WorldWideScience

Sample records for base pair deletion

  1. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  2. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  3. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  4. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  5. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  6. Mapping genomic deletions down to the base

    DEFF Research Database (Denmark)

    Dunø, Morten; Hove, Hanne; Kirchhoff, Maria

    2004-01-01

    the breakpoint of the third patient was mapped to a region previously predicted to be prone for rearrangements. One patient also harboured an inversion in connection with the deletion that disrupted the HDAC9 gene. All three patients showed clinical characteristics reminiscent of the hand-foot-genital syndrome...

  7. Whole exome sequencing identified 1 base pair novel deletion in BCL2-associated athanogene 3 (BAG3) gene associated with severe dilated cardiomyopathy (DCM) requiring heart transplant in multiple family members.

    Science.gov (United States)

    Rafiq, Muhammad Arshad; Chaudhry, Ayeshah; Care, Melanie; Spears, Danna A; Morel, Chantal F; Hamilton, Robert M

    2017-03-01

    Dilated cardiomyopathy (DCM) is characterized by dilation and impaired contraction of the left ventricle or both ventricles. Among hereditary DCM, the genetic causes are heterogeneous, and include mutations encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. We report three severely affected males, in a four-generation pedigree, with DCM phenotype who underwent cardiac transplant. Cardiomegaly with marked biventricular dilation and fibrosis were noticeable histopathological findings. The affected males had tested negative on a 46-gene pancardiomyopathy panel. Whole Exome Sequencing (WES) was performed to reveal mutation in the gene responsible in generation of DCM phenotypes. The 1-bp (Chr10:121435979delC; c.913delC) novel heterozygous deletion in exon 4 of BAG3, was identified in three affected males, resulted in frame-shift and a premature termination codon (p.Met306-Stop) producing a truncated BAG3 protein lacking functionally important PXXP and BAG domains. WES data were further utilized to map 10 SNP markers around the discovered mutation to generate shared disease haplotype in all affected individuals encompassing 11 Mb on 10q25.3-26.2 harboring BAG3. Finally genotypes were inferred for the unavailable/deceased individuals in the pedigrees. Here we propose that Chr10:121435979delC in BAG3 is a causal mutation in these subjects. Our and earlier studies indicate that BAG3 mutations are associated with DCM phenotypes. BAG3 should be added to cardiomyopathy gene panels for screening of DCM patients, and patients previously considered gene elusive should undergo sequencing of the BAG3 gene. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  9. Ku80-deleted cells are defective at base excision repair

    International Nuclear Information System (INIS)

    Li, Han; Marple, Teresa; Hasty, Paul

    2013-01-01

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H 2 O 2 and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs

  10. Ku80-deleted cells are defective at base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Li, Han [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain); Marple, Teresa [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain)

    2013-05-15

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H{sub 2}O{sub 2} and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs.

  11. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  12. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  13. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  14. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  15. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  16. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  17. Detection of three-base deletion by exciplex formation with perylene derivatives.

    Science.gov (United States)

    Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki

    2011-06-14

    Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011

  18. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  19. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  20. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  1. Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

    Directory of Open Access Journals (Sweden)

    Kozmin Stanislav G

    2005-06-01

    Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

  2. Microarray-based ultra-high resolution discovery of genomic deletion mutations

    Science.gov (United States)

    2014-01-01

    Background Oligonucleotide microarray-based comparative genomic hybridization (CGH) offers an attractive possible route for the rapid and cost-effective genome-wide discovery of deletion mutations. CGH typically involves comparison of the hybridization intensities of genomic DNA samples with microarray chip representations of entire genomes, and has widespread potential application in experimental research and medical diagnostics. However, the power to detect small deletions is low. Results Here we use a graduated series of Arabidopsis thaliana genomic deletion mutations (of sizes ranging from 4 bp to ~5 kb) to optimize CGH-based genomic deletion detection. We show that the power to detect smaller deletions (4, 28 and 104 bp) depends upon oligonucleotide density (essentially the number of genome-representative oligonucleotides on the microarray chip), and determine the oligonucleotide spacings necessary to guarantee detection of deletions of specified size. Conclusions Our findings will enhance a wide range of research and clinical applications, and in particular will aid in the discovery of genomic deletions in the absence of a priori knowledge of their existence. PMID:24655320

  3. Dual entanglement measures based on no local cloning and no local deleting

    International Nuclear Information System (INIS)

    Horodecki, Michal; Sen, Aditi; Sen, Ujjwal

    2004-01-01

    The impossibility of cloning and deleting of unknown states constitute important restrictions on processing of information in the quantum world. On the other hand, a known quantum state can always be cloned or deleted. However, if we restrict the class of allowed operations, there will arise restrictions on the ability of cloning and deleting machines. We have shown that cloning and deleting of known states is in general not possible by local operations. This impossibility hints at quantum correlation in the state. We propose dual measures of quantum correlation based on the dual restrictions of no local cloning and no local deleting. The measures are relative entropy distances of the desired states in a (generally impossible) perfect local cloning or local deleting process from the best approximate state that is actually obtained by imperfect local cloning or deleting machines. Just like the dual measures of entanglement cost and distillable entanglement, the proposed measures are based on important processes in quantum information. We discuss their properties. For the case of pure states, estimations of these two measures are also provided. Interestingly, the entanglement of cloning for a maximally entangled state of two two-level systems is not unity

  4. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  5. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  6. Waardenburg syndrome type 3 (Klein-Waardenburg syndrome) segregating with a heterozygous deletion in the paired box domain of PAX3: a simple variant or a true syndrome?

    Science.gov (United States)

    Tekin, M; Bodurtha, J N; Nance, W E; Pandya, A

    2001-10-01

    Klein-Waardenburg syndrome or Waardenburg syndrome type 3 (WS-III; MIM 148820) is characterized by the presence of musculoskeletal abnormalities in association with clinical features of Waardenburg syndrome type 1 (WS-I). Since the description of the first patient in 1947 (D. Klein, Arch Klaus Stift Vererb Forsch 1947: 22: 336-342), a few cases have been reported. Only occasional families have demonstrated autosomal-dominant inheritance of WS-III. In a previous report, a missense mutation in the paired domain of the PAX3 gene has been described in a family with dominant segregation of WS-III. In this report, we present a second family (mother and son) with typical clinical findings of WS-III segregating with a heterozygous 13-bp deletion in the paired domain of the PAX3 gene. Although homozygosity or compound heterozygosity has also been documented in patients with severe limb involvement, a consistent genotype-phenotype correlation for limb abnormalities associated with heterozygous PAX3 mutations has not previously been apparent. Heterozygous mutations could either reflect a unique dominant-negative effect or possibly the contribution of other unlinked genetic modifiers in determining the phenotype.

  7. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  8. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae

    Science.gov (United States)

    2011-09-20

    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  9. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  10. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  11. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  12. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  13. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  14. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  15. Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

    Science.gov (United States)

    Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

    2014-12-01

    The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutations in mammalian cells

    International Nuclear Information System (INIS)

    Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.

    1988-01-01

    The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage

  17. Enhanced genome editing tools for multi-gene deletion knock-out approaches using paired CRISPR sgRNAs in CHO cells

    DEFF Research Database (Denmark)

    Schmieder, Valerie; Bydlinski, Nina; Strasser, Richard

    2017-01-01

    (sgRNAs) for full gene deletions. This strategy also enables the targeting of regulatory regions, which would not respond to the conventional frameshift mutations, as shown by deleting the α-1,6-Fucosyltransferase 8 (FUT8) promoter resulting in a functional knock-out. Fut8 also served as model...

  18. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  19. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  20. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  1. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  2. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  3. Development of Insertion and Deletion Markers based on Biparental Resequencing for Fine Mapping Seed Weight in Soybean

    Directory of Open Access Journals (Sweden)

    Ying-hui Li

    2014-11-01

    Full Text Available As a complement to single nucleotide polymorphisms (SNPs and simple sequence repeats (SSRs, biallelic insertions and deletions (InDels represent powerful molecular markers with desirable features for filling the gap in current genetic linkage maps. In this study, 28,908 small InDel polymorphisms (1–5 base pair, bp distributed genome-wide were identified and annotated by comparison of a whole-genome resequencing data set from two soybean [ (L. Merr.] genotypes, cultivar Zhonghunag13 (ZH and line Zhongpin03-5373 (ZP. The physical distribution of InDel polymorphisms in soybean genome was uneven, and matched closely with the distribution of previously annotated genes. The average density of InDel in the arm region was significantly higher than that in the pericentromeric region. The genomic regions that were fixed between the two elites were elucidated. With this information, five InDel markers within a putative quantitative trait locus (QTL for seed weight (SW, , were developed and used to genotype 254 recombinant inbred lines (RILs derived from the cross of ZP × ZH. Adding these five InDel markers to previously used SNP and SSR markers facilitated the discovery of further recombination events allowing fine-mapping the QTL to a 0.5 Mbp region. Our study clearly underlines the high value of InDel markers for map-based cloning and marker-assisted selection in soybean.

  4. Efficiently Hiding Sensitive Itemsets with Transaction Deletion Based on Genetic Algorithms

    Directory of Open Access Journals (Sweden)

    Chun-Wei Lin

    2014-01-01

    Full Text Available Data mining is used to mine meaningful and useful information or knowledge from a very large database. Some secure or private information can be discovered by data mining techniques, thus resulting in an inherent risk of threats to privacy. Privacy-preserving data mining (PPDM has thus arisen in recent years to sanitize the original database for hiding sensitive information, which can be concerned as an NP-hard problem in sanitization process. In this paper, a compact prelarge GA-based (cpGA2DT algorithm to delete transactions for hiding sensitive itemsets is thus proposed. It solves the limitations of the evolutionary process by adopting both the compact GA-based (cGA mechanism and the prelarge concept. A flexible fitness function with three adjustable weights is thus designed to find the appropriate transactions to be deleted in order to hide sensitive itemsets with minimal side effects of hiding failure, missing cost, and artificial cost. Experiments are conducted to show the performance of the proposed cpGA2DT algorithm compared to the simple GA-based (sGA2DT algorithm and the greedy approach in terms of execution time and three side effects.

  5. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    Science.gov (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  6. DNA-based detection of chromosome deletion and amplification: diagnostic and mechanistic significance

    International Nuclear Information System (INIS)

    Latt, S.A.; Lalande, M.; Donlon, T.

    1986-01-01

    This paper describes a few of the many possible examples in which application of a molecular cytogenetic approach can ultimately lead to a new, important understanding about the statics and dynamics of human chromosome structure. In the case of retinoblastoma, cytological observations of deletions and linkage analysis have positioned the retinoblastoma locus to bank 13q14. This locus is grossly deleted in some spontaneous tumors. It is still necessary to locate more precisely and characterize the nature of the retinoblastoma locus, as well as the basis for the heterogeneity in deletions removing one copy of this locus. One is left with the possibility that those deletions that may be observed cytologically reflect but the tip of the iceberg of deletions; detection of others may require molecular probes. A related question is the nature of the DNA sequences at the deletion boundaries and the role they play in promoting these deletions

  7. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  8. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  9. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  10. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  11. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  12. Rapid deletion plasmid construction methods for protoplast and Agrobacterium based fungal transformation systems

    Science.gov (United States)

    Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Gene deletion is a critical tool for functional analysis. The targeted deletion of genes requires both a suitable method for the trans...

  13. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  14. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  15. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  16. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  17. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  18. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  19. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  1. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  2. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  3. Immune Modulation of NYVAC-Based HIV Vaccines by Combined Deletion of Viral Genes that Act on Several Signalling Pathways

    Directory of Open Access Journals (Sweden)

    Carmen Elena Gómez

    2017-12-01

    Full Text Available An HIV-1 vaccine continues to be a major target to halt the AIDS pandemic. The limited efficacy of the RV144 phase III clinical trial with the canarypox virus-based vector ALVAC and a gp120 protein component led to the conclusion that improved immune responses to HIV antigens are needed for a more effective vaccine. In non-human primates, the New York vaccinia virus (NYVAC poxvirus vector has a broader immunogenicity profile than ALVAC and has been tested in clinical trials. We therefore analysed the HIV immune advantage of NYVAC after removing viral genes that act on several signalling pathways (Toll-like receptors—TLR—interferon, cytokines/chemokines, as well as genes of unknown immune function. We generated a series of NYVAC deletion mutants and studied immune behaviour (T and B cell to HIV antigens and to the NYVAC vector in mice. Our results showed that combined deletion of selected vaccinia virus (VACV genes is a valuable strategy for improving the immunogenicity of NYVAC-based vaccine candidates. These immune responses were differentially modulated, positive or negative, depending on the combination of gene deletions. The deletions also led to enhanced antigen- or vector-specific cellular and humoral responses. These findings will facilitate the development of optimal NYVAC-based vaccines for HIV and other diseases.

  4. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  5. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  6. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  7. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  8. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  9. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  10. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  11. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  12. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  13. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  14. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  15. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  16. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  17. New traits in crops produced by genome editing techniques based on deletions

    NARCIS (Netherlands)

    Wiel, van de C.C.M.; Schaart, J.G.; Lotz, L.A.P.; Smulders, M.J.M.

    2017-01-01

    One of the most promising New Plant Breeding Techniques is genome editing (also called gene editing) with the help of a programmable site-directed nuclease (SDN). In this review, we focus on SDN-1, which is the generation of small deletions or insertions (indels) at a precisely defined location in

  18. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  19. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    Science.gov (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  20. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  1. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  2. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  3. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  4. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.

    2011-01-01

    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  5. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  6. Optimal in-feed amino acid ratio for broiler breeder hens based on deletion studies.

    Science.gov (United States)

    Dorigam, J C P; Sakomura, N K; Sarcinelli, M F; Gonçalves, C A; de Lima, M B; Peruzzi, N J

    2017-12-01

    An ideal amino acid ratio (IAAR) for breeder hens is needed for maximum nitrogen retention (NR) taking into account nitrogen deposition in body (ND B ), feathers (ND F ) and egg mass (NEM) to improve dietary protein efficiency. Thus, the aim of this study was to apply the deletion method to derive the IAAR for broiler breeder hens. The nitrogen balance trials were performed from 31 to 35 weeks and from 46 to 50 weeks. Twelve treatments with eight replicates and one hen per cage were used. A balanced diet (BD) was formulated to meet the requirement of all nutrients. The other diets were formulated diluting 55% of BD with corn starch and refilled with amino acids (AAs) and other ingredients, except the AA tested. Each trial lasted 25 days. Feather losses, egg production and egg weight were recorded daily, and the samples were stored to further determine NEM and nitrogen in feather losses (ND FL ). At the start and the end of each period, a group of birds were slaughtered to further determine ND B and ND F . The NR was calculated as the sum of ND B , ND F , ND FL , NEM and the nitrogen maintenance requirement (NMR). The deletion of valine greatly depressed the NR in peak production (31 to 35 weeks) while the deletion of the isoleucine greatly depressed the NR of the hens from 46 to 50 weeks of age. The percentual reduction in NR and the per cent of the AA to delete from the BD were used to calculate the AA requirement. The average IAAR was Lys 100, Met+Cys 86, Trp 23, Thr 80, Arg 113, Val 90, Ile 91, Leu 133, Phe+Tyr 108, Gly+Ser 94 and His 35. The IAAR was in line with the recommendation from the literature, validating deletion method with the advantages from a rapid and low-cost procedure. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.

  7. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  8. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  9. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  11. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  12. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  13. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  14. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    Science.gov (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  15. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  16. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  17. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  18. Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

    Science.gov (United States)

    Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

    2013-06-01

    Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

  19. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  20. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  1. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  2. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  3. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  4. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  5. The feasibility study based on e-commerce instructions-focuses on detection and deletion of illegal content

    Science.gov (United States)

    Guo, Tianze; Bi, Siyu; Liu, Jiaming

    2018-04-01

    This essay legally restrains the illegal content based on the e-commerce directive and introduces that the European countries detect and notify illegal content through the instructions of competent authorities, notification of credible flaggers, user reports and technical tools. The illegal content should be deleted through the service terms and transparency report basing on prevent excessive deletions system. At the same time, use filters to detect and filter to against the recurrence of illegal content. By analyzing the advantages of China under the environment of cracking down on illegal content, this essay concludes that the success of China in cracking down on illegal content lies in all-round collaborative management model of countries, governments, enterprises and individuals. At the end of the essay, one is to build a training corpus that can automatically update the ability to identify the illegal content. And it proposes an optimization scheme that establish a complete set of address resolution procedures and classify IP address data according to big data analysis and DNS protection module to prevent hackers from spreading illegal content by tampering with DNS segments.

  6. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  7. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  8. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  9. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  10. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  11. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  12. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  13. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  14. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  15. ReacKnock: identifying reaction deletion strategies for microbial strain optimization based on genome-scale metabolic network.

