0/K/sup 0/ pairs

CERN Document Server

Foadi, R

1999-01-01

The interest of the Orsay Einstein-Podolsky-Rosen experiments of the eighties was limited by a loophole due to the photomultipliers' low detection efficiency. This limitation can be overcome in the case of neutral kaon pairs for which the detection efficiency is high. We show that for such pairs produced in the state J/sup PC/=1/sup --/ the prediction of local realism differ from those of standard quantum theory by 30561400r more. A natural extension of a recent experiment on antiproton annihilations at rest into kaon pairs (CPLEAR collaboration, A. Apostolakis et al., 1998) could lead to a decisive step forward in this matter. (19 refs).

Is ad-hoc plan adaptation based on 2-Step IMRT feasible?

International Nuclear Information System (INIS)

Bratengeier, Klaus; Polat, Buelent; Gainey, Mark; Grewenig, Patricia; Meyer, Juergen; Flentje, Michael

2009-01-01

Background: The ability of a geometry-based method to expeditiously adapt a '2-Step' step and shoot IMRT plan was explored. Both changes of the geometry of target and organ at risk have to be balanced. A retrospective prostate planning study was performed to investigate the relative benefits of beam segment adaptation to the changes in target and organ at risk coverage. Methods: Four patients with six planning cases with extraordinarily large deformations of rectum and prostate were chosen for the study. A 9-field IMRT plan (A) using 2-Step IMRT segments was planned on an initial CT study. The plan had to fulfil all the requirements of a conventional high-quality step and shoot IMRT plan. To adapt to changes of the anatomy in a further CT data set, three approaches were considered: the original plan with optimized isocentre position (B), a newly optimized plan (C) and the original plan, adapted using the 2-Step IMRT optimization rules (D). DVH parameters were utilized for quantification of plan quality: D 99 for the CTV and the central planning target volume (PTV), D 95 for an outer PTV, V 95 , V 80 and V 50 for rectum and bladder. Results: The adapted plan (D) achieved almost the same target coverage as the newly optimized plan (C). Target coverage for plan B was poor and for the organs at risk, the rectum V 80 was slightly increased. The volume with more than 95% of the target dose (V 95 ) was 1.5 ± 1.5 cm 3 for the newly optimized plan (C), compared to 2.2 ± 1.3 cm 3 for the original plan (A) and 7.2 ± 4.8 cm 3 (B) on the first and the second CT, respectively. The adapted plan resulted in 4.3 ± 2.1 cm 3 (D), an intermediate dose load to the rectum. All other parameters were comparable for the newly optimized and the adapted plan. Conclusions: The first results for adaptation of interfractional changes using the 2-Step IMRT algorithm are encouraging. The plans were superior to plans with optimized isocentre position and only marginally inferior to a newly

QED peripheral mechanism of pair production at colliders

International Nuclear Information System (INIS)

Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.

2008-01-01

Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.

Space-Efficient Re-Pair Compression

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Prezza, Nicola

2017-01-01

Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...

An adaptive spatio-temporal smoothing model for estimating trends and step changes in disease risk

OpenAIRE

Rushworth, Alastair; Lee, Duncan; Sarran, Christophe

2014-01-01

Statistical models used to estimate the spatio-temporal pattern in disease\\ud risk from areal unit data represent the risk surface for each time period with known\\ud covariates and a set of spatially smooth random effects. The latter act as a proxy\\ud for unmeasured spatial confounding, whose spatial structure is often characterised by\\ud a spatially smooth evolution between some pairs of adjacent areal units while other\\ud pairs exhibit large step changes. This spatial heterogeneity is not c...

Observation of correlated atom pairs in spontaneous four wave mixing of two colliding Bose-Einstein condensates; Observation de paires d'atomes correles au travers de la collision de deux condensats de Bose-Einstein

Energy Technology Data Exchange (ETDEWEB)

Perrin, A

2007-11-15

In this thesis, we report on the observation of pairs of correlated atoms produced in the collision of two Bose-Einstein condensates of metastable helium. Three laser beams perform a Raman transfer which extracts the condensate from the magnetic trap and separates it into two parts with opposite mean momenta. While the condensates propagate, elastic scattering of pairs of atoms occurs, whose momenta satisfy energy and momentum conservation laws. Metastable helium atoms large internal energy allows the use of a position-sensitive, single-atom detector which permits a three-dimensional reconstruction of the scattered atoms'momenta. The statistics of these momenta show correlations for atoms with opposite momenta. The measured correlation volume can be understood from the uncertainty-limited momentum spread of the colliding condensates. This interpretation is confirmed by the observation of the momentum correlation function for two atoms scattered in the same direction. This latter effect is a manifestation of the Hanbury Brown-Twiss effect for indistinguishable bosons. Such a correlated-atom-pair source is a first step towards experiments in which one would like to confirm the pairs'entanglement. (author)

