WorldWideScience

Sample records for base pair step

  1. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  2. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  3. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  4. Evaluation of several two-step scoring functions based on linear interaction energy, effective ligand size, and empirical pair potentials for prediction of protein-ligand binding geometry and free energy.

    Science.gov (United States)

    Rahaman, Obaidur; Estrada, Trilce P; Doren, Douglas J; Taufer, Michela; Brooks, Charles L; Armen, Roger S

    2011-09-26

    The performances of several two-step scoring approaches for molecular docking were assessed for their ability to predict binding geometries and free energies. Two new scoring functions designed for "step 2 discrimination" were proposed and compared to our CHARMM implementation of the linear interaction energy (LIE) approach using the Generalized-Born with Molecular Volume (GBMV) implicit solvation model. A scoring function S1 was proposed by considering only "interacting" ligand atoms as the "effective size" of the ligand and extended to an empirical regression-based pair potential S2. The S1 and S2 scoring schemes were trained and 5-fold cross-validated on a diverse set of 259 protein-ligand complexes from the Ligand Protein Database (LPDB). The regression-based parameters for S1 and S2 also demonstrated reasonable transferability in the CSARdock 2010 benchmark using a new data set (NRC HiQ) of diverse protein-ligand complexes. The ability of the scoring functions to accurately predict ligand geometry was evaluated by calculating the discriminative power (DP) of the scoring functions to identify native poses. The parameters for the LIE scoring function with the optimal discriminative power (DP) for geometry (step 1 discrimination) were found to be very similar to the best-fit parameters for binding free energy over a large number of protein-ligand complexes (step 2 discrimination). Reasonable performance of the scoring functions in enrichment of active compounds in four different protein target classes established that the parameters for S1 and S2 provided reasonable accuracy and transferability. Additional analysis was performed to definitively separate scoring function performance from molecular weight effects. This analysis included the prediction of ligand binding efficiencies for a subset of the CSARdock NRC HiQ data set where the number of ligand heavy atoms ranged from 17 to 35. This range of ligand heavy atoms is where improved accuracy of predicted ligand

  5. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  6. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  7. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  8. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  9. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  10. One step paired electrochemical synthesis of iron and iron oxide nanoparticles

    Directory of Open Access Journals (Sweden)

    Ordoukhanian Juliet

    2016-09-01

    Full Text Available In this study, a new one step paired electrochemical method is developed for simultaneous synthesis of iron and iron oxide nanoparticles. iron and iron oxide are prepared as cathodic and anodic products from iron (ii sulfate aqueous solution in a membrane divided electrolytic cell by the pulsed current electrosynthesis. Because of organic solvent-free and electrochemical nature of the synthesis, the process could be considered as green and environmentally friendly. The reduction of energy consumption and low cost are the other significant advantages of this new method that would have a great application potential in the chemical industry. The nanostructure of prepared samples was characterized by Fourier transform infrared spectroscopy (FT-IR, X-ray diffraction (XRD, scanning electron microscopy (SEM and transmission electron microscopy (TEM. The magnetic properties were studied by vibrating sample magnetometer (VsM.

  11. Two-step quantum direct communication protocol using the Einstein- Podolsky-Rosen pair block

    CERN Document Server

    Fu Guo Deng; Xiao Shu Liu; 10.1103/PhysRevA.68.042317

    2003-01-01

    A protocol for quantum secure direct communication using blocks of Einstein-Podolsky-Rosen (EPR) pairs is proposed. A set of ordered N EPR pairs is used as a data block for sending secret message directly. The ordered N EPR set is divided into two particle sequences, a checking sequence and a message-coding sequence. After transmitting the checking sequence, the two parties of communication check eavesdropping by measuring a fraction of particles randomly chosen, with random choice of two sets of measuring bases. After insuring the security of the quantum channel, the sender Alice encodes the secret message directly on the message-coding sequence and sends them to Bob. By combining the checking and message-coding sequences together, Bob is able to read out the encoded messages directly. The scheme is secure because an eavesdropper cannot get both sequences simultaneously. We also discuss issues in a noisy channel. (30 refs).

  12. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  13. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  14. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  15. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  16. Generating photon pairs from a silicon microring resonator using an electronic step recovery diode for pump pulse generation

    Energy Technology Data Exchange (ETDEWEB)

    Savanier, Marc, E-mail: msavanier@eng.ucsd.edu; Mookherjea, Shayan, E-mail: smookherjea@eng.ucsd.edu [Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, California 92093 (United States)

    2016-06-20

    Generation of photon pairs from compact, manufacturable, and inexpensive silicon (Si) photonic devices at room temperature may help develop practical applications of quantum photonics. An important characteristic of photon-pair generation is the two-photon joint spectral intensity, which describes the frequency correlations of the photon pair. Recent attempts to generate a factorizable photon-pair state suitable for heralding have used short optical pump pulses from mode-locked lasers, which are much more expensive and bigger table-top or rack-sized instruments compared with the Si microchip used for generating photon pairs, and thus dominate the cost and inhibit the miniaturization of the source. Here, we generate photon pairs from an Si microring resonator by using an electronic step-recovery diode to drive an electro-optic modulator which carves the pump light from a continuous-wave laser diode into pulses of the appropriate width, thus potentially eliminating the need for optical mode-locked lasers.

  17. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  18. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  19. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  20. Split-step scheme for photon-pair generation through spontaneous four-wave mixing

    DEFF Research Database (Denmark)

    Koefoed, Jacob Gade; Christensen, Jesper Bjerge; Rottwitt, Karsten

    2017-01-01

    The rapid development of quantum information technology requires the ability to reliably create and distribute single photons [1]. Photon-pair production through spontaneous four-wave mixing (SpFWM) allows heralded single photons to be generated at communication wavelengths and in fiber, compatible...... with conventional communication systems, with small losses. Creating single photons in desired quantum states require careful design of waveguide structures. This is greatly facilitated by a general numerical approach as presented here. Additionally, such a numerical approach allows detailed analysis of real...... systems where all relevent effects are included....

  1. Microprocessor-based stepping motor driver

    International Nuclear Information System (INIS)

    Halbig, J.K.; Klosterbuer, S.F.

    1979-09-01

    The Pion Generation for Medical Irradiations (PIGMI) program at the Los Alamos Scientific Laboratory requires a versatile stepping motor driver to do beam diagnostic measurements. A driver controlled by a microprocessor that can move eight stepping motors simultaneously was designed. The driver can monitor and respond to clockwise- and counterclockwise-limit switches, and it can monitor a 0- to 10-V dc position signal. The software controls start and stop ramping and maximum stepping rates. 2 figures, 1 table

  2. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  3. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  4. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  5. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  6. Microcomputer-based stepping-motor controller

    International Nuclear Information System (INIS)

    Johnson, K.

    1983-04-01

    A microcomputer-controlled stepping motor is described. A Motorola MC68701 microcomputer unit is interfaced to a Cybernetic CY500 stored-program controller that outputs through Motorola input/output isolation modules to the stepping motor. A complex multifunction controller with enhanced capabilities is thus available with a minimum number of parts

  7. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  8. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  9. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  10. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  11. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  12. Using an isomorphic problem pair to learn introductory physics: Transferring from a two-step problem to a three-step problem

    Directory of Open Access Journals (Sweden)

    Shih-Yin Lin

    2013-10-01

    Full Text Available In this study, we examine introductory physics students’ ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation in which they had to learn from a solved problem provided and take advantage of what they learned from it to solve another isomorphic problem (which we call the quiz problem. The solved problem provided has two subproblems while the quiz problem has three subproblems, which is known from previous research to be challenging for introductory students. In addition to the solved problem, students also received extra scaffolding supports that were intended to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. The data analysis suggests that students had great difficulty in transferring what they learned from a two-step problem to a three-step problem. Although most students were able to learn from the solved problem to some extent with the scaffolding provided and invoke the relevant principles in the quiz problem, they were not necessarily able to apply the principles correctly. We also conducted think-aloud interviews with six introductory students in order to understand in depth the difficulties they had and explore strategies to provide better scaffolding. The interviews suggest that students often superficially mapped the principles employed in the solved problem to the quiz problem without necessarily understanding the governing conditions underlying each principle and examining the applicability of the principle in the new situation in an in-depth manner. Findings suggest that more scaffolding is needed to help students in transferring from a two-step problem to a three-step problem and applying the physics principles appropriately. We outline a few

  13. Using an isomorphic problem pair to learn introductory physics: Transferring from a two-step problem to a three-step problem

    Science.gov (United States)

    Lin, Shih-Yin; Singh, Chandralekha

    2013-12-01

    In this study, we examine introductory physics students’ ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation in which they had to learn from a solved problem provided and take advantage of what they learned from it to solve another isomorphic problem (which we call the quiz problem). The solved problem provided has two subproblems while the quiz problem has three subproblems, which is known from previous research to be challenging for introductory students. In addition to the solved problem, students also received extra scaffolding supports that were intended to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. The data analysis suggests that students had great difficulty in transferring what they learned from a two-step problem to a three-step problem. Although most students were able to learn from the solved problem to some extent with the scaffolding provided and invoke the relevant principles in the quiz problem, they were not necessarily able to apply the principles correctly. We also conducted think-aloud interviews with six introductory students in order to understand in depth the difficulties they had and explore strategies to provide better scaffolding. The interviews suggest that students often superficially mapped the principles employed in the solved problem to the quiz problem without necessarily understanding the governing conditions underlying each principle and examining the applicability of the principle in the new situation in an in-depth manner. Findings suggest that more scaffolding is needed to help students in transferring from a two-step problem to a three-step problem and applying the physics principles appropriately. We outline a few possible strategies

  14. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  15. A STEPPING STONE TOWARDS KNOWLEDGE BASED MAINTENANCE

    OpenAIRE

    G. Waeyenbergh; L. Pintelon; L. Gelders

    2012-01-01

    Maintenance decision making becomes more and more a management concern. Some decades ago, maintenance was still often considered as an unavoidable side effect of production. The perception of maintenance has evolved considerably. One of the current issues is the maintenance concept, being the mix of maintenance interventions and the general framework for determining this mix. In this paper we describe a modular framework, called Knowledge Based Maintenance, for developing a customised mainten...

  16. A STEPPING STONE TOWARDS KNOWLEDGE BASED MAINTENANCE

    Directory of Open Access Journals (Sweden)

    G. Waeyenbergh

    2012-01-01

    Full Text Available Maintenance decision making becomes more and more a management concern. Some decades ago, maintenance was still often considered as an unavoidable side effect of production. The perception of maintenance has evolved considerably. One of the current issues is the maintenance concept, being the mix of maintenance interventions and the general framework for determining this mix. In this paper we describe a modular framework, called Knowledge Based Maintenance, for developing a customised maintenance concept. After describing the general framework and its decision support use, some case experiences are given. This experience covers some elements of the proposed framework.

  17. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  18. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  19. Monte-Carlo simulations of geminate electron-hole pair dissociation in a molecular heterojunction: a two-step dissociation mechanism

    International Nuclear Information System (INIS)

    Offermans, Ton; Meskers, Stefan C.J.; Janssen, Rene A.J.

    2005-01-01

    The Monte-Carlo simulations are used to investigate the dissociation of a Coulomb correlated charge pair at an idealized interface between an electron accepting and an electron donating molecular material. In the simulations the materials are represented by cubic lattices of sites, with site the energies spread according to Gaussian distributions. The influence of temperature, applied external fields, and the width of the Gaussian densities of states distribution for both the electron and the hole transporting material are investigated. The results show that the dissociation of geminate charge pairs is assisted by disorder and the results can be understood in terms of a two-step model. In the first step, the slow carrier in the most disordered material jumps away from the interface. In the following, second step, the reduced Coulombic attraction allows the faster carrier in the less disordered material to escape from the interface by thermally activated hopping. When the rate for geminate recombination at the interface is very low ( -1 ) the simulations predict a high yield for carrier collection, as observed experimentally. Comparison of the simulated and experimentally observed temperature dependence of the collection efficiency indicates that at low temperature dissociation of the geminate charge pairs may be one of the factors limiting the device performance

  20. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  1. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  2. Variable Step Size Maximum Correntropy Criteria Based Adaptive Filtering Algorithm

    Directory of Open Access Journals (Sweden)

    S. Radhika

    2016-04-01

    Full Text Available Maximum correntropy criterion (MCC based adaptive filters are found to be robust against impulsive interference. This paper proposes a novel MCC based adaptive filter with variable step size in order to obtain improved performance in terms of both convergence rate and steady state error with robustness against impulsive interference. The optimal variable step size is obtained by minimizing the Mean Square Deviation (MSD error from one iteration to the other. Simulation results in the context of a highly impulsive system identification scenario show that the proposed algorithm has faster convergence and lesser steady state error than the conventional MCC based adaptive filters.

  3. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  4. Constructing an exposure chart: step by step (based on standard procedures)

    International Nuclear Information System (INIS)

    David, Jocelyn L; Cansino, Percedita T.; Taguibao, Angileo P.

    2000-01-01

    An exposure chart is very important in conducting radiographic inspection of materials. By using an accurate exposure chart, an inspector is able to avoid a trial and error way of determining correct time to expose a specimen, thereby producing a radiograph that has an acceptable density based on a standard. The chart gives the following information: x-ray machine model and brand, distance of the x-ray tube from the film, type and thickness of intensifying screens, film type, radiograph density, and film processing conditions. The methods of preparing an exposure chart are available in existing radiographic testing manuals. These described methods are presented in step by step procedures, covering the actual laboratory set-up, data gathering, computations, and transformation of derived data into Characteristic Curve and Exposure Chart

  5. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  6. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  7. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  8. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  9. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  10. SIMULATION COMPARISON AND STEPS TO DO SIMULATION BY AUTOLISP (AUTOCAD) AND PRO-E FOR GEAR PAIR.

    OpenAIRE

    PRATIK A. SOLANKI; KALPESH P. PATEL; J.R.LIMBACHIYA

    2012-01-01

    This paper gives the basic idea of steps required for doing simulation in AutoCAD with the help of AutoLisp and Pro-Engineering. It includes the comparison between both methods. AutoCAD 2005 and Pro-E wildfireV4.0 used as software to do simulation (Animation).

  11. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  12. Using an Isomorphic Problem Pair to Learn Introductory Physics: Transferring from a Two-Step Problem to a Three-Step Problem

    Science.gov (United States)

    Lin, Shih-Yin; Singh, Chandralekha

    2013-01-01

    In this study, we examine introductory physics students' ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. 382 students from a calculus-based and an algebra-based introductory physics course were administered a quiz in the recitation…

  13. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  14. One Step Quantum Key Distribution Based on EPR Entanglement.

    Science.gov (United States)

    Li, Jian; Li, Na; Li, Lei-Lei; Wang, Tao

    2016-06-30

    A novel quantum key distribution protocol is presented, based on entanglement and dense coding and allowing asymptotically secure key distribution. Considering the storage time limit of quantum bits, a grouping quantum key distribution protocol is proposed, which overcomes the vulnerability of first protocol and improves the maneuverability. Moreover, a security analysis is given and a simple type of eavesdropper's attack would introduce at least an error rate of 46.875%. Compared with the "Ping-pong" protocol involving two steps, the proposed protocol does not need to store the qubit and only involves one step.

  15. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  16. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Optical three-step binary-logic-gate-based MSD arithmetic

    Science.gov (United States)

    Fyath, R. S.; Alsaffar, A. A. W.; Alam, M. S.

    2003-11-01

    A three-step modified signed-digit (MSD) adder is proposed which can be optically implmented using binary logic gates. The proposed scheme depends on encoding each MSD digits into a pair of binary digits using a two-state and multi-position based encoding scheme. The design algorithm depends on constructing the addition truth table of binary-coded MSD numbers and then using Karnaugh map to achieve output minimization. The functions associated with the optical binary logic gates are achieved by simply programming the decoding masks of an optical shadow-casting logic system.

  18. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  19. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  20. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  1. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  2. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  3. Data-Based Predictive Control with Multirate Prediction Step

    Science.gov (United States)

    Barlow, Jonathan S.

    2010-01-01

    Data-based predictive control is an emerging control method that stems from Model Predictive Control (MPC). MPC computes current control action based on a prediction of the system output a number of time steps into the future and is generally derived from a known model of the system. Data-based predictive control has the advantage of deriving predictive models and controller gains from input-output data. Thus, a controller can be designed from the outputs of complex simulation code or a physical system where no explicit model exists. If the output data happens to be corrupted by periodic disturbances, the designed controller will also have the built-in ability to reject these disturbances without the need to know them. When data-based predictive control is implemented online, it becomes a version of adaptive control. One challenge of MPC is computational requirements increasing with prediction horizon length. This paper develops a closed-loop dynamic output feedback controller that minimizes a multi-step-ahead receding-horizon cost function with multirate prediction step. One result is a reduced influence of prediction horizon and the number of system outputs on the computational requirements of the controller. Another result is an emphasis on portions of the prediction window that are sampled more frequently. A third result is the ability to include more outputs in the feedback path than in the cost function.

  4. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  5. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  6. SU-F-J-66: Anatomy Deformation Based Comparison Between One-Step and Two-Step Optimization for Online ART

    International Nuclear Information System (INIS)

    Feng, Z; Yu, G; Qin, S; Li, D; Ma, C; Zhu, J; Yin, Y

    2016-01-01

    Purpose: This study investigated that how the quality of adapted plan was affected by inter-fractional anatomy deformation by using one-step and two-step optimization for on line adaptive radiotherapy (ART) procedure. Methods: 10 lung carcinoma patients were chosen randomly to produce IMRT plan by one-step and two-step algorithms respectively, and the prescribed dose was set as 60 Gy on the planning target volume (PTV) for all patients. To simulate inter-fractional target deformation, four specific cases were created by systematic anatomy variation; including target superior shift 0.5 cm, 0.3cm contraction, 0.3 cm expansion and 45-degree rotation. Based on these four anatomy deformation, adapted plan, regenerated plan and non-adapted plan were created to evaluate quality of adaptation. Adapted plans were generated automatically by using one-step and two-step algorithms respectively to optimize original plans, and regenerated plans were manually created by experience physicists. Non-adapted plans were produced by recalculating the dose distribution based on corresponding original plans. The deviations among these three plans were statistically analyzed by paired T-test. Results: In PTV superior shift case, adapted plans had significantly better PTV coverage by using two-step algorithm compared with one-step one, and meanwhile there was a significant difference of V95 by comparison with adapted and non-adapted plans (p=0.0025). In target contraction deformation, with almost same PTV coverage, the total lung received lower dose using one-step algorithm than two-step algorithm (p=0.0143,0.0126 for V20, Dmean respectively). In other two deformation cases, there were no significant differences observed by both two optimized algorithms. Conclusion: In geometry deformation such as target contraction, with comparable PTV coverage, one-step algorithm gave better OAR sparing than two-step algorithm. Reversely, the adaptation by using two-step algorithm had higher efficiency

  7. SU-F-J-66: Anatomy Deformation Based Comparison Between One-Step and Two-Step Optimization for Online ART

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Z; Yu, G; Qin, S; Li, D [Shandong Normal University, Jinan, Shandong (China); Ma, C; Zhu, J; Yin, Y [Shandong Cancer Hospital and Institute, Jinan, Shandong (China)

    2016-06-15

    Purpose: This study investigated that how the quality of adapted plan was affected by inter-fractional anatomy deformation by using one-step and two-step optimization for on line adaptive radiotherapy (ART) procedure. Methods: 10 lung carcinoma patients were chosen randomly to produce IMRT plan by one-step and two-step algorithms respectively, and the prescribed dose was set as 60 Gy on the planning target volume (PTV) for all patients. To simulate inter-fractional target deformation, four specific cases were created by systematic anatomy variation; including target superior shift 0.5 cm, 0.3cm contraction, 0.3 cm expansion and 45-degree rotation. Based on these four anatomy deformation, adapted plan, regenerated plan and non-adapted plan were created to evaluate quality of adaptation. Adapted plans were generated automatically by using one-step and two-step algorithms respectively to optimize original plans, and regenerated plans were manually created by experience physicists. Non-adapted plans were produced by recalculating the dose distribution based on corresponding original plans. The deviations among these three plans were statistically analyzed by paired T-test. Results: In PTV superior shift case, adapted plans had significantly better PTV coverage by using two-step algorithm compared with one-step one, and meanwhile there was a significant difference of V95 by comparison with adapted and non-adapted plans (p=0.0025). In target contraction deformation, with almost same PTV coverage, the total lung received lower dose using one-step algorithm than two-step algorithm (p=0.0143,0.0126 for V20, Dmean respectively). In other two deformation cases, there were no significant differences observed by both two optimized algorithms. Conclusion: In geometry deformation such as target contraction, with comparable PTV coverage, one-step algorithm gave better OAR sparing than two-step algorithm. Reversely, the adaptation by using two-step algorithm had higher efficiency

  8. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  9. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  10. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  11. Aerial robot intelligent control method based on back-stepping

    Science.gov (United States)

    Zhou, Jian; Xue, Qian

    2018-05-01

    The aerial robot is characterized as strong nonlinearity, high coupling and parameter uncertainty, a self-adaptive back-stepping control method based on neural network is proposed in this paper. The uncertain part of the aerial robot model is compensated online by the neural network of Cerebellum Model Articulation Controller and robust control items are designed to overcome the uncertainty error of the system during online learning. At the same time, particle swarm algorithm is used to optimize and fix parameters so as to improve the dynamic performance, and control law is obtained by the recursion of back-stepping regression. Simulation results show that the designed control law has desired attitude tracking performance and good robustness in case of uncertainties and large errors in the model parameters.

  12. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  13. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  14. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  15. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  16. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  17. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  18. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  19. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  20. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  1. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    Science.gov (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  2. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  3. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  4. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  5. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.

    2009-01-01

    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  6. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  7. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.

    2011-01-01

    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  8. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  9. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  10. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  11. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  13. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  14. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  15. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  16. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    Science.gov (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  17. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  18. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  19. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  20. Flow-based market coupling. Stepping stone towards nodal pricing?

    International Nuclear Information System (INIS)

    Van der Welle, A.J.

    2012-07-01

    For achieving one internal energy market for electricity by 2014, market coupling is deployed to integrate national markets into regional markets and ultimately one European electricity market. The extent to which markets can be coupled depends on the available transmission capacities between countries. Since interconnections are congested from time to time, congestion management methods are deployed to divide the scarce available transmission capacities over market participants. For further optimization of the use of available transmission capacities while maintaining current security of supply levels, flow-based market coupling (FBMC) will be implemented in the CWE region by 2013. Although this is an important step forward, important hurdles for efficient congestion management remain. Hence, flow based market coupling is compared to nodal pricing, which is often considered as the most optimal solution from theoretical perspective. In the context of decarbonised power systems it is concluded that advantages of nodal pricing are likely to exceed its disadvantages, warranting further development of FBMC in the direction of nodal pricing.

  1. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  2. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  3. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  4. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  5. An Inquiry-Based Approach of Traditional "Step-by-Step" Experiments

    Science.gov (United States)

    Szalay, L.; Tóth, Z.

    2016-01-01

    This is the start of a road map for the effective introduction of inquiry-based learning in chemistry. Advantages of inquiry-based approaches to the development of scientific literacy are widely discussed in the literature. However, unless chemistry educators take account of teachers' reservations and identified disadvantages such approaches will…

  6. A Step-by-Step Design Methodology for a Base Case Vanadium Redox-Flow Battery

    Science.gov (United States)

    Moore, Mark; Counce, Robert M.; Watson, Jack S.; Zawodzinski, Thomas A.; Kamath, Haresh

    2012-01-01

    The purpose of this work is to develop an evolutionary procedure to be used by Chemical Engineering students for the base-case design of a Vanadium Redox-Flow Battery. The design methodology is based on the work of Douglas (1985) and provides a profitability analysis at each decision level so that more profitable alternatives and directions can be…

  7. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  8. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  9. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  10. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  11. Practical Biostatistics A Friendly Step-by-Step Approach for Evidence-based Medicine

    CERN Document Server

    Suchmacher, Mendel

    2012-01-01

    Evidence-based medicine aims to apply the best available evidence gained from the scientific method to medical decision making. It is a practice that uses statistical analysis of scientific methods and outcomes to drive further experimentation and diagnosis. The profusion of evidence-based medicine in medical practice and clinical research has produced a need for life scientists and clinical researchers to assimilate biostatistics into their work to meet efficacy and practical standards. Practical Biostatistics provides researchers, medical professionals, and students with a friendly, practica

  12. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  13. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  14. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  15. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  16. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  17. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  18. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  19. Control in the Rate-Determining Step Provides a Promising Strategy To Develop New Catalysts for CO2 Hydrogenation: A Local Pair Natural Orbital Coupled Cluster Theory Study.

    Science.gov (United States)

    Mondal, Bhaskar; Neese, Frank; Ye, Shengfa

    2015-08-03

    The development of efficient catalysts with base metals for CO2 hydrogenation has always been a major thrust of interest. A series of experimental and theoretical work has revealed that the catalytic cycle typically involves two key steps, namely, base-promoted heterolytic H2 splitting and hydride transfer to CO2, either of which can be the rate-determining step (RDS) of the entire reaction. To explore the determining factor for the nature of RDS, we present herein a comparative mechanistic investigation on CO2 hydrogenation mediated by [M(H)(η(2)-H2)(PP3(Ph))](n+) (M = Fe(II), Ru(II), and Co(III); PP3(Ph) = tris(2-(diphenylphosphino)phenyl)phosphine) type complexes. In order to construct reliable free energy profiles, we used highly correlated wave function based ab initio methods of the coupled cluster type alongside the standard density functional theory. Our calculations demonstrate that the hydricity of the metal-hydride intermediate generated by H2 splitting dictates the nature of the RDS for the Fe(II) and Co(III) systems, while the RDS for the Ru(II) catalyst appears to be ambiguous. CO2 hydrogenation catalyzed by the Fe(II) complex that possesses moderate hydricity traverses an H2-splitting RDS, whereas the RDS for the high-hydricity Co(III) species is found to be the hydride transfer. Thus, our findings suggest that hydricity can be used as a practical guide in future catalyst design. Enhancing the electron-accepting ability of low-hydricity catalysts is likely to improve their catalytic performance, while increasing the electron-donating ability of high-hydricity complexes may speed up CO2 conversion. Moreover, we also established the active roles of base NEt3 in directing the heterolytic H2 splitting and assisting product release through the formation of an acid-base complex.

