Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.
2014-01-01
We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,
Directory of Open Access Journals (Sweden)
Hsin-Ming Liu
2012-08-01
Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.
Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.
1994-01-01
The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair
Deletions induced by gamma rays in the genome of Escherichia coli
International Nuclear Information System (INIS)
Raha, Manidipa; Hutchinson, Franklin
1991-01-01
An Escherichia coli lysogen was constructed with a lambda phage bearing a lacZ gene surrounded by about 100 x 10 3 base-pairs of dispensable DNA. The lacZ mutants induced by gamma rays in this lysogen were more than 10% large deletions, ranging in size from 0.6 x 10 -3 to 70 x 10 3 base-pairs. These deletions were centered, not on lacZ, but on a ColE1 origin of DNA replication located 1.2 x 10 3 bases downstream from lacZ, suggesting that this origin of replication was involved in the process by which deletions were formed. In agreement with this hypothesis, a lysogen of the same phage without the ColE1 origin showed a very much lower percentage of radiation-induced deletions, as did a second lysogen of a lambda phage without any known plasmid origin of replication. Indirect evidence is presented for radiation-induced deletions centered on the lambda origin of DNA replication in a lysogen. (author)
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
Directory of Open Access Journals (Sweden)
Kozmin Stanislav G
2005-06-01
Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.
Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu
2012-01-01
P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Microarray-based ultra-high resolution discovery of genomic deletion mutations
2014-01-01
Background Oligonucleotide microarray-based comparative genomic hybridization (CGH) offers an attractive possible route for the rapid and cost-effective genome-wide discovery of deletion mutations. CGH typically involves comparison of the hybridization intensities of genomic DNA samples with microarray chip representations of entire genomes, and has widespread potential application in experimental research and medical diagnostics. However, the power to detect small deletions is low. Results Here we use a graduated series of Arabidopsis thaliana genomic deletion mutations (of sizes ranging from 4 bp to ~5 kb) to optimize CGH-based genomic deletion detection. We show that the power to detect smaller deletions (4, 28 and 104 bp) depends upon oligonucleotide density (essentially the number of genome-representative oligonucleotides on the microarray chip), and determine the oligonucleotide spacings necessary to guarantee detection of deletions of specified size. Conclusions Our findings will enhance a wide range of research and clinical applications, and in particular will aid in the discovery of genomic deletions in the absence of a priori knowledge of their existence. PMID:24655320
Detection of three-base deletion by exciplex formation with perylene derivatives.
Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki
2011-06-14
Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Directory of Open Access Journals (Sweden)
Michael F Sloma
2017-11-01
Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Sloma, Michael F; Mathews, David H
2017-11-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Ku80-deleted cells are defective at base excision repair
International Nuclear Information System (INIS)
Li, Han; Marple, Teresa; Hasty, Paul
2013-01-01
Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H 2 O 2 and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs
Ku80-deleted cells are defective at base excision repair
Energy Technology Data Exchange (ETDEWEB)
Li, Han [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain); Marple, Teresa [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain)
2013-05-15
Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H{sub 2}O{sub 2} and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs.
The rates and patterns of deletions in the human factor IX gene
Energy Technology Data Exchange (ETDEWEB)
Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))
1994-02-01
Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.
2011-09-20
respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI
Directory of Open Access Journals (Sweden)
Anne Wöhlke
2011-10-01
Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.
Dual entanglement measures based on no local cloning and no local deleting
International Nuclear Information System (INIS)
Horodecki, Michal; Sen, Aditi; Sen, Ujjwal
2004-01-01
The impossibility of cloning and deleting of unknown states constitute important restrictions on processing of information in the quantum world. On the other hand, a known quantum state can always be cloned or deleted. However, if we restrict the class of allowed operations, there will arise restrictions on the ability of cloning and deleting machines. We have shown that cloning and deleting of known states is in general not possible by local operations. This impossibility hints at quantum correlation in the state. We propose dual measures of quantum correlation based on the dual restrictions of no local cloning and no local deleting. The measures are relative entropy distances of the desired states in a (generally impossible) perfect local cloning or local deleting process from the best approximate state that is actually obtained by imperfect local cloning or deleting machines. Just like the dual measures of entanglement cost and distillable entanglement, the proposed measures are based on important processes in quantum information. We discuss their properties. For the case of pure states, estimations of these two measures are also provided. Interestingly, the entanglement of cloning for a maximally entangled state of two two-level systems is not unity
Identification of a Novel Deletion in AVP-NPII Gene in a Patient with Central Diabetes Insipidus.