    Directory of Open Access Journals (Sweden)

    Zixiang Xu

    Full Text Available Gene knockout has been used as a common strategy to improve microbial strains for producing chemicals. Several algorithms are available to predict the target reactions to be deleted. Most of them apply mixed integer bi-level linear programming (MIBLP based on metabolic networks, and use duality theory to transform bi-level optimization problem of large-scale MIBLP to single-level programming. However, the validity of the transformation was not proved. Solution of MIBLP depends on the structure of inner problem. If the inner problem is continuous, Karush-Kuhn-Tucker (KKT method can be used to reformulate the MIBLP to a single-level one. We adopt KKT technique in our algorithm ReacKnock to attack the intractable problem of the solution of MIBLP, demonstrated with the genome-scale metabolic network model of E. coli for producing various chemicals such as succinate, ethanol, threonine and etc. Compared to the previous methods, our algorithm is fast, stable and reliable to find the optimal solutions for all the chemical products tested, and able to provide all the alternative deletion strategies which lead to the same industrial objective.

  16. Array-based FMR1 sequencing and deletion analysis in patients with a fragile X syndrome-like phenotype.

    Directory of Open Access Journals (Sweden)

    Stephen C Collins

    2010-03-01

    Full Text Available Fragile X syndrome (FXS is caused by loss of function mutations in the FMR1 gene. Trinucleotide CGG-repeat expansions, resulting in FMR1 gene silencing, are the most common mutations observed at this locus. Even though the repeat expansion mutation is a functional null mutation, few conventional mutations have been identified at this locus, largely due to the clinical laboratory focus on the repeat tract.To more thoroughly evaluate the frequency of conventional mutations in FXS-like patients, we used an array-based method to sequence FMR1 in 51 unrelated males exhibiting several features characteristic of FXS but with normal CGG-repeat tracts of FMR1. One patient was identified with a deletion in FMR1, but none of the patients were found to have other conventional mutations.These data suggest that missense mutations in FMR1 are not a common cause of the FXS phenotype in patients who have normal-length CGG-repeat tracts. However, screening for small deletions of FMR1 may be of clinically utility.

  17. Array based characterization of a terminal deletion involving chromosome subband 15q26.2: an emerging syndrome associated with growth retardation, cardiac defects and developmental delay

    Directory of Open Access Journals (Sweden)

    Björkhem Gudrun

    2008-01-01

    Full Text Available Abstract Background Subtelomeric regions are gene rich and deletions in these chromosomal segments have been demonstrated to account for approximately 2.5% of patients displaying mental retardation with or without association of dysmorphic features. However, cases that report de novo terminal deletions on chromosome arm 15q are rare. Methods In this study we present the first example of a detailed molecular genetic mapping of a de novo deletion in involving 15q26.2-qter, caused by the formation of a dicentric chromosome 15, using metaphase FISH and tiling resolution (32 k genome-wide array-based comparative genomic hybridization (CGH. Results After an initial characterization of the dicentric chromosome by metaphase FISH, array CGH analysis mapped the terminal deletion to encompass a 6.48 megabase (Mb region, ranging from 93.86–100.34 Mb on chromosome 15. Conclusion In conclusion, we present an additional case to the growing family of reported cases with 15q26-deletion, thoroughly characterized at the molecular cytogenetic level. In the deleted regions, four candidate genes responsible for the phenotype of the patient could be delineated: IGFR1, MEF2A, CHSY1, and TM2D3. Further characterization of additional patients harboring similar 15q-aberrations might hopefully in the future lead to the description of a clear cut clinically recognizable syndrome.

  18. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  19. A New Strategy for Deleting Animal drugs from Traditional Chinese Medicines based on Modified Yimusake Formula.

    Science.gov (United States)

    Wang, Jinghui; Li, Yan; Yang, Yinfeng; Chen, Xuetong; Du, Jian; Zheng, Qiusheng; Liang, Zongsuo; Wang, Yonghua

    2017-05-04

    Traditional Chinese medicine (TCM), such as Uyghur Medicine (UM) has been used in clinical treatment for many years. TCM is featured as multiple targets and complex mechanisms of action, which is normally a combination of medicinal herbs and sometimes even contains certain rare animal medicinal ingredients. A question arises as to whether these animal materials can be removed replaced from TCM applications due to their valuable rare resources or animal ethics. Here, we select a classical UM Yimusake formula, which contains 3 animal drugs and other 8 herbs, and has got wealthy experience and remarkable achievements in treating erectile dysfunction (ED) in China. The active components, drug targets and therapeutic mechanisms have been comprehensively analyzed by systems-pharmacology methods. Additionally, to validate the inhibitory effects of all candidate compounds on their related targets, in vitro experiments, computational analysis and molecular dynamics simulations were performed. The results show that the modified, original and three animal materials display very similar mechanisms for an effective treatment of ED, indicating that it is quite possible to remove these three animal drugs from the original formula while still keep its efficiency. This work provides a new attempt for deleting animal materials from TCM, which should be important for optimization of traditional medicines.

  20. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  1. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  2. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  3. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Development of Insertion and Deletion Markers for Bottle Gourd Based on Restriction Site-associated DNA Sequencing Data

    Directory of Open Access Journals (Sweden)

    Xinyi WU

    2017-01-01

    Full Text Available Bottle gourd is an important cucurbit crop worldwide. To provide more available molecular markers for this crop, a bioinformatic approach was employed to develop insertion–deletions (InDels markers in bottle gourd based on restriction site-associated DNA sequencing (RAD-Seq data. A total of 892 Indels were predicted, with the length varying from 1 bp to 167 bp. Single-nucleotide InDels were the predominant types of InDels. To validate these InDels, PCR primers were designed from 162 loci where InDels longer than 2 bp were predicated. A total of 112 InDels were found to be polymorphic among 9 bottle gourd accessions under investigation. The rate of prediction accuracy was thus at a high level of 72.7%. DNA fingerprinting for 4 cultivars were performed using 8 selected Indels markers, demonstrating the usefulness of these markers.

  5. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  6. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  7. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  9. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  10. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  11. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    OpenAIRE

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  12. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  13. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  14. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  15. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  16. Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

    Science.gov (United States)

    Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

    2005-02-01

    Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

  17. Deletion in HSP110 T17: correlation with wild-type HSP110 expression and prognostic significance in microsatellite-unstable advanced gastric cancers.

    Science.gov (United States)

    Kim, Kyung-Ju; Lee, Tae Hun; Kim, Jung Ho; Cho, Nam-Yun; Kim, Woo Ho; Kang, Gyeong Hoon

    2017-09-01

    Deletion of the HSP110 T 17 mononucleotide repeat has recently been identified as a prognostic marker that is correlated with wild-type HSP110 (HSP110wt) expression in microsatellite instability-high (MSI-H) colorectal cancers. The aim of this study was to assess the correlation between deletion of the HSP110 T 17 repeat and expression of HSP110wt using DNA testing and immunohistochemistry and to determine the prognostic implications of HSP110 T 17 deletion in MSI-H advanced gastric cancers (GCs). The status of HSP110wt expression was evaluated by immunohistochemistry using an HSP110wt-specific antibody in 142 MSI-H advanced GCs. The size of the HSP110 T 17 repeat deletion was analyzed in 96 MSI-H advanced GCs; deletions were divided into small (0-2base pairs) and large deletions (3-5base pairs). Low and high expressions of HSP110wt were detected in 38 (26.8%) and 104 (73.2%) of the 142 cases, respectively. The HSP110 T 17 deletion was observed in 45 (46.9%) of the 96 MSI-H GC samples. Tumors with high expression of HSP110wt showed a tendency to have small or no deletion of HSP110 T 17 . In Kaplan-Meier survival analysis, tumors with a large HSP110 T 17 deletion were associated with favorable overall survival and disease-free survival compared with those with small/no deletion of HSP110 T 17 . However, HSP110 T 17 deletion size was not an independent prognostic factor in multivariate analysis. In summary, deletion of the HSP110 T 17 repeat was frequently observed in MSI-H GCs, and HSP110 T 17 deletion size was inversely correlated with HSP110wt expression status. Large HSP110 T 17 was not a prognostic indicator in MSI-H GCs. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  19. Genomic Variability of Mycobacterium tuberculosis Strains of the Euro-American Lineage Based on Large Sequence Deletions and 15-Locus MIRU-VNTR Polymorphism

    Science.gov (United States)

    Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo

    2014-01-01

    A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794

  20. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  1. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  2. Spontaneous and mutagen-induced deletions: mechanistic studies in Salmonella tester strain TA102

    International Nuclear Information System (INIS)

    Levin, D.E.; Marnett, L.J.; Ames, B.N.

    1984-01-01

    Salmonella tester strain TA102 carries the hisG428 ochre mutation on the multicopy plasmid pAQ1. DNA sequence analysis of 45 spontaneous revertants of hisG428 on the chromosome in the presence of pKM101 (strain TA103) indicates that hisG428 revertants fall into three major categories: (i) small, in-frame deletions (3 or 6 base pairs) that remove part or all of the ochre triplet; (ii) base substitution mutations at the ochre site; (iii) extragenic ochre suppressors. Deletion revertants are identified in a simple phenotypic screen by their resistance to the inhibitory histidine analog thiazolealanine, which feedback inhibits the wild-type hisG enzyme but not the enzyme resulting from the deletions. The effect of various genetic backgrounds on the generation of spontaneous deletion revertants was examined. The presence of a uvrB mutation or a recA mutation suppressed the generation of spontaneous deletion revertants to approximately 1/2.5. When hisG428 was in multiple copies on pAQ1, the frequency of spontaneous deletion revertants increased by 40-fold, which is the approximate copy number of pAQ1. Mutagenic agents that induce single-strand breaks in DNA (e.g., x-rays, bleomycin, and nalidixic acid) induced deletion revertants in TA102. These agents induced deletion revertants only in hisG428 on pAQ1 and only in the presence of pKM101. Deletion revertants were not induced by frameshift mutagens (i.e., ICR-191 and 9aminoacridine). These results indicate that different pathways exist for the generation of spontaneous and mutagen-induced deletion revertants of hisG428. 41 references, 2 figures, 3 tables

  3. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    Science.gov (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  4. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  5. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin

    2014-01-01

    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  6. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    Science.gov (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  7. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  8. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  9. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  10. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  11. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  12. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  13. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  14. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  15. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  16. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  17. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  18. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  19. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  20. A novel KCNQ4 one-base deletion in a large pedigree with hearing loss: implication for the genotype-phenotype correlation.

    Science.gov (United States)

    Kamada, Fumiaki; Kure, Shigeo; Kudo, Takayuki; Suzuki, Yoichi; Oshima, Takeshi; Ichinohe, Akiko; Kojima, Kanako; Niihori, Tetsuya; Kanno, Junko; Narumi, Yoko; Narisawa, Ayumi; Kato, Kumi; Aoki, Yoko; Ikeda, Katsuhisa; Kobayashi, Toshimitsu; Matsubara, Yoichi

    2006-01-01

    Autosomal-dominant, nonsyndromic hearing impairment is clinically and genetically heterogeneous. We encountered a large Japanese pedigree in which nonsyndromic hearing loss was inherited in an autosomal-dominant fashion. A genome-wide linkage study indicated linkage to the DFNA2 locus on chromosome 1p34. Mutational analysis of KCNQ4 encoding a potassium channel revealed a novel one-base deletion in exon 1, c.211delC, which generated a profoundly truncated protein without transmembrane domains (p.Q71fsX138). Previously, six missense mutations and one 13-base deletion, c.211_223del, had been reported in KCNQ4. Patients with the KCNQ4 missense mutations had younger-onset and more profound hearing loss than patients with the 211_223del mutation. In our current study, 12 individuals with the c.211delC mutation manifested late-onset and pure high-frequency hearing loss. Our results support the genotype-phenotype correlation that the KCNQ4 deletions are associated with later-onset and milder hearing impairment than the missense mutations. The phenotypic difference may be caused by the difference in pathogenic mechanisms: haploinsufficiency in deletions and dominant-negative effect in missense mutations.

  1. Analysis of conditional gene deletion using probe based Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Lyko Frank

    2010-12-01

    Full Text Available Abstract Following publication of this article 1 the authors noticed that an incorrect probe reference was cited on page 3, 4, 5 and 6 ("UP #69, Roche Applied Science". The correct probe that was used for the 1lox/2lox allele ratio analysis in the paper is as follows Probe for 1lox/2lox allele quantification: 5'-6-FAM-atAaCtTCgtatagCATaCattatac-BHQ-1 -3' (uppercase letters = LNA bases Manufacturer: EUROGENTEC, Seraing, Belgium All other information and reaction conditions in the paper are correct as stated.

  2. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  3. Three types of preS1 start codon deletion variants in the natural course of chronic hepatitis B infection.

    Science.gov (United States)

    Choe, Won Hyeok; Kim, Hong; Lee, So-Young; Choi, Yu-Min; Kwon, So Young; Moon, Hee Won; Hur, Mina; Kim, Bum-Joon

    2017-12-12

    Naturally occurring hepatitis B virus variants carrying a deletion in the preS1 start codon region may evolve during long-lasting virus-host interactions in chronic hepatitis B (CHB). The aim of this study was to determine the immune phase-specific prevalent patterns of preS1 start codon deletion variants and related factors during the natural course of CHB. A total of 399 CHB patients were enrolled. Genotypic analysis of three different preS1 start codon deletion variants (classified by deletion size: 15-base pair [bp], 18-bp, and 21-bp deletion variants) was performed. PreS1 start codon deletion variants were detected in 155 of 399 patients (38.8%). The predominant variant was a 15-bp deletion in the immune-tolerance phase (18/50, 36%) and an 18-bp deletion in the immune-clearance phase (69/183, 37.7%). A 21-bp deletion was the predominant variant in the low replicative phase (3/25, 12.0%) and reactivated hepatitis Be antigen (HBeAg)-negative phase (22/141, 15.6%). The 15-bp and 18-bp deletion variants were more frequently found in HBeAg-positive patients (P start codon deletion variants changes according to the immune phases of CHB infection, and each variant type is associated with different clinical parameters. PreS1 start codon deletion variants might interact with the host immune response differently according to their variant types. © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  4. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

    Science.gov (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  6. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  7. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  8. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  10. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  11. Deletions induced by gamma rays in the genome of Escherichia coli

    International Nuclear Information System (INIS)

    Raha, Manidipa; Hutchinson, Franklin

    1991-01-01

    An Escherichia coli lysogen was constructed with a lambda phage bearing a lacZ gene surrounded by about 100 x 10 3 base-pairs of dispensable DNA. The lacZ mutants induced by gamma rays in this lysogen were more than 10% large deletions, ranging in size from 0.6 x 10 -3 to 70 x 10 3 base-pairs. These deletions were centered, not on lacZ, but on a ColE1 origin of DNA replication located 1.2 x 10 3 bases downstream from lacZ, suggesting that this origin of replication was involved in the process by which deletions were formed. In agreement with this hypothesis, a lysogen of the same phage without the ColE1 origin showed a very much lower percentage of radiation-induced deletions, as did a second lysogen of a lambda phage without any known plasmid origin of replication. Indirect evidence is presented for radiation-induced deletions centered on the lambda origin of DNA replication in a lysogen. (author)

  12. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  13. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  14. Markerless deletion of putative alanine dehydrogenase genes in Bacillus licheniformis using a codBA-based counterselection technique.

    Science.gov (United States)

    Kostner, David; Rachinger, Michael; Liebl, Wolfgang; Ehrenreich, Armin

    2017-11-01

    Bacillus licheniformis strains are used for the large-scale production of industrial exoenzymes from proteinaceous substrates, but details of the amino acid metabolism involved are largely unknown. In this study, two chromosomal genes putatively involved in amino acid metabolism of B. licheniformis were deleted to clarify their role. For this, a convenient counterselection system for markerless in-frame deletions was developed for B. licheniformis. A deletion plasmid containing up- and downstream DNA segments of the chromosomal deletion target was conjugated to B. licheniformis and integrated into the genome by homologous recombination. Thereafter, the counterselection was done by using a codBA cassette. The presence of cytosine deaminase and cytosine permease exerted a conditionally lethal phenotype on B. licheniformis cells in the presence of the cytosine analogue 5-fluorocytosine. Thereby clones were selected that lost the integrated vector sequence and the anticipated deletion target after a second recombination step. This method allows the construction of markerless mutants in Bacillus strains in iterative cycles. B. licheniformis MW3 derivatives lacking either one of the ORFs BL03009 or BL00190, encoding a putative alanine dehydrogenase and a similar putative enzyme, respectively, retained the ability to grow in minimal medium supplemented with alanine as the carbon source. In the double deletion mutant MW3 ΔBL03009 ΔBL00190, however, growth on alanine was completely abolished. These data indicate that the two encoded enzymes are paralogues fulfilling mutually replaceable functions in alanine utilization, and suggest that in B. licheniformis MW3 alanine utilization is initiated by direct oxidative transamination to pyruvate and ammonium.