  20. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  1. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  2. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  3. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  5. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  6. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  8. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  9. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  10. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    OpenAIRE

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  11. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  12. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  13. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  14. Student Opinions about the Seven-Step Procedure in Problem-Based Hospitality Management Education

    Science.gov (United States)

    Zwaal, Wichard; Otting, Hans

    2014-01-01

    This study investigates how hospitality management students appreciate the role and application of the seven-step procedure in problem-based learning. A survey was developed containing sections about personal characteristics, recall of the seven steps, overall report marks, and 30 statements about the seven-step procedure. The survey was…

  15. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  16. Performance of the Seven-step Procedure in Problem-based Hospitality Management Education

    Directory of Open Access Journals (Sweden)

    Wichard Zwaal

    2016-12-01

    Full Text Available The study focuses on the seven-step procedure (SSP in problem-based learning (PBL. The way students apply the seven-step procedure will help us understand how students work in a problem-based learning curriculum. So far, little is known about how students rate the performance and importance of the different steps, the amount of time they spend on each step and the perceived quality of execution of the procedure. A survey was administered to a sample of 101 students enrolled in a problem-based hospitality management program. Results show that students consider step 6 (Collect additional information outside the group to be most important. The highest performance-rating is for step two (Define the problem and the lowest for step four (Draw a systemic inventory of explanations from step three. Step seven is classified as low in performance and high in importance implicating urgent attention. The average amount of time spent on the seven steps is 133 minutes with the largest part of the time spent on self-study outside the group (42 minutes. The assessment of the execution of a set of specific guidelines (the Blue Card did not completely match with the overall performance ratings for the seven steps. The SSP could be improved by reducing the number of steps and incorporating more attention to group dynamics.

  17. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  18. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    Czech Academy of Sciences Publication Activity Database

    Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří

    Roč. 38, č. 1 ( 2010 ), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010

  19. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  20. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  1. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    Science.gov (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  2. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  3. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin

    2014-01-01

    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  4. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    Science.gov (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  5. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  6. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  7. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  8. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  9. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  10. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  11. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  12. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  13. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  14. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  15. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  16. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  17. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  18. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

    Science.gov (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  20. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  1. Developing evidence-based librarianship: practical steps for implementation.

    Science.gov (United States)

    Crumley, Ellen; Koufogiannakis, Denise

    2002-06-01

    Evidence-based librarianship (EBL) is a relatively new concept for librarians. This paper lays out a practical framework for the implementation of EBL. A new way of thinking about research in librarianship is introduced using the well-built question process and the assignment of librarian research questions to one of six domains specific to librarianship. As a profession, librarianship tends to reflect more qualitative, social sciences/humanities in its research methods and study types which tend to be less rigorous and more prone to bias. Randomised controlled trials (RCT) do not have to be placed at the top of an evidence 'hierarchy' for librarianship. Instead, a more encompassing model reflecting librarianship as a whole and the kind of research likely to be done by librarians is proposed. 'Evidence' from a number of disciplines including health sciences, business and education can be utilized by librarians and applied to their practice. However, access to and availability of librarianship literature needs to be further studied. While using other disciplines (e.g. EBHC) as a model for EBL has been explored in the literature, the authors develop models unique to librarianship. While research has always been a minor focus in the profession, moving research into practice is becoming more important and librarians need to consider the issues surrounding research in order to move EBL forward.

  2. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  3. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  4. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  5. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  6. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  7. Prediction Equations of Energy Expenditure in Chinese Youth Based on Step Frequency during Walking and Running

    Science.gov (United States)

    Sun, Bo; Liu, Yu; Li, Jing Xian; Li, Haipeng; Chen, Peijie

    2013-01-01

    Purpose: This study set out to examine the relationship between step frequency and velocity to develop a step frequency-based equation to predict Chinese youth's energy expenditure (EE) during walking and running. Method: A total of 173 boys and girls aged 11 to 18 years old participated in this study. The participants walked and ran on a…

  8. One-step production of biodiesel from Nannochloropsis sp. on solid base Mg-Zr catalyst

    International Nuclear Information System (INIS)

    Li, Yuesong; Lian, Shuang; Tong, Dongmei; Song, Ruili; Yang, Wenyan; Fan, Yong; Qing, Renwei; Hu, Changwei

    2011-01-01

    Nannochloropsis sp., one kind of green microalgae cultivated autotrophically and axenically in laboratory, is used as raw material to produce biodiesel by one-step method in an amended reactor. The effects of several reaction parameters on transesterification over Mg-Zr solid base catalyst were investigated through both conventional method and one-step method. One-step method could give a higher yield of methyl ester than conventional two-step method, which demonstrates that the present one-step method is suitable for biodiesel production from the microalgae Nannochloropsis sp. Moreover, the present one-step method realizes the convenient in situ separation of catalyst from microalgae residue which can be easily used consequently, reducing the procedure units as well as the overall costs.

  9. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  10. Multi-step wrought processing of TiAl-based alloys

    International Nuclear Information System (INIS)

    Fuchs, G.E.

    1997-04-01

    Wrought processing will likely be needed for fabrication of a variety of TiAl-based alloy structural components. Laboratory and development work has usually relied on one-step forging to produce test material. Attempts to scale-up TiAl-based alloy processing has indicated that multi-step wrought processing is necessary. The purpose of this study was to examine potential multi-step processing routes, such as two-step isothermal forging and extrusion + isothermal forging. The effects of processing (I/M versus P/M), intermediate recrystallization heat treatments and processing route on the tensile and creep properties of Ti-48Al-2Nb-2Cr alloys were examined. The results of the testing were then compared to samples from the same heats of materials processed by one-step routes. Finally, by evaluating the effect of processing on microstructure and properties, optimized and potentially lower cost processing routes could be identified

  11. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  12. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  13. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    Science.gov (United States)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  14. Compatibility of pedigree-based and marker-based relationship matrices for single-step genetic evaluation

    DEFF Research Database (Denmark)

    Christensen, Ole Fredslund

    2012-01-01

    Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker-based rel...

  15. Steps that count! A feasibility study of a pedometer-based, health ...

    African Journals Online (AJOL)

    a large gap between the development of effective pedometer-based interventions and their ... [13] Using more cost-effective intervention strategies, such as ..... Abel M, Hannon J, Mullineaux D, Beighle A. Determination of step rate thresholds.

  16. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  17. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Research on test of product based on spatial sampling criteria and variable step sampling mechanism

    Science.gov (United States)

    Li, Ruihong; Han, Yueping

    2014-09-01

    This paper presents an effective approach for online testing the assembly structures inside products using multiple views technique and X-ray digital radiography system based on spatial sampling criteria and variable step sampling mechanism. Although there are some objects inside one product to be tested, there must be a maximal rotary step for an object within which the least structural size to be tested is predictable. In offline learning process, Rotating the object by the step and imaging it and so on until a complete cycle is completed, an image sequence is obtained that includes the full structural information for recognition. The maximal rotary step is restricted by the least structural size and the inherent resolution of the imaging system. During online inspection process, the program firstly finds the optimum solutions to all different target parts in the standard sequence, i.e., finds their exact angles in one cycle. Aiming at the issue of most sizes of other targets in product are larger than that of the least structure, the paper adopts variable step-size sampling mechanism to rotate the product specific angles with different steps according to different objects inside the product and match. Experimental results show that the variable step-size method can greatly save time compared with the traditional fixed-step inspection method while the recognition accuracy is guaranteed.

  19. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  20. Molecular dynamics based enhanced sampling of collective variables with very large time steps

    Science.gov (United States)

    Chen, Pei-Yang; Tuckerman, Mark E.

    2018-01-01

    Enhanced sampling techniques that target a set of collective variables and that use molecular dynamics as the driving engine have seen widespread application in the computational molecular sciences as a means to explore the free-energy landscapes of complex systems. The use of molecular dynamics as the fundamental driver of the sampling requires the introduction of a time step whose magnitude is limited by the fastest motions in a system. While standard multiple time-stepping methods allow larger time steps to be employed for the slower and computationally more expensive forces, the maximum achievable increase in time step is limited by resonance phenomena, which inextricably couple fast and slow motions. Recently, we introduced deterministic and stochastic resonance-free multiple time step algorithms for molecular dynamics that solve this resonance problem and allow ten- to twenty-fold gains in the large time step compared to standard multiple time step algorithms [P. Minary et al., Phys. Rev. Lett. 93, 150201 (2004); B. Leimkuhler et al., Mol. Phys. 111, 3579-3594 (2013)]. These methods are based on the imposition of isokinetic constraints that couple the physical system to Nosé-Hoover chains or Nosé-Hoover Langevin schemes. In this paper, we show how to adapt these methods for collective variable-based enhanced sampling techniques, specifically adiabatic free-energy dynamics/temperature-accelerated molecular dynamics, unified free-energy dynamics, and by extension, metadynamics, thus allowing simulations employing these methods to employ similarly very large time steps. The combination of resonance-free multiple time step integrators with free-energy-based enhanced sampling significantly improves the efficiency of conformational exploration.

  1. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  2. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  3. Investigation to biodiesel production by the two-step homogeneous base-catalyzed transesterification.

    Science.gov (United States)

    Ye, Jianchu; Tu, Song; Sha, Yong

    2010-10-01

    For the two-step transesterification biodiesel production made from the sunflower oil, based on the kinetics model of the homogeneous base-catalyzed transesterification and the liquid-liquid phase equilibrium of the transesterification product, the total methanol/oil mole ratio, the total reaction time, and the split ratios of methanol and reaction time between the two reactors in the stage of the two-step reaction are determined quantitatively. In consideration of the transesterification intermediate product, both the traditional distillation separation process and the improved separation process of the two-step reaction product are investigated in detail by means of the rigorous process simulation. In comparison with the traditional distillation process, the improved separation process of the two-step reaction product has distinct advantage in the energy duty and equipment requirement due to replacement of the costly methanol-biodiesel distillation column. Copyright 2010 Elsevier Ltd. All rights reserved.

  4. Graph-based surface reconstruction from stereo pairs using image segmentation

    Science.gov (United States)

    Bleyer, Michael; Gelautz, Margrit

    2005-01-01

    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  5. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  6. Enriching step-based product information models to support product life-cycle activities

    Science.gov (United States)

    Sarigecili, Mehmet Ilteris

    The representation and management of product information in its life-cycle requires standardized data exchange protocols. Standard for Exchange of Product Model Data (STEP) is such a standard that has been used widely by the industries. Even though STEP-based product models are well defined and syntactically correct, populating product data according to these models is not easy because they are too big and disorganized. Data exchange specifications (DEXs) and templates provide re-organized information models required in data exchange of specific activities for various businesses. DEXs show us it would be possible to organize STEP-based product models in order to support different engineering activities at various stages of product life-cycle. In this study, STEP-based models are enriched and organized to support two engineering activities: materials information declaration and tolerance analysis. Due to new environmental regulations, the substance and materials information in products have to be screened closely by manufacturing industries. This requires a fast, unambiguous and complete product information exchange between the members of a supply chain. Tolerance analysis activity, on the other hand, is used to verify the functional requirements of an assembly considering the worst case (i.e., maximum and minimum) conditions for the part/assembly dimensions. Another issue with STEP-based product models is that the semantics of product data are represented implicitly. Hence, it is difficult to interpret the semantics of data for different product life-cycle phases for various application domains. OntoSTEP, developed at NIST, provides semantically enriched product models in OWL. In this thesis, we would like to present how to interpret the GD & T specifications in STEP for tolerance analysis by utilizing OntoSTEP.

  7. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  8. PID controller auto-tuning based on process step response and damping optimum criterion.

    Science.gov (United States)

    Pavković, Danijel; Polak, Siniša; Zorc, Davor

    2014-01-01

    This paper presents a novel method of PID controller tuning suitable for higher-order aperiodic processes and aimed at step response-based auto-tuning applications. The PID controller tuning is based on the identification of so-called n-th order lag (PTn) process model and application of damping optimum criterion, thus facilitating straightforward algebraic rules for the adjustment of both the closed-loop response speed and damping. The PTn model identification is based on the process step response, wherein the PTn model parameters are evaluated in a novel manner from the process step response equivalent dead-time and lag time constant. The effectiveness of the proposed PTn model parameter estimation procedure and the related damping optimum-based PID controller auto-tuning have been verified by means of extensive computer simulations. © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

  9. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  10. Step-height standards based on the rapid formation of monolayer steps on the surface of layered crystals

    Energy Technology Data Exchange (ETDEWEB)

    Komonov, A.I. [Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences (ISP SBRAS), pr. Lavrentieva 13, Novosibirsk 630090 (Russian Federation); Prinz, V.Ya., E-mail: prinz@isp.nsc.ru [Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences (ISP SBRAS), pr. Lavrentieva 13, Novosibirsk 630090 (Russian Federation); Seleznev, V.A. [Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences (ISP SBRAS), pr. Lavrentieva 13, Novosibirsk 630090 (Russian Federation); Kokh, K.A. [Sobolev Institute of Geology and Mineralogy, Siberian Branch of the Russian Academy of Sciences (IGM SB RAS), pr. Koptyuga 3, Novosibirsk 630090 (Russian Federation); Shlegel, V.N. [Nikolaev Institute of Inorganic Chemistry, Siberian Branch of the Russian Academy of Sciences (NIIC SB RAS), pr. Lavrentieva 3, Novosibirsk 630090 (Russian Federation)

    2017-07-15

    Highlights: • Easily reproducible step-height standard for SPM calibrations was proposed. • Step-height standard is monolayer steps on the surface of layered single crystal. • Long-term change in surface morphology of Bi{sub 2}Se{sub 3} and ZnWO{sub 4} was investigated. • Conducting surface of Bi{sub 2}Se{sub 3} crystals appropriate for calibrating STM. • Ability of robust SPM calibrations under ambient conditions were demonstrated. - Abstract: Metrology is essential for nanotechnology, especially for structures and devices with feature sizes going down to nm. Scanning probe microscopes (SPMs) permits measurement of nanometer- and subnanometer-scale objects. Accuracy of size measurements performed using SPMs is largely defined by the accuracy of used calibration measures. In the present publication, we demonstrate that height standards of monolayer step (∼1 and ∼0.6 nm) can be easily prepared by cleaving Bi{sub 2}Se{sub 3} and ZnWO{sub 4} layered single crystals. It was shown that the conducting surface of Bi{sub 2}Se{sub 3} crystals offers height standard appropriate for calibrating STMs and for testing conductive SPM probes. Our AFM study of the morphology of freshly cleaved (0001) Bi{sub 2}Se{sub 3} surfaces proved that such surfaces remained atomically smooth during a period of at least half a year. The (010) surfaces of ZnWO{sub 4} crystals remained atomically smooth during one day, but already two days later an additional nanorelief of amplitude ∼0.3 nm appeared on those surfaces. This relief, however, did not further grow in height, and it did not hamper the calibration. Simplicity and the possibility of rapid fabrication of the step-height standards, as well as their high stability, make these standards available for a great, permanently growing number of users involved in 3D printing activities.

  11. Workplace based assessment: a step to promote competency based postgraduate training.

    Science.gov (United States)

    Singh, Tejinder; Modi, Jyoti Nath

    2013-06-08

    There has been an increasing emphasis on defining outcomes of medical education in terms of performance of trainees. This is a step beyond the description of outcomes in terms of competence that encompasses mostly potential abilities rather than the actual performance. The contextual adaptations and behavior judgments of the trainees are best assessed by a program of in-training assessment. Workplace based assessment (WPBA) is one of the modalities, which assesses the trainee in authentic settings. Though Postgraduate (PG) medical training in India is said to be competency-based, most institutions do not have any formative or in-training assessment program for the same. The two cardinal elements of WPBA are direct observation and conducted in work place in addition to provision of feedback to the trainee. The WPBA conforms to the highest (Level 4: Does) of Millers pyramid and also has the potential to assess at all four levels. Some of the tools used for WPBA are: Logbooks, Clinical Encounter Cards (CEC), mini-Clinical Evaluation Exercise (mini-CEX), Case based discussions, Direct Observation of Procedural Skills (DOPS), Multisource feedback (peers, co-workers, seniors, patients) etc. These can be documented in the form of a portfolio that provides a longitudinal view of experiences and progress of the trainee. The WPBA scores high on validity and educational impact by virtue of being based on direct observation in real situation and contextual feedback. The feasibility and acceptability is enhanced by making appropriate choices of tools, advance planning, building of mutual trust, and training of assessors. Given the established benefits of WPBA in shaping clinical learning, there is an imminent need for including this mode of assessment in our clinical training programs especially PG training.

  12. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  13. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring

    Science.gov (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann

    2012-01-01

    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  14. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  15. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  16. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  17. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  18. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  19. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems.

    Science.gov (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  20. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    Science.gov (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  1. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  4. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-01-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

  5. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    Science.gov (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  6. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)

    2015-07-01

    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  7. Effectiveness of "Step into Health" program in Qatar: a pedometer-based longitudinal study.

    Science.gov (United States)

    Al-Kuwari, Mohamed G; Al-Mohannadi, Abdulla S; Sayegh, Suzan

    2017-11-01

    This study examines the impact of a one-year pedometer-based intervention on increasing the physical activity level among adult population in Qatar. This longitudinal study was conducted over a one-year period and included a total of 268 adults aged between 18-64 years old. Data were extracted and used from the "Step into Health" (SIH) program, a community-based program launched in 2012, as an approach to improve physical activity in Qatar. Walking intervention encouraged members of SIH to accumulate 10,000 steps or more per day and monitor their progress through a pedometer supported by a self-monitoring online account and a reinforcement system. This study shows a significant increase in average daily steps from 3933±3240 steps/day at baseline into 7507±5416 steps/week at the 12th month (P<0.001). It was found that 18.6% of participants met the daily target of 10,000 steps or more; however, there was a considerable increase of 39.2% by the 12th month. Females showed an increase in their physical activity; still, they remain less active than males. It was found that non-Arabs subgroup were more active than Arabs. Interestingly, older members (≥50 years old) were more active throughout the study period. Pedometer program was found to be effective in increasing the level of physical activity among participants. A decline in physical activity has been observed during hot weather, while re-enforcement campaign had a positive impact on the number of steps/day.

  8. Testing for direct genetic effects using a screening step in family-based association studies

    Directory of Open Access Journals (Sweden)

    Sharon M Lutz

    2013-11-01

    Full Text Available In genome wide association studies (GWAS, families based studies tend to have less power to detect genetic associations than population based studies, such as case-control studies. This can be an issue when testing if genes in a family based GWAS have a direct effect on the phenotype of interest or if the genes act indirectly through a secondary phenotype. When multiple SNPs are tested for a direct effect in the family based study, a screening step can be used to minimize the burden of multiple comparisons in the causal analysis. We propose a 2-stage screening step that can be incorporated into the family based association test (FBAT approach similar to the conditional mean model approach in the VanSteen-algorithm [1]. Simulations demonstrate that the type 1 error is preserved and this method is advantageous when multiple markers are tested. This method is illustrated by an application to the Framingham Heart Study.

  9. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  10. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  11. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  12. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  13. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

    2011-01-01

    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  14. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  15. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  16. Students' Errors in Solving the Permutation and Combination Problems Based on Problem Solving Steps of Polya

    Science.gov (United States)

    Sukoriyanto; Nusantara, Toto; Subanji; Chandra, Tjang Daniel

    2016-01-01

    This article was written based on the results of a study evaluating students' errors in problem solving of permutation and combination in terms of problem solving steps according to Polya. Twenty-five students were asked to do four problems related to permutation and combination. The research results showed that the students still did a mistake in…

  17. Initial steps towards an evidence-based classification system for golfers with a physical impairment

    NARCIS (Netherlands)

    Stoter, Inge K.; Hettinga, Florentina J.; Altmann, Viola; Eisma, Wim; Arendzen, Hans; Bennett, Tony; van der Woude, Lucas H.; Dekker, Rienk

    2017-01-01

    Purpose: The present narrative review aims to make a first step towards an evidence-based classification system in handigolf following the International Paralympic Committee (IPC). It intends to create a conceptual framework of classification for handigolf and an agenda for future research. Method:

  18. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  19. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  2. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  3. Smoke regions extraction based on two steps segmentation and motion detection in early fire

    Science.gov (United States)

    Jian, Wenlin; Wu, Kaizhi; Yu, Zirong; Chen, Lijuan

    2018-03-01

    Aiming at the early problems of video-based smoke detection in fire video, this paper proposes a method to extract smoke suspected regions by combining two steps segmentation and motion characteristics. Early smoldering smoke can be seen as gray or gray-white regions. In the first stage, regions of interests (ROIs) with smoke are obtained by using two step segmentation methods. Then, suspected smoke regions are detected by combining the two step segmentation and motion detection. Finally, morphological processing is used for smoke regions extracting. The Otsu algorithm is used as segmentation method and the ViBe algorithm is used to detect the motion of smoke. The proposed method was tested on 6 test videos with smoke. The experimental results show the effectiveness of our proposed method over visual observation.

  4. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  5. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  6. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  7. LiLEDDA: A Six-Step Forum-Based Netnographic Research Method for Nursing Science

    Directory of Open Access Journals (Sweden)

    MARTIN SALZMANN-ERIKSON

    2012-01-01

    Full Text Available Internet research methods in nursing science are less developed than in other sciences. We choose to present an approach to conducting nursing research on an internet-based forum. This paper presents LiLEDDA, a six-step forum-based netnographic research method for nursing science. The steps consist of: 1. Literature review and identification of the research question(s; 2. Locating the field(s online; 3. Ethical considerations; 4. Data gathering; 5. Data analysis and interpretation; and 6. Abstractions and trustworthiness. Traditional research approaches are limiting when studying non-normative and non-mainstream life-worlds and their cultures. We argue that it is timely to develop more up-to-date research methods and study designs applicable to nursing science that reflect social developments and human living conditions that tend to be increasingly online-based.

  8. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  10. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  11. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt

    2018-05-01

    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  12. A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

    Science.gov (United States)

    Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

    2012-12-01

    A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

  13. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  14. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  16. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    Science.gov (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  17. Robust and unobtrusive algorithm based on position independence for step detection

    Science.gov (United States)

    Qiu, KeCheng; Li, MengYang; Luo, YiHan

    2018-04-01

    Running is becoming one of the most popular exercises among the people, monitoring steps can help users better understand their running process and improve exercise efficiency. In this paper, we design and implement a robust and unobtrusive algorithm based on position independence for step detection under real environment. It applies Butterworth filter to suppress high frequency interference and then employs the projection based on mathematics to transform system to solve the problem of unknown position of smartphone. Finally, using sliding window to suppress the false peak. The algorithm was tested for eight participants on the Android 7.0 platform. In our experiments, the results show that the proposed algorithm can achieve desired effect in spite of device pose.

  18. A Method of MPPT Control Based on Power Variable Step-size in Photovoltaic Converter System

    Directory of Open Access Journals (Sweden)

    Xu Hui-xiang

    2016-01-01

    Full Text Available Since the disadvantage of traditional MPPT algorithms of variable step-size, proposed power tracking based on variable step-size with the advantage method of the constant-voltage and the perturb-observe (P&O[1-3]. The control strategy modify the problem of voltage fluctuation caused by perturb-observe method, at the same time, introducing the advantage of constant-voltage method and simplify the circuit topology. With the theoretical derivation, control the output power of photovoltaic modules to change the duty cycle of main switch. Achieve the maximum power stabilization output, reduce the volatility of energy loss effectively, and improve the inversion efficiency[3,4]. Given the result of experimental test based theoretical derivation and the curve of MPPT when the prototype work.

  19. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  1. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  2. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  3. Multi-Step Deep Reactive Ion Etching Fabrication Process for Silicon-Based Terahertz Components

    Science.gov (United States)

    Jung-Kubiak, Cecile (Inventor); Reck, Theodore (Inventor); Chattopadhyay, Goutam (Inventor); Perez, Jose Vicente Siles (Inventor); Lin, Robert H. (Inventor); Mehdi, Imran (Inventor); Lee, Choonsup (Inventor); Cooper, Ken B. (Inventor); Peralta, Alejandro (Inventor)

    2016-01-01

    A multi-step silicon etching process has been developed to fabricate silicon-based terahertz (THz) waveguide components. This technique provides precise dimensional control across multiple etch depths with batch processing capabilities. Nonlinear and passive components such as mixers and multipliers waveguides, hybrids, OMTs and twists have been fabricated and integrated into a small silicon package. This fabrication technique enables a wafer-stacking architecture to provide ultra-compact multi-pixel receiver front-ends in the THz range.