Deniz, Ferhat; Acar, Ceren; Saglar, Emel; Erdem, Beril; Karaduman, Tugce; Yonem, Arif; Cagiltay, Eylem; Ay, Seyit Ahmet; Mergen, Hatice
2015-01-01
Central Diabetes Insipidus (CDI) is caused by a deficiency of antidiuretic hormone and characterized by polyuria, polydipsia and inability to concentrate urine. Our objective was to present the results of the molecular analyses of AVP-neurophysin II (AVP-NPII) gene in a large familial neurohypophyseal (central) DI pedigree. A male patient and his family members were analyzed and the prospective clinical data were collected. The proband applied to hospital for eligibility to be a recruit in Armed Forces. The patient had severe polyuria (20 L/day), polydipsia (20.5 L/day), fatique, and deep thirstiness. CDI was confirmed with the water deprivation-desmopressin test according to an increase in urine osmolality from 162 mOsm/kg to 432 mOsm/kg after desmopressin acetate injection. To evaluate the coding regions of AVP-NPII gene, polymerase chain reactions were performed and amplified regions were submitted to direct sequence analysis. We detected a heterozygous three base pair deletion at codon 69-70 (207_209delGGC) in exon 2, which lead to a deletion of the amino acid alanine. A three-dimensional protein structure prediction was shown for the deleted AVP-NPII and compared with the wild type. The three base pair deletion may yield an abnormal AVP precursor in neurophysin moiety, but further functional analyses are needed to understand the function of the deleted protein. © 2015 by the Association of Clinical Scientists, Inc.
Radical-pair based avian magnetoreception
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
Spontaneous and mutagen-induced deletions: mechanistic studies in Salmonella tester strain TA102
International Nuclear Information System (INIS)
Levin, D.E.; Marnett, L.J.; Ames, B.N.
1984-01-01
Salmonella tester strain TA102 carries the hisG428 ochre mutation on the multicopy plasmid pAQ1. DNA sequence analysis of 45 spontaneous revertants of hisG428 on the chromosome in the presence of pKM101 (strain TA103) indicates that hisG428 revertants fall into three major categories: (i) small, in-frame deletions (3 or 6 base pairs) that remove part or all of the ochre triplet; (ii) base substitution mutations at the ochre site; (iii) extragenic ochre suppressors. Deletion revertants are identified in a simple phenotypic screen by their resistance to the inhibitory histidine analog thiazolealanine, which feedback inhibits the wild-type hisG enzyme but not the enzyme resulting from the deletions. The effect of various genetic backgrounds on the generation of spontaneous deletion revertants was examined. The presence of a uvrB mutation or a recA mutation suppressed the generation of spontaneous deletion revertants to approximately 1/2.5. When hisG428 was in multiple copies on pAQ1, the frequency of spontaneous deletion revertants increased by 40-fold, which is the approximate copy number of pAQ1. Mutagenic agents that induce single-strand breaks in DNA (e.g., x-rays, bleomycin, and nalidixic acid) induced deletion revertants in TA102. These agents induced deletion revertants only in hisG428 on pAQ1 and only in the presence of pKM101. Deletion revertants were not induced by frameshift mutagens (i.e., ICR-191 and 9aminoacridine). These results indicate that different pathways exist for the generation of spontaneous and mutagen-induced deletion revertants of hisG428. 41 references, 2 figures, 3 tables
Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.