  15. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  16. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  17. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  18. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    Science.gov (United States)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  19. Frontal dysconnectivity in 22q11.2 deletion syndrome: an atlas-based functional connectivity analysis.

    Science.gov (United States)

    Mattiaccio, Leah M; Coman, Ioana L; Thompson, Carlie A; Fremont, Wanda P; Antshel, Kevin M; Kates, Wendy R

    2018-01-20

    22q11.2 deletion syndrome (22q11DS) is a neurodevelopmental syndrome associated with deficits in cognitive and emotional processing. This syndrome represents one of the highest risk factors for the development of schizophrenia. Previous studies of functional connectivity (FC) in 22q11DS report aberrant connectivity patterns in large-scale networks that are associated with the development of psychotic symptoms. In this study, we performed a functional connectivity analysis using the CONN toolbox to test for differential connectivity patterns between 54 individuals with 22q11DS and 30 healthy controls, between the ages of 17-25 years old. We mapped resting-state fMRI data onto 68 atlas-based regions of interest (ROIs) generated by the Desikan-Killany atlas in FreeSurfer, resulting in 2278 ROI-to-ROI connections for which we determined total linear temporal associations between each. Within the group with 22q11DS only, we further tested the association between prodromal symptoms of psychosis and FC. We observed that relative to controls, individuals with 22q11DS displayed increased FC in lobar networks involving the frontal-frontal, frontal-parietal, and frontal-occipital ROIs. In contrast, FC between ROIs in the parietal-temporal and occipital lobes was reduced in the 22q11DS group relative to healthy controls. Moreover, positive psychotic symptoms were positively associated with increased functional connections between the left precuneus and right superior frontal gyrus, as well as reduced functional connectivity between the bilateral pericalcarine. Positive symptoms were negatively associated with increased functional connectivity between the right pericalcarine and right postcentral gyrus. Our results suggest that functional organization may be altered in 22q11DS, leading to disruption in connectivity between frontal and other lobar substructures, and potentially increasing risk for prodromal psychosis.

  20. A re-sequencing based assessment of genomic heterogeneity and fast neutron-induced deletions in a common bean cultivar

    Directory of Open Access Journals (Sweden)

    Jamie A. O'Rourke

    2013-06-01

    Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.

  1. Deletion of ultraconserved elements yields viable mice

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Zhu, Yiwen; Visel, Axel; Holt, Amy; Afzal, Veena; Pennacchio, Len A.; Rubin, Edward M.

    2007-07-15

    Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lacking these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.

  2. Molecular evidence for the induction of large interstitial deletions on mouse chromosome 8 by ionizing radiation

    International Nuclear Information System (INIS)

    Turker, Mitchell S.; Pieretti, Maura; Kumar, Sudha

    1997-01-01

    The P19H22 mouse embryonal carcinoma cell line is characterized by a hemizygous deficiency for the chromosome 8 encoded aprt (adenine phosphoribosyltransferase) gene and heterozygosity for many chromosome 8 loci. We have previously demonstrated that this cell line is suitable for mutational studies because it is permissive of events ranging in size from base-pair substitutions at the aprt locus to apparent loss of chromosome 8. Large mutational events, defined by loss of the remaining aprt allele, were found to predominate in spontaneous mutants and those induced by ionizing radiation. In this study we have used a PCR based assay to screen for loss of heterozygosity at microsatellite loci both proximal and distal to aprt in 137 Cs-induced and spontaneous aprt mutants. This approach allowed us to distinguish apparent interstitial deletional events from apparent recombinational events. Significantly, 32.5% (26 of 80) of the mutational events induced by 137 Cs appeared to be interstitial deletions as compared with 7.7% (6 of 78) in the spontaneous group. This difference was statistically significant (p 137 Cs caused a significant number of deletion mutations. Most 137 Cs-induced interstitial deletions were larger than 6 cM, whereas none of the spontaneous deletions were larger than 6 cM. These results provide further support for the notion that ionizing radiation induces deletion mutations and validate the use of the P19H22 cell line for the study of events induced by ionizing radiation

  3. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  4. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  6. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  7. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  8. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  9. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  10. Graph-based surface reconstruction from stereo pairs using image segmentation

    Science.gov (United States)

    Bleyer, Michael; Gelautz, Margrit

    2005-01-01

    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  11. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  12. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  13. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  14. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  15. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.

    2009-01-01

    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  16. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  17. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring

    Science.gov (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann

    2012-01-01

    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  18. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  19. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  20. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  1. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  2. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  3. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  4. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems.

    Science.gov (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  5. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  6. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  7. Rare copy number deletions predict individual variation in intelligence.

    Directory of Open Access Journals (Sweden)

    Ronald A Yeo

    2011-01-01

    Full Text Available Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in "mutation load" emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent copy number variations (CNVs, and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77 had been administered the Wechsler Abbreviated Scale of Intelligence (WASI. After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = -.30, p = .01. As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES, we also examined the impact of ethnicity (Anglo/White vs. Other, as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed.

  8. Rare Copy Number Deletions Predict Individual Variation in Intelligence

    Science.gov (United States)

    Yeo, Ronald A.; Gangestad, Steven W.; Liu, Jingyu; Calhoun, Vince D.; Hutchison, Kent E.

    2011-01-01

    Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in “mutation load” emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent) copy number variations (CNVs), and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77) had been administered the Wechsler Abbreviated Scale of Intelligence (WASI). After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = −.30, p = .01). As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES), we also examined the impact of ethnicity (Anglo/White vs. Other), as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less) adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed. PMID:21298096

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    Science.gov (United States)

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  11. Partial deletion 11q

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Tommerup, N; Sørensen, F B

    1995-01-01

    We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...

  12. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    Science.gov (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  13. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)

    2015-07-01

    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  14. Deletion mutations of bacteriophage

    International Nuclear Information System (INIS)

    Ryo, Yeikou

    1975-01-01

    Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

  15. Schizophrenia and chromosomal deletions

    Energy Technology Data Exchange (ETDEWEB)

    Lindsay, E.A.; Baldini, A. [Baylor College of Medicine, Houston, TX (United States); Morris, M. A. [Univ. of Geneva School of Medicine, NY (United States)] [and others

    1995-06-01

    Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.

  16. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  17. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  18. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  19. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

    2011-01-01

    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  20. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  1. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  2. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Construction of upp deletion mutant strains of Lactobacillus casei and Lactococcus lactis based on counterselective system using temperature-sensitive plasmid.

    Science.gov (United States)

    Song, Li; Cui, Hongyu; Tang, Lijie; Qiao, Xinyuan; Liu, Min; Jiang, Yanping; Cui, Wen; Li, Yijing

    2014-07-01

    Integration plasmids are often used in constructing chromosomal mutations, as it enables the alternation of genes at any location by integration or replacement. Food-grade integration vectors can integrate into the host genome without introducing any selectable markers or residual bases, and the recombination often happens in non-coding region. In this study we used the temperature-sensitive pWV01 replicon to construct 2 chloramphenicol-resistant integration plasmids (pGBHC32-upp) containing the uracil phosphoribosyl transferase (upp) gene as a counterselective marker for Lactobacillus casei (L. casei) ATCC393 and Lactococcus lactis (L. lactis) MG1363. We then ligated the designed homologous arms to the pGBHC32-upp plasmids to allow their integration to the bacterial chromosome, and selected upp deletion mutants of L. casei ATCC393 and L. lactis MG1363 in the presence of 5-fluorouracil (5-FU). Analysis of genetic stability, growth curve, carbon utilization and scanning electronic microscopy showed that, except for 5-FU resistance, there were no significant differences between the wild type and mutant lactic acid bacteria. The integration system and the upp deletion strains could be used in the insertion or deletion of genes at any location of the chromosome of both L. casei ATCC 393 and L. lactis MG1363, and the homologous recombination would not introduce any selectable markers or residual bases. These mutant strains can be further investigated for heterologous protein expression and construction of a live mucosal vaccine carrier. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Quantum deletion: Beyond the no-deletion principle

    International Nuclear Information System (INIS)

    Adhikari, Satyabrata

    2005-01-01

    Suppose we are given two identical copies of an unknown quantum state and we wish to delete one copy from among the given two copies. The quantum no-deletion principle restricts us from perfectly deleting a copy but it does not prohibit us from deleting a copy approximately. Here we construct two types of a 'universal quantum deletion machine' which approximately deletes a copy such that the fidelity of deletion does not depend on the input state. The two types of universal quantum deletion machines are (1) a conventional deletion machine described by one unitary operator and (2) a modified deletion machine described by two unitary operators. Here it is shown that the modified deletion machine deletes a qubit with fidelity 3/4, which is the maximum limit for deleting an unknown quantum state. In addition to this we also show that the modified deletion machine retains the qubit in the first mode with average fidelity 0.77 (approx.) which is slightly greater than the fidelity of measurement for two given identical states, showing how precisely one can determine its state [S. Massar and S. Popescu, Phys. Rev. Lett. 74, 1259 (1995)]. We also show that the deletion machine itself is input state independent, i.e., the information is not hidden in the deleting machine, and hence we can delete the information completely from the deletion machine

  5. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  7. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  8. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  9. Identification of a Novel Deletion in AVP-NPII Gene in a Patient with Central Diabetes Insipidus.

    Science.gov (United States)

    Deniz, Ferhat; Acar, Ceren; Saglar, Emel; Erdem, Beril; Karaduman, Tugce; Yonem, Arif; Cagiltay, Eylem; Ay, Seyit Ahmet; Mergen, Hatice

    2015-01-01

    Central Diabetes Insipidus (CDI) is caused by a deficiency of antidiuretic hormone and characterized by polyuria, polydipsia and inability to concentrate urine. Our objective was to present the results of the molecular analyses of AVP-neurophysin II (AVP-NPII) gene in a large familial neurohypophyseal (central) DI pedigree. A male patient and his family members were analyzed and the prospective clinical data were collected. The proband applied to hospital for eligibility to be a recruit in Armed Forces. The patient had severe polyuria (20 L/day), polydipsia (20.5 L/day), fatique, and deep thirstiness. CDI was confirmed with the water deprivation-desmopressin test according to an increase in urine osmolality from 162 mOsm/kg to 432 mOsm/kg after desmopressin acetate injection. To evaluate the coding regions of AVP-NPII gene, polymerase chain reactions were performed and amplified regions were submitted to direct sequence analysis. We detected a heterozygous three base pair deletion at codon 69-70 (207_209delGGC) in exon 2, which lead to a deletion of the amino acid alanine. A three-dimensional protein structure prediction was shown for the deleted AVP-NPII and compared with the wild type. The three base pair deletion may yield an abnormal AVP precursor in neurophysin moiety, but further functional analyses are needed to understand the function of the deleted protein. © 2015 by the Association of Clinical Scientists, Inc.

  10. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  11. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  12. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  13. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Impact of the canine double-deletion β1 adrenoreceptor polymorphisms on protein structure and heart rate response to atenolol, a β1-selective β-blocker.

    Science.gov (United States)

    Meurs, Kathryn M; Stern, Josh A; Reina-Doreste, Yamir; Maran, Brian A; Chdid, Lhoucine; Lahmers, Sunshine; Keene, Bruce W; Mealey, Katrina L

    2015-09-01

    β-Adrenergic receptor antagonists are widely utilized for the management of cardiac diseases in dogs. We have recently identified two deletion polymorphisms in the canine adrenoreceptor 1 (ADRB1) gene.We hypothesized that canine ADRB1 deletions would alter the structure of the protein, as well as the heart rate response to the β-adrenergic receptor antagonist, atenolol. The objectives of this study were to predict the impact of these deletions on the predicted structure of the protein and on the heart rate response to atenolol in a population of healthy adult dogs. Eighteen apparently healthy, mature dogs with (11) and without (seven) ADRB1 deletions were evaluated. The heart rate of the dogs was evaluated with a baseline ambulatory ECG before and 14-21 days after atenolol therapy (1 mg/kg orally q12 h). Minimum, average, and maximum heart rates were compared between groups of dogs (deletions, controls) using an unpaired t-test and within each group of dogs using a paired t-test. The protein structure of ADRB1 was predicted by computer modeling. Deletions were predicted to alter the structure of the ADRB1 protein. The heart rates of the dogs with deletions were lower than those of the control dogs (the average heart rates were significantly lower). ADRB1 deletions appear to have structural and functional consequences. Individual genome-based treatment recommendations could impact the management of dogs with heart disease.

  15. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  16. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  17. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt

    2018-05-01

    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  18. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  19. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  1. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    Science.gov (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  2. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  4. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  5. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  6. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  7. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  8. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  9. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail: b6rgw@fantasy.plala.or.jp; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)

    2007-02-01

    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  10. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  11. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  12. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  13. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  14. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  15. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  16. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  17. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  18. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    Science.gov (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  19. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia

    2016-03-01

    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  20. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    Science.gov (United States)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  1. Brain and behaviour in children with 22q11.2 deletion syndrome: a volumetric and voxel-based morphometry MRI study

    NARCIS (Netherlands)

    Campbell, Linda E.; Daly, Eileen; Toal, Fiona; Stevens, Angela; Azuma, Rayna; Catani, Marco; Ng, Virginia; van Amelsvoort, Therese; Chitnis, Xavier; Cutter, William; Murphy, Declan G. M.; Murphy, Kieran C.

    2006-01-01

    In people with velo-cardio-facial syndrome [or 22q11.2 deletion syndrome (22qDS)], a single interstitial deletion of chromosome 22q11.2 causes a wide spectrum of cognitive deficits ranging from global learning difficulties to specific cognitive deficits. People with 22qDS are also at high risk of

  2. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  3. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  4. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    Science.gov (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  6. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  7. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    Science.gov (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  8. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

    Science.gov (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

    2009-01-01

    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  9. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  10. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  11. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves

    Science.gov (United States)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin

    2018-05-01

    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  12. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  13. Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

    2015-12-15

    Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

  14. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

    Science.gov (United States)

    Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

    2010-06-01

    Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

  16. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    Science.gov (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  18. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  19. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  20. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  1. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  2. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  3. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  4. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  5. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  6. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  7. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  8. Construction of Various γ34.5 Deleted Fluorescent-Expressing Oncolytic herpes Simplex type 1 (oHSV) for Generation and Isolation of HSV-Based Vectors

    Science.gov (United States)

    Abdoli, Shahriyar; Roohvand, Farzin; Teimoori-Toolabi, Ladan; Shokrgozar, Mohammad Ali; Bahrololoumi, Mina; Azadmanesh, Kayhan

    2017-07-01

    Oncolytic herpes simplex virus (oHSV)-based vectors lacking γ34.5 gene, are considered as ideal templates to construct efficient vectors for (targeted) cancer gene therapy. Herein, we reported the construction of three single/dually-flourescence labeled and γ34.5-deleted, recombinant HSV-1 vectors for rapid generation and easy selection/isolation of different HSV-Based vectors. Generation of recombinant viruses was performed with conventional homologous recombination methods using green fluorescent protein (GFP) and BleCherry harboring shuttle vectors. Viruses were isolated by direct fluorescence observation and standard plaque purifying methods and confirmed by PCR and sequencing and flow cytometry. XTT and plaque assay titration were performed on Vero, U87MG, and T98 GBM cell lines. We generated three recombinant viruses, HSV-GFP, HSV-GR (Green-Red), and HSV-Red. The HSV-GFP showed two log higher titer (1010 PFU) than wild type (108 PFU). In contrast, HSV-GR and HSV-Red showed one log lower titer (107 PFU) than parental HSV. Cytotoxicity analysis showed that HSV-GR and HSV-Red can lyse target tumor cells at multiplicity of infection of 10 and 1 (Pidentification via fluorescence activated cell sorting. These vectors can also be used for tracing the efficacy of therapeutic agents on target cells, imaging of neural or tumoral cells in vitro/in vivo and as oncolytic agents in cancer therapy.

  9. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  10. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  11. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  12. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  13. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  14. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  15. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  16. Deletion of a coordinate regulator of type 2 cytokine expression in mice

    Energy Technology Data Exchange (ETDEWEB)

    Mohrs, Markus; Blankespoor, Catherine M.; Wang, Zhi-En; Loots, Gaby G.; Hadeiba, Husein; Shinkai, Kanade; Rubin, Edward M.; Locksley, Richard M.

    2001-07-30

    Mechanisms underlying the differentiation of stable T helper subsets will be important in understanding how discrete types of immunity develop in response to different pathogens. An evolutionarily conserved {approx}400 base pair non-coding sequence in the IL-4/IL-13 intergenic region, designated CNS-1, was deleted in mice. The capacity to develop Th2 cells was compromised in vitro and in vivo in the absence of CNS-1. Despite the profound effect in T cells, mast cells from CNS-1-deleted mice maintained their capacity to produce IL-4. A T cell-specific element critical for optimal expression of type 2 cytokines may represent evolution of a regulatory sequence exploited by adaptive immunity.