  4. Step-based cognitive virtual surgery simulation: an innovative approach to surgical education.

    Science.gov (United States)

    Oliker, Aaron; Napier, Zachary; Deluccia, Nicolette; Qualter, John; Sculli, Frank; Smith, Brandon; Stern, Carrie; Flores, Roberto; Hazen, Alexes; McCarthy, Joseph

    2012-01-01

    BioDigital Systems, LLC in collaboration with New York University Langone Medical Center Department of Reconstructive Plastic Surgery has created a complex, real-time, step-based simulation platform for plastic surgery education. These simulators combine live surgical footage, interactive 3D visualization, text labels, and voiceover as well as a high-yield, expert-approved testing mode to create a comprehensive virtual educational environment for the plastic surgery resident or physician.

  5. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  6. Data-based control of a multi-step forming process

    Science.gov (United States)

    Schulte, R.; Frey, P.; Hildenbrand, P.; Vogel, M.; Betz, C.; Lechner, M.; Merklein, M.

    2017-09-01

    The fourth industrial revolution represents a new stage in the organization and management of the entire value chain. However, concerning the field of forming technology, the fourth industrial revolution has only arrived gradually until now. In order to make a valuable contribution to the digital factory the controlling of a multistage forming process was investigated. Within the framework of the investigation, an abstracted and transferable model is used to outline which data have to be collected, how an interface between the different forming machines can be designed tangible and which control tasks must be fulfilled. The goal of this investigation was to control the subsequent process step based on the data recorded in the first step. The investigated process chain links various metal forming processes, which are typical elements of a multi-step forming process. Data recorded in the first step of the process chain is analyzed and processed for an improved process control of the subsequent process. On the basis of the gained scientific knowledge, it is possible to make forming operations more robust and at the same time more flexible, and thus create the fundament for linking various production processes in an efficient way.

  7. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  8. Comparison of crossover and jab step start techniques for base stealing in baseball.

    Science.gov (United States)

    Miyanishi, Tomohisa; Endo, So; Nagahara, Ryu

    2017-11-01

    Base stealing is an important tactic for increasing the chance of scoring in baseball. This study aimed to compare the crossover step (CS) and jab step (JS) starts for base stealing start performance and to clarify the differences between CS and JS starts in terms of three-dimensional lower extremity joint kinetics. Twelve male baseball players performed CS and JS starts, during which their motion and the force they applied to the ground were simultaneously recorded using a motion-capture system and two force platforms. The results showed that the normalised average forward external power, the average forward-backward force exerted by the left leg, and the forward velocities of the whole body centre of gravity generated by both legs and the left leg were significantly higher for the JS start than for the CS start. Moreover, the positive work done by hip extension during the left leg push-off was two-times greater for the JS start than the CS start. In conclusion, this study has demonstrated that the jab step start may be the better technique for a base stealing start and that greater positive work produced by left hip extension is probably responsible for producing its larger forward ground reaction force.

  9. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  10. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail: b6rgw@fantasy.plala.or.jp; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)

    2007-02-01

    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  11. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  12. A 3-Step Algorithm Using Region-Based Active Contours for Video Objects Detection

    Directory of Open Access Journals (Sweden)

    Stéphanie Jehan-Besson

    2002-06-01

    Full Text Available We propose a 3-step algorithm for the automatic detection of moving objects in video sequences using region-based active contours. First, we introduce a very full general framework for region-based active contours with a new Eulerian method to compute the evolution equation of the active contour from a criterion including both region-based and boundary-based terms. This framework can be easily adapted to various applications, thanks to the introduction of functions named descriptors of the different regions. With this new Eulerian method based on shape optimization principles, we can easily take into account the case of descriptors depending upon features globally attached to the regions. Second, we propose a 3-step algorithm for detection of moving objects, with a static or a mobile camera, using region-based active contours. The basic idea is to hierarchically associate temporal and spatial information. The active contour evolves with successively three sets of descriptors: a temporal one, and then two spatial ones. The third spatial descriptor takes advantage of the segmentation of the image in intensity homogeneous regions. User interaction is reduced to the choice of a few parameters at the beginning of the process. Some experimental results are supplied.

  13. New schemes for high-voltage pulsed generators based on stepped transmission lines

    International Nuclear Information System (INIS)

    Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.

    1993-01-01

    Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

  14. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  15. Two-Step Time of Arrival Estimation for Pulse-Based Ultra-Wideband Systems

    Directory of Open Access Journals (Sweden)

    H. Vincent Poor

    2008-05-01

    Full Text Available In cooperative localization systems, wireless nodes need to exchange accurate position-related information such as time-of-arrival (TOA and angle-of-arrival (AOA, in order to obtain accurate location information. One alternative for providing accurate position-related information is to use ultra-wideband (UWB signals. The high time resolution of UWB signals presents a potential for very accurate positioning based on TOA estimation. However, it is challenging to realize very accurate positioning systems in practical scenarios, due to both complexity/cost constraints and adverse channel conditions such as multipath propagation. In this paper, a two-step TOA estimation algorithm is proposed for UWB systems in order to provide accurate TOA estimation under practical constraints. In order to speed up the estimation process, the first step estimates a coarse TOA of the received signal based on received signal energy. Then, in the second step, the arrival time of the first signal path is estimated by considering a hypothesis testing approach. The proposed scheme uses low-rate correlation outputs and is able to perform accurate TOA estimation in reasonable time intervals. The simulation results are presented to analyze the performance of the estimator.

  16. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  17. Specification of a STEP Based Reference Model for Exchange of Robotics Models

    DEFF Research Database (Denmark)

    Haenisch, Jochen; Kroszynski, Uri; Ludwig, Arnold

    robot programming, the descriptions of geometry, kinematics, robotics, dynamics, and controller data using STEP are addressed as major goals of the project.The Project Consortium has now released the "Specificatin of a STEP Based Reference Model for Exchange of Robotics Models" on which a series......ESPRIT Project 6457: "Interoperability of Standards for Robotics in CIME" (InterRob) belongs to the Subprogram "Computer Integrated Manufacturing and Engineering" of ESPRIT, the European Specific Programme for Research and Development in Information Technology supported by the European Commision....... InterRob aims to develop an integrated solution to precision manufacturing by combining product data and database technologies with robotic off-line programming and simulation. Benefits arise from the use of high level simulation tools and developing standards for the exchange of product model data...

  18. Effectiveness of a two-step population-based osteoporosis screening program using FRAX

    DEFF Research Database (Denmark)

    Rubin, K H; Rothmann, M J; Holmberg, T

    2018-01-01

    The Risk-stratified Osteoporosis Strategy Evaluation (ROSE) study investigated the effectiveness of a two-step screening program for osteoporosis in women. We found no overall reduction in fractures from systematic screening compared to the current case-finding strategy. The group of moderate......- to high-risk women, who accepted the invitation to DXA, seemed to benefit from the program. INTRODUCTION: The purpose of the ROSE study was to investigate the effectiveness of a two-step population-based osteoporosis screening program using the Fracture Risk Assessment Tool (FRAX) derived from a self......-administered questionnaire to select women for DXA scan. After the scanning, standard osteoporosis management according to Danish national guidelines was followed. METHODS: Participants were randomized to either screening or control group, and randomization was stratified according to age and area of residence. Inclusion...

  19. Investigating the Effectiveness of Teaching Methods Based on a Four-Step Constructivist Strategy

    Science.gov (United States)

    Çalik, Muammer; Ayas, Alipaşa; Coll, Richard K.

    2010-02-01

    This paper reports on an investigation of the effectiveness an intervention using several different methods for teaching solution chemistry. The teaching strategy comprised a four-step approach derived from a constructivist view of learning. A sample consisting of 44 students (18 boys and 26 girls) was selected purposively from two different Grade 9 classes in the city of Trabzon, Turkey. Data collection employed a purpose-designed `solution chemistry concept test', consisting of 17 items, with the quantitative data from the survey supported by qualitative interview data. The findings suggest that using different methods embedded within the four-step constructivist-based teaching strategy enables students to refute some alternative conceptions, but does not completely eliminate student alternative conceptions for solution chemistry.

  20. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  1. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  2. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  3. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  4. One-step synthesis of DNA functionalized cadmium-free quantum dots and its application in FRET-based protein sensing

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)

    2017-03-08

    DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.

  5. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  6. Is ad-hoc plan adaptation based on 2-Step IMRT feasible?

    International Nuclear Information System (INIS)

    Bratengeier, Klaus; Polat, Buelent; Gainey, Mark; Grewenig, Patricia; Meyer, Juergen; Flentje, Michael

    2009-01-01

    Background: The ability of a geometry-based method to expeditiously adapt a '2-Step' step and shoot IMRT plan was explored. Both changes of the geometry of target and organ at risk have to be balanced. A retrospective prostate planning study was performed to investigate the relative benefits of beam segment adaptation to the changes in target and organ at risk coverage. Methods: Four patients with six planning cases with extraordinarily large deformations of rectum and prostate were chosen for the study. A 9-field IMRT plan (A) using 2-Step IMRT segments was planned on an initial CT study. The plan had to fulfil all the requirements of a conventional high-quality step and shoot IMRT plan. To adapt to changes of the anatomy in a further CT data set, three approaches were considered: the original plan with optimized isocentre position (B), a newly optimized plan (C) and the original plan, adapted using the 2-Step IMRT optimization rules (D). DVH parameters were utilized for quantification of plan quality: D 99 for the CTV and the central planning target volume (PTV), D 95 for an outer PTV, V 95 , V 80 and V 50 for rectum and bladder. Results: The adapted plan (D) achieved almost the same target coverage as the newly optimized plan (C). Target coverage for plan B was poor and for the organs at risk, the rectum V 80 was slightly increased. The volume with more than 95% of the target dose (V 95 ) was 1.5 ± 1.5 cm 3 for the newly optimized plan (C), compared to 2.2 ± 1.3 cm 3 for the original plan (A) and 7.2 ± 4.8 cm 3 (B) on the first and the second CT, respectively. The adapted plan resulted in 4.3 ± 2.1 cm 3 (D), an intermediate dose load to the rectum. All other parameters were comparable for the newly optimized and the adapted plan. Conclusions: The first results for adaptation of interfractional changes using the 2-Step IMRT algorithm are encouraging. The plans were superior to plans with optimized isocentre position and only marginally inferior to a newly

  7. Assessing Gait Impairments Based on Auto-Encoded Patterns of Mahalanobis Distances from Consecutive Steps.

    Science.gov (United States)

    Muñoz-Organero, Mario; Davies, Richard; Mawson, Sue

    2017-01-01

    Insole pressure sensors capture the force distribution patterns during the stance phase while walking. By comparing patterns obtained from healthy individuals to patients suffering different medical conditions based on a given similarity measure, automatic impairment indexes can be computed in order to help in applications such as rehabilitation. This paper uses the data sensed from insole pressure sensors for a group of healthy controls to train an auto-encoder using patterns of stochastic distances in series of consecutive steps while walking at normal speeds. Two experiment groups are compared to the healthy control group: a group of patients suffering knee pain and a group of post-stroke survivors. The Mahalanobis distance is computed for every single step by each participant compared to the entire dataset sensed from healthy controls. The computed distances for consecutive steps are fed into the previously trained autoencoder and the average error is used to assess how close the walking segment is to the autogenerated model from healthy controls. The results show that automatic distortion indexes can be used to assess each participant as compared to normal patterns computed from healthy controls. The stochastic distances observed for the group of stroke survivors are bigger than those for the people with knee pain.

  8. Single-Camera-Based Method for Step Length Symmetry Measurement in Unconstrained Elderly Home Monitoring.

    Science.gov (United States)

    Cai, Xi; Han, Guang; Song, Xin; Wang, Jinkuan

    2017-11-01

    single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring. To build unconstrained monitoring environments, we propose a method to measure step length symmetry ratio (a useful gait parameter representing gait symmetry without significant relationship with age) from unconstrained straight walking using a single camera, without strict restrictions on walking directions or routes. according to projective geometry theory, we first develop a calculation formula of step length ratio for the case of unconstrained straight-line walking. Then, to adapt to general cases, we propose to modify noncollinear footprints, and accordingly provide general procedure for step length ratio extraction from unconstrained straight walking. Our method achieves a mean absolute percentage error (MAPE) of 1.9547% for 15 subjects' normal and abnormal side-view gaits, and also obtains satisfactory MAPEs for non-side-view gaits (2.4026% for 45°-view gaits and 3.9721% for 30°-view gaits). The performance is much better than a well-established monocular gait measurement system suitable only for side-view gaits with a MAPE of 3.5538%. Independently of walking directions, our method can accurately estimate step length ratios from unconstrained straight walking. This demonstrates our method is applicable for elders' daily gait monitoring to provide valuable information for elderly health care, such as abnormal gait recognition, fall risk assessment, etc. single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring

  9. Two-step calibration method for multi-algorithm score-based face recognition systems by minimizing discrimination loss

    NARCIS (Netherlands)

    Susyanto, N.; Veldhuis, R.N.J.; Spreeuwers, L.J.; Klaassen, C.A.J.; Fierrez, J.; Li, S.Z.; Ross, A.; Veldhuis, R.; Alonso-Fernandez, F.; Bigun, J.

    2016-01-01

    We propose a new method for combining multi-algorithm score-based face recognition systems, which we call the two-step calibration method. Typically, algorithms for face recognition systems produce dependent scores. The two-step method is based on parametric copulas to handle this dependence. Its

  10. Evidence-based practice, step by step: critical appraisal of the evidence: part II: digging deeper--examining the "keeper" studies.

    Science.gov (United States)

    Fineout-Overholt, Ellen; Melnyk, Bernadette Mazurek; Stillwell, Susan B; Williamson, Kathleen M

    2010-09-01

    This is the sixth article in a series from the Arizona State University College of Nursing and Health Innovation's Center for the Advancement of Evidence-Based Practice. Evidence-based practice (EBP) is a problem-solving approach to the delivery of health care that integrates the best evidence from studies and patient care data with clinician expertise and patient preferences and values. When delivered in a context of caring and in a supportive organizational culture, the highest quality of care and best patient outcomes can be achieved. The purpose of this series is to give nurses the knowledge and skills they need to implement EBP consistently, one step at a time. Articles will appear every two months to allow you time to incorporate information as you work toward implementing EBP at your institution. Also, we've scheduled "Chat with the Authors" calls every few months to provide a direct line to the experts to help you resolve questions. Details about how to participate in the next call will be published with November's Evidence-Based Practice, Step by Step.

  11. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  12. Statistical deprojection of galaxy pairs

    Science.gov (United States)

    Nottale, Laurent; Chamaraux, Pierre

    2018-06-01

    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  13. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    Science.gov (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  14. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia

    2016-03-01

    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  15. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    Science.gov (United States)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  16. A Study on the Storage Reliability of LSINS Based on Step-stress Accelerated Life Test

    Directory of Open Access Journals (Sweden)

    Teng Fei

    2015-01-01

    Full Text Available Based on the step-stress accelerated life test and the laser strap-down inertial navigation system, this paper studies the accelerated life model and the test method, provides the likelihood function, the likelihood equation and the two-order derivative when the stress level is k, evaluates the effectiveness of the method with the simulation test model established by MATLAB, applies the research findings in the storage reliability study of the XX laser strap-down inertial navigation system, and puts forward an effective evaluation method of the storage life of the inertial navigation system.

  17. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  18. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  19. Flexible biodegradable citrate-based polymeric step-index optical fiber.

    Science.gov (United States)

    Shan, Dingying; Zhang, Chenji; Kalaba, Surge; Mehta, Nikhil; Kim, Gloria B; Liu, Zhiwen; Yang, Jian

    2017-10-01

    Implanting fiber optical waveguides into tissue or organs for light delivery and collection is among the most effective ways to overcome the issue of tissue turbidity, a long-standing obstacle for biomedical optical technologies. Here, we report a citrate-based material platform with engineerable opto-mechano-biological properties and demonstrate a new type of biodegradable, biocompatible, and low-loss step-index optical fiber for organ-scale light delivery and collection. By leveraging the rich designability and processibility of citrate-based biodegradable polymers, two exemplary biodegradable elastomers with a fine refractive index difference and yet matched mechanical properties and biodegradation profiles were developed. Furthermore, we developed a two-step fabrication method to fabricate flexible and low-loss (0.4 db/cm) optical fibers, and performed systematic characterizations to study optical, spectroscopic, mechanical, and biodegradable properties. In addition, we demonstrated the proof of concept of image transmission through the citrate-based polymeric optical fibers and conducted in vivo deep tissue light delivery and fluorescence sensing in a Sprague-Dawley (SD) rat, laying the groundwork for realizing future implantable devices for long-term implantation where deep-tissue light delivery, sensing and imaging are desired, such as cell, tissue, and scaffold imaging in regenerative medicine and in vivo optogenetic stimulation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. First steps towards the realization of a double layer perceptron based on organic memristive devices

    Directory of Open Access Journals (Sweden)

    A. V. Emelyanov

    2016-11-01

    Full Text Available Memristors are widely considered as promising elements for the efficient implementation of synaptic weights in artificial neural networks (ANNs since they are resistors that keep memory of their previous conductive state. Whereas demonstrations of simple neural networks (e.g., a single-layer perceptron based on memristors already exist, the implementation of more complicated networks is more challenging and has yet to be reported. In this study, we demonstrate linearly nonseparable combinational logic classification (XOR logic task using a network implemented with CMOS-based neurons and organic memrisitive devices that constitutes the first step toward the realization of a double layer perceptron. We also show numerically the ability of such network to solve a principally analogue task which cannot be realized by digital devices. The obtained results prove the possibility to create a multilayer ANN based on memristive devices that paves the way for designing a more complex network such as the double layer perceptron.

  1. First steps towards the realization of a double layer perceptron based on organic memristive devices

    Science.gov (United States)

    Emelyanov, A. V.; Lapkin, D. A.; Demin, V. A.; Erokhin, V. V.; Battistoni, S.; Baldi, G.; Dimonte, A.; Korovin, A. N.; Iannotta, S.; Kashkarov, P. K.; Kovalchuk, M. V.

    2016-11-01

    Memristors are widely considered as promising elements for the efficient implementation of synaptic weights in artificial neural networks (ANNs) since they are resistors that keep memory of their previous conductive state. Whereas demonstrations of simple neural networks (e.g., a single-layer perceptron) based on memristors already exist, the implementation of more complicated networks is more challenging and has yet to be reported. In this study, we demonstrate linearly nonseparable combinational logic classification (XOR logic task) using a network implemented with CMOS-based neurons and organic memrisitive devices that constitutes the first step toward the realization of a double layer perceptron. We also show numerically the ability of such network to solve a principally analogue task which cannot be realized by digital devices. The obtained results prove the possibility to create a multilayer ANN based on memristive devices that paves the way for designing a more complex network such as the double layer perceptron.

  2. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    Science.gov (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  4. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  5. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    Science.gov (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  6. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

    Science.gov (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

    2009-01-01

    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  7. Development of a membrane adsorber based capture step for the purification of yellow fever virus.

    Science.gov (United States)

    Pato, Tânia P; Souza, Marta Cristina O; Silva, Andréa N M R; Pereira, Renata C; Silva, Marlon V; Caride, Elena; Gaspar, Luciane P; Freire, Marcos S; Castilho, Leda R

    2014-05-19

    Yellow fever (YF) is an endemic disease in some tropical areas of South America and Africa that presents lethality rate between 20 and 50%. There is no specific treatment and to control this disease a highly effective live-attenuated egg based vaccine is widely used for travelers and residents of areas where YF is endemic. However, recent reports of rare, sometimes fatal, adverse events post-vaccination have raised concerns. In order to increase safety records, alternative strategies should be considered, such as developing a new inactivated vaccine using a cell culture based technology, capable of meeting the demands in cases of epidemic. With this goal, the production of YF virus in Vero cells grown on microcarriers and its subsequent purification by chromatographic techniques was studied. In this work we investigate the capture step of the purification process of the YF virus. At first, virus stability was studied over a wide pH range, showing best results for the alkaline region. Considering this result and the pI of the envelope protein previously determined in silico, a strong anion exchanger was considered most suitable. Due to the easy scalability, simplicity to handle, absence of diffusional limitations and suitability for virus handling of membrane adsorbers, a Q membrane was evaluated. The amount of antigen adsorbed onto the membrane was investigated within the pH range for virus stability, and the best pH for virus adsorption was considered to be 8.5. Finally, studies on gradient and step elution allowed to determine the most adequate salt concentration for washing (0.15M) and virus elution (0.30 M). Under these operating conditions, it was shown that this capture step is quite efficient, showing high product recovery (93.2±30.3%) and efficient DNA clearance (0.9±0.3 ng/dose). Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  9. An FPGA-Based Multiple-Axis Velocity Controller and Stepping Motors Drives Design

    Directory of Open Access Journals (Sweden)

    Lai Chiu-Keng

    2016-01-01

    Full Text Available A Field Programmable Gate Array based system is a great hardware platform to support the implementation of hardware controllers such as PID controller and fuzzy controller. It is also programmed as hardware accelerator to speed up the mathematic calculation and greatly enhance the performance as applied to motor drive and motion control. Furthermore, the open structure of FPGA-based system is suitable for those designs with the ability of parallel processing or soft code processor embedded. In this paper, we apply the FPGA to a multi-axis velocity controller design. The developed system integrated three functions inside the FPGA chip, which are respectively the stepping motor drive, the multi-axis motion controller and the motion planning. Furthermore, an embedded controller with a soft code processor compatible to 8051 micro-control unit (MCU is built to handle the data transfer between the FPGA board and host PC. The MCU is also used to initialize the motion control and run the interpolator. The designed system is practically applied to a XYZ motion platform which is driven by stepping motors to verify its performance.

  10. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  11. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves

    Science.gov (United States)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin

    2018-05-01

    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  12. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  13. First Steps Toward Incorporating Image Based Diagnostics Into Particle Accelerator Control Systems Using Convolutional Neural Networks

    Energy Technology Data Exchange (ETDEWEB)

    Edelen, A. L.; Biedron, S. G.; Milton, S. V.; Edelen, J. P.

    2016-12-16

    At present, a variety of image-based diagnostics are used in particle accelerator systems. Often times, these are viewed by a human operator who then makes appropriate adjustments to the machine. Given recent advances in using convolutional neural networks (CNNs) for image processing, it should be possible to use image diagnostics directly in control routines (NN-based or otherwise). This is especially appealing for non-intercepting diagnostics that could run continuously during beam operation. Here, we show results of a first step toward implementing such a controller: our trained CNN can predict multiple simulated downstream beam parameters at the Fermilab Accelerator Science and Technology (FAST) facility's low energy beamline using simulated virtual cathode laser images, gun phases, and solenoid strengths.

  14. Thread-like supercapacitors based on one-step spun nanocomposite yarns.

    Science.gov (United States)

    Meng, Qinghai; Wang, Kai; Guo, Wei; Fang, Jin; Wei, Zhixiang; She, Xilin

    2014-08-13

    Thread-like electronic devices have attracted great interest because of their potential applications in wearable electronics. To produce high-performance, thread-like supercapacitors, a mixture of stable dispersions of single-walled carbon nanotubes and conducting polyaniline nanowires are prepared. Then, the mixture is spun into flexible yarns with a polyvinyl alcohol outer sheath by a one-step spinning process. The composite yarns show excellent mechanical properties and high electrical conductivities after sufficient washing to remove surfactants. After applying a further coating layer of gel electrolyte, two flexible yarns are twisted together to form a thread-like supercapacitor. The supercapacitor based on these two yarns (SWCNTs and PAniNWs) possesses a much higher specific capacitance than that based only on pure SWCNTs yarns, making it an ideal energy-storage device for wearable electronics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Electrochemical model of polyaniline-based memristor with mass transfer step

    International Nuclear Information System (INIS)

    Demin, V.A.; Erokhin, V.V.; Kashkarov, P.K.; Kovalchuk, M.V.

    2015-01-01

    The electrochemical organic memristor with polyaniline active layer is a stand-alone device designed and realized for reproduction of some synapse properties in the innovative electronic circuits, such as the new field-programmable gate arrays or the neuromorphic networks capable for learning. In this work a new theoretical model of the polyaniline memristor is presented. The developed model of organic memristor functioning was based on the detailed consideration of possible electrochemical processes occuring in the active zone of this device including the mass transfer step of ionic reactants. Results of the calculation have demonstrated not only the qualitative explanation of the characteristics observed in the experiment, but also quantitative similarities of the resultant current values. This model can establish a basis for the design and prediction of properties of more complicated circuits and systems (including stochastic ones) based on the organic memristive devices

  16. Microstructural and electrical properties of cordierite-based ceramics obtained after two-step sintering technique

    Directory of Open Access Journals (Sweden)

    Obradović Nina

    2016-01-01

    Full Text Available Cordierite-based ceramic materials are attracting much interest for their various applications in industry, for manufacturing multilayer circuit boards, catalytic converters, filters, thermal insulation, kiln furniture, components of portable electronic devices, etc. In order to reduce production costs and modify cordierite-based materials, mechanical activation can be used. In this study, microstructural and electrical properties of mechanically activated MgO-Al2O3-SiO2 system have been analyzed. The mixtures of MgO-Al2O3-SiO2 powders were mechanically activated in a planetary ball mill for the time periods from 0 to 160 min. Morphological investigations have been performed on the obtained powders. The effects of activation and two-step sintering process on microstructure were investigated by scanning electron microscopy (SEM. Electrical measurements showed variations of the dielectric constant (εr and loss tangent (tan δ as a function of time of mechanical treatment.

  17. Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

    2015-12-15

    Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

  18. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    Science.gov (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. The Inquiry Based Science and Technology Education Program (IN-STEP): The Evaluation of the First Year

    Science.gov (United States)

    Corcoran, Thomas B.