The paired-domination and the upper paired-domination numbers of graphs

Directory of Open Access Journals (Sweden)

Włodzimierz Ulatowski

2015-01-01

Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

Research on test of product based on spatial sampling criteria and variable step sampling mechanism

Science.gov (United States)

Li, Ruihong; Han, Yueping

2014-09-01

This paper presents an effective approach for online testing the assembly structures inside products using multiple views technique and X-ray digital radiography system based on spatial sampling criteria and variable step sampling mechanism. Although there are some objects inside one product to be tested, there must be a maximal rotary step for an object within which the least structural size to be tested is predictable. In offline learning process, Rotating the object by the step and imaging it and so on until a complete cycle is completed, an image sequence is obtained that includes the full structural information for recognition. The maximal rotary step is restricted by the least structural size and the inherent resolution of the imaging system. During online inspection process, the program firstly finds the optimum solutions to all different target parts in the standard sequence, i.e., finds their exact angles in one cycle. Aiming at the issue of most sizes of other targets in product are larger than that of the least structure, the paper adopts variable step-size sampling mechanism to rotate the product specific angles with different steps according to different objects inside the product and match. Experimental results show that the variable step-size method can greatly save time compared with the traditional fixed-step inspection method while the recognition accuracy is guaranteed.

Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

NARCIS (Netherlands)

Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

Science.gov (United States)

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

Science.gov (United States)

Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

2012-11-01

Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

Opera: reconstructing optimal genomic scaffolds with high-throughput paired-end sequences.

Science.gov (United States)

Gao, Song; Sung, Wing-Kin; Nagarajan, Niranjan

2011-11-01

Scaffolding, the problem of ordering and orienting contigs, typically using paired-end reads, is a crucial step in the assembly of high-quality draft genomes. Even as sequencing technologies and mate-pair protocols have improved significantly, scaffolding programs still rely on heuristics, with no guarantees on the quality of the solution. In this work, we explored the feasibility of an exact solution for scaffolding and present a first tractable solution for this problem (Opera). We also describe a graph contraction procedure that allows the solution to scale to large scaffolding problems and demonstrate this by scaffolding several large real and synthetic datasets. In comparisons with existing scaffolders, Opera simultaneously produced longer and more accurate scaffolds demonstrating the utility of an exact approach. Opera also incorporates an exact quadratic programming formulation to precisely compute gap sizes (Availability: http://sourceforge.net/projects/operasf/ ).

Seniority zero pair coupled cluster doubles theory

International Nuclear Information System (INIS)

Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

2014-01-01

Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

OpenAIRE

Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

2005-01-01

Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

The Inquiry Based Science and Technology Education Program (IN-STEP): The Evaluation of the First Year

Science.gov (United States)

Corcoran, Thomas B.

2008-01-01

This is the first report on the evaluation of the Inquiry Based Science and Technology Education Program (IN-STEP), an innovative and ambitious science education initiative for lower secondary schools being undertaken by a public-private partnership in Thailand funded by MSD-Thailand, an affiliate of Merck & Co. IN-STEP is a public-private…

Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

Energy Technology Data Exchange (ETDEWEB)

Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

2015-12-15

Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.

Science.gov (United States)

Hao, Pei-Yi

This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

OpenAIRE

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

Prediction Equations of Energy Expenditure in Chinese Youth Based on Step Frequency during Walking and Running

Science.gov (United States)

Sun, Bo; Liu, Yu; Li, Jing Xian; Li, Haipeng; Chen, Peijie

2013-01-01

Purpose: This study set out to examine the relationship between step frequency and velocity to develop a step frequency-based equation to predict Chinese youth's energy expenditure (EE) during walking and running. Method: A total of 173 boys and girls aged 11 to 18 years old participated in this study. The participants walked and ran on a…

Observing Pair-Work Task in an English Speaking Class

Directory of Open Access Journals (Sweden)

Diana Achmad

2014-01-01

Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

Development process and data management of TurnSTEP, a STEP-compliant CNC system for turning

NARCIS (Netherlands)

Choi, I.; Suh, S.-H; Kim, K.; Song, M.S.; Jang, M.; Lee, B.-E.

2006-01-01

TurnSTEP is one of the earliest STEP-compliant CNC systems for turning. Based on the STEP-NC data model formalized as ISO 14649-12 and 121, it is designed to support intelligent and autonomous control of NC machines for e-manufacturing. The present paper introduces the development process and data

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

Science.gov (United States)

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Smoke regions extraction based on two steps segmentation and motion detection in early fire

Science.gov (United States)

Jian, Wenlin; Wu, Kaizhi; Yu, Zirong; Chen, Lijuan

2018-03-01

Aiming at the early problems of video-based smoke detection in fire video, this paper proposes a method to extract smoke suspected regions by combining two steps segmentation and motion characteristics. Early smoldering smoke can be seen as gray or gray-white regions. In the first stage, regions of interests (ROIs) with smoke are obtained by using two step segmentation methods. Then, suspected smoke regions are detected by combining the two step segmentation and motion detection. Finally, morphological processing is used for smoke regions extracting. The Otsu algorithm is used as segmentation method and the ViBe algorithm is used to detect the motion of smoke. The proposed method was tested on 6 test videos with smoke. The experimental results show the effectiveness of our proposed method over visual observation.