  17. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  18. Panchromatic cooperative hyperspectral adaptive wide band deletion repair method

    Science.gov (United States)

    Jiang, Bitao; Shi, Chunyu

    2018-02-01

    In the hyperspectral data, the phenomenon of stripe deletion often occurs, which seriously affects the efficiency and accuracy of data analysis and application. Narrow band deletion can be directly repaired by interpolation, and this method is not ideal for wide band deletion repair. In this paper, an adaptive spectral wide band missing restoration method based on panchromatic information is proposed, and the effectiveness of the algorithm is verified by experiments.

  19. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  20. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  1. Molecular Modeling of the Major DNA Adduct Formed from Food Mutagen Ochratoxin A in NarI Two-Base Deletion Duplexes: Impact of Sequence Context and Adduct Ionization on Conformational Preference and Mutagenicity.

    Science.gov (United States)

    Kathuria, Preetleen; Sharma, Purshotam; Manderville, Richard A; Wetmore, Stacey D

    2017-08-21

    Exposure to ochratoxin A (OTA), a possible human carcinogen, leads to many different DNA mutations. As a first step toward understanding the structural basis of OTA-induced mutagenicity, the present work uses a robust computational approach and a slipped mutagenic intermediate model previously studied for C 8 -dG aromatic amine adducts to analyze the conformational features of postreplication two-base deletion DNA duplexes containing OT-dG, the major OTA lesion at the C 8 position of guanine. Specifically, a total of 960 ns of molecular dynamics simulations (excluding trial simulations) were carried out on four OT-dG ionization states in three sequence contexts within oligomers containing the NarI recognition sequence, a known hotspot for deletion mutations induced by related adducts formed from known carcinogens. Our results indicate that the structural properties and relative stability of the competing "major groove" and "stacked" conformations of OTA adducted two-base deletion duplexes depend on both the OTA ionization state and the sequence context, mainly due to conformation-dependent deviations in discrete local (hydrogen-bonding and stacking) interactions at the lesion site, as well as DNA bending. When the structural characteristics of the OT-dG adducted two-base deletion duplexes are compared to those associated with previously studied C 8 -dG adducts, a greater understanding of the effects of the nucleobase-carcinogen linkage, and size of the carcinogenic moiety on the conformational preferences of damaged DNA is obtained. Most importantly, our work predicts key structural features for OT-dG-adducted deletion DNA duplexes, which in turn allow us to develop hypotheses regarding OT-dG replication outcomes. Thus, our computational results are valuable for the design and interpretation of future biochemical studies on the potentially carcinogenic OT-dG lesion.

  2. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park

    2017-06-01

    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  3. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  4. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    Science.gov (United States)

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    OpenAIRE

    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

    2005-01-01

    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  6. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    Science.gov (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash

    2017-01-01

    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  8. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  9. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  11. White matter microstructure in 22q11 deletion syndrome: a pilot diffusion tensor imaging and voxel-based morphometry study of children and adolescents.

    Science.gov (United States)

    Sundram, Frederick; Campbell, Linda E; Azuma, Rayna; Daly, Eileen; Bloemen, Oswald J N; Barker, Gareth J; Chitnis, Xavier; Jones, Derek K; van Amelsvoort, Therese; Murphy, Kieran C; Murphy, Declan G M

    2010-06-01

    Young people with 22q11 Deletion Syndrome (22q11DS) are at substantial risk for developing psychosis and have significant differences in white matter (WM) volume. However, there are few in vivo studies of both WM microstructural integrity (as measured using Diffusion Tensor (DT)-MRI) and WM volume in the same individual. We used DT-MRI and structural MRI (sMRI) with voxel based morphometry (VBM) to compare, respectively, the fractional anisotropy (FA) and WM volume of 11 children and adolescents with 22q11DS and 12 controls. Also, within 22q11DS we related differences in WM to severity of schizotypy, and polymorphism of the catechol-O-methyltransferase (COMT) gene. People with 22q11DS had significantly lower FA in inter-hemispheric and brainstem and frontal, parietal and temporal lobe regions after covarying for IQ. Significant WM volumetric increases were found in the internal capsule, anterior brainstem and frontal and occipital lobes. There was a significant negative correlation between increased schizotypy scores and reduced WM FA in the right posterior limb of internal capsule and the right body and left splenium of corpus callosum. Finally, the Val allele of COMT was associated with a significant reduction in both FA and volume of WM in the frontal lobes, cingulum and corpus callosum. Young people with 22q11DS have significant differences in both WM microstructure and volume. Also, there is preliminary evidence that within 22q11DS, some regional differences in FA are associated with allelic variation in COMT and may perhaps also be associated with schizotypy.

  12. Genomic diversity of Mycobacterium tuberculosis Beijing strains isolated in Tuscany, Italy, based on large sequence deletions, SNPs in putative DNA repair genes and MIRU-VNTR polymorphisms.

    Science.gov (United States)

    Garzelli, Carlo; Lari, Nicoletta; Rindi, Laura

    2016-03-01

    The Beijing genotype of Mycobacterium tuberculosis is cause of global concern as it is rapidly spreading worldwide, is considered hypervirulent, and is most often associated to massive spread of MDR/XDR TB, although these epidemiological or pathological properties have not been confirmed for all strains and in all geographic settings. In this paper, to gain new insights into the biogeographical heterogeneity of the Beijing family, we investigated a global sample of Beijing strains (22% from Italian-born, 78% from foreign-born patients) by determining large sequence polymorphism of regions RD105, RD181, RD150 and RD142, single nucleotide polymorphism of putative DNA repair genes mutT4 and mutT2 and MIRU-VNTR profiles based on 11 discriminative loci. We found that, although our sample of Beijing strains showed a considerable genomic heterogeneity, yielding both ancient and recent phylogenetic strains, the prevalent successful Beijing subsets were characterized by deletions of RD105 and RD181 and by one nucleotide substitution in one or both mutT genes. MIRU-VNTR analysis revealed 47 unique patterns and 9 clusters including a total of 33 isolates (41% of total isolates); the relatively high proportion of Italian-born Beijing TB patients, often occurring in mixed clusters, supports the possibility of an ongoing cross-transmission of the Beijing genotype to autochthonous population. High rates of extra-pulmonary localization and drug-resistance, particularly MDR, frequently reported for Beijing strains in other settings, were not observed in our survey. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing

    2010-01-01

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  14. Computational Identification of Protein Pupylation Sites by Using Profile-Based Composition of k-Spaced Amino Acid Pairs.

    Directory of Open Access Journals (Sweden)

    Md Mehedi Hasan

    Full Text Available Prokaryotic proteins are regulated by pupylation, a type of post-translational modification that contributes to cellular function in bacterial organisms. In pupylation process, the prokaryotic ubiquitin-like protein (Pup tagging is functionally analogous to ubiquitination in order to tag target proteins for proteasomal degradation. To date, several experimental methods have been developed to identify pupylated proteins and their pupylation sites, but these experimental methods are generally laborious and costly. Therefore, computational methods that can accurately predict potential pupylation sites based on protein sequence information are highly desirable. In this paper, a novel predictor termed as pbPUP has been developed for accurate prediction of pupylation sites. In particular, a sophisticated sequence encoding scheme [i.e. the profile-based composition of k-spaced amino acid pairs (pbCKSAAP] is used to represent the sequence patterns and evolutionary information of the sequence fragments surrounding pupylation sites. Then, a Support Vector Machine (SVM classifier is trained using the pbCKSAAP encoding scheme. The final pbPUP predictor achieves an AUC value of 0.849 in 10-fold cross-validation tests and outperforms other existing predictors on a comprehensive independent test dataset. The proposed method is anticipated to be a helpful computational resource for the prediction of pupylation sites. The web server and curated datasets in this study are freely available at http://protein.cau.edu.cn/pbPUP/.

  15. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)

    2010-04-15

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  16. One Step Construction of Agrobacterium Recombination-ready-plasmids (OSCAR), an efficient and robust tool for ATMT based gene deletion construction in fungi

    Science.gov (United States)

    Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Previously we reported a method called DelsGate for rapid preparation of deletion constructs for protoplast-mediated fungal transforma...

  17. White matter microstructure in 22q11 deletion syndrome: a pilot diffusion tensor imaging and voxel-based morphometry study of children and adolescents

    NARCIS (Netherlands)

    Sundram, Frederick; Campbell, Linda E.; Azuma, Rayna; Daly, Eileen; Bloemen, Oswald J. N.; Barker, Gareth J.; Chitnis, Xavier; Jones, Derek K.; van Amelsvoort, Therese; Murphy, Kieran C.; Murphy, Declan G. M.

    2010-01-01

    Young people with 22q11 Deletion Syndrome (22q11DS) are at substantial risk for developing psychosis and have significant differences in white matter (WM) volume. However, there are few in vivo studies of both WM microstructural integrity (as measured using Diffusion Tensor (DT)-MRI) and WM volume

  18. PIPE: a protein-protein interaction prediction engine based on the re-occurring short polypeptide sequences between known interacting protein pairs

    Directory of Open Access Journals (Sweden)

    Greenblatt Jack

    2006-07-01

    Full Text Available Abstract Background Identification of protein interaction networks has received considerable attention in the post-genomic era. The currently available biochemical approaches used to detect protein-protein interactions are all time and labour intensive. Consequently there is a growing need for the development of computational tools that are capable of effectively identifying such interactions. Results Here we explain the development and implementation of a novel Protein-Protein Interaction Prediction Engine termed PIPE. This tool is capable of predicting protein-protein interactions for any target pair of the yeast Saccharomyces cerevisiae proteins from their primary structure and without the need for any additional information or predictions about the proteins. PIPE showed a sensitivity of 61% for detecting any yeast protein interaction with 89% specificity and an overall accuracy of 75%. This rate of success is comparable to those associated with the most commonly used biochemical techniques. Using PIPE, we identified a novel interaction between YGL227W (vid30 and YMR135C (gid8 yeast proteins. This lead us to the identification of a novel yeast complex that here we term vid30 complex (vid30c. The observed interaction was confirmed by tandem affinity purification (TAP tag, verifying the ability of PIPE to predict novel protein-protein interactions. We then used PIPE analysis to investigate the internal architecture of vid30c. It appeared from PIPE analysis that vid30c may consist of a core and a secondary component. Generation of yeast gene deletion strains combined with TAP tagging analysis indicated that the deletion of a member of the core component interfered with the formation of vid30c, however, deletion of a member of the secondary component had little effect (if any on the formation of vid30c. Also, PIPE can be used to analyse yeast proteins for which TAP tagging fails, thereby allowing us to predict protein interactions that are not

  19. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  1. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains.

    Science.gov (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai

    2017-08-01

    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  2. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang

    2018-02-01

    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  3. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data.

    Science.gov (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai

    2012-02-15

    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.

  4. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques.

    Science.gov (United States)

    Schmitz, Gunnar; Hättig, Christof

    2016-12-21

    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  5. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory

    Science.gov (United States)

    Frank, Marius S.; Hättig, Christof

    2018-04-01

    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  6. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  7. Detection of mitochondrial DNA deletions in human cells induced by ionizing radiation

    International Nuclear Information System (INIS)

    Liu, Qing-Jie; Feng, Jiang-Bin; Lu, Xue; Li, Yu-Wen; Chen, De-Qing

    2008-01-01

    Full text: Purpose: To screen the novel mitochondrial DNA (mt DNA) deletions induced by ionizing radiation, and analyze the several kinds of mt DNA deletions, known as 3895 bp, 889 bp, 7436 bp or 4934 bp deletions. Methods: Long-range PCR with two pairs of primers, which could amplify the whole human mitochondrial genome, was used to analyze the lymphoblastoid cell line before and after exposed to 10 Gy 60 Co γ-rays. The limited condition PCR was used to certify the possible mt DNA deletion showed by long-range PCR. The PCR products were purified, cloned, sequenced and the sequence result were BLASTed. Regular PCR or nest-PCR were used to analyze the 3895 bp, 889 bp, 7436 bp or 4934 bp deletions before and after radiation exposure. The final PCR products were purified, sequenced and BALSTed on standard human mitochondrial genome sequence database. Results: (1) The predicted bands of mt DNA were observed on the control cell lines, and the possible mt DNA deletions were also detected on the irradiated cell lines. The deletions were certified by the limited condition PCR. The sequence BLAST results of the cloned PCR products showed that two kinds of deletions, 7455 bp deletion (nt 475-7929 in heavy strand) and 9225 bp deletion (nt 7714-369 in heavy strand), which were between two 8 bp direct repeats. Further bioinformatics analysis showed that the two deletions were novel deletions. (2) The 889 bp and 3895 bp deletion were not detected for the cell line samples not exposed to 60 Co γ-rays. The 889 bp and 3895 bp deletions were detected on samples exposed to 10 Gy 60 Co γ-rays. The BALST results showed that the 889 bp and 3895 deletions flanked nt 11688 bp-12576, nt 548 bp-4443, respectively. The 7436 bp deletion levels were not changed much before and after irradiation. (3) The 4934 bp deletions had the same pattern as 7436 bp deletion, but it could induced by radiation. Conclusions: Ionizing radiation could induce the human lymphoblastoid two novel mt DNA

  8. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  9. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  10. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  11. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  12. Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

    Science.gov (United States)

    Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

    2014-01-01

    Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

  13. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  14. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  15. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  16. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  17. The effect of the CCR5-delta32 deletion on global gene expression considering immune response and inflammation

    Directory of Open Access Journals (Sweden)

    Hütter Gero

    2011-10-01

    Full Text Available Abstract Background The natural function of the C-C chemokine receptor type 5 (CCR5 is poorly understood. A 32 base pair deletion in the CCR5 gene (CCR5-delta32 located on chromosome 3 results in a non-functional protein. It is supposed that this deletion causes an alteration in T-cell response to inflammation. For example, the presence of the CCR5-delta32 allele in recipients of allografts constitutes as an independent and protective factor associated with a decreased risk of graft-versus-host disease (GVHD and graft rejection. However, the mechanism of this beneficial effect of the deletion regarding GVHD is unknown. In this survey we searched for a CCR5-delta32 associated regulation of critical genes involved in the immune response and the development of GVHD. Methods We examined CD34+ hematopoietic progenitor cells derived from bone marrow samples from 19 healthy volunteers for the CCR5-delta32 deletion with a genomic PCR using primers flanking the site of the deletion. Results 12 individuals were found to be homozygous for CCR5 WT and 7 carried the CCR5-delta32 deletion heterozygously. Global gene expression analysis led to the identification of 11 differentially regulated genes. Six of them are connected with mechanisms of immune response and control: LRG1, CXCR2, CCRL2, CD6, CD7, WD repeat domain, and CD30L. Conclusions Our data indicate that the CCR5-delta32 mutation may be associated with differential gene expression. Some of these genes are critical for immune response, in the case of CD30L probably protective in terms of GVHD.

  18. High performance of histidine-rich protein 2 based rapid diagnostic tests in French Guiana are explained by the absence of pfhrp2 gene deletion in P. falciparum.

    Directory of Open Access Journals (Sweden)

    Mélanie Trouvay

    Full Text Available BACKGROUND: Care for malaria patients in endemic areas has been improved through the increasing use of Rapid Diagnostic Tests (RDTs. Most RDTs target the histidine-rich protein-2 antigen (PfHRP2 to detect P. falciparum, as it is abundant and shows great heat stability. However, their use in South America has been widely questioned following a recent publication that pinpoints the high prevalence of Peruvian field isolates lacking the gene encoding this protein. In the remote rural health centers of French Guiana, RDTs are the main diagnosis tools. Therefore, a study of PfHRP2 RDT performances and pfhrp2 genotyping was conducted to determine whether a replacement of the current pLDH-based kit could be considered. METHODS: The performance study compared the SD Malaria Ag test P.f/Pan® kit with the current gold standard diagnosis by microscopy. The prevalence of pfhrp2 and pfhrp3 deletions were evaluated from 221 P. falciparum isolates collected between 2009 and 2011 in French Guiana. RESULTS: Between January 2010 and August 2011, 960 suspected cases of malaria were analyzed using microscopy and RDTs. The sensitivity of the SD Malaria Ag test P.f/Pan® for detection of P. falciparum was 96.8% (95% CI: 90.9-99.3, and 86.0% (95% CI: 78.9-91.5 for the detection of P. vivax. No isolates (95% CI: 0-4.5 lacking either exon of the pfhrp2 gene were identified among the 221 P. falciparum isolates analyzed, but 7.4% (95% CI: 2.8-15.4 lacked the exon 2 part of the pfhrp3 gene. CONCLUSIONS: Field isolates lacking either exon of the pfhrp2 gene are absent in this western part of South America. Despite its sensibility to detect P. vivax, the SD Malaria Ag test P.f/Pan® kit is a satisfying alternative to microscopy in remote health centers, where it is difficult to provide highly skilled microscopists and to maintain the necessary equipment.