    2008-01-01

    This is the first report on the evaluation of the Inquiry Based Science and Technology Education Program (IN-STEP), an innovative and ambitious science education initiative for lower secondary schools being undertaken by a public-private partnership in Thailand funded by MSD-Thailand, an affiliate of Merck & Co. IN-STEP is a public-private…

  1. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  2. Stepping to the Beat: Feasibility and Potential Efficacy of a Home-Based Auditory-Cued Step Training Program in Chronic Stroke

    Directory of Open Access Journals (Sweden)

    Rachel L. Wright

    2017-08-01

    Full Text Available BackgroundHemiparesis after stroke typically results in a reduced walking speed, an asymmetrical gait pattern and a reduced ability to make gait adjustments. The purpose of this pilot study was to investigate the feasibility and preliminary efficacy of home-based training involving auditory cueing of stepping in place.MethodsTwelve community-dwelling participants with chronic hemiparesis completed two 3-week blocks of home-based stepping to music overlaid with an auditory metronome. Tempo of the metronome was increased 5% each week. One 3-week block used a regular metronome, whereas the other 3-week block had phase shift perturbations randomly inserted to cue stepping adjustments.ResultsAll participants reported that they enjoyed training, with 75% completing all training blocks. No adverse events were reported. Walking speed, Timed Up and Go (TUG time and Dynamic Gait Index (DGI scores (median [inter-quartile range] significantly improved between baseline (speed = 0.61 [0.32, 0.85] m⋅s−1; TUG = 20.0 [16.0, 39.9] s; DGI = 14.5 [11.3, 15.8] and post stepping training (speed = 0.76 [0.39, 1.03] m⋅s−1; TUG = 16.3 [13.3, 35.1] s; DGI = 16.0 [14.0, 19.0] and was maintained at follow-up (speed = 0.75 [0.41, 1.03] m⋅s−1; TUG = 16.5 [12.9, 34.1] s; DGI = 16.5 [13.5, 19.8].ConclusionThis pilot study suggests that auditory-cued stepping conducted at home was feasible and well-tolerated by participants post-stroke, with improvements in walking and functional mobility. No differences were detected between regular and phase-shift training with the metronome at each assessment point.

  3. Alternate mutation based artificial immune algorithm for step fixed charge transportation problem

    Directory of Open Access Journals (Sweden)

    Mahmoud Moustafa El-Sherbiny

    2012-07-01

    Full Text Available Step fixed charge transportation problem (SFCTP is considered as a special version of the fixed-charge transportation problem (FCTP. In SFCTP, the fixed cost is incurred for every route that is used in the solution and is proportional to the amount shipped. This cost structure causes the value of the objective function to behave like a step function. Both FCTP and SFCTP are considered to be NP-hard problems. While a lot of research has been carried out concerning FCTP, not much has been done concerning SFCTP. This paper introduces an alternate Mutation based Artificial Immune (MAI algorithm for solving SFCTPs. The proposed MAI algorithm solves both balanced and unbalanced SFCTP without introducing a dummy supplier or a dummy customer. In MAI algorithm a coding schema is designed and procedures are developed for decoding such schema and shipping units. MAI algorithm guarantees the feasibility of all the generated solutions. Due to the significant role of mutation function on the MAI algorithm’s quality, 16 mutation functions are presented and their performances are compared to select the best one. For this purpose, forty problems with different sizes have been generated at random and then a robust calibration is applied using the relative percentage deviation (RPD method. Through two illustrative problems of different sizes the performance of the MAI algorithm has been compared with most recent methods.

  4. First Steps Towards AN Integrated Citygml-Based 3d Model of Vienna

    Science.gov (United States)

    Agugiaro, G.

    2016-06-01

    This paper presents and discusses the results regarding the initial steps (selection, analysis, preparation and eventual integration of a number of datasets) for the creation of an integrated, semantic, three-dimensional, and CityGML-based virtual model of the city of Vienna. CityGML is an international standard conceived specifically as information and data model for semantic city models at urban and territorial scale. It is being adopted by more and more cities all over the world. The work described in this paper is embedded within the European Marie-Curie ITN project "Ci-nergy, Smart cities with sustainable energy systems", which aims, among the rest, at developing urban decision making and operational optimisation software tools to minimise non-renewable energy use in cities. Given the scope and scale of the project, it is therefore vital to set up a common, unique and spatio-semantically coherent urban model to be used as information hub for all applications being developed. This paper reports about the experiences done so far, it describes the test area and the available data sources, it shows and exemplifies the data integration issues, the strategies developed to solve them in order to obtain the integrated 3D city model. The first results as well as some comments about their quality and limitations are presented, together with the discussion regarding the next steps and some planned improvements.

  5. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  6. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  7. Identifying typical patterns of vulnerability: A 5-step approach based on cluster analysis

    Science.gov (United States)

    Sietz, Diana; Lüdeke, Matthias; Kok, Marcel; Lucas, Paul; Carsten, Walther; Janssen, Peter

    2013-04-01

    Specific processes that shape the vulnerability of socio-ecological systems to climate, market and other stresses derive from diverse background conditions. Within the multitude of vulnerability-creating mechanisms, distinct processes recur in various regions inspiring research on typical patterns of vulnerability. The vulnerability patterns display typical combinations of the natural and socio-economic properties that shape a systems' vulnerability to particular stresses. Based on the identification of a limited number of vulnerability patterns, pattern analysis provides an efficient approach to improving our understanding of vulnerability and decision-making for vulnerability reduction. However, current pattern analyses often miss explicit descriptions of their methods and pay insufficient attention to the validity of their groupings. Therefore, the question arises as to how do we identify typical vulnerability patterns in order to enhance our understanding of a systems' vulnerability to stresses? A cluster-based pattern recognition applied at global and local levels is scrutinised with a focus on an applicable methodology and practicable insights. Taking the example of drylands, this presentation demonstrates the conditions necessary to identify typical vulnerability patterns. They are summarised in five methodological steps comprising the elicitation of relevant cause-effect hypotheses and the quantitative indication of mechanisms as well as an evaluation of robustness, a validation and a ranking of the identified patterns. Reflecting scale-dependent opportunities, a global study is able to support decision-making with insights into the up-scaling of interventions when available funds are limited. In contrast, local investigations encourage an outcome-based validation. This constitutes a crucial step in establishing the credibility of the patterns and hence their suitability for informing extension services and individual decisions. In this respect, working at

  8. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  9. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  10. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  11. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  12. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  13. Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

    Directory of Open Access Journals (Sweden)

    Gaosheng Luo

    2014-01-01

    Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

  14. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  15. Development of a three dimensional circulation model based on fractional step method

    Directory of Open Access Journals (Sweden)

    Mazen Abualtayef

    2010-03-01

    Full Text Available A numerical model was developed for simulating a three-dimensional multilayer hydrodynamic and thermodynamic model in domains with irregular bottom topography. The model was designed for examining the interactions between flow and topography. The model was based on the three-dimensional Navier-Stokes equations and was solved using the fractional step method, which combines the finite difference method in the horizontal plane and the finite element method in the vertical plane. The numerical techniques were described and the model test and application were presented. For the model application to the northern part of Ariake Sea, the hydrodynamic and thermodynamic results were predicted. The numerically predicted amplitudes and phase angles were well consistent with the field observations.

  16. A Three Step B2B Sales Model Based on Satisfaction Judgments

    DEFF Research Database (Denmark)

    Grünbaum, Niels Nolsøe

    2015-01-01

    . The insights produces can be applied for selling companies to craft close collaborative customer relationships in a systematic a d efficient way. The process of building customer relationships will be guided through actions that yields higher satisfaction judgments leading to loyal customers and finally......This paper aims to provide a coherent, detailed and integrative understanding of the mental processes (i.e. dimensions) that industrial buyers apply when forming satisfaction judgments in adjacent to new task buying situations. A qualitative inductive research strategy is utilized in this study...... companies’ perspective. The buying center members applied satisfaction dimension when forming satisfaction judgments. Moreover, the focus and importance of the identified satisfaction dimensions fluctuated pending on the phase of the buying process. Based on the findings a three step sales model is proposed...

  17. A Three Step B2B Sales Model Based on Satisfaction Judgments

    DEFF Research Database (Denmark)

    Grünbaum, Niels Nolsøe

    2015-01-01

    . The insights produces can be applied for selling companies to craft close collaborative customer relationships in a systematic ad efficient way. The process of building customer relationships will be guided through actions that yields higher satisfaction judgments leading to loyal customers and finally......This paper aims to provide a coherent, detailed and integrative understanding of the mental processes (i.e. dimensions) that industrial buyers apply when forming satisfaction judgments in adjacent to new task buying situations. A qualitative inductive research strategy is utilized in this study...... companies‘ perspective. The buying center members applied satisfaction dimension when forming satisfaction judgments. Moreover, the focus and importance of the identified satisfaction dimensions fluctuated pending on the phase of the buying process. Based on the findings a three step sales model is proposed...

  18. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  19. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  20. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  1. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  2. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  3. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  4. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  5. Angle Control-Based Multi-Terminal Out-of-Step Protection System

    Directory of Open Access Journals (Sweden)

    Antans Sauhats

    2017-03-01

    Full Text Available From time to time a sequence of unexpected and overlapping contingencies may lead to power system angular instability and even blackouts if not addressed adequately by means of an out-of-step (OOS protection system. The motivation of the paper is an attempt to develop a workable prototype of the OOS protection system. The deficiencies of the protection currently used in the Latvian Power System network are highlighted and a new protection structure is proposed. The protection system comprises of several strategically located terminals, exchanging information in real time by means of a communication network. The OOS condition detection method is based on system-wide generation sources, electromotive forces, vectors, and angle control. The network splitting decision is based on generator coherence evaluation. Protection terminals determine online the groups of coherent generators and choose the splitting boundary from a predefined transmission lines (TLs cut sets list. The protection system structure, algorithm of operation, and possible IEC 61850 communication standard-based implementation are described.

  6. Alcoholics Anonymous and twelve-step recovery: a model based on social and cognitive neuroscience.

    Science.gov (United States)

    Galanter, Marc

    2014-01-01

    In the course of achieving abstinence from alcohol, longstanding members of Alcoholics Anonymous (AA) typically experience a change in their addiction-related attitudes and behaviors. These changes are reflective of physiologically grounded mechanisms which can be investigated within the disciplines of social and cognitive neuroscience. This article is designed to examine recent findings associated with these disciplines that may shed light on the mechanisms underlying this change. Literature review and hypothesis development. Pertinent aspects of the neural impact of drugs of abuse are summarized. After this, research regarding specific brain sites, elucidated primarily by imaging techniques, is reviewed relative to the following: Mirroring and mentalizing are described in relation to experimentally modeled studies on empathy and mutuality, which may parallel the experiences of social interaction and influence on AA members. Integration and retrieval of memories acquired in a setting like AA are described, and are related to studies on storytelling, models of self-schema development, and value formation. A model for ascription to a Higher Power is presented. The phenomena associated with AA reflect greater complexity than the empirical studies on which this article is based, and certainly require further elucidation. Despite this substantial limitation in currently available findings, there is heuristic value in considering the relationship between the brain-based and clinical phenomena described here. There are opportunities for the study of neuroscientific correlates of Twelve-Step-based recovery, and these can potentially enhance our understanding of related clinical phenomena. © American Academy of Addiction Psychiatry.

  7. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  8. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  9. Mastery-Based Virtual Reality Robotic Simulation Curriculum: The First Step Toward Operative Robotic Proficiency.

    Science.gov (United States)

    Hogg, Melissa E; Tam, Vernissia; Zenati, Mazen; Novak, Stephanie; Miller, Jennifer; Zureikat, Amer H; Zeh, Herbert J

    Hepatobiliary surgery is a highly complex, low-volume specialty with long learning curves necessary to achieve optimal outcomes. This creates significant challenges in both training and measuring surgical proficiency. We hypothesize that a virtual reality curriculum with mastery-based simulation is a valid tool to train fellows toward operative proficiency. This study evaluates the content and predictive validity of robotic simulation curriculum as a first step toward developing a comprehensive, proficiency-based pathway. A mastery-based simulation curriculum was performed in a virtual reality environment. A pretest/posttest experimental design used both virtual reality and inanimate environments to evaluate improvement. Participants self-reported previous robotic experience and assessed the curriculum by rating modules based on difficulty and utility. This study was conducted at the University of Pittsburgh Medical Center (Pittsburgh, PA), a tertiary care academic teaching hospital. A total of 17 surgical oncology fellows enrolled in the curriculum, 16 (94%) completed. Of 16 fellows who completed the curriculum, 4 fellows (25%) achieved mastery on all 24 modules; on average, fellows mastered 86% of the modules. Following curriculum completion, individual test scores improved (p < 0.0001). An average of 2.4 attempts was necessary to master each module (range: 1-17). Median time spent completing the curriculum was 4.2 hours (range: 1.1-6.6). Total 8 (50%) fellows continued practicing modules beyond mastery. Survey results show that "needle driving" and "endowrist 2" modules were perceived as most difficult although "needle driving" modules were most useful. Overall, 15 (94%) fellows perceived improvement in robotic skills after completing the curriculum. In a cohort of board-certified general surgeons who are novices in robotic surgery, a mastery-based simulation curriculum demonstrated internal validity with overall score improvement. Time to complete the

  10. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  11. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  12. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    Science.gov (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  13. Single-step laser-based fabrication and patterning of cell-encapsulated alginate microbeads

    International Nuclear Information System (INIS)

    Kingsley, D M; Dias, A D; Corr, D T; Chrisey, D B

    2013-01-01

    Alginate can be used to encapsulate mammalian cells and for the slow release of small molecules. Packaging alginate as microbead structures allows customizable delivery for tissue engineering, drug release, or contrast agents for imaging. However, state-of-the-art microbead fabrication has a limited range in achievable bead sizes, and poor control over bead placement, which may be desired to localize cellular signaling or delivery. Herein, we present a novel, laser-based method for single-step fabrication and precise planar placement of alginate microbeads. Our results show that bead size is controllable within 8%, and fabricated microbeads can remain immobilized within 2% of their target placement. Demonstration of this technique using human breast cancer cells shows that cells encapsulated within these microbeads survive at a rate of 89.6%, decreasing to 84.3% after five days in culture. Infusing rhodamine dye into microbeads prior to fluorescent microscopy shows their 3D spheroidal geometry and the ability to sequester small molecules. Microbead fabrication and patterning is compatible with conventional cellular transfer and patterning by laser direct-write, allowing location-based cellular studies. While this method can also be used to fabricate microbeads en masse for collection, the greatest value to tissue engineering and drug delivery studies and applications lies in the pattern registry of printed microbeads. (paper)

  14. A six step approach for developing computer based assessment in medical education.

    Science.gov (United States)

    Hassanien, Mohammed Ahmed; Al-Hayani, Abdulmoneam; Abu-Kamer, Rasha; Almazrooa, Adnan

    2013-01-01

    Assessment, which entails the systematic evaluation of student learning, is an integral part of any educational process. Computer-based assessment (CBA) techniques provide a valuable resource to students seeking to evaluate their academic progress through instantaneous, personalized feedback. CBA reduces examination, grading and reviewing workloads and facilitates training. This paper describes a six step approach for developing CBA in higher education and evaluates student perceptions of computer-based summative assessment at the College of Medicine, King Abdulaziz University. A set of questionnaires were distributed to 341 third year medical students (161 female and 180 male) immediately after examinations in order to assess the adequacy of the system for the exam program. The respondents expressed high satisfaction with the first Saudi experience of CBA for final examinations. However, about 50% of them preferred the use of a pilot CBA before its formal application; hence, many did not recommend its use for future examinations. Both male and female respondents reported that the range of advantages offered by CBA outweighed any disadvantages. Further studies are required to monitor the extended employment of CBA technology for larger classes and for a variety of subjects at universities.

  15. Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.

    Science.gov (United States)

    Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan

    2017-09-26

    Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.

  16. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  17. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park

    2017-06-01

    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  18. A novel multimodal chromatography based single step purification process for efficient manufacturing of an E. coli based biotherapeutic protein product.

    Science.gov (United States)

    Bhambure, Rahul; Gupta, Darpan; Rathore, Anurag S

    2013-11-01

    Methionine oxidized, reduced and fMet forms of a native recombinant protein product are often the critical product variants which are associated with proteins expressed as bacterial inclusion bodies in E. coli. Such product variants differ from native protein in their structural and functional aspects, and may lead to loss of biological activity and immunogenic response in patients. This investigation focuses on evaluation of multimodal chromatography for selective removal of these product variants using recombinant human granulocyte colony stimulating factor (GCSF) as the model protein. Unique selectivity in separation of closely related product variants was obtained using combined pH and salt based elution gradients in hydrophobic charge induction chromatography. Simultaneous removal of process related impurities was also achieved in flow-through leading to single step purification process for the GCSF. Results indicate that the product recovery of up to 90.0% can be obtained with purity levels of greater than 99.0%. Binding the target protein at pHproduct variants using the combined pH and salt based elution gradient and removal of the host cell impurities in flow-through are the key novel features of the developed multimodal chromatographic purification step. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  20. Optimization design for the stepped impedance transformer based on the genetic algorithm

    International Nuclear Information System (INIS)

    Zou Dehui; Lai Wanchang; Qiu Dong

    2007-01-01

    This paper introduces the basic principium and mathematic model of the stepped impedance transformer, then puts the emphasis on comparing two kinds of design methods of the stepped impedance transformer. The design results are simulated by EDA, which indicates that genetic algorithm design is better than Chebyshev integrated design in the term of the most reflect coefficient's module. (authors)

  1. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    Science.gov (United States)

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Algorithm of axial fuel optimization based in progressive steps of turned search

    International Nuclear Information System (INIS)

    Martin del Campo, C.; Francois, J.L.

    2003-01-01

    The development of an algorithm for the axial optimization of fuel of boiling water reactors (BWR) is presented. The algorithm is based in a serial optimizations process in the one that the best solution in each stage is the starting point of the following stage. The objective function of each stage adapts to orient the search toward better values of one or two parameters leaving the rest like restrictions. Conform to it advances in those optimization stages, it is increased the fineness of the evaluation of the investigated designs. The algorithm is based on three stages, in the first one are used Genetic algorithms and in the two following Tabu Search. The objective function of the first stage it looks for to minimize the average enrichment of the one it assembles and to fulfill with the generation of specified energy for the operation cycle besides not violating none of the limits of the design base. In the following stages the objective function looks for to minimize the power factor peak (PPF) and to maximize the margin of shutdown (SDM), having as restrictions the one average enrichment obtained for the best design in the first stage and those other restrictions. The third stage, very similar to the previous one, it begins with the design of the previous stage but it carries out a search of the margin of shutdown to different exhibition steps with calculations in three dimensions (3D). An application to the case of the design of the fresh assemble for the fourth fuel reload of the Unit 1 reactor of the Laguna Verde power plant (U1-CLV) is presented. The obtained results show an advance in the handling of optimization methods and in the construction of the objective functions that should be used for the different design stages of the fuel assemblies. (Author)

  3. A truly international lunar base as the next logical step for human spaceflight

    Science.gov (United States)

    Bonneville, R.

    2018-06-01

    A human mission to Mars has been highlighted as the long term goal for space exploration, with intermediate stages such as missions to the Moon and/or to asteroids, but a human mission to Mars will not be feasible before several decades. For the time being the major ambitious accomplishment in the field of human spaceflight is the International Space Station but a human spaceflight programme which would be restricted to Low Earth orbit (LEO) has indeed little interest. Thus the next step in the field of human exploration should be the definition of a new exploration programme beyond LEO, built within a long term perspective. We must acknowledge that science is not the main driver of human space exploration and that the main success of the ISS is to have allowed its partners to work together. The main goal of a new human exploration programme will be to promote international cooperation between the major space-faring countries. The only sensible and feasible objective of a near/mid-term human spaceflight programme should be the edification of a lunar base, under the condition that this base is built as a truly international venture. The ISS in the 1990s had illustrated a calmed relation between the USA, together with Europe, Canada and Japan, and Russia; a lunar base would be the symbol of a similar calmed relation between the same partners and China, and possibly others such as India. For the benefit of all humankind this extra continent, the Moon, should be used only for peaceful purposes like Antarctica today, and should not become the theatre or the stake of conflicts. Such a programme is technically feasible and financially affordable in a rather short term. So let us go to the Moon, but let us get there together.

  4. Reducing workpieces to their base geometry for multi-step incremental forming using manifold harmonics

    Science.gov (United States)

    Carette, Yannick; Vanhove, Hans; Duflou, Joost

    2018-05-01

    Single Point Incremental Forming is a flexible process that is well-suited for small batch production and rapid prototyping of complex sheet metal parts. The distributed nature of the deformation process and the unsupported sheet imply that controlling the final accuracy of the workpiece is challenging. To improve the process limits and the accuracy of SPIF, the use of multiple forming passes has been proposed and discussed by a number of authors. Most methods use multiple intermediate models, where the previous one is strictly smaller than the next one, while gradually increasing the workpieces' wall angles. Another method that can be used is the manufacture of a smoothed-out "base geometry" in the first pass, after which more detailed features can be added in subsequent passes. In both methods, the selection of these intermediate shapes is freely decided by the user. However, their practical implementation in the production of complex freeform parts is not straightforward. The original CAD model can be manually adjusted or completely new CAD models can be created. This paper discusses an automatic method that is able to extract the base geometry from a full STL-based CAD model in an analytical way. Harmonic decomposition is used to express the final geometry as the sum of individual surface harmonics. It is then possible to filter these harmonic contributions to obtain a new CAD model with a desired level of geometric detail. This paper explains the technique and its implementation, as well as its use in the automatic generation of multi-step geometries.

  5. Operator care and eco-concerned development of a fast, facile and economical assay for basic nitrogenous drugs based on simplified ion-pair mini-scale extraction using safer solvent combined with drop-based spectrophotometry.

    Science.gov (United States)

    Plianwong, Samarwadee; Sripattanaporn, Areerut; Waewsa-nga, Kwanrutai; Buacheen, Parin; Opanasopit, Praneet; Ngawhirunpat, Tanasait; Rojanarata, Theerasak

    2012-08-30

    A fast, facile, and economical assay for basic nitrogenous drugs has been developed based on the mini-scale extraction of the drug-dye ion pair complex combined with the use of safe-for-analyst and eco-friendlier organic extractant and drop-based micro-spectrophotometry. Instead of using large volume devices, the extraction was simply carried out in typical 1.5 mL microcentrifuge tubes along with the use of micropipettes for accurate transfer of liquids, vortex mixer for efficient partitioning of solutes and benchtop centrifuge for rapid phase separation. In the last step, back-extraction was performed by using the microvolume of acidic solution in order to concentrate the colored species into a confined aqueous microdrop and to keep the analyst away from unwanted contact and inhalation of organic solvents during the quantitation step which was achieved by using cuvetteless UV-vis micro-spectrophotometry without any prior dilutions. Using chlorpheniramine maleate as a representative analyte and n-butyl acetate as a less toxic and non-ozone depleting extractant, the miniaturized method was less laborious and much faster. It was accurate, precise and insensitive to the interferences from common excipients. Notably, it gave the assay results of drug in tablets and oral solution comparable to the large-scale pharmacopeial method while the consumption of organic solvents and the release of wastes were lowered by 200-400 folds. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    OpenAIRE

    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

    2005-01-01

    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  7. Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands

    Directory of Open Access Journals (Sweden)

    José M. M. M. de Almeida

    2018-04-01

    Full Text Available It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO2 substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency.

  8. Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands

    Science.gov (United States)

    Vasconcelos, Helena

    2018-01-01

    It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR) with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO2) substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS) and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency. PMID:29677108

  9. Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands.

    Science.gov (United States)

    de Almeida, José M M M; Vasconcelos, Helena; Jorge, Pedro A S; Coelho, Luis

    2018-04-20

    It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR) with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO₂) substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS) and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency.

  10. Evaluating Machine Learning-Based Automated Personalized Daily Step Goals Delivered Through a Mobile Phone App: Randomized Controlled Trial.

    Science.gov (United States)

    Zhou, Mo; Fukuoka, Yoshimi; Mintz, Yonatan; Goldberg, Ken; Kaminsky, Philip; Flowers, Elena; Aswani, Anil

    2018-01-25

    Growing evidence shows that fixed, nonpersonalized daily step goals can discourage individuals, resulting in unchanged or even reduced physical activity. The aim of this randomized controlled trial (RCT) was to evaluate the efficacy of an automated mobile phone-based personalized and adaptive goal-setting intervention using machine learning as compared with an active control with steady daily step goals of 10,000. In this 10-week RCT, 64 participants were recruited via email announcements and were required to attend an initial in-person session. The participants were randomized into either the intervention or active control group with a one-to-one ratio after a run-in period for data collection. A study-developed mobile phone app (which delivers daily step goals using push notifications and allows real-time physical activity monitoring) was installed on each participant's mobile phone, and participants were asked to keep their phone in a pocket throughout the entire day. Through the app, the intervention group received fully automated adaptively personalized daily step goals, and the control group received constant step goals of 10,000 steps per day. Daily step count was objectively measured by the study-developed mobile phone app. The mean (SD) age of participants was 41.1 (11.3) years, and 83% (53/64) of participants were female. The baseline demographics between the 2 groups were similar (P>.05). Participants in the intervention group (n=34) had a decrease in mean (SD) daily step count of 390 (490) steps between run-in and 10 weeks, compared with a decrease of 1350 (420) steps among control participants (n=30; P=.03). The net difference in daily steps between the groups was 960 steps (95% CI 90-1830 steps). Both groups had a decrease in daily step count between run-in and 10 weeks because interventions were also provided during run-in and no natural baseline was collected. The results showed the short-term efficacy of this intervention, which should be formally

  11. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    Science.gov (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Multi-step wind speed forecasting based on a hybrid forecasting architecture and an improved bat algorithm

    International Nuclear Information System (INIS)

    Xiao, Liye; Qian, Feng; Shao, Wei

    2017-01-01

    Highlights: • Propose a hybrid architecture based on a modified bat algorithm for multi-step wind speed forecasting. • Improve the accuracy of multi-step wind speed forecasting. • Modify bat algorithm with CG to improve optimized performance. - Abstract: As one of the most promising sustainable energy sources, wind energy plays an important role in energy development because of its cleanliness without causing pollution. Generally, wind speed forecasting, which has an essential influence on wind power systems, is regarded as a challenging task. Analyses based on single-step wind speed forecasting have been widely used, but their results are insufficient in ensuring the reliability and controllability of wind power systems. In this paper, a new forecasting architecture based on decomposing algorithms and modified neural networks is successfully developed for multi-step wind speed forecasting. Four different hybrid models are contained in this architecture, and to further improve the forecasting performance, a modified bat algorithm (BA) with the conjugate gradient (CG) method is developed to optimize the initial weights between layers and thresholds of the hidden layer of neural networks. To investigate the forecasting abilities of the four models, the wind speed data collected from four different wind power stations in Penglai, China, were used as a case study. The numerical experiments showed that the hybrid model including the singular spectrum analysis and general regression neural network with CG-BA (SSA-CG-BA-GRNN) achieved the most accurate forecasting results in one-step to three-step wind speed forecasting.