Propagation of optical vortex beams and nucleation of vortex-antivortex pairs in disordered nonlinear photonic lattices

International Nuclear Information System (INIS)

Cho, Yeong-Kwon; Kim, Ki-Hong

2014-01-01

The propagation of optical vortex beams through disordered nonlinear photonic lattices is numerically studied. The vortex beams are generated by using a superposition of several Gaussian laser beams arranged in a radially-symmetric manner. The paraxial nonlinear Schroedinger equation describing the longitudinal propagation of the beam array through nonlinear triangular photonic lattices with two-dimensional disorder is solved numerically by using the split-step Fourier method. We find that due to the spatial disorder, the vortex beam is destabilized after propagating a finite distance and new vortex-antivortex pairs are nucleated at the positions of perfect destructive interference. We also find that in the presence of a self-focusing nonlinearity, the vortex-antivortex pair nucleation is suppressed and the vortex beam becomes more stable, while a self-defocusing nonlinearity enhances the vortex-antivortex pair nucleation.

SPAR-H Step-by-Step Guidance

Energy Technology Data Exchange (ETDEWEB)

W. J. Galyean; A. M. Whaley; D. L. Kelly; R. L. Boring

2011-05-01

This guide provides step-by-step guidance on the use of the SPAR-H method for quantifying Human Failure Events (HFEs). This guide is intended to be used with the worksheets provided in: 'The SPAR-H Human Reliability Analysis Method,' NUREG/CR-6883, dated August 2005. Each step in the process of producing a Human Error Probability (HEP) is discussed. These steps are: Step-1, Categorizing the HFE as Diagnosis and/or Action; Step-2, Rate the Performance Shaping Factors; Step-3, Calculate PSF-Modified HEP; Step-4, Accounting for Dependence, and; Step-5, Minimum Value Cutoff. The discussions on dependence are extensive and include an appendix that describes insights obtained from the psychology literature.

SPAR-H Step-by-Step Guidance

International Nuclear Information System (INIS)

Galyean, W.J.; Whaley, A.M.; Kelly, D.L.; Boring, R.L.

2011-01-01

This guide provides step-by-step guidance on the use of the SPAR-H method for quantifying Human Failure Events (HFEs). This guide is intended to be used with the worksheets provided in: 'The SPAR-H Human Reliability Analysis Method,' NUREG/CR-6883, dated August 2005. Each step in the process of producing a Human Error Probability (HEP) is discussed. These steps are: Step-1, Categorizing the HFE as Diagnosis and/or Action; Step-2, Rate the Performance Shaping Factors; Step-3, Calculate PSF-Modified HEP; Step-4, Accounting for Dependence, and; Step-5, Minimum Value Cutoff. The discussions on dependence are extensive and include an appendix that describes insights obtained from the psychology literature.

Controlling the orientation of spin-correlated radical pairs by covalent linkage to nanoporous anodic aluminum oxide membranes.

Science.gov (United States)

Chen, Hsiao-Fan; Gardner, Daniel M; Carmieli, Raanan; Wasielewski, Michael R

2013-10-07

Ordered multi-spin assemblies are required for developing solid-state molecule-based spintronics. A linear donor-chromophore-acceptor (D-C-A) molecule was covalently attached inside the 150 nm diam. nanopores of an anodic aluminum oxide (AAO) membrane. Photoexcitation of D-C-A in a 343 mT magnetic field results in sub-nanosecond, two-step electron transfer to yield the spin-correlated radical ion pair (SCRP) (1)(D(+)˙-C-A(-)˙), which then undergoes radical pair intersystem crossing (RP-ISC) to yield (3)(D(+)˙-C-A(-)˙). RP-ISC results in S-T0 mixing to selectively populate the coherent superposition states |S'> and |T'>. Microwave-induced transitions between these states and the unpopulated |T(+1)> and |T(-1)> states result in spin-polarized time-resolved EPR (TREPR) spectra. The dependence of the electron spin polarization (ESP) phase of the TREPR spectra on the orientation of the AAO membrane pores relative to the externally applied magnetic field is used to determine the overall orientation of the SCRPs within the pores at room temperature.

SIMULATION COMPARISON AND STEPS TO DO SIMULATION BY AUTOLISP (AUTOCAD) AND PRO-E FOR GEAR PAIR.

OpenAIRE

PRATIK A. SOLANKI; KALPESH P. PATEL; J.R.LIMBACHIYA

2012-01-01

This paper gives the basic idea of steps required for doing simulation in AutoCAD with the help of AutoLisp and Pro-Engineering. It includes the comparison between both methods. AutoCAD 2005 and Pro-E wildfireV4.0 used as software to do simulation (Animation).