  19. A novel nine base deletion mutation in NADH-cytochrome b5 reductase gene in an Indian family with recessive congenital methemoglobinemia-type-II

    Directory of Open Access Journals (Sweden)

    Prashant Warang

    2015-12-01

    Full Text Available Recessive hereditary methemoglobinemia (RCM associated with severe neurological abnormalities is a very rare disorder caused by NADH- cytochrome b5 reductase (cb5r deficiency (Type II. We report a case of 11 month old male child who had severe mental retardation, microcephaly and gross global developmental delay with methemoglobin level of 61.1%. The diagnosis of NADH-CYB5R3 deficiency was made by the demonstration of significantly reduced NADH-CYB5R3 activity in the patient and intermediate enzyme activity in both the parents. Mutation analysis of the CYB5R gene revealed a novel nine nucleotide deletion in exon 6 leading to the elimination of 3 amino acid residues (Lys173, Ser174 and Val 175. To confirm that this mutation was not an artifact, we performed PCR-RFLP analysis using the restriction enzyme Drd I. As the normal sequence has a restriction recognition site for Drd I which was eliminated by the deletion, a single band of 603-bp was seen in the presence of the homozygous mutation. Molecular modeling analysis showed a significant effect of these 3 amino acids deletion on the protein structure and stability leading to a severe clinical presentation. A novel homozygous 9 nucleotide deletion (p.K173–p.V175del3 is shown to be segregated with the disease in this family. Knowing the profile of mutations would allow us to offer prenatal diagnosis in families with severe neurological disorders associated with RCM — Type II.

  20. Role of DNA deletion length in mutation and cell survival

    International Nuclear Information System (INIS)

    Braby, L.A.; Morgan, T.L.

    1992-01-01

    A model is presented which is based on the assumption that malignant transformation, mutation, chromosome aberration, and reproductive death of cells are all manifestations of radiation induced deletions in the DNA of the cell, and that the size of the deletion in relation to the spacing of essential genes determines the consequences of that deletion. It is assumed that two independent types of potentially lethal lesions can result in DNA deletions, and that the relative numbers of these types of damage is dependent on radiation quality. The repair of the damage reduces the length of a deletion, but does not always eliminate it. The predictions of this model are in good agreement with a wide variety of experimental evidence. (author)

  1. 4977-bp mitochondrial DNA deletion in infertile patients with varicocele.

    Science.gov (United States)

    Gashti, N G; Salehi, Z; Madani, A H; Dalivandan, S T

    2014-04-01

    Varicocele is the abnormal inflexion and distension of veins of the pampiniform plexus within spermatic cord and is one of the amendable causes of male infertility. It can increase reactive oxygen species (ROS) production in semen and cause oxidative stress. The purpose of this study was to analyse spermatozoa mtDNA 4977-bp deletion in infertile men with varicocele. To detect 4977-bp deletion in spermatozoa mtDNA, semen samples of 60 infertile patients with clinical varicocele and 90 normal men from northern Iran were prepared. After extraction of spermatozoa total DNA, Gap polymerase chain reaction (Gap PCR) was performed. 4977-bp deletion was observed in 81.66% of patients with varicocele, while approximately 15.55% of controls had this deletion. As spermatozoa from patients with varicocele had a high frequency of occurrence of 4977-bp deletion in mtDNA [OR = 24.18, 95% confidence interval (CI) = 10.15-57.57, P deletion in spermatozoa and cause infertility in north Iranian men. However, to determine the relation between sperm mtDNA 4977-bp deletion and varicocele-induced infertility, larger population-based studies are needed. It is concluded that there is an association between sperm mtDNA 4977-bp deletion and varicocele-induced infertility in the population studied. © 2013 Blackwell Verlag GmbH.

  2. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  3. Conversion of Deletions during Recombination in Pneumococcal Transformation

    Science.gov (United States)

    Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

    1989-01-01

    Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

  4. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)

    HURD, RE; ROBILLARD, GT; REID, BR

    1977-01-01

    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  6. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  7. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. On Deletion of Sutra Translation

    Institute of Scientific and Technical Information of China (English)

    CHEN Shu-juan

    2017-01-01

    Dao An's the metaphor of translation "wine diluted with water' ' expressed a view about translation that had been abridged.Later Kumarajiva provided metaphor "rice chewed—tasteless and downright disgusting".Both of them felt regretted at the weakening of taste,sometimes even the complete loss of flavor caused by deletion in translation of Buddhist sutras.In early sutra translation,deletion is unavoidable which made many sutra translators felt confused and drove them to study it further and some even managed to give their understanding to this issue.This thesis will discuss the definition,and what causes deletion and the measures adopted by the sutra translators.

  9. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  10. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  11. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories

    Science.gov (United States)

    Guo, Yang; Becker, Ute; Neese, Frank

    2018-03-01

    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  12. Delayed chromosomal instability caused by large deletion

    International Nuclear Information System (INIS)

    Ojima, M.; Suzuki, K.; Kodama, S.; Watanabe, M.

    2003-01-01

    Full text: There is accumulating evidence that genomic instability, manifested by the expression of delayed phenotypes, is induced by X-irradiation but not by ultraviolet (UV) light. It is well known that ionizing radiation, such as X-rays, induces DNA double strand breaks, but UV-light mainly causes base damage like pyrimidine dimers and (6-4) photoproducts. Although the mechanism of radiation-induced genomic instability has not been thoroughly explained, it is suggested that DNA double strand breaks contribute the induction of genomic instability. We examined here whether X-ray induced gene deletion at the hprt locus induces delayed instability in chromosome X. SV40-immortalized normal human fibroblasts, GM638, were irradiated with X-rays (3, 6 Gy), and the hprt mutants were isolated in the presence of 6-thioguanine (6-TG). A 2-fold and a 60-fold increase in mutation frequency were found by 3 Gy and 6 Gy irradiation, respectively. The molecular structure of the hprt mutations was determined by multiplex polymerase chain reaction of nine exons. Approximately 60% of 3 Gy mutants lost a part or the entire hprt gene, and the other mutants showed point mutations like spontaneous mutants. All 6 Gy mutants show total gene deletion. The chromosomes of the hprt mutants were analyzed by Whole Human Chromosome X Paint FISH or Xq telomere FISH. None of the point or partial gene deletion mutants showed aberrations of X-chromosome, however total gene deletion mutants induced translocations and dicentrics involving chromosome X. These results suggest that large deletion caused by DNA double strand breaks destabilizes chromosome structure, which may be involved in an induction of radiation-induced genomic instability

  13. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    Science.gov (United States)

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  14. Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

    Science.gov (United States)

    Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

    2018-01-01

    Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

  15. A 50 bp deletion in the SOD1 promoter lowers enzyme expression but is not associated with ALS in Sweden.

    Science.gov (United States)

    Ingre, Caroline; Wuolikainen, Anna; Marklund, Stefan L; Birve, Anna; Press, Rayomand; Andersen, Peter M

    2016-01-01

    Mutations in the superoxide dismutase (SOD1) gene have been linked to amyotrophic lateral sclerosis (ALS). A 50 base pair (bp) deletion of SOD1 has been suggested to reduce transcription and to be associated with later disease onset in ALS. This study was aimed to reveal if the 50 bp deletion influenced SOD1 enzymatic activity, occurrence and phenotype of the disease in a Swedish ALS/control cohort. Blood samples from 512 Swedish ALS patients and 354 Swedish controls without coding SOD1 mutations were analysed for the 50 bp deletion allele. The enzymatic activity of SOD1 in erythrocytes was analysed and genotype-phenotype correlations were assessed. Results demonstrated that the genotype frequencies of the 50 bp deletion were all found to be in Hardy-Weinberg equilibrium. No significant differences were found for age of onset, disease duration or site of onset. SOD1 enzymatic activity showed a statistically significant decreasing trend in the control group, in which the allele was associated with a 5% reduction in SOD1 activity. The results suggest that the 50 bp deletion has a moderate reducing effect on SOD1 synthesis. No modulating effects, however, were found on ALS onset, phenotype and survival in the Swedish population.

  16. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    Science.gov (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  17. Detecting exact breakpoints of deletions with diversity in hepatitis B viral genomic DNA from next-generation sequencing data.

    Science.gov (United States)

    Cheng, Ji-Hong; Liu, Wen-Chun; Chang, Ting-Tsung; Hsieh, Sun-Yuan; Tseng, Vincent S

    2017-10-01

    Many studies have suggested that deletions of Hepatitis B Viral (HBV) are associated with the development of progressive liver diseases, even ultimately resulting in hepatocellular carcinoma (HCC). Among the methods for detecting deletions from next-generation sequencing (NGS) data, few methods considered the characteristics of virus, such as high evolution rates and high divergence among the different HBV genomes. Sequencing high divergence HBV genome sequences using the NGS technology outputs millions of reads. Thus, detecting exact breakpoints of deletions from these big and complex data incurs very high computational cost. We proposed a novel analytical method named VirDelect (Virus Deletion Detect), which uses split read alignment base to detect exact breakpoint and diversity variable to consider high divergence in single-end reads data, such that the computational cost can be reduced without losing accuracy. We use four simulated reads datasets and two real pair-end reads datasets of HBV genome sequence to verify VirDelect accuracy by score functions. The experimental results show that VirDelect outperforms the state-of-the-art method Pindel in terms of accuracy score for all simulated datasets and VirDelect had only two base errors even in real datasets. VirDelect is also shown to deliver high accuracy in analyzing the single-end read data as well as pair-end data. VirDelect can serve as an effective and efficient bioinformatics tool for physiologists with high accuracy and efficient performance and applicable to further analysis with characteristics similar to HBV on genome length and high divergence. The software program of VirDelect can be downloaded at https://sourceforge.net/projects/virdelect/. Copyright © 2017. Published by Elsevier Inc.

  18. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  19. Detection of genomic deletions in rice using oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Bordeos Alicia

    2009-03-01

    Full Text Available Abstract Background The induction of genomic deletions by physical- or chemical- agents is an easy and inexpensive means to generate a genome-saturating collection of mutations. Different mutagens can be selected to ensure a mutant collection with a range of deletion sizes. This would allow identification of mutations in single genes or, alternatively, a deleted group of genes that might collectively govern a trait (e.g., quantitative trait loci, QTL. However, deletion mutants have not been widely used in functional genomics, because the mutated genes are not tagged and therefore, difficult to identify. Here, we present a microarray-based approach to identify deleted genomic regions in rice mutants selected from a large collection generated by gamma ray or fast neutron treatment. Our study focuses not only on the utility of this method for forward genetics, but also its potential as a reverse genetics tool through accumulation of hybridization data for a collection of deletion mutants harboring multiple genetic lesions. Results We demonstrate that hybridization of labeled genomic DNA directly onto the Affymetrix Rice GeneChip® allows rapid localization of deleted regions in rice mutants. Deletions ranged in size from one gene model to ~500 kb and were predicted on all 12 rice chromosomes. The utility of the technique as a tool in forward genetics was demonstrated in combination with an allelic series of mutants to rapidly narrow the genomic region, and eventually identify a candidate gene responsible for a lesion mimic phenotype. Finally, the positions of mutations in 14 mutants were aligned onto the rice pseudomolecules in a user-friendly genome browser to allow for rapid identification of untagged mutations http://irfgc.irri.org/cgi-bin/gbrowse/IR64_deletion_mutants/. Conclusion We demonstrate the utility of oligonucleotide arrays to discover deleted genes in rice. The density and distribution of deletions suggests the feasibility of a

  20. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    Science.gov (United States)

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  1. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  2. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Strategies for state-dependent quantum deleting

    International Nuclear Information System (INIS)

    Song Wei; Yang Ming; Cao Zhuoliang

    2004-01-01

    A quantum state-dependent quantum deleting machine is constructed. We obtain a upper bound of the global fidelity on N-to-M quantum deleting from a set of K non-orthogonal states. Quantum networks are constructed for the above state-dependent quantum deleting machine when K=2. Our deleting protocol only involves a unitary interaction among the initial copies, with no ancilla. We also present some analogies between quantum cloning and deleting

  4. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  5. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    Science.gov (United States)

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  6. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    Science.gov (United States)

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  7. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  8. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  9. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  10. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  11. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations

    Science.gov (United States)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.

    2018-02-01

    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  12. Evidence of weak pair coupling in the penetration depth of bi-based high-Tc superconductors

    International Nuclear Information System (INIS)

    Thompson, J.R.; Sun, Yang Ren; Ossandon, J.G.; Christen, D.K.; Chakoumakos, B.C.; Sales, B.C.; Kerchner, H.R.; Sonder, E.

    1990-01-01

    The magnetic penetration depth λ(T) has been investigated in Bi(Pb)SrCaCuO high-T c compounds having 2- and 3-layers of copper-oxygen per unit cell. Studies of the magnetization in the vortex state were employed and the results were compared with weak and strong coupling calculations. The temperature dependence of λ is described well by BCS theory in the clean limit, giving evidence for weak pair coupling in this family of materials. For the short component of the λ tensor, we obtain values of 292 and 220 nm (T = 0) for Bi-2212 and (BiPb)-2223, respectively

  13. Genetic differentiation and forensic efficiency evaluation for Chinese Salar ethnic minority based on a 5-dye multiplex insertion and deletion panel.

    Science.gov (United States)

    Ma, Ruilin; Shen, Chunmei; Wei, Yuanyuan; Jin, Xiaoye; Guo, Yuxin; Mu, Yuling; Sun, Siqi; Chen, Chong; Cui, Wei; Wei, Zhaoming; Lian, Zhenmin

    2018-06-20

    The present study investigated the genetic diversities of 30 autosomal insertion and deletion (InDel) loci of Investigator DIPplex kit (Qiagen) in Chinese Salar ethnic minority and explored the genetic relationships between the studied Salar group and other populations. The allelic frequencies of deletion alleles at the 30 InDel loci were in the range of 0.1739 (HLD64) to 0.8478 (HLD39). The discrimination power, polymorphism information content and probability of exclusion ranged from 0.4101 (HLD39) to 0.6447 (HLD136), 0.2247 (HLD39) to 0.3750 (HLD92) and 0.0400 (HLD39) to 0.2806 (HLD92), respectively. The observed and expected heterozygosity were in the range of 0.2348 (HLD39) to 0.5913 (HLD92), and 0.2580 (HLD39) to 0.5000 (HLD92), respectively. The cumulative discrimination power and probability of exclusion of the 30 loci reached 0.999999999993418 and 0.99039, respectively. The results of population genetic differentiation comparisons revealed that Salar group had similar allele distributions with Qinghai Tibetan, Xibe and Yi groups. Population Bayesian cluster analysis showed that there were similar ancestry components between Salar group and most Chinese populations. Besides, the principal components analysis and phylogenetic reconstructions further indicated that Salar group had intimate genetic relationships with Qinghai Tibetan and Xibe groups. In short, the results of the current studies indicated the genetic distributions of the 30 InDel loci in Salar group were relatively high genetic polymorphisms, which could be used in forensic individual identifications and as a supplementary tool for complex paternity testing. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  15. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  16. The Effect of Think-Pair-Share-Write Based on Hybrid Learning on Metakognitive Skills, Creative Thinking and Cognitive Learning at SMA Negeri 3 Malang

    Directory of Open Access Journals (Sweden)

    Ika Yulianti Siregar

    2017-07-01

    Full Text Available The results of biology learning observation show that there are many constraints during the learning process in the class and consultation meeting between teacher and students. The think-pair-share-write based on hybrid learning was conducted to analyze the effect on metacognitive skills, creative thinking and learning outcomes. The research design was quasi experiment with pretest-posttest non-equivalent control group design. The independent variable is think-pair-share-write based on Hybrid learning model, while the dependent variables are metacognitive skills, creative thinking, and cognitive learning outcomes. Metacognitive skills are measured by using metacognitive rubrics. Creative thinking skills and cognitive learning outcomes are measured by using a description test. The data were taken by conducting pretest and posttest. The hypothesis test used was anakova with level of significance 0,05 (P <0,05, as the test result was significant then the test was continued to LSD. Before the anakova test, normality and homogeneity test were performed. The results showed that think-pair-share-write based on Hybrid Learning significantly affecting: 1 the metacognitive skills with F arithmetic of 183,472 and Sig. 0,000; 2 the creative thinking skill with F value of 325,111 and Sig. 0,000; 3 the cognitive learning outcomes with F arithmetic of 175.068 and Sig. 0,000.