  13. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash

    2017-01-01

    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  14. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  15. Epitope mapping: the first step in developing epitope-based vaccines.

    Science.gov (United States)

    Gershoni, Jonathan M; Roitburd-Berman, Anna; Siman-Tov, Dror D; Tarnovitski Freund, Natalia; Weiss, Yael

    2007-01-01

    Antibodies are an effective line of defense in preventing infectious diseases. Highly potent neutralizing antibodies can intercept a virus before it attaches to its target cell and, thus, inactivate it. This ability is based on the antibodies' specific recognition of epitopes, the sites of the antigen to which antibodies bind. Thus, understanding the antibody/epitope interaction provides a basis for the rational design of preventive vaccines. It is assumed that immunization with the precise epitope, corresponding to an effective neutralizing antibody, would elicit the generation of similarly potent antibodies in the vaccinee. Such a vaccine would be a 'B-cell epitope-based vaccine', the implementation of which requires the ability to backtrack from a desired antibody to its corresponding epitope. In this article we discuss a range of methods that enable epitope discovery based on a specific antibody. Such a reversed immunological approach is the first step in the rational design of an epitope-based vaccine. Undoubtedly, the gold standard for epitope definition is x-ray analyses of crystals of antigen:antibody complexes. This method provides atomic resolution of the epitope; however, it is not readily applicable to many antigens and antibodies, and requires a very high degree of sophistication and expertise. Most other methods rely on the ability to monitor the binding of the antibody to antigen fragments or mutated variations. In mutagenesis of the antigen, loss of binding due to point modification of an amino acid residue is often considered an indication of an epitope component. In addition, computational combinatorial methods for epitope mapping are also useful. These methods rely on the ability of the antibody of interest to affinity isolate specific short peptides from combinatorial phage display peptide libraries. The peptides are then regarded as leads for the definition of the epitope corresponding to the antibody used to screen the peptide library. For

  16. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  18. Property (RD) for Hecke Pairs

    International Nuclear Information System (INIS)

    Shirbisheh, Vahid

    2012-01-01

    As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

  19. Investigating the role of ion-pair strategy in regulating nicotine release from patch: Mechanistic insights based on intermolecular interaction and mobility of pressure sensitive adhesive.

    Science.gov (United States)

    Li, Qiaoyun; Wan, Xiaocao; Liu, Chao; Fang, Liang

    2018-07-01

    The aim of this study was to prepare a drug-in-adhesive patch of nicotine (NIC) and use ion-pair strategy to regulate drug delivery rate. Moreover, the mechanism of how ion-pair strategy regulated drug release was elucidated at molecular level. Formulation factors including pressure sensitive adhesives (PSAs), drug loading and counter ions (C 4 , C 6 , C 8 , C 10 , and C 12 ) were screened. In vitro release experiment and in vitro transdermal experiment were conducted to determine the rate-limiting step in drug delivery process. FT-IR and molecular modeling were used to characterize the interaction between drug and PSA. Thermal analysis and rheology study were conducted to investigate the mobility variation of PSA. The optimized patch prepared with NIC-C 8 had the transdermal profile fairly close to that of the commercial product (p > 0.05). The release rate constants (k) of NIC, NIC-C 4 and NIC-C 10 were 21.1, 14.4 and 32.4, respectively. Different release rates of NIC ion-pair complexes were attributed to the dual effect of ion-pair strategy on drug release. On one hand, ion-pair strategy enhanced the interaction between drug and PSA, which inhibited drug release. On the other hand, using ion-pair strategy improved the mobility of PSA, which facilitated drug release. Drug release behavior was determined by combined effect of two aspects above. These conclusions provided a new idea for us to regulate drug release behavior from patch. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing

    2010-01-01

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  1. Computational Identification of Protein Pupylation Sites by Using Profile-Based Composition of k-Spaced Amino Acid Pairs.

    Directory of Open Access Journals (Sweden)

    Md Mehedi Hasan

    Full Text Available Prokaryotic proteins are regulated by pupylation, a type of post-translational modification that contributes to cellular function in bacterial organisms. In pupylation process, the prokaryotic ubiquitin-like protein (Pup tagging is functionally analogous to ubiquitination in order to tag target proteins for proteasomal degradation. To date, several experimental methods have been developed to identify pupylated proteins and their pupylation sites, but these experimental methods are generally laborious and costly. Therefore, computational methods that can accurately predict potential pupylation sites based on protein sequence information are highly desirable. In this paper, a novel predictor termed as pbPUP has been developed for accurate prediction of pupylation sites. In particular, a sophisticated sequence encoding scheme [i.e. the profile-based composition of k-spaced amino acid pairs (pbCKSAAP] is used to represent the sequence patterns and evolutionary information of the sequence fragments surrounding pupylation sites. Then, a Support Vector Machine (SVM classifier is trained using the pbCKSAAP encoding scheme. The final pbPUP predictor achieves an AUC value of 0.849 in 10-fold cross-validation tests and outperforms other existing predictors on a comprehensive independent test dataset. The proposed method is anticipated to be a helpful computational resource for the prediction of pupylation sites. The web server and curated datasets in this study are freely available at http://protein.cau.edu.cn/pbPUP/.

  2. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)

    2010-04-15

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  3. Cryptosystem based on two-step phase-shifting interferometry and the RSA public-key encryption algorithm

    Science.gov (United States)

    Meng, X. F.; Peng, X.; Cai, L. Z.; Li, A. M.; Gao, Z.; Wang, Y. R.

    2009-08-01

    A hybrid cryptosystem is proposed, in which one image is encrypted to two interferograms with the aid of double random-phase encoding (DRPE) and two-step phase-shifting interferometry (2-PSI), then three pairs of public-private keys are utilized to encode and decode the session keys (geometrical parameters, the second random-phase mask) and interferograms. In the stage of decryption, the ciphered image can be decrypted by wavefront reconstruction, inverse Fresnel diffraction, and real amplitude normalization. This approach can successfully solve the problem of key management and dispatch, resulting in increased security strength. The feasibility of the proposed cryptosystem and its robustness against some types of attack are verified and analyzed by computer simulations.

  4. Differentiation between solid-ankle cushioned heel and energy storage and return prosthetic foot based on step-to-step transition cost

    NARCIS (Netherlands)

    Wezenberg, Daphne; Cutti, Andrea G.; Bruno, Antonino; Houdijk, Han

    2014-01-01

    Decreased push-off power by the prosthetic foot and inadequate roll-over shape of the foot have been shown to increase the energy dissipated during the step-to-step transition in human walking. The aim of this study was to determine whether energy storage and return (ESAR) feet are able to reduce

  5. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  7. Developing a framework to model the primary drying step of a continuous freeze-drying process based on infrared radiation

    DEFF Research Database (Denmark)

    Van Bockstal, Pieter-Jan; Corver, Jos; Mortier, Séverine Thérèse F.C.

    2018-01-01

    . These results assist in the selection of proper materials which could serve as IR window in the continuous freeze-drying prototype. The modelling framework presented in this paper fits the model-based design approach used for the development of this prototype and shows the potential benefits of this design...... requires the fundamental mechanistic modelling of each individual process step. Therefore, a framework is presented for the modelling and control of the continuous primary drying step based on non-contact IR radiation. The IR radiation emitted by the radiator filaments passes through various materials...

  8. Numerical research of dynamic characteristics in tower solar cavity receiver based on step-change radiation flux

    Science.gov (United States)

    Chen, Zhengwei; Wang, Yueshe; Hao, Yun; Wang, Qizhi

    2013-07-01

    The solar cavity receiver is an important light-energy to thermal-energy convector in the tower solar thermal power plant system. The heat flux in the inner surface of the cavity will show the characteristics of non-continuous step change especially in non-normal and transient weather conditions, which may result in a continuous dynamic variation of the characteristic parameters. Therefore, the research of dynamic characteristics of the receiver plays a very important role in the operation and the control safely in solar cavity receiver system. In this paper, based on the non-continuous step change of radiation flux, a non-linear dynamic model is put forward to obtain the effects of the non-continuous step change radiation flux and step change feed water flow on the receiver performance by sequential modular approach. The subject investigated in our study is a 1MW solar power station constructed in Yanqing County, Beijing. This study has obtained the dynamic responses of the characteristic parameters in the cavity receiver, such as drum pressure, drum water level, main steam flow and main steam enthalpy under step change radiation flux. And the influence law of step-change feed water flow to the dynamic characteristics in the receiver also has been analyzed. The results have a reference value for the safe operation and the control in solar cavity receiver system.

  9. Implementation of Real-Time Machining Process Control Based on Fuzzy Logic in a New STEP-NC Compatible System

    Directory of Open Access Journals (Sweden)

    Po Hu

    2016-01-01

    Full Text Available Implementing real-time machining process control at shop floor has great significance on raising the efficiency and quality of product manufacturing. A framework and implementation methods of real-time machining process control based on STEP-NC are presented in this paper. Data model compatible with ISO 14649 standard is built to transfer high-level real-time machining process control information between CAPP systems and CNC systems, in which EXPRESS language is used to define new STEP-NC entities. Methods for implementing real-time machining process control at shop floor are studied and realized on an open STEP-NC controller, which is developed using object-oriented, multithread, and shared memory technologies conjunctively. Cutting force at specific direction of machining feature in side mill is chosen to be controlled object, and a fuzzy control algorithm with self-adjusting factor is designed and embedded in the software CNC kernel of STEP-NC controller. Experiments are carried out to verify the proposed framework, STEP-NC data model, and implementation methods for real-time machining process control. The results of experiments prove that real-time machining process control tasks can be interpreted and executed correctly by the STEP-NC controller at shop floor, in which actual cutting force is kept around ideal value, whether axial cutting depth changes suddenly or continuously.

  10. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains.

    Science.gov (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai

    2017-08-01

    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  11. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang

    2018-02-01

    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  12. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data.

    Science.gov (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai

    2012-02-15

    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.

  13. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques.

    Science.gov (United States)

    Schmitz, Gunnar; Hättig, Christof

    2016-12-21

    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  14. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory

    Science.gov (United States)

    Frank, Marius S.; Hättig, Christof

    2018-04-01

    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  15. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  16. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  17. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  18. ATMS Step By Step.

    Science.gov (United States)

    National Library of Australia, Canberra.

    This manual is designed to provide an introduction and basic guide to the use of IBM's Advanced Text Management System (ATMS), the text processing system to be used for the creation of Australian data bases within AUSINET. Instructions are provided for using the system to enter, store, retrieve, and modify data, which may then be displayed at the…

  19. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  20. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  1. Home-based step training using videogame technology in people with Parkinson's disease: a single-blinded randomised controlled trial.

    Science.gov (United States)

    Song, Jooeun; Paul, Serene S; Caetano, Maria Joana D; Smith, Stuart; Dibble, Leland E; Love, Rachelle; Schoene, Daniel; Menant, Jasmine C; Sherrington, Cathie; Lord, Stephen R; Canning, Colleen G; Allen, Natalie E

    2018-03-01

    To determine whether 12-week home-based exergame step training can improve stepping performance, gait and complementary physical and neuropsychological measures associated with falls in Parkinson's disease. A single-blinded randomised controlled trial. Community (experimental intervention), university laboratory (outcome measures). Sixty community-dwelling people with Parkinson's disease. Home-based step training using videogame technology. The primary outcomes were the choice stepping reaction time test and Functional Gait Assessment. Secondary outcomes included physical and neuropsychological measures associated with falls in Parkinson's disease, number of falls over six months and self-reported mobility and balance. Post intervention, there were no differences between the intervention ( n = 28) and control ( n = 25) groups in the primary or secondary outcomes except for the Timed Up and Go test, where there was a significant difference in favour of the control group ( P = 0.02). Intervention participants reported mobility improvement, whereas control participants reported mobility deterioration-between-group difference on an 11-point scale = 0.9 (95% confidence interval: -1.8 to -0.1, P = 0.03). Interaction effects between intervention and disease severity on physical function measures were observed ( P = 0.01 to P = 0.08) with seemingly positive effects for the low-severity group and potentially negative effects for the high-severity group. Overall, home-based exergame step training was not effective in improving the outcomes assessed. However, the improved physical function in the lower disease severity intervention participants as well as the self-reported improved mobility in the intervention group suggest home-based exergame step training may have benefits for some people with Parkinson's disease.

  2. A Systematic, Inquiry-Based 7-Step Virtual Worlds Teacher Training

    Science.gov (United States)

    Nussli, Natalie Christina; Oh, Kevin

    2015-01-01

    Eighteen special education teachers explored one prominent example of three-dimensional virtual worlds, namely Second Life. This study aimed to (a) determine their perception of the effectiveness of a systematic 7-Step Virtual Worlds Teacher Training workshop in terms of enabling them to make informed decisions about the usability of virtual…

  3. Taking Steps Together: A Family- and Community-Based Obesity Intervention for Urban, Multiethnic Children

    Science.gov (United States)

    Anderson, John D.; Newby, Rachel; Kehm, Rebecca; Barland, Patricia; Hearst, Mary O.

    2015-01-01

    Objectives: Successful childhood obesity intervention models that build sustainable behavioral change are needed, particularly in low-income, ethnic minority communities disparately affected by this problem. Method: Families were referred to Taking Steps Together (TST) by their primary care provider if at least one child had a body mass index…

  4. Floating high step-down stacked dc-dc converter based on buck-boost cells

    NARCIS (Netherlands)

    Tibola, G.; Duarte, J.L.; Blinov, A.

    2015-01-01

    In some high power dc-dc applications, where high voltage is present, a converter with high step-down ratio is required in order to provide an isolated low power auxiliary supply. This requirement represents a challenge and many topologies are currently being researched. The analysis of a

  5. A Dimensionality Reduction-Based Multi-Step Clustering Method for Robust Vessel Trajectory Analysis

    Directory of Open Access Journals (Sweden)

    Huanhuan Li

    2017-08-01

    Full Text Available The Shipboard Automatic Identification System (AIS is crucial for navigation safety and maritime surveillance, data mining and pattern analysis of AIS information have attracted considerable attention in terms of both basic research and practical applications. Clustering of spatio-temporal AIS trajectories can be used to identify abnormal patterns and mine customary route data for transportation safety. Thus, the capacities of navigation safety and maritime traffic monitoring could be enhanced correspondingly. However, trajectory clustering is often sensitive to undesirable outliers and is essentially more complex compared with traditional point clustering. To overcome this limitation, a multi-step trajectory clustering method is proposed in this paper for robust AIS trajectory clustering. In particular, the Dynamic Time Warping (DTW, a similarity measurement method, is introduced in the first step to measure the distances between different trajectories. The calculated distances, inversely proportional to the similarities, constitute a distance matrix in the second step. Furthermore, as a widely-used dimensional reduction method, Principal Component Analysis (PCA is exploited to decompose the obtained distance matrix. In particular, the top k principal components with above 95% accumulative contribution rate are extracted by PCA, and the number of the centers k is chosen. The k centers are found by the improved center automatically selection algorithm. In the last step, the improved center clustering algorithm with k clusters is implemented on the distance matrix to achieve the final AIS trajectory clustering results. In order to improve the accuracy of the proposed multi-step clustering algorithm, an automatic algorithm for choosing the k clusters is developed according to the similarity distance. Numerous experiments on realistic AIS trajectory datasets in the bridge area waterway and Mississippi River have been implemented to compare our

  6. A Dimensionality Reduction-Based Multi-Step Clustering Method for Robust Vessel Trajectory Analysis.

    Science.gov (United States)

    Li, Huanhuan; Liu, Jingxian; Liu, Ryan Wen; Xiong, Naixue; Wu, Kefeng; Kim, Tai-Hoon

    2017-08-04

    The Shipboard Automatic Identification System (AIS) is crucial for navigation safety and maritime surveillance, data mining and pattern analysis of AIS information have attracted considerable attention in terms of both basic research and practical applications. Clustering of spatio-temporal AIS trajectories can be used to identify abnormal patterns and mine customary route data for transportation safety. Thus, the capacities of navigation safety and maritime traffic monitoring could be enhanced correspondingly. However, trajectory clustering is often sensitive to undesirable outliers and is essentially more complex compared with traditional point clustering. To overcome this limitation, a multi-step trajectory clustering method is proposed in this paper for robust AIS trajectory clustering. In particular, the Dynamic Time Warping (DTW), a similarity measurement method, is introduced in the first step to measure the distances between different trajectories. The calculated distances, inversely proportional to the similarities, constitute a distance matrix in the second step. Furthermore, as a widely-used dimensional reduction method, Principal Component Analysis (PCA) is exploited to decompose the obtained distance matrix. In particular, the top k principal components with above 95% accumulative contribution rate are extracted by PCA, and the number of the centers k is chosen. The k centers are found by the improved center automatically selection algorithm. In the last step, the improved center clustering algorithm with k clusters is implemented on the distance matrix to achieve the final AIS trajectory clustering results. In order to improve the accuracy of the proposed multi-step clustering algorithm, an automatic algorithm for choosing the k clusters is developed according to the similarity distance. Numerous experiments on realistic AIS trajectory datasets in the bridge area waterway and Mississippi River have been implemented to compare our proposed method with

  7. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  8. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  9. Differentiation between solid-ankle cushioned heel and energy storage and return prosthetic foot based on step-to-step transition cost.

    Science.gov (United States)

    Wezenberg, Daphne; Cutti, Andrea G; Bruno, Antonino; Houdijk, Han

    2014-01-01

    Decreased push-off power by the prosthetic foot and inadequate roll-over shape of the foot have been shown to increase the energy dissipated during the step-to-step transition in human walking. The aim of this study was to determine whether energy storage and return (ESAR) feet are able to reduce the mechanical energy dissipated during the step-to-step transition. Fifteen males with a unilateral lower-limb amputation walked with their prescribed ESAR foot (Vari-Flex, Ossur; Reykjavik, Iceland) and with a solid-ankle cushioned heel foot (SACH) (1D10, Ottobock; Duderstadt, Germany), while ground reaction forces and kinematics were recorded. The positive mechanical work on the center of mass performed by the trailing prosthetic limb was larger (33%, p = 0.01) and the negative work performed by the leading intact limb was lower (13%, p = 0.04) when walking with the ESAR foot compared with the SACH foot. The reduced step-to-step transition cost coincided with a higher mechanical push-off power generated by the ESAR foot and an extended forward progression of the center of pressure under the prosthetic ESAR foot. Results can explain the proposed improvement in walking economy with this kind of energy storing and return prosthetic foot.

  10. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  11. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Direct Taxation in the Eu: The Common Corporate Tax Base as the Next Sub-Step towards Harmonization

    Directory of Open Access Journals (Sweden)

    Norbert Herzig

    2011-12-01

    Full Text Available This paper analyzes the Common Corporate Tax Base (CCTB as an interim alternative to the proposal of a Council directive on a Common Consolidated Corporate Tax Base (CCCTB. The CCCTB concept does not only include common rules for determining the tax base like the CCTB but also the steps of consolidation and subsequent formula apportionment. Therefore, the paper starts by showing that particularly these second and third steps of the CCCTB project meet fierce political opposition from several Member States and do leave leeway for tax planning. Afterwards, the CCCTB proposal's approach to common rules for determining the tax base is evaluated, i.e. tested for its suitability as a point of departure for drafting a CCTB. Finally, various other aspects of the proposal are examined in light of a CCTB without consolidation.

  14. Multi-step-prediction of chaotic time series based on co-evolutionary recurrent neural network

    International Nuclear Information System (INIS)

    Ma Qianli; Zheng Qilun; Peng Hong; Qin Jiangwei; Zhong Tanwei

    2008-01-01

    This paper proposes a co-evolutionary recurrent neural network (CERNN) for the multi-step-prediction of chaotic time series, it estimates the proper parameters of phase space reconstruction and optimizes the structure of recurrent neural networks by co-evolutionary strategy. The searching space was separated into two subspaces and the individuals are trained in a parallel computational procedure. It can dynamically combine the embedding method with the capability of recurrent neural network to incorporate past experience due to internal recurrence. The effectiveness of CERNN is evaluated by using three benchmark chaotic time series data sets: the Lorenz series, Mackey-Glass series and real-world sun spot series. The simulation results show that CERNN improves the performances of multi-step-prediction of chaotic time series

  15. Angle Control-Based Multi-Terminal Out-of-Step Protection System

    OpenAIRE

    Antans Sauhats; Andrejs Utans; Dmitrijs Antonovs; Andrejs Svalovs

    2017-01-01

    From time to time a sequence of unexpected and overlapping contingencies may lead to power system angular instability and even blackouts if not addressed adequately by means of an out-of-step (OOS) protection system. The motivation of the paper is an attempt to develop a workable prototype of the OOS protection system. The deficiencies of the protection currently used in the Latvian Power System network are highlighted and a new protection structure is proposed. The protection system comprise...

  16. Class-Wide Access to a Commercial Step 1 Question Bank During Preclinical Organ-Based Modules: A Pilot Project.

    Science.gov (United States)

    Baños, James H; Pepin, Mark E; Van Wagoner, Nicholas

    2018-03-01

    The authors examined the usefulness of a commercially available Step 1 question bank as a formative academic support tool throughout organ-based modules in an integrated preclinical medical curriculum. The authors also determined the extent to which correlation between question bank utilization and academic metrics varied with Medical College Admission Test (MCAT) scores. In 2015, a cohort of 185 first-year medical students at University of Alabama School of Medicine were provided with 18-month full access to a commercially available Step 1 question bank of over 2,100 items throughout organ-based modules, although there were no requirements for use. Data on student use of the question bank were collected via an online administrative portal. Relationships between question bank utilization and academic outcomes including exams, module grades, and United States Medical Licensing Examination (USMLE) Step 1 were determined using multiple linear regression. MCAT scores and number of items attempted in the question bank significantly predicted all academic measures, with question bank utilization as the stronger predictor. The association between question bank utilization and academic outcome was stronger for individuals with lower MCAT scores. The findings elucidate a novel academic support mechanism that, for some programs, may help bridge the gap between holistic and mission-based admissions practices and a residency match process that places a premium on USMLE exam scores. Distributed formative use of USMLE Step 1 practice questions may be of value as an academic support tool that benefits all students, but particularly those entering with lower MCAT scores.

  17. Development of interface between MCNP-FISPACT-MCNP (IPR-MFM) based on rigorous two step method

    International Nuclear Information System (INIS)

    Shaw, A.K.; Swami, H.L.; Danani, C.

    2015-01-01

    In this work we present the development of interface tool between MCNP-FISPACT-MCNP (MFM) based on Rigorous Two Step method for the shutdown dose rate (SDDR) calculation. The MFM links MCNP radiation transport and the FISPACT inventory code through a suitable coupling scheme. MFM coupling scheme has three steps. In first step it picks neutron spectrum and total flux from MCNP output file to use as input parameter for FISPACT. It prepares the FISPACT input files by using irradiation history, neutron flux and neutron spectrum and then execute the FISPACT input file in the second step. Third step of MFM coupling scheme extracts the decay gammas from the FISPACT output file and prepares MCNP input file for decay gamma transport followed by execution of MCNP input file and estimation of SDDR. Here detailing of MFM methodology and flow scheme has been described. The programming language PYTHON has been chosen for this development of the coupling scheme. A complete loop of MCNP-FISPACT-MCNP has been developed to handle the simplified geometrical problems. For validation of MFM interface a manual cross-check has been performed which shows good agreements. The MFM interface also has been validated with exiting MCNP-D1S method for a simple geometry with 14 MeV cylindrical neutron source. (author)

  18. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  19. Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

    Science.gov (United States)

    Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

    2017-12-01

    We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

  20. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae

    Science.gov (United States)

    2011-09-20

    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  2. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)

    HURD, RE; ROBILLARD, GT; REID, BR

    1977-01-01

    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  3. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  4. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  6. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  7. A randomized controlled pilot study of home-based step training in older people using videogame technology.