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

SPAR-H Step-by-Step Guidance

Energy Technology Data Exchange (ETDEWEB)

April M. Whaley; Dana L. Kelly; Ronald L. Boring; William J. Galyean

2012-06-01

Step-by-step guidance was developed recently at Idaho National Laboratory for the US Nuclear Regulatory Commission on the use of the Standardized Plant Analysis Risk-Human Reliability Analysis (SPAR-H) method for quantifying Human Failure Events (HFEs). This work was done to address SPAR-H user needs, specifically requests for additional guidance on the proper application of various aspects of the methodology. This paper overviews the steps of the SPAR-H analysis process and highlights some of the most important insights gained during the development of the step-by-step directions. This supplemental guidance for analysts is applicable when plant-specific information is available, and goes beyond the general guidance provided in existing SPAR-H documentation. The steps highlighted in this paper are: Step-1, Categorizing the HFE as Diagnosis and/or Action; Step-2, Rate the Performance Shaping Factors; Step-3, Calculate PSF-Modified HEP; Step-4, Accounting for Dependence, and; Step-5, Minimum Value Cutoff.

Flow-based market coupling. Stepping stone towards nodal pricing?

International Nuclear Information System (INIS)

Van der Welle, A.J.

2012-07-01

For achieving one internal energy market for electricity by 2014, market coupling is deployed to integrate national markets into regional markets and ultimately one European electricity market. The extent to which markets can be coupled depends on the available transmission capacities between countries. Since interconnections are congested from time to time, congestion management methods are deployed to divide the scarce available transmission capacities over market participants. For further optimization of the use of available transmission capacities while maintaining current security of supply levels, flow-based market coupling (FBMC) will be implemented in the CWE region by 2013. Although this is an important step forward, important hurdles for efficient congestion management remain. Hence, flow based market coupling is compared to nodal pricing, which is often considered as the most optimal solution from theoretical perspective. In the context of decarbonised power systems it is concluded that advantages of nodal pricing are likely to exceed its disadvantages, warranting further development of FBMC in the direction of nodal pricing.

Josephson junction analog and quasiparticle-pair current

DEFF Research Database (Denmark)

Bak, Christen Kjeldahl; Pedersen, Niels Falsig

1973-01-01

A close analogy exists between a Josephson junction and a phase-locked loop. A new type of electrical analog based on this principle is presented. It is shown that the inclusion in this analog of a low-pass filter gives rise to a current of the same form as the Josephson quasiparticle-pair current....... A simple picture of the quasiparticle-pair current, which gives the right dependences, is obtained by assuming a junction cutoff frequency to be at the energy gap. ©1973 American Institute of Physics...

Effectiveness of a two-step population-based osteoporosis screening program using FRAX

DEFF Research Database (Denmark)

Rubin, K H; Rothmann, M J; Holmberg, T

2018-01-01

The Risk-stratified Osteoporosis Strategy Evaluation (ROSE) study investigated the effectiveness of a two-step screening program for osteoporosis in women. We found no overall reduction in fractures from systematic screening compared to the current case-finding strategy. The group of moderate......- to high-risk women, who accepted the invitation to DXA, seemed to benefit from the program. INTRODUCTION: The purpose of the ROSE study was to investigate the effectiveness of a two-step population-based osteoporosis screening program using the Fracture Risk Assessment Tool (FRAX) derived from a self......-administered questionnaire to select women for DXA scan. After the scanning, standard osteoporosis management according to Danish national guidelines was followed. METHODS: Participants were randomized to either screening or control group, and randomization was stratified according to age and area of residence. Inclusion...

Specification of a STEP Based Reference Model for Exchange of Robotics Models

DEFF Research Database (Denmark)

Haenisch, Jochen; Kroszynski, Uri; Ludwig, Arnold

robot programming, the descriptions of geometry, kinematics, robotics, dynamics, and controller data using STEP are addressed as major goals of the project.The Project Consortium has now released the "Specificatin of a STEP Based Reference Model for Exchange of Robotics Models" on which a series......ESPRIT Project 6457: "Interoperability of Standards for Robotics in CIME" (InterRob) belongs to the Subprogram "Computer Integrated Manufacturing and Engineering" of ESPRIT, the European Specific Programme for Research and Development in Information Technology supported by the European Commision....... InterRob aims to develop an integrated solution to precision manufacturing by combining product data and database technologies with robotic off-line programming and simulation. Benefits arise from the use of high level simulation tools and developing standards for the exchange of product model data...

Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

Science.gov (United States)

Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

2018-01-01

Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

Designing an ASIP for cryptographic pairings over Barreto-Naehrig curves

NARCIS (Netherlands)

Kammler, D.; Zhang, D.; Schwabe, P.; Scharwaechter, H.; Langenberg, M.; Auras, D.; Ascheid, G.; Mathar, R.; Clavier, C.; Gaj, K.