  17. ATLAS DQ2 Deletion Service

    International Nuclear Information System (INIS)

    Oleynik, Danila; Petrosyan, Artem; Garonne, Vincent; Campana, Simone

    2012-01-01

    The ATLAS Distributed Data Management project DQ2 is responsible for the replication, access and bookkeeping of ATLAS data across more than 100 distributed grid sites. It also enforces data management policies decided on by the collaboration and defined in the ATLAS computing model. The DQ2 Deletion Service is one of the most important DDM services. This distributed service interacts with 3rd party grid middleware and the DQ2 catalogues to serve data deletion requests on the grid. Furthermore, it also takes care of retry strategies, check-pointing transactions, load management and fault tolerance. In this paper special attention is paid to the technical details which are used to achieve the high performance of service, accomplished without overloading either site storage, catalogues or other DQ2 components. Special attention is also paid to the deletion monitoring service that allows operators a detailed view of the working system.

  18. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  19. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    International Nuclear Information System (INIS)

    Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian

    2016-01-01

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers

  20. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)

    2016-09-15

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  1. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

    Science.gov (United States)

    Koh, Jansen

    2016-01-01

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  3. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  4. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    Science.gov (United States)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  5. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

    Science.gov (United States)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

    2018-01-01

    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  6. [Mechanism of treatment effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats based on metabolomic approach].

    Science.gov (United States)

    Cao, Hui-Ting; Zhu, Hua-Xu; Zhang, Qi-Chun; Guo, Li-Wei

    2017-06-01

    The metabolic effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats was studied by using metabolomic method. The rat model of ischemia reperfusion injury induced by introduction of transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Ultra high performance liquid chromatography-series four pole time of flight mass spectrometry method(UPLC-Q-TOF/MS), Markerlynx software, and principal component analysis and partial least-squares discriminant analysis were used to analyze the different endogenous metabolites among the urine samples of sham rats, cerebral ischemia model rats, Huanglian groups (HL), Huangqin groups (HQ) and Huanglian-Huangqin herb pairs groups (LQ) was achieved, combined with accurate information about the endogenous metabolites level and secondary fragment ions, retrieval and identification of possible biological markers, metabolic pathway which build in MetPA database. The 20 potential biomarkers were found in the urine of rats with cerebral ischemia, which mainly involved in the neurotransmitter regulation, amino acid metabolism, energy metabolism, lipid metabolism and so on. Those metabolic pathways were disturbed in cerebral ischemia model rats, the principal component analysis showed that the normal and cerebral ischemia model is clearly distinguished, and the compound can be given to the normal state of change after HL, HQ, LQ administration. This study index the interpretation of cerebral ischemia rat metabolism group and mechanism, the embodiment of metabonomics can reflect the physiological and metabolic state, which can better reflect the traditional Chinese medicine as a whole view, system view and the features of multi ingredient synergistic or antagonistic effects. Copyright© by the Chinese Pharmaceutical Association.

  7. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  8. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  9. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  10. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  11. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  12. Fast detection of deletion breakpoints using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Gulshara Abildinova

    2016-01-01

    Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

  13. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

    2014-01-01

    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  14. In vivo dynamics of enterovirus protease revealed by fluorescence resonance emission transfer (FRET) based on a novel FRET pair

    International Nuclear Information System (INIS)

    Hsu, Y.-Y.; Liu, Y.-N.; Wang Wenyen; Kao, Fu-Jen; Kung, S.-H.

    2007-01-01

    An in vivo protease assay suitable for analysis by fluorescence resonance energy transfer (FRET) was developed on the basis of a novel FRET pair. The specifically designed fusion substrate consists of green fluorescent protein 2 (GFP 2 )-peptide-red fluorescent protein 2 (DsRed2), with a cleavage motif for the enterovirus 2A protease (2A pro ) embedded within the peptide region. FRET can be readily visualized in real-time from cells expressing the fusion substrate until a proteolytic cleavage by 2A pro from the input virus. The level of FRET decay is a function of the amount and infection duration of the inoculated virus as measured by a fluorometer assay. The FRET biosensor also responded well to other related enteroviruses but not to a phylogenetically distant virus. Western blot analysis confirmed the physical cleavage of the fusion substrate upon the infections. The study provides proof of principle for applying the FRET technology to diagnostics, screening procedures, and cell biological research

  15. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

    Science.gov (United States)

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2016-01-01

    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  16. Spontaneous 8bp Deletion in Nbeal2 Recapitulates the Gray Platelet Syndrome in Mice

    Science.gov (United States)

    Tomberg, Kärt; Khoriaty, Rami; Westrick, Randal J.; Fairfield, Heather E.; Reinholdt, Laura G.; Brodsky, Gary L.; Davizon-Castillo, Pavel; Ginsburg, David; Di Paola, Jorge

    2016-01-01

    During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp) deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS), an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps) exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10−7). Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains. PMID:26950939

  17. Spontaneous 8bp Deletion in Nbeal2 Recapitulates the Gray Platelet Syndrome in Mice.

    Directory of Open Access Journals (Sweden)

    Kärt Tomberg

    Full Text Available During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS, an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10-7. Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains.

  18. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  19. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  20. An automated method for the analysis of phenolic acids in plasma based on ion-pairing micro-extraction coupled on-line to gas chromatography/mass spectrometry with in-liner derivatisation

    NARCIS (Netherlands)

    Peters, S.; Kaal, E.; Horsting, I.; Janssen, H.-G.

    2012-01-01

    A new method is presented for the analysis of phenolic acids in plasma based on ion-pairing ‘Micro-extraction in packed sorbent’ (MEPS) coupled on-line to in-liner derivatisation-gas chromatography-mass spectrometry (GC-MS). The ion-pairing reagent served a dual purpose. It was used both to improve

  1. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  2. A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

    Science.gov (United States)

    Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

    2012-12-01

    A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

  3. Tube Stent-Grafts for Infrarenal Aortic Aneurysm: A Matched-Paired Analysis Based on EUROSTAR Data

    International Nuclear Information System (INIS)

    Ruppert, Volker; Leurs, Lina J.; Hobo, Roel; Buth, Jacob; Rieger, Johannes; Umscheid, Thomas

    2007-01-01

    Objective. Tube stent-grafts for treatment of infrarenal aortic aneurysms (AAAs) are a nearly forgotten concept. For focal aortic pathologies tube stent-grafts may be a treatment option. We have performed a retrospective matched-paired analysis of the EUROSTAR registry regarding the outcome of tube vs. bifurcated stent-grafts for AAA. Tapered aortomonoiliac stent-grafts were not the objective of this study. Materials and methods. From July 1997 to June 2006, 7581 patients who underwent an endovascular AAA repair were entered in the EUROSTAR registry by 164 centers. One hundred fifty-three patients were treated with tube stent-grafts. For each of these 153 patients we selected one patient from a bifurcated stent-graft group (BGG-original, 7428 patients) matched according to gender, ASA, age, AAA diameter, and type of anesthesia. Differences in preoperative details between the two study groups were analyzed using chi-square test for discrete variables and Wilcoxon rank-sum test for continuous variables. Multivariate logistic regression analysis was performed on early complications. Midterm outcomes (>30 days) were analyzed by Kaplan-Meier and multivariate Cox proportional hazard model. Results. The duration of the procedure was shorter in the tube stent-graft group (TGG; 102.3 ± 52.2) than in BGG (128.3 ± 55.0; p 0.0002). Type II endoleak was less frequent in TGG (4.0%; mean follow-up, 23.12 ± 23.9 months) than in BGG (14.3%; mean follow-up, 20.77 ± 20.0 months; p = 0.0394). Type I endoleaks and migration were distributed equally, without significant differences between the groups. Combined 30-day and late mortality was higher for TGG (p = 0.0346) and was obviously not aneurysm related. Conclusions. We conclude that after selection of patients, tube stent-grafts for infrarenal aortic repair can be performed with great safety regarding endoleaks and migration. The combined higher 30-day mortality and non-aneurysm-related mortality during follow-up were mainly

  4. Matched molecular pair-based data sets for computer-aided medicinal chemistry [v1; ref status: indexed, http://f1000r.es/2w9

    Directory of Open Access Journals (Sweden)

    Ye Hu

    2014-02-01

    Full Text Available Matched molecular pairs (MMPs are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the latest release of the ChEMBL database for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community.

  5. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  6. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization

    Science.gov (United States)

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin

    2017-08-01

    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously.

  7. Variations in screening outcome among pairs of screening radiologists at non-blinded double reading of screening mammograms: a population-based study

    NARCIS (Netherlands)

    Klompenhouwer, E. G.; Duijm, L. E. M.; Voogd, A. C.; den Heeten, G. J.; Nederend, J.; Jansen, F. H.; Broeders, M. J. M.

    2014-01-01

    Substantial inter-observer variability in screening mammography interpretation has been reported at single reading. However, screening results of pairs of screening radiologists have not yet been published. We determined variations in screening performances among pairs of screening radiologists at

  8. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  9. Partial USH2A deletions contribute to Usher syndrome in Denmark.

    Science.gov (United States)

    Dad, Shzeena; Rendtorff, Nanna D; Kann, Erik; Albrechtsen, Anders; Mehrjouy, Mana M; Bak, Mads; Tommerup, Niels; Tranebjærg, Lisbeth; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth B

    2015-12-01

    Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment, progressive visual loss owing to retinitis pigmentosa and in some cases vestibular dysfunction. Usher syndrome is divided into three subtypes, USH1, USH2 and USH3. Twelve loci and eleven genes have so far been identified. Duplications and deletions in PCDH15 and USH2A that lead to USH1 and USH2, respectively, have previously been identified in patients from United Kingdom, Spain and Italy. In this study, we investigate the proportion of exon deletions and duplications in PCDH15 and USH2A in 20 USH1 and 30 USH2 patients from Denmark using multiplex ligation-dependent probe amplification (MLPA). Two heterozygous deletions were identified in USH2A, but no deletions or duplications were identified in PCDH15. Next-generation mate-pair sequencing was used to identify the exact breakpoints of the two deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.

  10. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  11. Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

    Science.gov (United States)

    Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

    2014-01-01

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

  12. Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

    Science.gov (United States)

    Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

    2014-08-01

    The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)

    2016-06-15

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  14. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    International Nuclear Information System (INIS)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki

    2016-01-01

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  15. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  16. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  17. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  18. The mitochondrial DNA 4,977-bp deletion and its implication in copy number alteration in colorectal cancer

    Science.gov (United States)

    2011-01-01

    Background Qualitative and quantitative changes in human mitochondrial DNA (mtDNA) have been implicated in various cancer types. A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging. Methods We conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China. In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients. Results We found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027). In patients with the 4,977 bp deletion, the deletion level decreased as the cancer stage advanced (p = 0.031). Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion. Such mtDNA content increase correlated with the levels of the 4,977 bp deletion and with cancer stage (p deletion may play a role in the early stage of colorectal cancer, and it is also implicated in alteration of mtDNA content in cancer cells. PMID:21232124

  19. Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

    2010-08-17

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  20. Unique TTC repeat base pair loss mutation in cases of pure neural leprosy: A survival strategy of Mycobacterium leprae?

    Directory of Open Access Journals (Sweden)

    Abhishek De

    2015-01-01

    Full Text Available Background: Genomic reduction helps obligate intracellular microbes to survive difficult host niches. Adaptation of Mycobacterium leprae in cases of pure neural leprosy (PNL in the intracellular niche of peripheral nerves can be associated with some gene loss. Recently, a stable but variable number of tandem repefzats (TTC have been reported in strains of M. leprae. FolP and rpoB genes are the two common mutation sites which deal with the susceptibility of the bacteria to drugs. Aim: We attempted to find if genomic reduction of M. leprae in context of these TTC repeats or mutations in folP1 and rpoB can be the reason for the restriction of M. leprae in the nerves in PNL. Materials and Methods: DNA extracts taken from fine needle aspiration of affected nerves of 24 PNL cases were studied for tandem repeats with 21TTC primer in multiplex-PCR. Mutations were also studied by PCR Amplification of SRDR (Sulphone Resistance Determining Region of the folP1 and multiple primer PCR amplification refractory mutation system (MARS of the rpoB. Results: Of the 24 PNL, only 1 patient showed mutation in the rpoB gene and none in the folp1 gene. Studying the mutation in TTC region of the M. leprae gene we found that all the cases have a loss of a few bases in the sequence. Conclusion: We can conclude that there is consistent loss in the bases in the TTC region in all cases of pure neural Hansen and we postulate that it may be an adaptive response of the bacteria to survive host niche resulting in its restriction to peripheral nerves.

  1. A Large PROP1 Gene Deletion in a Turkish Pedigree

    Directory of Open Access Journals (Sweden)

    Suheyla Gorar

    2018-01-01

    Full Text Available Pituitary-specific paired-like homeodomain transcription factor, PROP1, is associated with multiple pituitary hormone deficiency. Alteration of the gene encoding the PROP1 may affect somatotropes, thyrotropes, and lactotropes, as well as gonadotropes and corticotropes. We performed genetic analysis of PROP1 gene in a Turkish pedigree with three siblings who presented with short stature. Parents were first degree cousins. Index case, a boy, had somatotrope, gonadotrope, thyrotrope, and corticotrope deficiency. However, two elder sisters had somatotroph, gonadotroph, and thyrotroph deficiency and no corticotroph deficiency. On pituitary magnetic resonance, partial empty sella was detected with normal bright spot in all siblings. In genetic analysis, we found a gross deletion involving PROP1 coding region. In conclusion, we report three Turkish siblings with a gross deletion in PROP1 gene. Interestingly, although little boy with combined pituitary hormone deficiency has adrenocorticotropic hormone (ACTH deficiency, his elder sisters with the same gross PROP1 deletion have no ACTH deficiency. This finding is in line with the fact that patients with PROP1 mutations may have different phenotype/genotype correlation.

  2. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  3. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  4. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  5. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  6. Optical sensing system based on wireless paired emitter detector diode device and ionogels for lab-on-a-disc water quality analysis.

    Science.gov (United States)

    Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando

    2012-12-07

    This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.

  7. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  8. Highly Efficient One-Pot Synthesis of COS-Based Block Copolymers by Using Organic Lewis Pairs.

    Science.gov (United States)

    Yang, Jia-Liang; Cao, Xiao-Han; Zhang, Cheng-Jian; Wu, Hai-Lin; Zhang, Xing-Hong

    2018-01-31

    A one-pot synthesis of block copolymer with regioregular poly(monothiocarbonate) block is described via metal-free catalysis. Lewis bases such as guanidine, quaternary onium salts, and Lewis acid triethyl borane (TEB) were equivalently combined and used as the catalysts. By using polyethylene glycol (PEG) as the macromolecular chain transfer agent (CTA), narrow polydispersity block copolymers were obtained from the copolymerization of carbonyl sulfide (COS) and propylene oxide (PO). The block copolymers had a poly(monothiocarbonate) block with perfect alternating degree and regioregularity. Unexpectedly, the addition of CTA to COS/PO copolymerization system could dramatically improve the turnover frequency (TOF) of PO (up to 240 h -1 ), higher than that of the copolymerization without CTA. In addition, the conversion of CTA could be up to 100% in most cases, as revealed by ¹H NMR spectra. Of consequence, the number-average molecular weights ( M n s) of the resultant block copolymers could be regulated by varying the feed ratio of CTA to PO. Oxygen-sulfur exchange reaction (O/S ER), which can generate randomly distributed thiocarbonate and carbonate units, was effectively suppressed in all of the cases in the presence of CTA, even at 80 °C. This work presents a versatile method for synthesizing sulfur-containing block copolymers through a metal-free route, providing an array of new block copolymers.

  9. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  10. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  11. Growing Right Onto Wellness (GROW): a family-centered, community-based obesity prevention randomized controlled trial for preschool child-parent pairs.

    Science.gov (United States)

    Po'e, Eli K; Heerman, William J; Mistry, Rishi S; Barkin, Shari L

    2013-11-01

    Growing Right Onto Wellness (GROW) is a randomized controlled trial that tests the efficacy of a family-centered, community-based, behavioral intervention to prevent childhood obesity among preschool-aged children. Focusing on parent-child pairs, GROW utilizes a multi-level framework, which accounts for macro (i.e., built-environment) and micro (i.e., genetics) level systems that contribute to the childhood obesity epidemic. Six hundred parent-child pairs will be randomized to a 3-year healthy lifestyle intervention or a 3-year school readiness program. Eligible children are enrolled between ages 3 and 5, are from minority communities, and are not obese. The principal site for the GROW intervention is local community recreation centers and libraries. The primary outcome is childhood body mass index (BMI) trajectory at the end of the three-year study period. In addition to other anthropometric measurements, mediators and moderators of growth are considered, including genetics, accelerometry, and diet recall. GROW is a staged intensity intervention, consisting of intensive, maintenance, and sustainability phases. Throughout the study, parents build skills in nutrition, physical activity, and parenting, concurrently forming new social networks. Participants are taught goal-setting, self-monitoring, and problem solving techniques to facilitate sustainable behavior change. The GROW curriculum uses low health literacy communication and social media to communicate key health messages. The control arm is administered to both control and intervention participants. By conducting this trial in public community centers, and by implementing a family-centered approach to sustainable healthy childhood growth, we aim to develop an exportable community-based intervention to address the expanding public health crisis of pediatric obesity. © 2013.