    Directory of Open Access Journals (Sweden)

    Daniel Schoene

    Full Text Available BACKGROUND: Stepping impairments are associated with physical and cognitive decline in older adults and increased fall risk. Exercise interventions can reduce fall risk, but adherence is often low. A new exergame involving step training may provide an enjoyable exercise alternative for preventing falls in older people. PURPOSE: To assess the feasibility and safety of unsupervised, home-based step pad training and determine the effectiveness of this intervention on stepping performance and associated fall risk in older people. DESIGN: Single-blinded two-arm randomized controlled trial comparing step pad training with control (no-intervention. SETTING/PARTICIPANTS: Thirty-seven older adults residing in independent-living units of a retirement village in Sydney, Australia. INTERVENTION: Intervention group (IG participants were provided with a computerized step pad system connected to their TVs and played a step game as often as they liked (with a recommended dose of 2-3 sessions per week for 15-20 minutes each for eight weeks. In addition, IG participants were asked to complete a choice stepping reaction time (CSRT task once each week. MAIN OUTCOME MEASURES: CSRT, the Physiological Profile Assessment (PPA, neuropsychological and functional mobility measures were assessed at baseline and eight week follow-up. RESULTS: Thirty-two participants completed the study (86.5%. IG participants played a median 2.75 sessions/week and no adverse events were reported. Compared to the control group, the IG significantly improved their CSRT (F31,1 = 18.203, p<.001, PPA composite scores (F31,1 = 12.706, p = 0.001, as well as the postural sway (F31,1 = 4.226, p = 0.049 and contrast sensitivity (F31,1 = 4.415, p = 0.044 PPA sub-component scores. In addition, the IG improved significantly in their dual-task ability as assessed by a timed up and go test/verbal fluency task (F31,1 = 4.226, p = 0.049. CONCLUSIONS: Step pad training can

  8. Step-Based Data Sharing and Exchange in One-of-a-Kind Product Collaborative Design for Cloud Manufacturing

    Directory of Open Access Journals (Sweden)

    B. M. Li

    2013-01-01

    Full Text Available With the trend for global collaboration, there is a need for collaborative design between geographically distributed teams and companies. In particular, this need is inevitable in the companies doing their business based on one-of-a-kind production (OKP. One important problem is the lack of interoperability and compatibility of data between different CAx systems. This problem is further highlighted in data exchange in cloud manufacturing. To the best of authors' knowledge, current studies have limitations in achieving the interoperability and compatibility of data. In this paper, a STEP-based data model is proposed to represent OKP product data/knowledge, which contains four categories of product knowledge (i.e., customer, product, manufacturing, and resource resp.. A STEP-based data modelling approach is proposed to describe each category of knowledge separately and then connect them to form the final integrated model. Compared with most current product models, this model includes the more complete product data/knowledge involved in OKP product development (OKPPD, and thus it can provide more adequate knowledge support for OKPPD activities. Based on the proposed STEP-based data model, a product data exchange and sharing (DES framework is proposed and developed to enable DES in collaborative OKPPD in the cloud manufacturing environment. Case studies were carried out to validate the proposed data model and DES framework.

  9. Stepping Stones to Resiliency following a community-based two-generation Canadian preschool programme.

    Science.gov (United States)

    Ginn, Carla S; Benzies, Karen M; Keown, Leslie Anne; Raffin Bouchal, Shelley; Thurston, Wilfreda E Billlie

    2018-05-01

    Early intervention programmes are designed to address complex inequities for Canadian families living with low income, affecting social relationships, well-being and mental health. However, there is limited understanding of resiliency and change in families living with low income over time. We conducted a mixed methods study with recent immigrant, other Canadian-born, and Aboriginal families living with low income, who attended a two-generation preschool programme (CUPS One World) between 2002 and 2008. The aim of this study was to develop an understanding of the processes of change. We included 134 children and their caregivers living with low income, and experiencing mental health problems, addiction or social isolation. Children's receptive language, a proxy for school readiness, was measured at programme intake, exit, and age 10 years using the Peabody Picture Vocabulary Test 3rd Edition (PPVT-III). In Phase I (quantitative), we identified children with receptive language scores in the top and bottom 25th percentile, informing participant selection for Phase II. In Phase II (qualitative), we engaged in constructivist grounded theory to explore experiences of 14 biological mothers, after their children (n = 25) reached age 10 years. Interviews were conducted between June and September 2015. The core category, Stepping Stones to Resiliency, encompassed Perceptions of Family, Moving Forward, Achieving Goals, and Completely Different. Perceptions of Family influenced families' capabilities to move across the Stepping Stones to Resiliency. Stepping Stones to Resiliency provides a lens from which to view others in their daily challenges to break free of painful intergenerational cycles. It is a reminder of our struggle, our shared humanness, and that movement towards resiliency is more difficult for some than others. Our findings challenge traditional episodic, biomedical treatment paradigms for low-income families also experiencing intergenerational cycles of

  10. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories

    Science.gov (United States)

    Guo, Yang; Becker, Ute; Neese, Frank

    2018-03-01

    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  11. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    Science.gov (United States)

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  12. HVS-based quantization steps for validation of digital cinema extended bitrates

    Science.gov (United States)

    Larabi, M.-C.; Pellegrin, P.; Anciaux, G.; Devaux, F.-O.; Tulet, O.; Macq, B.; Fernandez, C.

    2009-02-01

    In Digital Cinema, the video compression must be as transparent as possible to provide the best image quality to the audience. The goal of compression is to simplify transport, storing, distribution and projection of films. For all those tasks, equipments need to be developed. It is thus mandatory to reduce the complexity of the equipments by imposing limitations in the specifications. In this sense, the DCI has fixed the maximum bitrate for a compressed stream to 250 Mbps independently from the input format (4K/24fps, 2K/48fps or 2K/24fps). The work described in this paper This parameter is discussed in this paper because it is not consistent to double/quadruple the input rate without increasing the output rate. The work presented in this paper is intended to define quantization steps ensuring the visually lossless compression. Two steps are followed first to evaluate the effect of each subband separately and then to fin the scaling ratio. The obtained results show that it is necessary to increase the bitrate limit for cinema material in order to achieve the visually lossless.

  13. An improved algorithm to convert CAD model to MCNP geometry model based on STEP file

    International Nuclear Information System (INIS)

    Zhou, Qingguo; Yang, Jiaming; Wu, Jiong; Tian, Yanshan; Wang, Junqiong; Jiang, Hai; Li, Kuan-Ching

    2015-01-01

    Highlights: • Fully exploits common features of cells, making the processing efficient. • Accurately provide the cell position. • Flexible to add new parameters in the structure. • Application of novel structure in INP file processing, conveniently evaluate cell location. - Abstract: MCNP (Monte Carlo N-Particle Transport Code) is a general-purpose Monte Carlo N-Particle code that can be used for neutron, photon, electron, or coupled neutron/photon/electron transport. Its input file, the INP file, has the characteristics of complicated form and is error-prone when describing geometric models. Due to this, a conversion algorithm that can solve the problem by converting general geometric model to MCNP model during MCNP aided modeling is highly needed. In this paper, we revised and incorporated a number of improvements over our previous work (Yang et al., 2013), which was proposed and targeted after STEP file and INP file were analyzed. Results of experiments show that the revised algorithm is more applicable and efficient than previous work, with the optimized extraction of geometry and topology information of the STEP file, as well as the production efficiency of output INP file. This proposed research is promising, and serves as valuable reference for the majority of researchers involved with MCNP-related researches

  14. Seven-step problem-based learning in an interaction design course

    DEFF Research Database (Denmark)

    Schultz, Nette; Christensen, Hans Peter

    2004-01-01

    The objective in this paper is the implementation of the highly structured seven-step PBL procedure as part of the learning process in a human-computer interaction design course at the Technical University of Denmark, taking into account the common learning processes in PBL and the interaction de...... others in a single course. The evaluation results showed that the students definitely took a deep approach to learning, and indicated clearly that the students had obtained competences not only within the traditional HCI curriculum but also in terms of team-work skills.......The objective in this paper is the implementation of the highly structured seven-step PBL procedure as part of the learning process in a human-computer interaction design course at the Technical University of Denmark, taking into account the common learning processes in PBL and the interaction...... individual reports after each case in the PBL-process in order to explore the students’ inter- and intra-personal team skills development in the learning process. Different qualitative and quantitative evaluation methods have been used to obtain a thorough evaluation of PBL used as a learning method among...

  15. Defining a competency framework: the first step toward competency-based medical education.

    Directory of Open Access Journals (Sweden)

    Azim Mirzazadeh

    2014-09-01

    Full Text Available Despite the existence of a large variety of competency frameworks for medical graduates, there is no agreement on a single set of outcomes. Different countries have attempted to define their own set of competencies to respond to their local situations. This article reports the process of developing medical graduates' competency framework as the first step in the curriculum reform in Tehran University of Medical Sciences (TUMS. A participatory approach was applied to develop a competency framework in Tehran University of Medical Sciences (TUMS. Following literature review, nominal group meetings with students and faculty members were held to generate the initial list of expectations, and 9 domains was proposed. Then, domains were reviewed, and one of the domains was removed. The competency framework was sent to Curriculum Reform Committee for consideration and approval, where it was decided to distribute electronic and paper forms among all faculty members and ask them for their comments. Following incorporating some of the modifications, the document was approved by the committee. The TUMS competency framework consists of 8 domains: Clinical skills; Communication skills; Patient management; Health promotion and disease prevention; Personal development; Professionalism, medical ethics and law; Decision making, reasoning and problem-solving; and Health system and the corresponding role of physicians. Development of a competency framework through a participatory approach was the first step towards curriculum reform in TUMS, aligned with local needs and conditions. The lessons learned through the process may be useful for similar projects in the future.

  16. [Virtual endoscopic navigation and body transparency based on computed tomography. A step towards in vivo imaging].

    Science.gov (United States)

    Cabanis, Emmanuel-Alain; Gombergh, Rodolphe; Castro, Albert; Gandjbakhch, Iradj; Iba-Zizen, Marie-Thérèse; Dubois, François

    2011-06-01

    Progress in HR-CTdata processing has led to lower X-ray exposure and to better diagnostic performance. We describe 19 adult patients (among 5000) examined by HR CT with 64 detectors, acquisition and exposure protocols in mSv, spiral, 0.6-mm slices, 5To PACS. After the two usual processing steps (60 gray values, 5122 and 10242 matrices, dedicated workstations for coronaroscopy and virtual coloscopy, 2D multiplanar reformation, surfacic, 3D volumes with dissection and navigation), a third original data processing step on additional workstations was added. Variable matrix extrapolated images, flexible colored curves (different from anatomical conventions), lighting (sources) and transparencies (unavailable with traditional endoscopy) were used. The digital film is a 16-minute "journey "consisting of 19 endo-body navigations in 5 regions, from the head to the bronchi, from the heart to the coronary arteries, and from the digestive tract to the abdomen and pelvis. One possible application is post-operative verification of an aortic graft. The movie is illustrated here with ten plates. This new approach is cost-effective and beneficial for the patient, in terms of early diagnosis and therapeutic follow-up. Ethical issues are also examined.

  17. LifeSteps: An Evidence-based Health Promotion Program for Underserved Populations – A Community Service Learning Approach

    Directory of Open Access Journals (Sweden)

    Melanie Austin-McCain

    2015-04-01

    Full Text Available Chronic diseases are the most common, costly, and preventable of all health problems in the United States. Chronic diseases represent the leading causes of death and are experienced at higher rates by minority populations (CDC, 2012. Innovative community-based health promotion programs are recommended that meet the diverse needs of underserved populations (Yeary, et al., 2011. LifeSteps is being developed as an evidence-based health promotion program focusing on health and wellness, a domain area defined within the Occupational Therapy Practice Framework (OTPF, 2008. LifeSteps will utilize a client-centered approach to coach individuals in making health behavior changes. Fieldwork and service-learning components are incorporated integrating clinical practice, academic study, and collaboration with community providers. Program evaluation measures based on the Transtheoretical Model (TTM have been identified to address all phases of program planning. The LifeSteps health promotion program aligns with local, national, and international objectives and addresses the need for programs that meet the diverse needs of underserved populations. Occupational therapists are in a unique position for implementing community-based interventions that promote health and contribute to a healthier society.

  18. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    Science.gov (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  19. An unstructured finite volume solver for two phase water/vapour flows based on an elliptic oriented fractional step method

    International Nuclear Information System (INIS)

    Mechitoua, N.; Boucker, M.; Lavieville, J.; Pigny, S.; Serre, G.

    2003-01-01

    Based on experience gained at EDF and Cea, a more general and robust 3-dimensional (3D) multiphase flow solver has been being currently developed for over three years. This solver, based on an elliptic oriented fractional step approach, is able to simulate multicomponent/multiphase flows. Discretization follows a 3D full unstructured finite volume approach, with a collocated arrangement of all variables. The non linear behaviour between pressure and volume fractions and a symmetric treatment of all fields are taken into account in the iterative procedure, within the time step. It greatly enforces the realizability of volume fractions (i.e 0 < α < 1), without artificial numerical needs. Applications to widespread test cases as static sedimentation, water hammer and phase separation are shown to assess the accuracy and the robustness of the flow solver in different flow conditions, encountered in nuclear reactors pipes. (authors)

  20. Practical Design Guidelines of qZSI Based Step-Up DC/DC Converter

    Science.gov (United States)

    Zakis, Janis; Vinnikov, Dmitri; Roasto, Indrek; Jalakas, Tanel

    2010-01-01

    This paper presents some design guidelines for a new voltage fed step-up DC/DC isolated converter. The most significant advantage of proposed converter is voltage buck-boost operation on single stage. The most promising application for proposed converter is in the field of distributed power generation e.g. fuel cells or photovoltaic. The most sensitive issues - such as power losses caused by high currents in the input side of converter and high transient overvoltages across the inverter bridge caused by stray inductances were discussed and solved. The proposals and recommendations to overcome these issues are given in the paper. The Selection and design guidelines of converter elements are proposed and explained. The prototype of proposed converter was built and experimentally tested. Some results are presented and evaluated.

  1. Street based self-employment : a poverty trap or a stepping stone for migrant youth in Africa?

    OpenAIRE

    Bezu, Sosina; Holden, Stein Terje

    2015-01-01

    A significant percentage of youth in urban Africa is employed in the informal sector. The informal sector is more accessible than the formal sector for people with low human and financial capital, such as youth migrants from rural areas. But the sector is also generally considered to provide a subsistence livelihood. This study examines whether street based selfemployment in Africa offer a stepping stone towards a better livelihood or an urban poverty trap for youth migrants. The ana...

  2. Usability of an internet-based platform (Next.Step for adolescent weight management

    Directory of Open Access Journals (Sweden)

    Pedro Sousa

    2015-02-01

    Full Text Available OBJECTIVE: The current study evaluates the usability perception of an e-therapeutic platform (supported by electronic processes and communication, aiming to promote the behavior change and to improve the adolescent health status through increased and interactive contact between the adolescent and the clinical staff. METHODS: This was a correlational study with a sample of 48 adolescents (12-18 years who attended a Pediatric Obesity Clinic between January and August of 2012. Participants were invited to access, during 24 weeks, the e-therapeutic multidisciplinary platform (Next.Step in addition to the standard treatment program. A usability questionnaire was administered and the platform performance and utilization indicators were analyzed. RESULTS: The users' perception of satisfaction, efficiency, and effectiveness regarding the Next.Step platform was clearly positive. However, only 54.17% of the enrolled adolescents accessed the platform, with a mean task-completion rate of 14.55% (SD = 18.853. The higher the number of the platform consulted resources, the greater the tendency to enjoy the platform, to consider it exciting and quick, to consider that the time spent in it was useful, to consider the access to information easy, and to login easier. Post-intervention assessment revealed a significant reduction in anthropometric and behavioral variables, including body mass index z-score, waist circumference percentile, hip circumference, and weekly screen time. CONCLUSION: These results highlight the importance of information and communication technologies in the health information access and the healthcare provision. Despite the limited adherence rate, platform users expressed a positive overall perception of its usability and presented a positive anthropometric and behavioral progress.

  3. Steps Towards Alcohol Misuse Prevention Programme (STAMPP): a school-based and community-based cluster randomised controlled trial.

    Science.gov (United States)

    McKay, Michael; Agus, Ashley; Cole, Jonathan; Doherty, Paul; Foxcroft, David; Harvey, Séamus; Murphy, Lynn; Percy, Andrew; Sumnall, Harry

    2018-03-09

    To assess the effectiveness of a combined classroom curriculum and parental intervention (the Steps Towards Alcohol Misuse Prevention Programme (STAMPP)), compared with alcohol education as normal (EAN), in reducing self-reported heavy episodic drinking (HED) and alcohol-related harms (ARHs) in adolescents. 105 high schools in Northern Ireland (NI) and in Scotland. Schools were stratified by free school meal provision. Schools in NI were also stratified by school type (male/female/coeducational). Eligible students were in school year 8/S1 (aged 11-12 years) at baseline (June 2012). A classroom-based alcohol education intervention, coupled with a brief alcohol intervention for parents/carers. PRIMARY OUTCOMES: (1) The prevalence of self-reported HED in the previous 30 days and (2) the number of self-reported ARHs in the previous 6 months. Outcomes were assessed using two-level random intercepts models (logistic regression for HED and negative binomial for number of ARHs). At 33 months, data were available for 5160 intervention and 5073 control students (HED outcome), and 5234 and 5146 students (ARH outcome), respectively. Of those who completed a questionnaire at either baseline or 12 months (n=12 738), 10 405 also completed the questionnaire at 33 months (81.7%). Fewer students in the intervention group reported HED compared with EAN (17%vs26%; OR=0.60, 95% CI 0.49 to 0.73), with no significant difference in the number of self-reported ARHs (incident rate ratio=0.92, 95% CI 0.78 to 1.05). Although the classroom component was largely delivered as intended, there was low uptake of the parental component. There were no reported adverse effects. Results suggest that STAMPP could be an effective programme to reduce HED prevalence. While there was no significant reduction in ARH, it is plausible that effects on harms would manifest later. ISRCTN47028486; Post-results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article

  4. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  5. Managing chronic pathologies with a stepped mHealth-based approach in clinical psychology and medicine

    Directory of Open Access Journals (Sweden)

    Gianluca eCastelnuovo

    2015-04-01

    Full Text Available Chronic diseases and conditions typically require long-term monitoring and treatment protocols both in traditional settings and in out-patient frameworks. The economic burden of chronic conditions is a key challenge and new and mobile technologies could offer good solutions. mHealth could be considered an evolution of ehealth and could be defined as the practice of medicine and public health supported by mobile communication devices. mHealth approach could overcome limitations linked with the traditional, restricted and highly expensive in-patient treatment of many chronic pathologies. Possible applications include stepped mHealth approach, where patients can be monitored and treated in their everyday contexts. Unfortunately, many barriers for the spread of mHealth are still present. Due the significant impact of psychosocial factors on disease evolution, psychotherapies have to be included into the chronic disease protocols. Existing psychological theories of health behavior change have to be adapted to the new technological contexts and requirements. In conclusion, clinical psychology and medicine have to face the chronic care management challenge in both traditional and mHealth settings.

  6. Ring-dot-shaped multilayer piezoelectric step-down transformers using PZT-based ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Insung; Joo, Hyeonkyu; Song, Jaesung; Jeong, Soonjong; Kim, Minsoo [Korea Electrotechnology Research Institute, Changwon (Korea, Republic of)

    2010-10-15

    In this study, multilayer piezo stack transformers for switching mode power supply (SMPS) application were manufactured using 0.01Pb(Ni{sub 1/3}Nb{sub 2/3})O{sub 3} - 0.08Pb(Mn{sub 1/3}Nb{sub 2/3})O{sub 3} - 0.91Pb(Zr{sub 0.505}Ti{sub 0.495})O{sub 3} (PNN-PMN-PZT) ceramics. The voltage ratio of a multilayer piezo stack transformer showed a maximum at the resonance frequency of the input and then increased with increasing load resistance. The efficiency of the multilayer piezo stack transformer showed its highest value at around the matching load. The output power increased with increasing input voltage. The temperature of the multilayer piezo stack transformer increased with increasing output power and load resistance. The manufactured multilayer piezo stack transformer could be used up to 5 W at a resonance frequency of 70.25 kHz for SMPS application because the temperature rise from room temperature is believed to about 20 .deg. C and because the transformer is electrically stable. The newly-developed ring-dot-type step-down multilayer piezo stack transformer shows possible applications as SMPS for electronic power sources with excellent input-to-output properties.

  7. Ring-dot-shaped multilayer piezoelectric step-down transformers using PZT-based ceramics

    International Nuclear Information System (INIS)

    Kim, Insung; Joo, Hyeonkyu; Song, Jaesung; Jeong, Soonjong; Kim, Minsoo

    2010-01-01

    In this study, multilayer piezo stack transformers for switching mode power supply (SMPS) application were manufactured using 0.01Pb(Ni 1/3 Nb 2/3 )O 3 - 0.08Pb(Mn 1/3 Nb 2/3 )O 3 - 0.91Pb(Zr 0.505 Ti 0.495 )O 3 (PNN-PMN-PZT) ceramics. The voltage ratio of a multilayer piezo stack transformer showed a maximum at the resonance frequency of the input and then increased with increasing load resistance. The efficiency of the multilayer piezo stack transformer showed its highest value at around the matching load. The output power increased with increasing input voltage. The temperature of the multilayer piezo stack transformer increased with increasing output power and load resistance. The manufactured multilayer piezo stack transformer could be used up to 5 W at a resonance frequency of 70.25 kHz for SMPS application because the temperature rise from room temperature is believed to about 20 .deg. C and because the transformer is electrically stable. The newly-developed ring-dot-type step-down multilayer piezo stack transformer shows possible applications as SMPS for electronic power sources with excellent input-to-output properties.

  8. One step gold (bio)functionalisation based on CS{sub 2}-amine reaction

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Ines [Centro de Quimica e Bioquimica, Faculdade de Ciencias da Universidade de Lisboa, Ed. C8, Campo Grande, 1749-016 Lisboa (Portugal); Cascalheira, Antonio C. [Lumisense, Lda, Campus Faculdade de Ciencias da Universidade de Lisboa, Ed. ICAT, Campo Grande, 1749-016 Lisboa (Portugal); Viana, Ana S., E-mail: anaviana@fc.ul.p [Centro de Quimica e Bioquimica, Faculdade de Ciencias da Universidade de Lisboa, Ed. C8, Campo Grande, 1749-016 Lisboa (Portugal)

    2010-12-01

    Dithiocarbamates have been regarded as alternative anchor groups to thiols on gold surfaces, and claimed to be formed in situ through the reaction between secondary amines and carbon disulphide. In this paper, we further exploit this methodology for a convenient one step biomolecule immobilisation onto gold surfaces. First, the reactivity between CS{sub 2} and electroactive compounds containing amines, primary (dopamine), secondary (epinephrine), and an amino acid (tryptophan) has been investigated by electrochemical methods. Cyclic voltammetric characterisation of the modified electrodes confirmed the immobilisation of all the target compounds, allowing the estimation of their surface concentration. The best result was obtained with epinephrine, a secondary amine, for which a typical quasi-reversible behaviour of surface confined electroactive species could be clearly depicted. Electrochemical reductive desorption studies enabled to infer on the extent of the reaction and on the relative stability of the generated monolayers. Bio-functionalisation studies have been accomplished through the reaction of CS{sub 2} with glucose oxidase in aqueous medium, and the catalytic activity of the immobilised enzyme was evaluated towards glucose, by electrochemical methods in the presence of a redox mediator. Scanning tunnelling microscopy (STM) and Atomic force microscopy (AFM) were used respectively, to characterize the gold electrodes and Glucose Oxidase coverage and distribution on the modified surfaces.

  9. Do not Lose Your Students in Large Lectures: A Five-Step Paper-Based Model to Foster Students’ Participation

    Directory of Open Access Journals (Sweden)

    Mona Hassan Aburahma

    2015-07-01

    Full Text Available Like most of the pharmacy colleges in developing countries with high population growth, public pharmacy colleges in Egypt are experiencing a significant increase in students’ enrollment annually due to the large youth population, accompanied with the keenness of students to join pharmacy colleges as a step to a better future career. In this context, large lectures represent a popular approach for teaching the students as economic and logistic constraints prevent splitting them into smaller groups. Nevertheless, the impact of large lectures in relation to student learning has been widely questioned due to their educational limitations, which are related to the passive role the students maintain in lectures. Despite the reported feebleness underlying large lectures and lecturing in general, large lectures will likely continue to be taught in the same format in these countries. Accordingly, to soften the negative impacts of large lectures, this article describes a simple and feasible 5-step paper-based model to transform lectures from a passive information delivery space into an active learning environment. This model mainly suits educational establishments with financial constraints, nevertheless, it can be applied in lectures presented in any educational environment to improve active participation of students. The components and the expected advantages of employing the 5-step paper-based model in large lectures as well as its limitations and ways to overcome them are presented briefly. The impact of applying this model on students’ engagement and learning is currently being investigated.

  10. Developing School Heads as Instructional Leaders in School-Based Assessment: Challenges and Next Steps

    Science.gov (United States)

    Lingam, Govinda Ishwar; Lingam, Narsamma

    2016-01-01

    The study explored challenges faced by school leaders in the Pacific nation of Solomon Islands in school-based assessment, and the adequacy of an assessment course to prepare them. A questionnaire including both open and closed-ended questions elicited relevant data from the school leaders. Modelling best practices in school-based assessment was…

  11. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    Science.gov (United States)

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  12. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  13. Amperometric sensor for ethanol based on one-step electropolymerization of thionine-carbon nanofiber nanocomposite containing alcohol oxidase.