2009-01-01

This paper presents a design-space exploration of an application-specific instruction-set processor (ASIP) for the computation of various cryptographic pairings over Barreto-Naehrig curves (BN curves). Cryptographic pairings are based on elliptic curves over finite fields—in the case of BN curves a

Measurement of top quark properties from pair production and decay with the CMS detector

International Nuclear Information System (INIS)

Rosemann, C.

2009-02-01

Semileptonic top quark pair decays are analysed using full simulation of the CMS detector at the proton-proton collider LHC. A complete analysis of event selection and reconstruction is performed with the goal of the determination of differential cross sections. Special emphasis is put on object reconstruction and an efficient and unbiased event selection procedure. The reconstruction of semileptonic t anti t decays uses the full combination of all reconstruction objects. These objects are specifically defined and analysed in their reconstruction performance. For this several methods are developed and implemented. A highly efficient electron identification and a clear procedure of lepton isolation are defined. Two selections are compared, a cut-based and a neural network-based selection with a common efficiency of 10%. For the event selection and reconstruction a kinematic fit is implemented. As final step the t anti t spectra of rapidity, invariant mass and transverse momentum are analysed. (orig.)

Measurement of top quark properties from pair production and decay with the CMS detector

Energy Technology Data Exchange (ETDEWEB)

Rosemann, C.

2009-02-15

Semileptonic top quark pair decays are analysed using full simulation of the CMS detector at the proton-proton collider LHC. A complete analysis of event selection and reconstruction is performed with the goal of the determination of differential cross sections. Special emphasis is put on object reconstruction and an efficient and unbiased event selection procedure. The reconstruction of semileptonic t anti t decays uses the full combination of all reconstruction objects. These objects are specifically defined and analysed in their reconstruction performance. For this several methods are developed and implemented. A highly efficient electron identification and a clear procedure of lepton isolation are defined. Two selections are compared, a cut-based and a neural network-based selection with a common efficiency of 10%. For the event selection and reconstruction a kinematic fit is implemented. As final step the t anti t spectra of rapidity, invariant mass and transverse momentum are analysed. (orig.)

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

Science.gov (United States)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

Directory of Open Access Journals (Sweden)

Ol'ha O. Brovarets'

2018-02-01

Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

Pair formation models for sexually transmitted infections: A primer

Directory of Open Access Journals (Sweden)

Mirjam Kretzschmar

2017-08-01

Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number

Awakened Oscillations in Coupled Consumer-Resource Pairs

Directory of Open Access Journals (Sweden)

Almaz Mustafin

2014-01-01

Full Text Available The paper concerns two interacting consumer-resource pairs based on chemostat-like equations under the assumption that the dynamics of the resource is considerably slower than that of the consumer. The presence of two different time scales enables to carry out a fairly complete analysis of the problem. This is done by treating consumers and resources in the coupled system as fast-scale and slow-scale variables, respectively, and subsequently considering developments in phase planes of these variables, fast and slow, as if they are independent. When uncoupled, each pair has unique asymptotically stable steady state and no self-sustained oscillatory behavior (although damped oscillations about the equilibrium are admitted. When the consumer-resource pairs are weakly coupled through direct reciprocal inhibition of consumers, the whole system exhibits self-sustained relaxation oscillations with a period that can be significantly longer than intrinsic relaxation time of either pair. It is shown that the model equations adequately describe locally linked consumer-resource systems of quite different nature: living populations under interspecific interference competition and lasers coupled via their cavity losses.

EFEKTIVITAS PENGGUNAAN METODE THINK PAIR SHARE DALAM PEMBELAJARAN EKONOMI POKOK BAHASAN PEMBENTUKAN HARGA PASAR DI SMP

Directory of Open Access Journals (Sweden)

Joko Widodo

2011-06-01

Full Text Available The result of teaching-learning by using Think Pair Share method can improve the students’ activities. It can be seen from the steps to apply the Think Pair Share method that focused on student-centre. Think pair share learning has a simple structure, as a basic of the development ‘cooperative class’ which can help the learning process actively for students, thus it can improve the students’ study result. Students actively can show their ability to discuss and share and express the answer of questions in front of the class. Teachers in teaching- learning process by using think pair share method acted as mediator, facilitator and motivator. It is different with conventional teaching-learning process which focused on teacher-center. Students were passive in teaching-learning process. Students tended to be bored if the teacher was lack to give motivation for students to pay attention to the teacher. Thus, the using of think pair share would be more effective if we see on how the students interaction in learning process. Teacher can vary think pair share with conventional method or other method to improve the students’ activities in learning process, therefore the students’ result study will be increased.   Keywords: Think-pair-share, the increase of result study.