  12. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  13. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    Science.gov (United States)

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  14. Use of a line-pair resolution phantom for comprehensive quality assurance of electronic portal imaging devices based on fundamental imaging metrics

    International Nuclear Information System (INIS)

    Gopal, Arun; Samant, Sanjiv S.

    2009-01-01

    Image guided radiation therapy solutions based on megavoltage computed tomography (MVCT) involve the extension of electronic portal imaging devices (EPIDs) from their traditional role of weekly localization imaging and planar dose mapping to volumetric imaging for 3D setup and dose verification. To sustain the potential advantages of MVCT, EPIDs are required to provide improved levels of portal image quality. Therefore, it is vital that the performance of EPIDs in clinical use is maintained at an optimal level through regular and rigorous quality assurance (QA). Traditionally, portal imaging QA has been carried out by imaging calibrated line-pair and contrast resolution phantoms and obtaining arbitrarily defined QA indices that are usually dependent on imaging conditions and merely indicate relative trends in imaging performance. They are not adequately sensitive to all aspects of image quality unlike fundamental imaging metrics such as the modulation transfer function (MTF), noise power spectrum (NPS), and detective quantum efficiency (DQE) that are widely used to characterize detector performance in radiographic imaging and would be ideal for QA purposes. However, due to the difficulty of performing conventional MTF measurements, they have not been used for routine clinical QA. The authors present a simple and quick QA methodology based on obtaining the MTF, NPS, and DQE of a megavoltage imager by imaging standard open fields and a bar-pattern QA phantom containing 2 mm thick tungsten line-pair bar resolution targets. Our bar-pattern based MTF measurement features a novel zero-frequency normalization scheme that eliminates normalization errors typically associated with traditional bar-pattern measurements at megavoltage x-ray energies. The bar-pattern QA phantom and open-field images are used in conjunction with an automated image analysis algorithm that quickly computes the MTF, NPS, and DQE of an EPID system. Our approach combines the fundamental advantages of

  15. The angiotensin converting enzyme insertion/deletion polymorphism and differences in fasting plasma glucose in Hindustani Surinamese, African Surinamese and ethnic Dutch: the population-based SUNSET-study

    NARCIS (Netherlands)

    van Valkengoed, Irene G. M.; Stronks, Karien; Hahntow, Ines N.; Hoekstra, Joost B. L.; Holleman, Frits

    2008-01-01

    We investigated the association between the angiotensin converting enzyme (ACE) insertion/deletion polymorphism and glycemic state. Diabetes mellitus, impaired fasting glucose and mean fasting glucose were not associated with genotype among Hindustani Surinamese, African Surinamese and Dutch

  16. 77 FR 31335 - Procurement List; Proposed Additions and Deletion

    Science.gov (United States)

    2012-05-25

    .... Services Service Type/Location: Laundry and Dry Cleaning Service, Buckley Air Force Base Lodging & Medical... products and services to the Procurement List that will be furnished by nonprofit agencies employing persons who are blind or have other severe disabilities, and deletes a service previously provided by such...

  17. First comparative approach to touchscreen-based visual object-location paired-associates learning in humans (Homo sapiens) and a nonhuman primate (Microcebus murinus).

    Science.gov (United States)

    Schmidtke, Daniel; Ammersdörfer, Sandra; Joly, Marine; Zimmermann, Elke

    2018-05-10

    A recent study suggests that a specific, touchscreen-based task on visual object-location paired-associates learning (PAL), the so-called Different PAL (dPAL) task, allows effective translation from animal models to humans. Here, we adapted the task to a nonhuman primate (NHP), the gray mouse lemur, and provide first evidence for the successful comparative application of the task to humans and NHPs. Young human adults reach the learning criterion after considerably less sessions (one order of magnitude) than young, adult NHPs, which is likely due to faster and voluntary rejection of ineffective learning strategies in humans and almost immediate rule generalization. At criterion, however, all human subjects solved the task by either applying a visuospatial rule or, more rarely, by memorizing all possible stimulus combinations and responding correctly based on global visual information. An error-profile analysis in humans and NHPs suggests that successful learning in NHPs is comparably based either on the formation of visuospatial associative links or on more reflexive, visually guided stimulus-response learning. The classification in the NHPs is further supported by an analysis of the individual response latencies, which are considerably higher in NHPs classified as spatial learners. Our results, therefore, support the high translational potential of the standardized, touchscreen-based dPAL task by providing first empirical and comparable evidence for two different cognitive processes underlying dPAL performance in primates. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  18. Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions

    Directory of Open Access Journals (Sweden)

    Puisieux Alain

    2003-10-01

    Full Text Available Abstract Background Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. Results We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC in peripheral blood mononuclear cells; the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Conclusion Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

  19. Analytic energy derivatives for the calculation of the first-order molecular properties using the domain-based local pair-natural orbital coupled-cluster theory

    Science.gov (United States)

    Datta, Dipayan; Kossmann, Simone; Neese, Frank

    2016-09-01

    The domain-based local pair-natural orbital coupled-cluster (DLPNO-CC) theory has recently emerged as an efficient and powerful quantum-chemical method for the calculation of energies of molecules comprised of several hundred atoms. It has been demonstrated that the DLPNO-CC approach attains the accuracy of a standard canonical coupled-cluster calculation to about 99.9% of the basis set correlation energy while realizing linear scaling of the computational cost with respect to system size. This is achieved by combining (a) localized occupied orbitals, (b) large virtual orbital correlation domains spanned by the projected atomic orbitals (PAOs), and (c) compaction of the virtual space through a truncated pair natural orbital (PNO) basis. In this paper, we report on the implementation of an analytic scheme for the calculation of the first derivatives of the DLPNO-CC energy for basis set independent perturbations within the singles and doubles approximation (DLPNO-CCSD) for closed-shell molecules. Perturbation-independent one-particle density matrices have been implemented in order to account for the response of the CC wave function to the external perturbation. Orbital-relaxation effects due to external perturbation are not taken into account in the current implementation. We investigate in detail the dependence of the computed first-order electrical properties (e.g., dipole moment) on the three major truncation parameters used in a DLPNO-CC calculation, namely, the natural orbital occupation number cutoff used for the construction of the PNOs, the weak electron-pair cutoff, and the domain size cutoff. No additional truncation parameter has been introduced for property calculation. We present benchmark calculations on dipole moments for a set of 10 molecules consisting of 20-40 atoms. We demonstrate that 98%-99% accuracy relative to the canonical CCSD results can be consistently achieved in these calculations. However, this comes with the price of tightening the

  20. Loss of BRCA1 or BRCA2 markedly increases the rate of base substitution mutagenesis and has distinct effects on genomic deletions

    DEFF Research Database (Denmark)

    Zamborszky, J.; Szikriszt, B.; Gervai, J. Z.

    2017-01-01

    -genome sequencing of multiple isogenic chicken DT40 cell clones to precisely determine the consequences of BRCA1/2 loss on all types of genomic mutagenesis. Spontaneous base substitution mutation rates increased sevenfold upon the disruption of either BRCA1 or BRCA2, and the arising mutation spectra showed strong...... of stalled replication forks as the cause of increased mutagenesis. The high rate of base substitution mutagenesis demonstrated by our experiments is likely to significantly contribute to the oncogenic effect of the inactivation of BRCA1 or BRCA2....

  1. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  2. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni; Riplinger, Christoph; Minenkov, Yury; Cavallo, Luigi; Auer, Alexander A.; Neese, Frank

    2017-01-01

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  3. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  4. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  5. Deletion at the GCNT2 Locus Causes Autosomal Recessive Congenital Cataracts.

    Science.gov (United States)

    Irum, Bushra; Khan, Shahid Y; Ali, Muhammad; Daud, Muhammad; Kabir, Firoz; Rauf, Bushra; Fatima, Fareeha; Iqbal, Hira; Khan, Arif O; Al Obaisi, Saif; Naeem, Muhammad Asif; Nasir, Idrees A; Khan, Shaheen N; Husnain, Tayyab; Riazuddin, Sheikh; Akram, Javed; Eghrari, Allen O; Riazuddin, S Amer

    2016-01-01

    The aim of this study is to identify the molecular basis of autosomal recessive congenital cataracts (arCC) in a large consanguineous pedigree. All participating individuals underwent a detailed ophthalmic examination. Each patient's medical history, particularly of cataracts and other ocular abnormalities, was compiled from available medical records and interviews with family elders. Blood samples were donated by all participating family members and used to extract genomic DNA. Genetic analysis was performed to rule out linkage to known arCC loci and genes. Whole-exome sequencing libraries were prepared and paired-end sequenced. A large deletion was found that segregated with arCC in the family, and chromosome walking was conducted to estimate the proximal and distal boundaries of the deletion mutation. Exclusion and linkage analysis suggested linkage to a region of chromosome 6p24 harboring GCNT2 (glucosaminyl (N-acetyl) transferase 2) with a two-point logarithm of odds score of 5.78. PCR amplifications of the coding exons of GCNT2 failed in individuals with arCC, and whole-exome data analysis revealed a large deletion on chromosome 6p in the region harboring GCNT2. Chromosomal walking using multiple primer pairs delineated the extent of the deletion to approximately 190 kb. Interestingly, a failure to amplify a junctional fragment of the deletion break strongly suggests an insertion in addition to the large deletion. Here, we report a novel insertion/deletion mutation at the GCNT2 locus that is responsible for congenital cataracts in a large consanguineous family.

  6. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  7. Application of Powell's analogy for the prediction of vortex-pairing sound in a low-Mach number jet based on time-resolved planar and tomographic PIV

    NARCIS (Netherlands)

    Violato, D.; Bryon, K.; Moore, P.; Scarano, F.

    2010-01-01

    This paper describes an experimental investigation by time-resolved planar and tomographic PIV on the sound production mechanism of vortex pairing of a transitional water-jet flow at Re=5000. The shear layer is characterized by axisymmetric vortex rings which undergo pairing with a varicose mode.

  8. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  9. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  10. Skin fibroblasts from a D-deletion type retinoblastoma patient are abnormally X-ray sensitive

    International Nuclear Information System (INIS)

    Weichselbaum, R.R.; Nove, J.; Little, J.B.

    1977-01-01

    Retinoblastoma is a rare malignant eye tumour that appears either spontaneously or in genetically predisposed persons. The latter group is composed of persons who inherit the tumour with a dominant mode of transmission (the familial type) and those who have a deletion in the long arm of chromosome 13 referred to as the D-deletion type. When this deletion is present it is observed in many somatic cells and is often associated with structural defects. Survivors of the genetic forms of retinoblastoma have an increased risk of the development of cancers at other sites. A single genetic locus is unlikely to predispose many somatic cells to tumour formation unless a fundamental molecular defect, possibly related to DNA repair, is present. In order to investigate this hypothesis a study was made of the in vitro X-ray sensitivity of skin fibroblasts derived from three retinoblastoma patients, comprising a pair of twins with the familial type accompanied by no gross chromosome abnormalities, and a patient with the D-deletion type. It was found that fibroblasts derived from the D-deletion patient were significantly more radiosensitive than those from the other two patients. X-ray survival curves are shown. It is concluded that skin fibroblasts derived from a patient with the D-deletion variant of retinoblastoma are abnormally radiosensitive. Future investigations may indicate a specific defect in molecular repair of DNA that will explain the predisposition of these patients to the development of other tumours. (U.K.)

  11. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  12. Do mtDNA Deletions Play a Role in the Development of Nasal Polyposis?

    Directory of Open Access Journals (Sweden)

    Arzu Tatar

    2014-04-01

    Full Text Available Objective:Nasal polyposis (NP is an inflammatory disease of the nasal mucosa and paranasal sinuses. Mitochondria are the cellular organelles which produce cellular energy by Oxidative Phosphorylation (OXPHOS, and they have own inheritance material, mtDNA. mtDNA is affected by reactive oxygen samples (ROS which are produced by both OXPHOS and the inflammatory process. The aim of this study was to investigate the 4977 bp and 7400 bp deletions of mtDNA in nasal polyposis tissue, and to indicate the possible association of mtDNA deletions with NP. Methods:Thirty-three patients, aged 15 to 65 years, with nasal polyposis were selected to be assessed for mitochondrial DNA deletions. The patients with possible mtDNA mutations due to mitochondrial disease, being treated with radiotherapy, of advanced age, with a familiar history, aspirin hypersensitivity, or a history of asthma, were excluded. Polyp excision surgery was applied to the treatment of the NP, and after histopathological diagnosis 1x1 cm of polyp tissue samples were used to isolate mtDNA. The 4977 bp and 7400 bp deletion regions, and two control regions of mtDNA were assessed by using four pairs of primers. DNA extractions from the NP tissues and peripheral blood samples of the patients were made, and then Polymerase Chain Reactions (PCR were made. PCR products were separated in 2% agarose gel.Results:No patient had either the 4977 bp deletion or the 7400 bp deletion in their NP tissue, and neither were these deletions evident in their peripheral blood. Two control sequences, one of them from a non-deleted region, and the other from a possible deletion region, were detected in the NP tissues and peripheral blood of all the patients.Conclusions:We had anticipated that some mtDNA deletion might have occurred in NP tissue due to the increased ROS levels caused by chronic inflammation, but we did not detect any deletion. Probably, the duration of inflammation in NP is insufficient to form mt

  13. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  14. Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

    Directory of Open Access Journals (Sweden)

    Gaosheng Luo

    2014-01-01

    Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

  15. Probabilistic cloning and deleting of quantum states

    International Nuclear Information System (INIS)

    Feng Yuan; Zhang Shengyu; Ying Mingsheng

    2002-01-01

    We construct a probabilistic cloning and deleting machine which, taking several copies of an input quantum state, can output a linear superposition of multiple cloning and deleting states. Since the machine can perform cloning and deleting in a single unitary evolution, the probabilistic cloning and other cloning machines proposed in the previous literature can be thought of as special cases of our machine. A sufficient and necessary condition for successful cloning and deleting is presented, and it requires that the copies of an arbitrarily presumed number of the input states are linearly independent. This simply generalizes some results for cloning. We also derive an upper bound for the success probability of the cloning and deleting machine

  16. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    International Nuclear Information System (INIS)

    Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  17. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ibanez, Maria; Sancho, Juan V. [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain); Hernandez, Felix, E-mail: felix.hernandez@qfa.uji.es [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain)

    2009-09-01

    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg{sup -1}. Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg{sup -1}. In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg{sup -1}, were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  18. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Ibanez, Maria; Sancho, Juan V.; Hernandez, Felix

    2009-01-01

    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg -1 . Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg -1 . In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg -1 , were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  19. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  20. Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.

    Science.gov (United States)

    Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B

    2010-05-14

    Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  1. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  2. Oncolytic Replication of E1b-Deleted Adenoviruses

    Directory of Open Access Journals (Sweden)

    Pei-Hsin Cheng

    2015-11-01

    Full Text Available Various viruses have been studied and developed for oncolytic virotherapies. In virotherapy, a relatively small amount of viruses used in an intratumoral injection preferentially replicate in and lyse cancer cells, leading to the release of amplified viral particles that spread the infection to the surrounding tumor cells and reduce the tumor mass. Adenoviruses (Ads are most commonly used for oncolytic virotherapy due to their infection efficacy, high titer production, safety, easy genetic modification, and well-studied replication characteristics. Ads with deletion of E1b55K preferentially replicate in and destroy cancer cells and have been used in multiple clinical trials. H101, one of the E1b55K-deleted Ads, has been used for the treatment of late-stage cancers as the first approved virotherapy agent. However, the mechanism of selective replication of E1b-deleted Ads in cancer cells is still not well characterized. This review will focus on three potential molecular mechanisms of oncolytic replication of E1b55K-deleted Ads. These mechanisms are based upon the functions of the viral E1B55K protein that are associated with p53 inhibition, late viralmRNAexport, and cell cycle disruption.

  3. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome

    Science.gov (United States)

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.