    Science.gov (United States)

    Wu, Lina; McIntosh, Mike; Zhang, Xueji; Ju, Huangxian

    2007-12-15

    Thionine had strong interaction with carbon nanofiber (CNF) and was used in the non-covalent functionalization of carbon nanofiber for the preparation of stable thionine-CNF nanocomposite with good dispersion. With a simple one-step electrochemical polymerization of thionine-CNF nanocomposite and alcohol oxidase (AOD), a stable poly(thionine)-CNF/AOD biocomposite film was formed on electrode surface. Based on the excellent catalytic activity of the biocomposite film toward reduction of dissolved oxygen, a sensitive ethanol biosensor was proposed. The ethanol biosensor could monitor ethanol ranging from 2.0 to 252 microM with a detection limit of 1.7 microM. It displayed a rapid response, an expanded linear response range as well as excellent reproducibility and stability. The combination of catalytic activity of CNF and the promising feature of the biocomposite with one-step non-manual technique favored the sensitive determination of ethanol with improved analytical capabilities.

  14. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The Boomerang Lift: A Three-Step Compartment-Based Approach to the Youthful Cheek.

    Science.gov (United States)

    Schreiber, Jillian E; Terner, Jordan; Stern, Carrie S; Beut, Javier; Jelks, Elizabeth B; Jelks, Glenn W; Tepper, Oren M

    2018-04-01

    Autologous fat grafting is an important tool for plastic surgeons treating the aging face. Malar augmentation with fat is often targeted to restore the youthful facial contour and provides support to the lower eyelid. The existence of distinct facial fat compartments suggests that a stepwise approach may be appropriate in this regard. The authors describe a three-step approach to malar augmentation using targeted deep malar fat compartmental augmentation, termed the "boomerang lift." Clinical patients undergoing autologous fat grafting for malar augmentation were injected in three distinct deep malar fat compartments: the lateral sub-orbicularis oculi fat, the medial sub-orbicularis oculi fat, and the deep medial cheek (n = 9). Intraoperative three-dimensional images were taken at baseline and following compartmental injections (Canfield VECTRA H1). Images were overlaid between the augmented and baseline captures, and the three-dimensional surface changes were analyzed, which represented the resulting "augmentation zone." Three-dimensional analysis demonstrated a unique pattern for the augmentation zone consistent across patients. The augmentation zone resembled a boomerang, with the short tail supporting the medial lower lid and the long tail extending laterally along the zygomatic arch. The upper border was restricted by the level of the nasojugal interface, and the lower border was defined medially by the nasolabial fold and laterally by the level of the zygomaticocutaneous ligament. Lateral and medial sub-orbicularis oculi fat injections defined the boundaries of the boomerang shape, and injection to the deep medial cheek provided maximum projection. This is the first description of deep malar augmentation zones in clinical patients. Three-dimensional surface imaging was ideal for analyzing the surface change in response to targeted facial fat grafting. The authors' technique resulted in a reproducible surface shape, which they term the boomerang lift.

  16. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    Science.gov (United States)

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  17. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    Science.gov (United States)

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  18. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  19. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  20. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  1. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  2. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations

    Science.gov (United States)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.

    2018-02-01

    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  3. Evidence of weak pair coupling in the penetration depth of bi-based high-Tc superconductors

    International Nuclear Information System (INIS)

    Thompson, J.R.; Sun, Yang Ren; Ossandon, J.G.; Christen, D.K.; Chakoumakos, B.C.; Sales, B.C.; Kerchner, H.R.; Sonder, E.

    1990-01-01

    The magnetic penetration depth λ(T) has been investigated in Bi(Pb)SrCaCuO high-T c compounds having 2- and 3-layers of copper-oxygen per unit cell. Studies of the magnetization in the vortex state were employed and the results were compared with weak and strong coupling calculations. The temperature dependence of λ is described well by BCS theory in the clean limit, giving evidence for weak pair coupling in this family of materials. For the short component of the λ tensor, we obtain values of 292 and 220 nm (T = 0) for Bi-2212 and (BiPb)-2223, respectively

  4. Physician-based smoking intervention: a rededication to a five-step strategy to smoking research.

    Science.gov (United States)

    Ockene, J K; Zapka, J G

    1997-01-01

    It is well established that physicians can have a significant effect on the smoking behavior of their patients. To do this, attention must be paid to putting in place multiple strategies or mechanisms in the organization where the physician practices, as well as in the macroenvironment (i.e., social and public policy). It has been questioned whether or not there is stagnation in the field of clinical smoking intervention requiring a rededication to basic research regarding smoking. With respect to physician-based smoking intervention, we alternatively suggest that recommitment to all phases of research is essential for moving forward physician-based smoking interventions in the rapidly changing health services and social environment. In this article, we first review the essential framework of the National Cancer Institute's research science approach to cancer prevention and control. Evidence concerning physician-based interventions is then reviewed, followed by a schematic of a comprehensive framework for thinking about the process and intervention components needed for physician-based smoking intervention to take place in the health-care setting, the impact they have, and the eventual outcome of such interventions. There is a discussion of the challenges for the delivery of smoking-cessation services presented by the rapidly changing healthy delivery system of the 1990s. Finally, we present recommendations concerning research priorities for physician-based smoking intervention and the research funding process.

  5. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  6. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  7. The Effect of Think-Pair-Share-Write Based on Hybrid Learning on Metakognitive Skills, Creative Thinking and Cognitive Learning at SMA Negeri 3 Malang

    Directory of Open Access Journals (Sweden)

    Ika Yulianti Siregar

    2017-07-01

    Full Text Available The results of biology learning observation show that there are many constraints during the learning process in the class and consultation meeting between teacher and students. The think-pair-share-write based on hybrid learning was conducted to analyze the effect on metacognitive skills, creative thinking and learning outcomes. The research design was quasi experiment with pretest-posttest non-equivalent control group design. The independent variable is think-pair-share-write based on Hybrid learning model, while the dependent variables are metacognitive skills, creative thinking, and cognitive learning outcomes. Metacognitive skills are measured by using metacognitive rubrics. Creative thinking skills and cognitive learning outcomes are measured by using a description test. The data were taken by conducting pretest and posttest. The hypothesis test used was anakova with level of significance 0,05 (P <0,05, as the test result was significant then the test was continued to LSD. Before the anakova test, normality and homogeneity test were performed. The results showed that think-pair-share-write based on Hybrid Learning significantly affecting: 1 the metacognitive skills with F arithmetic of 183,472 and Sig. 0,000; 2 the creative thinking skill with F value of 325,111 and Sig. 0,000; 3 the cognitive learning outcomes with F arithmetic of 175.068 and Sig. 0,000.

  8. Using Variable Dwell Time to Accelerate Gaze-based Web Browsing with Two-step Selection

    OpenAIRE

    Chen, Zhaokang; Shi, Bertram E.

    2017-01-01

    In order to avoid the "Midas Touch" problem, gaze-based interfaces for selection often introduce a dwell time: a fixed amount of time the user must fixate upon an object before it is selected. Past interfaces have used a uniform dwell time across all objects. Here, we propose an algorithm for adjusting the dwell times of different objects based on the inferred probability that the user intends to select them. In particular, we introduce a probabilistic model of natural gaze behavior while sur...

  9. A proposed adaptive step size perturbation and observation maximum power point tracking algorithm based on photovoltaic system modeling

    Science.gov (United States)

    Huang, Yu

    Solar energy becomes one of the major alternative renewable energy options for its huge abundance and accessibility. Due to the intermittent nature, the high demand of Maximum Power Point Tracking (MPPT) techniques exists when a Photovoltaic (PV) system is used to extract energy from the sunlight. This thesis proposed an advanced Perturbation and Observation (P&O) algorithm aiming for relatively practical circumstances. Firstly, a practical PV system model is studied with determining the series and shunt resistances which are neglected in some research. Moreover, in this proposed algorithm, the duty ratio of a boost DC-DC converter is the object of the perturbation deploying input impedance conversion to achieve working voltage adjustment. Based on the control strategy, the adaptive duty ratio step size P&O algorithm is proposed with major modifications made for sharp insolation change as well as low insolation scenarios. Matlab/Simulink simulation for PV model, boost converter control strategy and various MPPT process is conducted step by step. The proposed adaptive P&O algorithm is validated by the simulation results and detail analysis of sharp insolation changes, low insolation condition and continuous insolation variation.

  10. Knowledge Based Artificial Augmentation Intelligence Technology: Next Step in Academic Instructional Tools for Distance Learning

    Science.gov (United States)

    Crowe, Dale; LaPierre, Martin; Kebritchi, Mansureh

    2017-01-01

    With augmented intelligence/knowledge based system (KBS) it is now possible to develop distance learning applications to support both curriculum and administrative tasks. Instructional designers and information technology (IT) professionals are now moving from the programmable systems era that started in the 1950s to the cognitive computing era.…

  11. Identification of Mine-Shaped Objects based on an Efficient Phase Stepped-Frequency Radar Approach

    DEFF Research Database (Denmark)

    Sørensen, Helge Bjarup Dissing; Jakobsen, Kaj Bjarne; Nymann, Ole

    1997-01-01

    a radar probe is moved automatically to measure in each grid point a set of reflection coefficients from which phase and amplitude information are extracted. Based on a simple processing of the phase information, quarternary image and template cross-correlation a successful detection of metal- and non...

  12. The PICO Game: An Innovative Strategy for Teaching Step 1 in Evidence-Based Practice.

    Science.gov (United States)

    Milner, Kerry A; Cosme, Sheryl

    2017-12-01

    This column shares the best evidence-based strategies and innovative ideas on how to facilitate the learning and implementation of EBP principles and processes by clinicians as well as nursing and interprofessional students. Guidelines for submission are available at https://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1741-6787. © 2017 Sigma Theta Tau International.

  13. Cultivating Preservice Secondary Teachers for Project-Based Learning: A Four-Step Model

    Science.gov (United States)

    Zhang, Gaoming; Ridgway, Angelia J.; Sachs, Deb

    2015-01-01

    This article describes four different mechanisms for preparing teacher candidates from a liberal arts institution to teach in project based learning (PBL) classrooms: Observe it, Experience it, Create it, and Become it. For each of the four mechanisms, the authors also provide concrete examples of candidates' PBL experiences and candidates'…

  14. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  15. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    International Nuclear Information System (INIS)

    Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian

    2016-01-01

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers

  16. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)

    2016-09-15

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  17. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Success rate evaluation of clinical governance implementation in teaching hospitals in Kerman (Iran) based on nine steps of Karsh's model.

    Science.gov (United States)

    Vali, Leila; Mastaneh, Zahra; Mouseli, Ali; Kardanmoghadam, Vida; Kamali, Sodabeh

    2017-07-01

    One of the ways to improve the quality of services in the health system is through clinical governance. This method aims to create a framework for clinical services providers to be accountable in return for continuing improvement of quality and maintaining standards of services. To evaluate the success rate of clinical governance implementation in Kerman teaching hospitals based on 9 steps of Karsh's Model. This cross-sectional study was conducted in 2015 on 94 people including chief executive officers (CEOs), nursing managers, clinical governance managers and experts, head nurses and nurses. The required data were collected through a researcher-made questionnaire containing 38 questions with three-point Likert Scale (good, moderate, and weak). The Karsh's Model consists of nine steps including top management commitment to change, accountability for change, creating a structured approach for change, training, pilot implementation, communication, feedback, simulation, and end-user participation. Data analysis using descriptive statistics and Mann-Whitney-Wilcoxon test was done by SPSS software version 16. About 81.9 % of respondents were female and 74.5 have a Bachelor of Nursing (BN) degree. In general, the status of clinical governance implementation in studied hospitals based on 9 steps of the model was 44 % (moderate). A significant relationship was observed among accountability and organizational position (p=0.0012) and field of study (p=0.000). Also, there were significant relationships between structure-based approach and organizational position (p=0.007), communication and demographic characteristics (p=0.000), and end-user participation with organizational position (p=0.03). Clinical governance should be implemented by correct needs assessment and participation of all stakeholders, to ensure its enforcement in practice, and to enhance the quality of services.

  19. First Steps towards Evidence-Based Preventive Home Visits: Experiences Gathered in a Swedish Municipality

    Directory of Open Access Journals (Sweden)

    Charlotte Löfqvist

    2012-01-01

    Full Text Available The purpose of preventive home visits is to promote overall health and wellbeing in old age. The aim of this paper was to describe the process of the development of evidence-based preventive home visits, targeting independent community-living older persons. The evidence base was generated from published studies and practical experiences. The results demonstrate that preventive home visits should be directed to persons 80 years old and older and involve various professional competences. The visits should be personalized, lead to concrete interventions, and be followed up. The health areas assessed should derive from a broad perspective and include social, psychological, and medical aspects. Core components in the protocol developed in this study captured physical, medical, psychosocial, and environmental aspects. Results of a pilot study showed that the protocol validly identified health risks among older people with different levels of ADL dependence.

  20. Present and next steps of the JAERI superconducting rf linac based FEL program

    International Nuclear Information System (INIS)

    Minehara, E.J.; Yamauchi, T.; Sugimoto, M.

    2000-01-01

    The JAERI superconducting rf linac based FEL has successfully been lased to produce a 0.3 kW FEL light and 100 kW or larger electron beam output in quasi continuous wave operation in 1999. The 1 kW class output as our present program goal will be achieved to improve the optical out coupling method in the FEL optical resonator, the electron gun, and the electron beam optics in the JAERI FEL driver. As our next 5 year program goal is the 100 kW class FEL light and a few tens MW class electron beam output in average, quasi continuous wave operation of the light and electron beam will be planned in the JAERI superconducting rf linac based FEL facility. Conceptual design options needed for such a very high power operation and shorter wavelength light sources will be discussed to improve and to upgrade the exciting facility. (author)

  1. From Goods to Traffic:First Steps Toward an Auction-based Traffic Signal Controller

    OpenAIRE

    Raphael, Jeffery; Maskell, Simon; Sklar, Elizabeth Ida

    2015-01-01

    Traffic congestion is a major issue that plagues many urban road networks large and small. Traffic engineers are now leaning towards Intelligent Traffic Systems as many physical changes to road networks are costly or infeasible. Multi-Agent Systems (MAS) have become a popular paradigm for intelligent solutions to traffic management problems. There are many MAS approaches to traffic management that utilise market mechanisms. In market-based approaches, drivers “pay” to use the roadways. Howeve...

  2. Methods and Systems for Configuring Sensor Acquisition Based on Pressure Steps

    Science.gov (United States)

    DeDonato, Mathew (Inventor)

    2015-01-01

    Technologies are provided for underwater measurements. A system includes an underwater vessels including: a plurality of sensors disposed thereon for measuring underwater properties; and a programmable controller configured to selectively activate the plurality of sensors based at least in part on underwater pressure. A user may program at what pressure ranges certain sensors are activated to measure selected properties, and may also program the ascent/descent rate of the underwater vessel, which is correlated with the underwater pressure.

  3. Initial steps of the base excision repair pathway within the nuclear architecture

    International Nuclear Information System (INIS)

    Amouroux, R.

    2009-09-01

    Oxidative stress induced lesions threaten aerobic organisms by representing a major cause of genomic instability. A common product of guanine oxidation, 8-oxo-guanine (8- oxoG) is particularly mutagenic by provoking G to T transversions. Removal of oxidised bases from DNA is initiated by the recognition and excision of the damaged base by a DNA glycosylase, initiating the base excision repair (BER) pathway. In mammals, 8-oxoG is processed by the 8-oxoG-DNA-glycosylase I (OGG1), which biochemical mechanisms has been well characterised in vitro. However how and where this enzyme finds the modified base within the complex chromatin architecture is not yet understood. We show that upon induction of 8-oxoG, OGG1, together with at least two other proteins involved in BER, is recruited from a soluble fraction to chromatin. Formation kinetics of this patches correlates with 8-oxoG excision, suggesting a direct link between presence of this chromatin-associated complexes and 8-oxoG repair. More precisely, these repair patches are specifically directed to euchromatin regions, and completely excluded from heterochromatin regions. Inducing of artificial chromatin compaction results in a complete inhibition of the in vivo repair of 8-oxoG, probably by impeding the access of OGG1 to the lesion. Using OGG1 mutants, we show that OGG1 direct recognition of 8-oxoG did not trigger its re-localisation to the chromatin. We conclude that in response to the induction of oxidative DNA damage, the DNA glycosylase is actively recruited to regions of open chromatin allowing the access of the BER machinery to the lesions. (author)

  4. Design-Based Research in Science Education: One Step Towards Methodology

    Directory of Open Access Journals (Sweden)

    Kalle Juuti

    2012-10-01

    Full Text Available Recently, there has been critiques towards science education research, as the potential of this research has not been actualised in science teaching and learning praxis. The paper describes an analysis of a design-based research approach (DBR that has been suggested as a solution for the discontinuation between science education research and praxis. We propose that a pragmatic frame helps to clarify well the design-based research endeavour. We abstracted three aspects from the analysis that constitute design-based research: (a a design process is essentially iterative starting from the recognition of the change of the environment of praxis, (b it generates a widely usable artefact, (c and it provides educational knowledge for more intelligible praxis. In the knowledge acquisition process, the pragmatic viewpoint emphasises the role of a teacher’s reflected actions as well as the researches’ involvement in the authentic teaching and learning settings.

  5. Biocatalytic conversion of methane to methanol as a key step for development of methane-based biorefineries.

    Science.gov (United States)

    Hwang, In Yeub; Lee, Seung Hwan; Choi, Yoo Seong; Park, Si Jae; Na, Jeong Geol; Chang, In Seop; Kim, Choongik; Kim, Hyun Cheol; Kim, Yong Hwan; Lee, Jin Won; Lee, Eun Yeol

    2014-12-28

    Methane is considered as a next-generation carbon feedstock owing to the vast reserves of natural and shale gas. Methane can be converted to methanol by various methods, which in turn can be used as a starting chemical for the production of value-added chemicals using existing chemical conversion processes. Methane monooxygenase is the key enzyme that catalyzes the addition of oxygen to methane. Methanotrophic bacteria can transform methane to methanol by inhibiting methanol dehydrogenase. In this paper, we review the recent progress made on the biocatalytic conversion of methane to methanol as a key step for methane-based refinery systems and discuss future prospects for this technology.

  6. A One-Step-Ahead Smoothing-Based Joint Ensemble Kalman Filter for State-Parameter Estimation of Hydrological Models

    KAUST Repository

    El Gharamti, Mohamad

    2015-11-26

    The ensemble Kalman filter (EnKF) recursively integrates field data into simulation models to obtain a better characterization of the model’s state and parameters. These are generally estimated following a state-parameters joint augmentation strategy. In this study, we introduce a new smoothing-based joint EnKF scheme, in which we introduce a one-step-ahead smoothing of the state before updating the parameters. Numerical experiments are performed with a two-dimensional synthetic subsurface contaminant transport model. The improved performance of the proposed joint EnKF scheme compared to the standard joint EnKF compensates for the modest increase in the computational cost.

  7. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

    Science.gov (United States)

    Koh, Jansen

    2016-01-01

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  8. Web based health surveys: Using a Two Step Heckman model to examine their potential for population health analysis.

    Science.gov (United States)

    Morrissey, Karyn; Kinderman, Peter; Pontin, Eleanor; Tai, Sara; Schwannauer, Mathias

    2016-08-01

    In June 2011 the BBC Lab UK carried out a web-based survey on the causes of mental distress. The 'Stress Test' was launched on 'All in the Mind' a BBC Radio 4 programme and the test's URL was publicised on radio and TV broadcasts, and made available via BBC web pages and social media. Given the large amount of data created, over 32,800 participants, with corresponding diagnosis, demographic and socioeconomic characteristics; the dataset are potentially an important source of data for population based research on depression and anxiety. However, as respondents self-selected to participate in the online survey, the survey may comprise a non-random sample. It may be only individuals that listen to BBC Radio 4 and/or use their website that participated in the survey. In this instance using the Stress Test data for wider population based research may create sample selection bias. Focusing on the depression component of the Stress Test, this paper presents an easy-to-use method, the Two Step Probit Selection Model, to detect and statistically correct selection bias in the Stress Test. Using a Two Step Probit Selection Model; this paper did not find a statistically significant selection on unobserved factors for participants of the Stress Test. That is, survey participants who accessed and completed an online survey are not systematically different from non-participants on the variables of substantive interest. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  10. A truly international lunar base as the next logical step for human spaceflight

    Science.gov (United States)

    Bonneville, Richard

    Recent fora (e.g. the ISECG’s Global Exploration Roadmap) have highlighted a human mission to Mars as the long term goal for space exploration, with intermediate stages such as missions to the Moon and/or to asteroids. But actually a human mission to Mars will not be feasible before several decades, whereas in the meantime robotic missions will be able to provide an enormous amount of information on the history and the environment of the red planet, at a rather moderate cost. And if we consider missions to asteroids, introducing a human in the loop will require a considerably higher complexity and cost than using robots, with no significant additional benefit. The only sensible and feasible objective of a near-term human spaceflight program would be the edification of a lunar base, under the condition that this base is built as a true international venture. Science will not be the main driver; it has to be acknowledged from the beginning that the true main goal will be peace and a nucleus of international cooperation between the big countries. The ISS in the 1990’s had illustrated a calmed relation between the USA, together with Europe, Canada and Japan, and Russia. A lunar base should be the symbol of a similar calmed relation between the same partners and China. For the benefit of all humankind this extra continent, the Moon, will be used only for peaceful purposes, like Antarctica today, and will not become the theatre or the stake of conflicts. The financial cost of that venture will be high, but not that high if it is compared with the cost of recent wars; so let us go to the Moon, OK, but let us get there together.

  11. Unmixing-Based Denoising as a Pre-Processing Step for Coral Reef Analysis

    Science.gov (United States)

    Cerra, D.; Traganos, D.; Gege, P.; Reinartz, P.

    2017-05-01

    Coral reefs, among the world's most biodiverse and productive submerged habitats, have faced several mass bleaching events due to climate change during the past 35 years. In the course of this century, global warming and ocean acidification are expected to cause corals to become increasingly rare on reef systems. This will result in a sharp decrease in the biodiversity of reef communities and carbonate reef structures. Coral reefs may be mapped, characterized and monitored through remote sensing. Hyperspectral images in particular excel in being used in coral monitoring, being characterized by very rich spectral information, which results in a strong discrimination power to characterize a target of interest, and separate healthy corals from bleached ones. Being submerged habitats, coral reef systems are difficult to analyse in airborne or satellite images, as relevant information is conveyed in bands in the blue range which exhibit lower signal-to-noise ratio (SNR) with respect to other spectral ranges; furthermore, water is absorbing most of the incident solar radiation, further decreasing the SNR. Derivative features, which are important in coral analysis, result greatly affected by the resulting noise present in relevant spectral bands, justifying the need of new denoising techniques able to keep local spatial and spectral features. In this paper, Unmixing-based Denoising (UBD) is used to enable analysis of a hyperspectral image acquired over a coral reef system in the Red Sea based on derivative features. UBD reconstructs pixelwise a dataset with reduced noise effects, by forcing each spectrum to a linear combination of other reference spectra, exploiting the high dimensionality of hyperspectral datasets. Results show clear enhancements with respect to traditional denoising methods based on spatial and spectral smoothing, facilitating the coral detection task.

  12. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    Science.gov (United States)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  13. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

    Science.gov (United States)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

    2018-01-01

    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  14. A versatile one-step CRISPR-Cas9 based approach to plasmid-curing

    DEFF Research Database (Denmark)

    Lauritsen, Ida; Porse, Andreas; Sommer, Morten Otto Alexander

    2017-01-01

    tool enabling rapid removal of plasmids from bacterial cells is lacking. Results Based on replicon abundance and sequence conservation analysis, we show that the vast majority of bacterial cloning and expression vectors share sequence similarities that allow for broad CRISPR-Cas9 targeting. We have...... widely used for expression and engineering purposes. By virtue of the CRISPR-Cas9 targeting, our platform is highly expandable and can be applied in a broad host context. We exemplify the wide applicability of our system in Gram-negative bacteria by demonstrating the successful application in both...

  15. Achieving the Desired Transformation: Thoughts on Next Steps for Outcomes-Based Medical Education.

    Science.gov (United States)

    Holmboe, Eric S; Batalden, Paul

    2015-09-01

    Since the introduction of the outcomes-based medical education (OBME) movement, progress toward implementation has been active but challenging. Much of the angst and criticism has been directed at the approaches to assessment that are associated with outcomes-based or competency frameworks, particularly defining the outcomes. In addition, these changes to graduate medical education (GME) are concomitant with major change in health care systems--specifically, changes to increase quality and safety while reducing cost. Every sector, from medical education to health care delivery and financing, is in the midst of substantial change and disruption.The recent release of the Institute of Medicine's report on the financing and governance of GME highlights the urgent need to accelerate the transformation of medical education. One source of continued tension within the medical education community arises from the assumption that the much-needed increases in value and improvement in health care can be achieved by holding the current educational structures and architecture of learning in place while concomitantly withdrawing resources. The authors of this Perspective seek to reframe the important and necessary debate surrounding the current challenges to implementing OBME. Building on recent change and service theories (e.g., Theory U and coproduction), they propose several areas of redirection, including reexamination of curricular models and greater involvement of learners, teachers, and regulators in cocreating new training models, to help facilitate the desired transformation in medical education.

  16. Deconstructing Chronic Low Back Pain in the Older Adult-Step by Step Evidence and Expert-Based Recommendations for Evaluation and Treatment. Part VI: Lumbar Spinal Stenosis.