EFEKTIVITAS PENGGUNAAN METODE THINK PAIR SHARE DALAM PEMBELAJARAN EKONOMI POKOK BAHASAN PEMBENTUKAN HARGA PASAR DI SMP

Directory of Open Access Journals (Sweden)

Joko Widodo

2007-06-01

Full Text Available The result of teaching-learning by using Think Pair Share method can improve the students’ activities. It can be seen from the steps to apply the Think Pair Share method that focused on student-centre. Think pair share learning has a simple structure, as a basic of the development ‘cooperative class’ which can help the learning process actively for students, thus it can improve the students’ study result. Students actively can show their ability to discuss and share and express the answer of questions in front of the class. Teachers in teaching- learning process by using think pair share method acted as mediator, facilitator and motivator. It is different with conventional teaching-learning process which focused on teacher-center. Students were passive in teaching-learning process. Students tended to be bored if the teacher was lack to give motivation for students to pay attention to the teacher. Thus, the using of think pair share would be more effective if we see on how the students interaction in learning process. Teacher can vary think pair share with conventional method or other method to improve the students’ activities in learning process, therefore the students’ result study will be increased.   Keywords: Think-pair-share, the increase of result study.

Nanoscale protein diffusion by STED-based pair correlation analysis.

Directory of Open Access Journals (Sweden)

Paolo Bianchini

Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

Home-based step training using videogame technology in people with Parkinson's disease: a single-blinded randomised controlled trial.

Science.gov (United States)

Song, Jooeun; Paul, Serene S; Caetano, Maria Joana D; Smith, Stuart; Dibble, Leland E; Love, Rachelle; Schoene, Daniel; Menant, Jasmine C; Sherrington, Cathie; Lord, Stephen R; Canning, Colleen G; Allen, Natalie E

2018-03-01

To determine whether 12-week home-based exergame step training can improve stepping performance, gait and complementary physical and neuropsychological measures associated with falls in Parkinson's disease. A single-blinded randomised controlled trial. Community (experimental intervention), university laboratory (outcome measures). Sixty community-dwelling people with Parkinson's disease. Home-based step training using videogame technology. The primary outcomes were the choice stepping reaction time test and Functional Gait Assessment. Secondary outcomes included physical and neuropsychological measures associated with falls in Parkinson's disease, number of falls over six months and self-reported mobility and balance. Post intervention, there were no differences between the intervention ( n = 28) and control ( n = 25) groups in the primary or secondary outcomes except for the Timed Up and Go test, where there was a significant difference in favour of the control group ( P = 0.02). Intervention participants reported mobility improvement, whereas control participants reported mobility deterioration-between-group difference on an 11-point scale = 0.9 (95% confidence interval: -1.8 to -0.1, P = 0.03). Interaction effects between intervention and disease severity on physical function measures were observed ( P = 0.01 to P = 0.08) with seemingly positive effects for the low-severity group and potentially negative effects for the high-severity group. Overall, home-based exergame step training was not effective in improving the outcomes assessed. However, the improved physical function in the lower disease severity intervention participants as well as the self-reported improved mobility in the intervention group suggest home-based exergame step training may have benefits for some people with Parkinson's disease.

Angle Control-Based Multi-Terminal Out-of-Step Protection System

Directory of Open Access Journals (Sweden)

Antans Sauhats

2017-03-01

Full Text Available From time to time a sequence of unexpected and overlapping contingencies may lead to power system angular instability and even blackouts if not addressed adequately by means of an out-of-step (OOS protection system. The motivation of the paper is an attempt to develop a workable prototype of the OOS protection system. The deficiencies of the protection currently used in the Latvian Power System network are highlighted and a new protection structure is proposed. The protection system comprises of several strategically located terminals, exchanging information in real time by means of a communication network. The OOS condition detection method is based on system-wide generation sources, electromotive forces, vectors, and angle control. The network splitting decision is based on generator coherence evaluation. Protection terminals determine online the groups of coherent generators and choose the splitting boundary from a predefined transmission lines (TLs cut sets list. The protection system structure, algorithm of operation, and possible IEC 61850 communication standard-based implementation are described.

New schemes for high-voltage pulsed generators based on stepped transmission lines

International Nuclear Information System (INIS)

Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.

1993-01-01

Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

Multi step FRET among three laser dyes Pyrene, Acriflavine and Rhodamine B

International Nuclear Information System (INIS)

Saha, Jaba; Dey, Dibyendu; Roy, Arpan Datta; Bhattacharjee, D.; Hussain, Syed Arshad

2016-01-01

Fluorescence Resonance Energy Transfer (FRET) system using three dyes has been demonstrated. It has been observed that multi step energy transfer occurred from Pyrene to Rhodamine B via Acriflavine. Here Acriflavine acts as an antenna to receive energy from Pyrene and transfer the same to Rhodamine B. This multi step FRET system is advantageous compared to the conventional FRET as this can be used to study molecular level interaction beyond conventional FRET distance (1–10 nm) as well as studying multi-branched macromolecules. The introduction of clay enhances the FRET efficiencies among the dye pair, which is an advantage to make the multi step system more useful. Similar approach can be used for increasing FRET efficiencies by using other dyes. - Highlights: • Multi-step FRET occurred from Pyrene (Py) to Rhodamine B (RhB) via Acriflavine (Acf). • Acf acts as an antenna to receive energy from Py and to transfer energy to RhB. • Multi-step FRET can be used to study molecular level interaction beyond 1–10 nm. • Incorporation of nanoclay laponite enhances the energy transfer efficiency.