    2008-01-01

    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  4. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  5. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    Science.gov (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  6. A FRET-based probe for epidermal growth factor receptor bound non-covalently to a pair of synthetic amphipathic helixes

    International Nuclear Information System (INIS)

    Itoh, Reina E.; Kurokawa, Kazuo; Fujioka, Aki; Sharma, Alok; Mayer, Bruce J.; Matsuda, Michiyuki

    2005-01-01

    Epidermal growth factor (EGF) receptor plays a pivotal role in a variety of cellular functions, such as proliferation, differentiation, and migration. To monitor the EGF receptor (EGFR) activity in living cells, we developed a probe for EGFR activity based on the principle of fluorescence resonance energy transfer (FRET). Previously, we developed a probe designated as Picchu (Phosphorylation indicator of the CrkII chimeric unit), which detects the tyrosine phosphorylation of the CrkII adaptor protein. We used a pair of synthetic amphipathic helixes, WinZipA2 and WinZipB1, to bind Picchu non-covalently to the carboxyl-terminus of the EGFR. Using this modified probe named Picchu-Z, the activity of EGFR was followed in EGF-stimulated Cos7 cells. We found that a high level of tyrosine phosphorylation of Picchu-Z probe remained after endocytosis until the point when the EGFR was translocated to the perinuclear region. These findings are in agreement with the previously reported 'signaling endosome' model. Furthermore, by pulse stimulation with EGF and by acute ablation of EGFR activity with AG1478, it was suggested that the phosphorylation of Picchu-Z probe, and probably the phosphorylation of EGFR also, underwent a rapid equilibrium (τ 1/2 < 2 min) between the phosphorylated and dephosphorylated states in the presence of EGF

  7. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  8. Assessment of the Coordination Ability of Sustainable Social-Ecological Systems Development Based on a Set Pair Analysis: A Case Study in Yanchi County, China

    Directory of Open Access Journals (Sweden)

    Ya Wang

    2016-08-01

    Full Text Available Sandy desertification is one of the most severe ecological problems in the world. Essentially, it is land degradation caused by discordance in the Social-Ecological Systems (SES. The ability to coordinate SES is a principal characteristic of regional sustainable development and a key factor in desertification control. This paper directly and comprehensively evaluates the ability to coordinate SES in the desertification reversal process. Assessment indicators and standards for SES have been established using statistical data and materials from government agencies. We applied a coordinated development model based on Identical-Discrepancy-Contrary (IDC situational ranking of a Set Pair Analysis (SPA to analyze the change in Yanchi County’s coordination ability since it implemented the grazing prohibition policy. The results indicated that Yanchi County was basically in the secondary grade of the national sustainable development level, and the subsystems’ development trend was relatively stable. Coordinate ability increased from 0.686 in 2003 to 0.957 in 2014 and experienced “weak coordination to basic coordination to high coordination” development processes. We concluded that drought, the grazing prohibition dilemma and the ecological footprint were key factors impeding the coordination of SES development in this area. These findings should provide information about desertification control and ecological policy implementation to guarantee sustainable rehabilitation.

  9. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  10. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  11. Novel Validated RP-HPLC Method for Bendamustine Hydrochloride Based on Ion-pair Chromatography: Application in Determining Infusion Stability and Pharmacokinetics.

    Science.gov (United States)

    Singh, Yuvraj; Chandrashekar, Anumandla; Pawar, Vivek K; Saravanakumar, Veeramuthu; Meher, Jayagopal; Raval, Kavit; Singh, Pankaj; Kumar, R Dinesh; Chourasia, Manish K

    2017-01-01

    Ion pair chromatography was used for quantifying bendamustine hydrochloride (BH) in its marketed vial. The permissive objective was to investigate time duration for which highly susceptible drug content of the marketed vial remained stable after reconstitution. However, the method could also be used to measure extremely low levels of drug in rat plasma and a pharmacokinetic study was accordingly conducted to further showcase method's applicability. Optimized separation was achieved on C-18 Purospher ® STAR (250 mm × 4.6 mm, 5 μm particle size) column. Mobile phase flowing at 1.5 mL/min consisted of 5 mM sodium salt of octane sulfonic acid dissolved in methanol, water and glacial acetic acid (55:45:0.075) maintained at pH 6. Detection was carried out at 233 nm with BH eluting after 7.8 min. Validation parameters were determined as per ICH guidelines. Limit of detection and limit of quantification were found to be 0.1 µg/mL and 0.33 µg/mL, respectively. The recoveries were 98-102% in bulk and 85-91% in plasma. The developed method was specific for BH, and utilized for assessing its short-term stability in physiologic solvents and forced degradation products in acid, base, oxidative, light and temperature induced stress environments. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  13. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  14. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

  15. Uptake and predictors of early postnatal follow-up care amongst mother-baby pairs in South Africa: Results from three population-based surveys, 2010-2013.

    Science.gov (United States)

    Larsen, Anna; Cheyip, Mireille; Aynalem, Getahun; Dinh, Thu-Ha; Jackson, Debra; Ngandu, Nobubelo; Chirinda, Witness; Mogashoa, Mary; Kindra, Gupreet; Lombard, Carl; Goga, Ameena

    2017-12-01

    Achieving World Health Organization (WHO) recommendations for postnatal care (PNC) within the first few weeks of life is vital to eliminating early mother-to-child transmission of HIV (MTCT) and improving infant health. Almost half of the annual global deaths among children under five occur during the first six weeks of life. This study aims to identify uptake of three PNC visits within the first six weeks of life as recommended by WHO among South African mother-infant pairs, and factors associated with uptake. We analyzed data from three facility-based, nationally representative surveys (2010, 2011/12 and 2012/13) primarily designed to determine the effectiveness of the South African program to prevent MTCT. This analysis describes the proportion of infants achieving the WHO recommendation of at least 3 PNC visits. Interviews from 27 699 HIV-negative and HIV-positive mothers of infants aged 4-8 weeks receiving their six week immunization were included in analysis. Data were analyzed using STATA 13.0 and weighted for sample ascertainment and South African live births. We fitted a multivariable logistic regression model to estimate factors associated with early PNC uptake. Over half (59.6%, 95% confidence interval (CI) = 59.0-60.3) of mother-infant pairs received the recommended three PNC visits during the first 6 weeks; uptake was 63.1% (95% CI = 61.9-64.3) amongst HIV exposed infants and 58.1% (95% CI = 57.3-58.9) amongst HIV unexposed infants. Uptake of early PNC improved significantly with each survey, but varied significantly by province. Multivariable analysis of the pooled data, controlling for survey year, demonstrated that number of antenatal visits (4+ vs 12 weeks, aOR = 1.13, 95% CI = 1.04-1.23), place of delivery (clinic vs hospital aOR = 1.5, 1.3-1.6), and infant HIV exposure (exposed vs unexposed aOR = 1.2, 95% CI = 1.1-1.2) were the key factors associated with receiving recommended PNC visits. Approximately 40% of

  16. Combinatorial DNA Damage Pairing Model Based on X-Ray-Induced Foci Predicts the Dose and LET Dependence of Cell Death in Human Breast Cells

    Energy Technology Data Exchange (ETDEWEB)

    Vadhavkar, Nikhil [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Pham, Christopher [University of Texas, Houston, TX (United States). MD Anderson Cancer Center; Georgescu, Walter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Deschamps, Thomas [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Heuskin, Anne-Catherine [Univ. of Namur (Belgium). Namur Research inst. for Life Sciences (NARILIS), Research Center for the Physics of Matter and Radiation (PMR); Tang, Jonathan [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Costes, Sylvain V. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.

    2014-09-01

    are based on experimental RIF and are three times larger than the hypothetical LEM voxel used to fit survival curves. Our model is therefore an alternative to previous approaches that provides a testable biological mechanism (i.e., RIF). In addition, we propose that DSB pairing will help develop more accurate alternatives to the linear cancer risk model (LNT) currently used for regulating exposure to very low levels of ionizing radiation.

  17. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  18. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  19. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    OpenAIRE

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2014-01-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

  20. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  1. Experimental dem Extraction from Aster Stereo Pairs and 3d Registration Based on Icesat Laser Altimetry Data in Upstream Area of Lambert Glacier, Antarctica

    Science.gov (United States)

    Hai, G.; Xie, H.; Chen, J.; Chen, L.; Li, R.; Tong, X.

    2017-09-01

    DEM Extraction from ASTER stereo pairs and three-dimensional registration by reference to ICESat laser altimetry data are carried out in upstream area of Lambert Glacier, East Antarctica. Since the study area is located in inland of East Antarctica where few textures exist, registration between DEM and ICESat data is performed. Firstly, the ASTER DEM generation is based on rational function model (RFM) and the procedure includes: a) rational polynomial coefficient (RPC) computation from ASTER metadata, b) L1A image product de-noise and destriping, c) local histogram equalization and matching, d) artificial collection of tie points and bundle adjustment, and e) coarse-to-fine hierarchical matching of five levels and grid matching. The matching results are filtered semi-automatically. Hereafter, DEM is interpolated using spline method with ground points converted from matching points. Secondly, the generated ASTER DEM is registered to ICESat data in three-dimensional space after Least-squares rigid transformation using singular value decomposition (SVD). The process is stated as: a) correspondence selection of terrain feature points from ICESat and DEM profiles, b) rigid transformation of generated ASTER DEM using selected feature correspondences based on least squares technique. The registration shows a good result that the elevation difference between DEM and ICESat data is low with a mean value less than 2 meters and the standard deviation around 7 meters. This DEM is generated and specially registered in Antarctic typical region without obvious ground rock control points and serves as true terrain input for further radar altimetry simulation.

  2. Micellar and analytical implications of a new potentiometric PVC sensor based on neutral ion-pair complexes of dodecylmethylimidazolium bromide-sodium dodecylsulfate.

    Science.gov (United States)

    Sanan, Reshu; Mahajan, Rakesh Kumar

    2013-03-15

    With an aim to characterize the micellar aggregates of imidazolium based ionic liquids, a new potentiometric PVC sensor based on neutral ion-pair complexes of dodecylmethylimidazolium bromide-sodium dodecylsulfate (C12MeIm(+)DS(-)) has been developed. The electrode exhibited a linear response for the concentration range of 7.9×10(-5)-9.8×10(-3) M with a super-Nernstian slope of 92.94 mV/decade, a response time of 5 s and critical micellar concentration (cmc) of 10.09 mM for C12MeImBr. The performance of the electrode in investigating the cmc of C12MeImBr in the presence of two drugs [promazine hydrochloride (PMZ) and promethazine hydrochloride (PMT)] and three triblock copolymers (P123, L64 and F68) has been found to be satisfactory on comparison with conductivity measurements. Various micellar parameters have been evaluated for the binary mixtures of C12MeImBr with drugs and triblock copolymers using Clint's, Rubingh's, and Motomura's approach. Thus the electrode offers a simple, straightforward and relatively fast technique for the characterization of micellar aggregates of C12MeImBr, complementing existing conventional techniques. Further, the analytical importance of proposed C12MeIm(+)-ISE as end point indicator in potentiometric titrations and for direct determination of cationic surfactants [cetylpyridinium chloride (CPC), tetradecyltrimethylammonium bromide (TTAB), benzalkonium chloride (BC)] in some commercial products was judged by comparing statistically with classical two-phase titration methods. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

    Science.gov (United States)

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

    2017-09-29

    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. ErasuCrypto: A Light-weight Secure Data Deletion Scheme for Solid State Drives

    Directory of Open Access Journals (Sweden)

    Liu Chen

    2017-01-01

    Full Text Available Securely deleting invalid data from secondary storage is critical to protect users’ data privacy against unauthorized accesses. However, secure deletion is very costly for solid state drives (SSDs, which unlike hard disks do not support in-place update. When applied to SSDs, both erasure-based and cryptography-based secure deletion methods inevitably incur large amount of valid data migrations and/or block erasures, which not only introduce extra latency and energy consumption, but also harm SSD lifetime.

  5. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  6. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  7. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium-Based Ionic Liquid Ion Pairs and the Application of Molecular Electrostatic Potential in Their Ionic Crystal Density Determination: A Comparative Study Using Density Functional Approach.

    Science.gov (United States)

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh

    2018-01-11

    A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with

  8. Average glandular dose in paired digital mammography and digital breast tomosynthesis acquisitions in a population based screening program: effects of measuring breast density, air kerma and beam quality

    Science.gov (United States)

    Helge Østerås, Bjørn; Skaane, Per; Gullien, Randi; Catrine Trægde Martinsen, Anne

    2018-02-01

    The main purpose was to compare average glandular dose (AGD) for same-compression digital mammography (DM) and digital breast tomosynthesis (DBT) acquisitions in a population based screening program, with and without breast density stratification, as determined by automatically calculated breast density (Quantra™). Secondary, to compare AGD estimates based on measured breast density, air kerma and half value layer (HVL) to DICOM metadata based estimates. AGD was estimated for 3819 women participating in the screening trial. All received craniocaudal and mediolateral oblique views of each breasts with paired DM and DBT acquisitions. Exposure parameters were extracted from DICOM metadata. Air kerma and HVL were measured for all beam qualities used to acquire the mammograms. Volumetric breast density was estimated using Quantra™. AGD was estimated using the Dance model. AGD reported directly from the DICOM metadata was also assessed. Mean AGD was 1.74 and 2.10 mGy for DM and DBT, respectively. Mean DBT/DM AGD ratio was 1.24. For fatty breasts: mean AGD was 1.74 and 2.27 mGy for DM and DBT, respectively. For dense breasts: mean AGD was 1.73 and 1.79 mGy, for DM and DBT, respectively. For breasts of similar thickness, dense breasts had higher AGD for DM and similar AGD for DBT. The DBT/DM dose ratio was substantially lower for dense compared to fatty breasts (1.08 versus 1.33). The average c-factor was 1.16. Using previously published polynomials to estimate glandularity from thickness underestimated the c-factor by 5.9% on average. Mean AGD error between estimates based on measurements (air kerma and HVL) versus DICOM header data was 3.8%, but for one mammography unit as high as 7.9%. Mean error of using the AGD value reported in the DICOM header was 10.7 and 13.3%, respectively. Thus, measurement of breast density, radiation dose and beam quality can substantially affect AGD estimates.

  9. Seven gene deletions in seven days

    DEFF Research Database (Denmark)

    Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering ...

  10. Analysis of human HPRT- deletion mutants by the microarray-CGH (comparative genomic hybridization)

    International Nuclear Information System (INIS)

    Kodaira, M.; Sasaki, K.; Tagawa, H.; Omine, H.; Kushiro, J.; Takahashi, N.; Katayama, H.

    2003-01-01

    We are trying to evaluate genetic effects of radiation on human using mutation frequency as an indicator. For the efficient detection of mutations, it is important to understand the mechanism and the characteristics of radiation-induced mutations. We have started the analysis of hypoxanthine-guanine phosphoribosyl transferase (HPRT) mutants induced by X-ray in order to clarify the deletion size and the mutation-distribution. We analyzed 39 human X-ray induced HPRT-deletion mutants by using the microarray-CGH. The array for this analysis contains 57 BAC clones covering as much as possible of the 4Mb of the 5' side and 10Mb of the 3' side of the HPRT gene based on the NCBI genome database. DNA from parent strain and each HPRT-mutant strain are labeled with Cy5 and Cy3 respectively, and were mixed and hybridized on the array. Fluorescent intensity ratio of the obtained spots was analyzed using software we developed to identify clones corresponding to the deletion region. The deletion in these strains ranged up to 3.5 Mb on the 5' side and 6 Mb on the 3' side of the HPRT gene. Deletions in 13 strains ended around BAC clones located at about 3 Mb on the 5' side. On the 3' side, deletions extended up to the specific clones located at 1.5 Mb in 11 strains. The mutations seem to be complex on the 3' end of deletion; some accompanied duplications with deletions and others could not be explained by one mutation event. We need to confirm these results, taking into account the experimental reproducibility and the accuracy of the published genetic map. The results of the research using the microarray-CGH help us to search the regions where deletions are easily induced and to identify the factors affecting the range of deletions

  11. Ehlers-Danlos Syndrome type IV: a multi-exon deletion in one of the two COL3A1 alleles affecting structure, stability, and processing of type III procollagen

    International Nuclear Information System (INIS)

    Superti-Furga, A.; Gugler, E.; Gitzelmann, R.; Steinmann, B.

    1988-01-01

    The authors have studied a patient with severe, dominantly inherited Ehlers-Danlos syndrome type IV. The results indicate that this patient carries a deletion of 3.3 kilobase pairs in the triple helical coding domain of one of the two alleles for the pro-α-chains of type III collagen (COL3A1). His cultured skin fibroblasts contain equal amounts of normal length mRNA and of mRNA shortened by approximately 600 bases, and synthesize both normal and shortened pro-α1(III)-chains. In procollagen molecules containing one or more shortened chains, a triple helix is formed with a length of only about 780 amino acids. The mutant procollagen molecules have decreased thermal stability, are less efficiently secreted, and are not processed as their normal counterpart. The deletion in this family is the first mutation to be described in COL3A1

  12. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  13. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  14. Conditional Deletion of Pten Causes Bronchiolar Hyperplasia