    Science.gov (United States)

    Fritz, Julie M; Rundell, Sean D; Dougherty, Paul; Gentili, Angela; Kochersberger, Gary; Morone, Natalia E; Naga Raja, Srinivasa; Rodriguez, Eric; Rossi, Michelle I; Shega, Joseph; Sowa, Gwendolyn; Weiner, Debra K

    2016-03-01

    . To present the sixth in a series of articles designed to deconstruct chronic low back pain (CLBP) in older adults. This article focuses on the evaluation and management of lumbar spinal stenosis (LSS), the most common condition for which older adults undergo spinal surgery. . The evaluation and treatment algorithm, a table articulating the rationale for the individual algorithm components, and stepped-care drug recommendations were developed using a modified Delphi approach. The Principal Investigator, a five-member content expert panel and a nine-member primary care panel were involved in the iterative development of these materials. The illustrative clinical case was taken from the clinical practice of a contributor's colleague (SR). . We present an algorithm and supportive materials to help guide the care of older adults with LSS, a condition that occurs not uncommonly in those with CLBP. The case illustrates the importance of function-focused management and a rational approach to conservative care. . Lumbar spinal stenosis exists not uncommonly in older adults with CLBP and management often can be accomplished without surgery. Treatment should address all conditions in addition to LSS contributing to pain and disability. © 2016 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Prevalence and correlates of diabetes mellitus in Malawi: population-based national NCD STEPS survey.

    Science.gov (United States)

    Msyamboza, Kelias Phiri; Mvula, Chimwemwe J; Kathyola, Damson

    2014-05-12

    Previously considered as a disease of the affluent, west or urban people and not of public health importance, diabetes mellitus is increasingly becoming a significant cause of morbidity and mortality in sub-Saharan Africa. However, population-based data to inform prevention, treatment and control are lacking. Using the WHO STEPwise approach to chronic disease risk factor surveillance, a population-based, nationwide cross-sectional survey was conducted between July and September 2009 on participants aged 25-64 years. A multi-stage cluster sample design and weighting were used to produce a national representative data for that age range. Detailed findings on the magnitude of diabetes mellitus and impaired fasting blood glucose are presented in this paper. Fasting blood glucose measurement was conducted on 3056 participants (70.2% females, 87.9% from rural areas). The age- sex standardised population-based mean fasting blood glucose was 4.3 mmol/L (95% CI 4.1-4.4 mmol/L) with no significant differences by age, sex and location (urban/rural). The overall prevalence of impaired fasting blood glucose was 4.2% (95% CI 3.0%-5.4%). Prevalence of impaired blood glucose was higher in men than in women, 5.7% (95% CI 3.9%-7.5%) vs 2.7% (95% CI 1.6%- 3.8%), p prevalence of raised fasting blood glucose or currently on medication for diabetes was 5.6% (95% CI 2.6%- 8.5%). Although the prevalence of diabetes was higher in men than women, 6.5% (95% CI 2.6%-10.3%) vs 4.7% (95% CI 2.4%-7.0%), in rural than urban, 5.4% (95% CI 2.4%-8.4%) vs 4.4% (95% CI 2.8%-5.9%) and in males in rural than males in urban, 6.9% (95% CI 2.8%-11.0%) vs 3.2% (95% CI 0.1%-6.3%), the differences were not statistically significant, p > 0.05. Compared to previous estimates, prevalence of diabetes increased from prevalence of impaired fasting blood glucose and diabetes mellitus call for the implementation of primary healthcare approaches such as the WHO package for essential non-communicable diseases

  18. LISA Pathfinder: An important first step towards a space-based gravitational wave observatory

    Science.gov (United States)

    Thorpe, James

    2017-08-01

    ESA's LISA Pathfinder mission was launched on Dec 3rd, 2015 and completed earlier this Summer. During this relatively short mission, Pathfinder at its two science payloads, Europe's LISA Technology Package and NASA's Disturbance Reduction System, demonstrated several techniques and technologies that enable development of a future space-based gravitational wave observatory. Most notably, Pathfinder demonstrated that the technique of drag-free flight could be utilized to place a test mass in near-perfect free-fall, with residual accelerations at the femto-g level in the milliHertz band. Additionally, technologies such as precision bonded optical structures for metrology, micropropulsion systems, and non-contact charge control, were successfully tested, retiring risk for LISA. In this talk, I will present an overview of Pathfinder's results to date and some perspective on how this success will be leveraged into realizing LISA.

  19. One step shift towards flexible supercapacitors based on carbon nanotubes - A review

    Energy Technology Data Exchange (ETDEWEB)

    Yar, A., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Dennis, J. O., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Mohamed, N. M., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Mumtaz, A., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com; Irshad, M. I., E-mail: asfandyarhargan@gmail.com, E-mail: johndennis@petronas.com.my, E-mail: noranimuti-mohamed@petronas.com.my, E-mail: asad-032@yahoo.com, E-mail: imrancssp@gmail.com [Department of Fundamental and Applied Sciences, Universiti Teknologi PETRONAS (Malaysia); Ahmad, F., E-mail: ahmad-1234farooq@yahoo.com [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS (Malaysia)

    2014-10-24

    Supercapacitors have emerged as prominent energy storage devices that offer high energy density compared to conventional capacitors and high power density which is not found in batteries. Carbon nanotubes (CNTs) because of their high surface area and tremendous electrical properties are used as electrode material for supercapacitors. In this review we focused on the factors like surface area, role of the electrolyte and techniques adopted to improve performance of CNTs based supercapacitors. The supercapacitors are widely tested in liquid electrolytes which are normally hazardous in nature, toxic, flammable and their leakage has safety concerns. This review also focuses on research which is replacing these unsafe electrolytes by solid electrolytes with the combination of low cost CNTs deposited flexible supports for supercapacitors.

  20. One step shift towards flexible supercapacitors based on carbon nanotubes - A review

    Science.gov (United States)

    Yar, A.; Dennis, J. O.; Mohamed, N. M.; Mumtaz, A.; Irshad, M. I.; Ahmad, F.

    2014-10-01

    Supercapacitors have emerged as prominent energy storage devices that offer high energy density compared to conventional capacitors and high power density which is not found in batteries. Carbon nanotubes (CNTs) because of their high surface area and tremendous electrical properties are used as electrode material for supercapacitors. In this review we focused on the factors like surface area, role of the electrolyte and techniques adopted to improve performance of CNTs based supercapacitors. The supercapacitors are widely tested in liquid electrolytes which are normally hazardous in nature, toxic, flammable and their leakage has safety concerns. This review also focuses on research which is replacing these unsafe electrolytes by solid electrolytes with the combination of low cost CNTs deposited flexible supports for supercapacitors.

  1. Double side multicrystalline silicon passivation by one step stain etching-based porous silicon

    Energy Technology Data Exchange (ETDEWEB)

    Mohamed, Seifeddine Belhadj; Ben Rabha, Mohamed; Bessais, Brahim [Laboratoire de Photovoltaique, Centre de Recherches et des Technologies de l' Energie, Technopole de Borj-Cedria, BP 95, 2050 Hammam-Lif (Tunisia)

    2012-10-15

    In this paper, we investigate the effect of stain etching-based porous silicon on the double side multicrystalline silicon. Special attention is given to the use of the stain etched PS as an antireflection coating as well as for surface passivating capabilities. Stain etching of double side multicrystalline silicon leads to the formation of PS nanostructures, that dramatically decrease the surface reflectivity from 30% to about 7% and increase the effective lifetime from 1 {mu}s to 10 {mu}s at a minority carrier density ({Delta}n) of 10{sup 15} cm{sup -3}. These results let us correlate the rise of the lifetime values to the photoluminescence intensity to the hydrogen and oxide passivation as shown by FTIR analysis. This low-cost PS formation process can be applied in the photovoltaic cell technology as a standard procedure (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  2. A three-step reconstruction method for fluorescence molecular tomography based on compressive sensing

    DEFF Research Database (Denmark)

    Zhu, Yansong; Jha, Abhinav K.; Dreyer, Jakob K.

    2017-01-01

    Fluorescence molecular tomography (FMT) is a promising tool for real time in vivo quantification of neurotransmission (NT) as we pursue in our BRAIN initiative effort. However, the acquired image data are noisy and the reconstruction problem is ill-posed. Further, while spatial sparsity of the NT...... matrix coherence. The resultant image data are input to a homotopy-based reconstruction strategy that exploits sparsity via ℓ1 regularization. The reconstructed image is then input to a maximum-likelihood expectation maximization (MLEM) algorithm that retains the sparseness of the input estimate...... and improves upon the quantitation by accurate Poisson noise modeling. The proposed reconstruction method was evaluated in a three-dimensional simulated setup with fluorescent sources in a cuboidal scattering medium with optical properties simulating human brain cortex (reduced scattering coefficient: 9.2 cm-1...

  3. One step shift towards flexible supercapacitors based on carbon nanotubes - A review

    International Nuclear Information System (INIS)

    Yar, A.; Dennis, J. O.; Mohamed, N. M.; Mumtaz, A.; Irshad, M. I.; Ahmad, F.

    2014-01-01

    Supercapacitors have emerged as prominent energy storage devices that offer high energy density compared to conventional capacitors and high power density which is not found in batteries. Carbon nanotubes (CNTs) because of their high surface area and tremendous electrical properties are used as electrode material for supercapacitors. In this review we focused on the factors like surface area, role of the electrolyte and techniques adopted to improve performance of CNTs based supercapacitors. The supercapacitors are widely tested in liquid electrolytes which are normally hazardous in nature, toxic, flammable and their leakage has safety concerns. This review also focuses on research which is replacing these unsafe electrolytes by solid electrolytes with the combination of low cost CNTs deposited flexible supports for supercapacitors

  4. [Mechanism of treatment effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats based on metabolomic approach].

    Science.gov (United States)

    Cao, Hui-Ting; Zhu, Hua-Xu; Zhang, Qi-Chun; Guo, Li-Wei

    2017-06-01

    The metabolic effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats was studied by using metabolomic method. The rat model of ischemia reperfusion injury induced by introduction of transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Ultra high performance liquid chromatography-series four pole time of flight mass spectrometry method(UPLC-Q-TOF/MS), Markerlynx software, and principal component analysis and partial least-squares discriminant analysis were used to analyze the different endogenous metabolites among the urine samples of sham rats, cerebral ischemia model rats, Huanglian groups (HL), Huangqin groups (HQ) and Huanglian-Huangqin herb pairs groups (LQ) was achieved, combined with accurate information about the endogenous metabolites level and secondary fragment ions, retrieval and identification of possible biological markers, metabolic pathway which build in MetPA database. The 20 potential biomarkers were found in the urine of rats with cerebral ischemia, which mainly involved in the neurotransmitter regulation, amino acid metabolism, energy metabolism, lipid metabolism and so on. Those metabolic pathways were disturbed in cerebral ischemia model rats, the principal component analysis showed that the normal and cerebral ischemia model is clearly distinguished, and the compound can be given to the normal state of change after HL, HQ, LQ administration. This study index the interpretation of cerebral ischemia rat metabolism group and mechanism, the embodiment of metabonomics can reflect the physiological and metabolic state, which can better reflect the traditional Chinese medicine as a whole view, system view and the features of multi ingredient synergistic or antagonistic effects. Copyright© by the Chinese Pharmaceutical Association.

  5. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  6. GNSS troposphere tomography based on two-step reconstructions using GPS observations and COSMIC profiles

    Directory of Open Access Journals (Sweden)

    P. Xia

    2013-10-01

    Full Text Available Traditionally, balloon-based radiosonde soundings are used to study the spatial distribution of atmospheric water vapour. However, this approach cannot be frequently employed due to its high cost. In contrast, GPS tomography technique can obtain water vapour in a high temporal resolution. In the tomography technique, an iterative or non-iterative reconstruction algorithm is usually utilised to overcome rank deficiency of observation equations for water vapour inversion. However, the single iterative or non-iterative reconstruction algorithm has their limitations. For instance, the iterative reconstruction algorithm requires accurate initial values of water vapour while the non-iterative reconstruction algorithm needs proper constraint conditions. To overcome these drawbacks, we present a combined iterative and non-iterative reconstruction approach for the three-dimensional (3-D water vapour inversion using GPS observations and COSMIC profiles. In this approach, the non-iterative reconstruction algorithm is first used to estimate water vapour density based on a priori water vapour information derived from COSMIC radio occultation data. The estimates are then employed as initial values in the iterative reconstruction algorithm. The largest advantage of this approach is that precise initial values of water vapour density that are essential in the iterative reconstruction algorithm can be obtained. This combined reconstruction algorithm (CRA is evaluated using 10-day GPS observations in Hong Kong and COSMIC profiles. The test results indicate that the water vapor accuracy from CRA is 16 and 14% higher than that of iterative and non-iterative reconstruction approaches, respectively. In addition, the tomography results obtained from the CRA are further validated using radiosonde data. Results indicate that water vapour densities derived from the CRA agree with radiosonde results very well at altitudes above 2.5 km. The average RMS value of their

  7. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  8. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  9. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  10. Comparative Study of One-Step Cross-Linked Electrospun Chitosan-Based Membranes

    Directory of Open Access Journals (Sweden)

    Yanet E. Aguirre-Chagala

    2017-01-01

    Full Text Available Chitosan membranes are widely applied for tissue engineering; however, a major drawback is their low resistance in aqueous phases and therefore the structure collapses impeding their long-term use. Although there is extensive research, because of chitosan’s importance as a biomaterial, studies involving chitosan-based membranes are still needed. Herein, a detailed investigation of diverse chemical routes to cross-link fibers in situ by electrospinning process is described. In case of using genipin as cross-linker, a close relationship with the content and the mean diameter values is reported, suggesting a crucial effect over the design of nanostructures. Also, the physical resistance is enhanced for the combination of two types of methods, such as chemical and physical methods. Cross-linked fibers upon exposure to long wave ultraviolet A (UVA light change their morphology, but not their chemical composition. When they are incubated in aqueous phase for 70 days, they show an extensive improvement of their macrostructural integrity which makes them attractive candidates for tissue engineering application. As a result, the thermal properties of these materials reveal less crystallinity and higher temperature of degradation.

  11. Baby steps: The expanding financial base of local government in Ireland

    Directory of Open Access Journals (Sweden)

    Considine John

    2015-08-01

    Full Text Available There are two essential elements to this paper. In the first instance, we explore the specific details of revenue and expenditure trends for local authorities over the last decade. The analysis is framed against a longer-term political context of forty years which focuses especially on the weakness of local government in Ireland. Despite an official narrative of financial overdependence on central government, the comparative examination of budgetary records of local authorities reveals considerable diversity in both the revenue and expenditure patterns of authorities across the state. While some authorities are heavily reliant on central government funding, others have a much stronger base of local funding, and indeed the financial crisis since 2008 may have increased these differences. The second dimension to the research is an exploration of the impact of the great recession from 2008 on local government finance in Ireland. Using a framework of new institutionalism, we identify the crisis as another critical moment for local government. We consider the political, economic and administrative variables which have brought local government to a financial crossroads, and we explore the potential for long-lasting financial change in local government, as well as speculating on the nature and outcome of that change.

  12. A Trajectory Correction based on Multi-Step Lining-up for the CLIC Main Linac

    CERN Document Server

    D'Amico, T E

    1999-01-01

    In the CLIC main linac it is very important to minimise the trajectory excursion and consequently the emittance dilution in order to obtain the required luminosity. Several algorithms have been proposed and lately the ballistic method has proved to be very effective. The trajectory method described in this Note retains the main advantages of the latter while adding some interesting features. It is based on the separation of the unknown variables like the quadrupole misalignments, the offset and slope of the injection straight line and the misalignments of the beam position monitors (BPM). This is achieved by referring the trajectory relatively to the injection line and not to the average pre-alignment line and by using two trajectories each corresponding to slightly different quadrupole strengths. A reference straight line is then derived onto which the beam is bent by a kick obtained by moving the first quadrupole. The other quadrupoles are then aligned on that line. The quality of the correction depends mai...

  13. Marginal microleakage of class V resin-based composite restorations bonded with six one-step self-etch systems

    Directory of Open Access Journals (Sweden)

    Alfonso Sánchez-Ayala

    2013-06-01

    Full Text Available This study compared the microleakage of class V restorations bonded with various one-step self-etching adhesives. Seventy class V resin-based composite restorations were prepared on the buccal and lingual surfaces of 35 premolars, by using: Clearfil S 3 Bond, G-Bond, iBond, One Coat 7.0, OptiBond All-In-One, or Xeno IV. The Adper Single Bond etch-and-rinse two-step adhesive was employed as a control. Specimens were thermocycled for 500 cycles in separate water baths at 5°C and 55°C and loaded under 40 to 70 N for 50,000 cycles. Marginal microleakage was measured based on the penetration of a tracer agent. Although the control showed no microleakage at the enamel margins, there were no differences between groups (p = 0.06. None of the adhesives avoided microleakage at the dentin margins, and they displayed similar performances (p = 0.76. When both margins were compared, iBond® presented higher microleakage (p < 0.05 at the enamel margins (median, 1.00; Q3–Q1, 1.25–0.00 compared to the dentin margins (median, 0.00; Q3–Q1, 0.25–0.00. The study adhesives showed similar abilities to seal the margins of class V restorations, except for iBond®, which presented lower performance at the enamel margin.

  14. Abundance and composition of indigenous bacterial communities in a multi-step biofiltration-based drinking water treatment plant.

    Science.gov (United States)

    Lautenschlager, Karin; Hwang, Chiachi; Ling, Fangqiong; Liu, Wen-Tso; Boon, Nico; Köster, Oliver; Egli, Thomas; Hammes, Frederik

    2014-10-01

    Indigenous bacterial communities are essential for biofiltration processes in drinking water treatment systems. In this study, we examined the microbial community composition and abundance of three different biofilter types (rapid sand, granular activated carbon, and slow sand filters) and their respective effluents in a full-scale, multi-step treatment plant (Zürich, CH). Detailed analysis of organic carbon degradation underpinned biodegradation as the primary function of the biofilter biomass. The biomass was present in concentrations ranging between 2-5 × 10(15) cells/m(3) in all filters but was phylogenetically, enzymatically and metabolically diverse. Based on 16S rRNA gene-based 454 pyrosequencing analysis for microbial community composition, similar microbial taxa (predominantly Proteobacteria, Planctomycetes, Acidobacteria, Bacteriodetes, Nitrospira and Chloroflexi) were present in all biofilters and in their respective effluents, but the ratio of microbial taxa was different in each filter type. This change was also reflected in the cluster analysis, which revealed a change of 50-60% in microbial community composition between the different filter types. This study documents the direct influence of the filter biomass on the microbial community composition of the final drinking water, particularly when the water is distributed without post-disinfection. The results provide new insights on the complexity of indigenous bacteria colonizing drinking water systems, especially in different biofilters of a multi-step treatment plant. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. First Steps Toward K-12 Teacher Professional Development Using Internet-based Telescopes

    Science.gov (United States)

    Berryhill, K. J.; Gershun, D.; Slater, T. F.; Armstrong, J. D.

    2012-12-01

    How can science teachers become more familiar with emerging technology, excite their students and give students a taste of astronomy research? Astronomy teachers do not always have research experience, so it is difficult for them to convey to students how researchers use telescopes. The nature of astronomical observation (e.g., remote sites, expensive equipment, and odd hours) has been a barrier to providing teachers with insight into the process. Robotic telescopes (operated automatically with queued observing schedules) and remotely controlled telescopes (controlled by the user via the Internet) allow scientists to conduct observing sessions on research-grade telescopes half a world away. The same technology can now be harnessed by STEM educators to engage students and reinforce what is being taught in the classroom, as seen in some early research in elementary schools (McKinnon and Mainwaring 2000 and McKinnon and Geissinger 2002), and middle/high schools (Sadler et al. 2001, 2007 and Gehret et al. 2005). However, teachers need to be trained to use these resources. Responding to this need, graduate students and faculty at the University of Wyoming and CAPER Center for Astronomy & Physics Education Research are developing teacher professional development programs using Internet-based telescopes. We conducted an online course in the science education graduate program at the University of Wyoming. This course was designed to sample different types of Internet-based telescopes to evaluate them as resources for teacher professional development. The 10 participants were surveyed at the end of the course to assess their experiences with each activity. In addition, pre-test/post-test data were collected focusing specifically on one of the telescopes (Gershun, Berryhill and Slater 2012). Throughout the course, the participants learned to use a variety of robotic and remote telescopes including SLOOH Space Camera (www.slooh.com), Sky Titan Observatory (www

  16. The Healthy Steps Study: A randomized controlled trial of a pedometer-based Green Prescription for older adults. Trial protocol

    Directory of Open Access Journals (Sweden)

    Schluter Philip J

    2009-11-01

    Full Text Available Abstract Background Graded health benefits of physical activity have been demonstrated for the reduction of coronary heart disease, some cancers, and type-2 diabetes, and for injury reduction and improvements in mental health. Older adults are particularly at risk of physical inactivity, and would greatly benefit from successful targeted physical activity interventions. Methods/Design The Healthy Steps study is a 12-month randomized controlled trial comparing the efficacy of a pedometer-based Green Prescription with the conventional time-based Green Prescription in increasing and maintaining physical activity levels in low-active adults over 65 years of age. The Green Prescription interventions involve a primary care physical activity prescription with 3 follow-up telephone counselling sessions delivered by trained physical activity counsellors over 3 months. Those in the pedometer group received a pedometer and counselling based around increasing steps that can be monitored on the pedometer, while those in the standard Green Prescription group received counselling using time-based goals. Baseline, 3 month (end of intervention, and 12 month measures were assessed in face-to-face home visits with outcomes measures being physical activity (Auckland Heart Study Physical Activity Questionnaire, quality of life (SF-36 and EQ-5D, depressive symptoms (Geriatric Depression Scale, blood pressure, weight status, functional status (gait speed, chair stands, and tandem balance test and falls and adverse events (self-report. Utilisation of health services was assessed for the economic evaluation carried out alongside this trial. As well, a process evaluation of the interventions and an examination of barriers and motives for physical activity in the sample were conducted. The perceptions of primary care physicians in relation to delivering physical activity counselling were also assessed. Discussion The findings from the Healthy Steps trial are due in late

  17. Modified Three-Step Search Block Matching Motion Estimation and Weighted Finite Automata based Fractal Video Compression

    Directory of Open Access Journals (Sweden)

    Shailesh Kamble

    2017-08-01

    Full Text Available The major challenge with fractal image/video coding technique is that, it requires more encoding time. Therefore, how to reduce the encoding time is the research component remains in the fractal coding. Block matching motion estimation algorithms are used, to reduce the computations performed in the process of encoding. The objective of the proposed work is to develop an approach for video coding using modified three step search (MTSS block matching algorithm and weighted finite automata (WFA coding with a specific focus on reducing the encoding time. The MTSS block matching algorithm are used for computing motion vectors between the two frames i.e. displacement of pixels and WFA is used for the coding as it behaves like the Fractal Coding (FC. WFA represents an image (frame or motion compensated prediction error based on the idea of fractal that the image has self-similarity in itself. The self-similarity is sought from the symmetry of an image, so the encoding algorithm divides an image into multi-levels of quad-tree segmentations and creates an automaton from the sub-images. The proposed MTSS block matching algorithm is based on the combination of rectangular and hexagonal search pattern and compared with the existing New Three-Step Search (NTSS, Three-Step Search (TSS, and Efficient Three-Step Search (ETSS block matching estimation algorithm. The performance of the proposed MTSS block matching algorithm is evaluated on the basis of performance evaluation parameters i.e. mean absolute difference (MAD and average search points required per frame. Mean of absolute difference (MAD distortion function is used as the block distortion measure (BDM. Finally, developed approaches namely, MTSS and WFA, MTSS and FC, and Plane FC (applied on every frame are compared with each other. The experimentations are carried out on the standard uncompressed video databases, namely, akiyo, bus, mobile, suzie, traffic, football, soccer, ice etc. Developed

  18. One Step Forward--Half a Step Back: A Status Report on Bias-Based Bullying of Asian American Students in New York City Schools

    Science.gov (United States)

    Asian American Legal Defense and Education Fund, 2013

    2013-01-01

    In September 2008, Mayor Michael Bloomberg and former Schools Chancellor, Joel Klein announced Chancellor's Regulation A-832, which established policies and procedures on how New York City schools should respond to bias-based harassment, intimidation, and bullying in schools. The Asian American Legal Defense and Education Fund (AALDEF), the Sikh…

  19. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

    2014-01-01

    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  20. Waste-based alternative adsorbents for the remediation of pharmaceutical contaminated waters: Has a step forward already been taken?

    Science.gov (United States)

    Silva, Carla Patrícia; Jaria, Guilaine; Otero, Marta; Esteves, Valdemar I; Calisto, Vânia

    2018-02-01

    When adsorption is considered for water treatment, commercial activated carbon is usually the chosen adsorbent for the removal of pollutants from the aqueous phase, particularly pharmaceuticals. In order to decrease costs and save natural resources, attempts have been made to use wastes as raw materials for the production of alternative carbon adsorbents. This approach intends to increase efficiency, cost-effectiveness, and also to propose an alternative and sustainable way for the valorization/management of residues. This review aims to provide an overview on waste-based adsorbents used on pharmaceuticals' adsorption. Experimental facts related to the adsorption behaviour of each adsorbent/pharmaceutical pair and some key factors were addressed. Also, research gaps that subsist in this research area, as well as future needs, were identified. Simultaneously, this review aims to clarify the current status of the research on pharmaceuticals' adsorption by waste-based adsorbents in order to recognize if the right direction is being taken. Copyright © 2017 Elsevier Ltd. All rights reserved.