Cooper Pairs in Insulators?

International Nuclear Information System (INIS)

Valles, James

2008-01-01

Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

Science.gov (United States)

Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

2014-05-01

The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

Energy Technology Data Exchange (ETDEWEB)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

2016-04-19

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

Understanding Fomalhaut as a Cooper pair

Science.gov (United States)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

[Involvement of cranial pairs as manifestation of prostatic cancer].

Science.gov (United States)

Ripa Saldias, L M; Ayuso Blanco, T; Delpon Pérez, E; Sarria Octavio de Toledo, L

1994-10-01

Two cases of prostate cancer (PC) which presented clinically with affectation of the cranial pairs due to skull base metastasis. In both cases, existence of intraparenchimatous brain metastasis was excluded. Initial improvement with hormonal therapy was followed by clinical, analytical and radiological relapse due to spread of process until death, at 11 and 36 months from diagnosis. Although PC's bone metastasis are frequent, their location at the skull base is uncommon. Even more rare are the cases which present with changes in the cranial pairs in the absence of signs and symptoms of prostatism.

An FPGA-Based Multiple-Axis Velocity Controller and Stepping Motors Drives Design

Directory of Open Access Journals (Sweden)

Lai Chiu-Keng

2016-01-01

Full Text Available A Field Programmable Gate Array based system is a great hardware platform to support the implementation of hardware controllers such as PID controller and fuzzy controller. It is also programmed as hardware accelerator to speed up the mathematic calculation and greatly enhance the performance as applied to motor drive and motion control. Furthermore, the open structure of FPGA-based system is suitable for those designs with the ability of parallel processing or soft code processor embedded. In this paper, we apply the FPGA to a multi-axis velocity controller design. The developed system integrated three functions inside the FPGA chip, which are respectively the stepping motor drive, the multi-axis motion controller and the motion planning. Furthermore, an embedded controller with a soft code processor compatible to 8051 micro-control unit (MCU is built to handle the data transfer between the FPGA board and host PC. The MCU is also used to initialize the motion control and run the interpolator. The designed system is practically applied to a XYZ motion platform which is driven by stepping motors to verify its performance.

Charge Aspects of Composite Pair Superconductivity

Science.gov (United States)

Flint, Rebecca

2014-03-01

Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

Are Human Mating Preferences with Respect to Height Reflected in Actual Pairings?

OpenAIRE

Stulp, Gert; Buunk, Abraham P.; Pollet, Thomas V.; Nettle, Daniel; Verhulst, Simon

2013-01-01

Pair formation, acquiring a mate to form a reproductive unit, is a complex process. Mating preferences are a step in this process. However, due to constraining factors such as availability of mates, rival competition, and mutual mate choice, preferred characteristics may not be realised in the actual partner. People value height in their partner and we investigated to what extent preferences for height are realised in actual couples. We used data from the Millennium Cohort Study (UK) and comp...

Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

Science.gov (United States)

Giangaspero, Massimo; Harasawa, Ryô

2007-12-01

The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

VLBA Reveals Closest Pair of Supermassive Black Holes

Science.gov (United States)

2006-05-01

black holes," Taylor said. The VLBA is a continent-wide system of ten radio-telescope antennas. It provides the greatest ability to see fine detail, called resolving power, of any telescope in astronomy. "Astronomers have thought for a long time that close pairs of black holes should result from galaxy collisions," Rodriguez said. Still, finding them has proven difficult. Until now, the closest confirmed pairs of supermassive black holes were at least 4,500 light-years apart. Pairs of smaller black holes, each only a few times the mass of the Sun, have been found in our own Milky Way Galaxy, but 0402+379 harbors the pair of supermassive black holes that are the closest to each other yet found. Galactic collisions are common throughout the Universe, and astronomers think that the binary pairs of supermassive black holes that result can have important effects on the subsequent evolution of the galaxies. In a number of predicted scenarios, such giant pairs of black holes will themselves collide, sending gravitational waves out through the Universe. Such gravitational waves could be detected with a proposed joint space mission between NASA and the European Space Agency, the Laser Interferometer Space Antenna. "Such black-hole collisions undoubtedly are important processes, and we need to understand them. Finding ever-closer pairs of supermassive black holes is the first step in that process. Even finding one such system has dramatically changed our expectations, and informed us about what to look for," Taylor said. Taylor and his collaborators are currently using the VLBA to carry out the largest survey of compact radio-emitting objects ever undertaken, in the hope of finding more such pairs. Rodriguez and Taylor worked with Robert Zavala of the U.S. Naval Observatory, Allison Peck of the SubMillimeter Array of the Harvard- Smithsonian Center for Astrophysics, Lindsey Pollack of the University of California at Santa Cruz, and Roger Romani of Stanford University. Their

Comparison study on mechanical properties single step and three step artificial aging on duralium

Science.gov (United States)

Tsamroh, Dewi Izzatus; Puspitasari, Poppy; Andoko, Sasongko, M. Ilman N.; Yazirin, Cepi

2017-09-01

Duralium is kind of non-ferro alloy that used widely in industrial. That caused its properties such as mild, high ductility, and resistance from corrosion. This study aimed to know mechanical properties of duralium on single step and three step articial aging process. Mechanical properties that discussed in this study focused on toughness value, tensile strength, and microstructure of duralium. Toughness value of single step artificial aging was 0.082 joule/mm2, and toughness value of three step artificial aging was 0,0721 joule/mm2. Duralium tensile strength of single step artificial aging was 32.36 kgf/mm^2, and duralium tensile strength of three step artificial aging was 32,70 kgf/mm^2. Based on microstructure photo of duralium of single step artificial aging showed that precipitate (θ) was not spreading evenly indicated by black spot which increasing the toughness of material. While microstructure photo of duralium that treated by three step artificial aging showed that it had more precipitate (θ) spread evenly compared with duralium that treated by single step artificial aging.

Multi-Step Usage of in Vivo Models During Rational Drug Design and Discovery

Directory of Open Access Journals (Sweden)

Charles H. Williams

2011-04-01

Full Text Available In this article we propose a systematic development method for rational drug design while reviewing paradigms in industry, emerging techniques and technologies in the field. Although the process of drug development today has been accelerated by emergence of computational methodologies, it is a herculean challenge requiring exorbitant resources; and often fails to yield clinically viable results. The current paradigm of target based drug design is often misguided and tends to yield compounds that have poor absorption, distribution, metabolism, and excretion, toxicology (ADMET properties. Therefore, an in vivo organism based approach allowing for a multidisciplinary inquiry into potent and selective molecules is an excellent place to begin rational drug design. We will review how organisms like the zebrafish and Caenorhabditis elegans can not only be starting points, but can be used at various steps of the drug development process from target identification to pre-clinical trial models. This systems biology based approach paired with the power of computational biology; genetics and developmental biology provide a methodological framework to avoid the pitfalls of traditional target based drug design.

Thread-like supercapacitors based on one-step spun nanocomposite yarns.

Science.gov (United States)

Meng, Qinghai; Wang, Kai; Guo, Wei; Fang, Jin; Wei, Zhixiang; She, Xilin

2014-08-13

Thread-like electronic devices have attracted great interest because of their potential applications in wearable electronics. To produce high-performance, thread-like supercapacitors, a mixture of stable dispersions of single-walled carbon nanotubes and conducting polyaniline nanowires are prepared. Then, the mixture is spun into flexible yarns with a polyvinyl alcohol outer sheath by a one-step spinning process. The composite yarns show excellent mechanical properties and high electrical conductivities after sufficient washing to remove surfactants. After applying a further coating layer of gel electrolyte, two flexible yarns are twisted together to form a thread-like supercapacitor. The supercapacitor based on these two yarns (SWCNTs and PAniNWs) possesses a much higher specific capacitance than that based only on pure SWCNTs yarns, making it an ideal energy-storage device for wearable electronics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrochemical model of polyaniline-based memristor with mass transfer step

International Nuclear Information System (INIS)

Demin, V.A.; Erokhin, V.V.; Kashkarov, P.K.; Kovalchuk, M.V.

2015-01-01

The electrochemical organic memristor with polyaniline active layer is a stand-alone device designed and realized for reproduction of some synapse properties in the innovative electronic circuits, such as the new field-programmable gate arrays or the neuromorphic networks capable for learning. In this work a new theoretical model of the polyaniline memristor is presented. The developed model of organic memristor functioning was based on the detailed consideration of possible electrochemical processes occuring in the active zone of this device including the mass transfer step of ionic reactants. Results of the calculation have demonstrated not only the qualitative explanation of the characteristics observed in the experiment, but also quantitative similarities of the resultant current values. This model can establish a basis for the design and prediction of properties of more complicated circuits and systems (including stochastic ones) based on the organic memristive devices

Universal quantum gates for Single Cooper Pair Box based quantum computing

Science.gov (United States)

Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

2000-01-01

We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

Science.gov (United States)

Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

A Method of MPPT Control Based on Power Variable Step-size in Photovoltaic Converter System