2013-01-01
Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905
Kim, Kyung-Ju; Lee, Tae Hun; Kim, Jung Ho; Cho, Nam-Yun; Kim, Woo Ho; Kang, Gyeong Hoon
2017-09-01
Deletion of the HSP110 T 17 mononucleotide repeat has recently been identified as a prognostic marker that is correlated with wild-type HSP110 (HSP110wt) expression in microsatellite instability-high (MSI-H) colorectal cancers. The aim of this study was to assess the correlation between deletion of the HSP110 T 17 repeat and expression of HSP110wt using DNA testing and immunohistochemistry and to determine the prognostic implications of HSP110 T 17 deletion in MSI-H advanced gastric cancers (GCs). The status of HSP110wt expression was evaluated by immunohistochemistry using an HSP110wt-specific antibody in 142 MSI-H advanced GCs. The size of the HSP110 T 17 repeat deletion was analyzed in 96 MSI-H advanced GCs; deletions were divided into small (0-2base pairs) and large deletions (3-5base pairs). Low and high expressions of HSP110wt were detected in 38 (26.8%) and 104 (73.2%) of the 142 cases, respectively. The HSP110 T 17 deletion was observed in 45 (46.9%) of the 96 MSI-H GC samples. Tumors with high expression of HSP110wt showed a tendency to have small or no deletion of HSP110 T 17 . In Kaplan-Meier survival analysis, tumors with a large HSP110 T 17 deletion were associated with favorable overall survival and disease-free survival compared with those with small/no deletion of HSP110 T 17 . However, HSP110 T 17 deletion size was not an independent prognostic factor in multivariate analysis. In summary, deletion of the HSP110 T 17 repeat was frequently observed in MSI-H GCs, and HSP110 T 17 deletion size was inversely correlated with HSP110wt expression status. Large HSP110 T 17 was not a prognostic indicator in MSI-H GCs. Copyright © 2017 Elsevier Inc. All rights reserved.
Deletion at the GCNT2 Locus Causes Autosomal Recessive Congenital Cataracts.
Irum, Bushra; Khan, Shahid Y; Ali, Muhammad; Daud, Muhammad; Kabir, Firoz; Rauf, Bushra; Fatima, Fareeha; Iqbal, Hira; Khan, Arif O; Al Obaisi, Saif; Naeem, Muhammad Asif; Nasir, Idrees A; Khan, Shaheen N; Husnain, Tayyab; Riazuddin, Sheikh; Akram, Javed; Eghrari, Allen O; Riazuddin, S Amer
2016-01-01
The aim of this study is to identify the molecular basis of autosomal recessive congenital cataracts (arCC) in a large consanguineous pedigree. All participating individuals underwent a detailed ophthalmic examination. Each patient's medical history, particularly of cataracts and other ocular abnormalities, was compiled from available medical records and interviews with family elders. Blood samples were donated by all participating family members and used to extract genomic DNA. Genetic analysis was performed to rule out linkage to known arCC loci and genes. Whole-exome sequencing libraries were prepared and paired-end sequenced. A large deletion was found that segregated with arCC in the family, and chromosome walking was conducted to estimate the proximal and distal boundaries of the deletion mutation. Exclusion and linkage analysis suggested linkage to a region of chromosome 6p24 harboring GCNT2 (glucosaminyl (N-acetyl) transferase 2) with a two-point logarithm of odds score of 5.78. PCR amplifications of the coding exons of GCNT2 failed in individuals with arCC, and whole-exome data analysis revealed a large deletion on chromosome 6p in the region harboring GCNT2. Chromosomal walking using multiple primer pairs delineated the extent of the deletion to approximately 190 kb. Interestingly, a failure to amplify a junctional fragment of the deletion break strongly suggests an insertion in addition to the large deletion. Here, we report a novel insertion/deletion mutation at the GCNT2 locus that is responsible for congenital cataracts in a large consanguineous family.
Deletion of a coordinate regulator of type 2 cytokine expression in mice
Energy Technology Data Exchange (ETDEWEB)
Mohrs, Markus; Blankespoor, Catherine M.; Wang, Zhi-En; Loots, Gaby G.; Hadeiba, Husein; Shinkai, Kanade; Rubin, Edward M.; Locksley, Richard M.
2001-07-30
Mechanisms underlying the differentiation of stable T helper subsets will be important in understanding how discrete types of immunity develop in response to different pathogens. An evolutionarily conserved {approx}400 base pair non-coding sequence in the IL-4/IL-13 intergenic region, designated CNS-1, was deleted in mice. The capacity to develop Th2 cells was compromised in vitro and in vivo in the absence of CNS-1. Despite the profound effect in T cells, mast cells from CNS-1-deleted mice maintained their capacity to produce IL-4. A T cell-specific element critical for optimal expression of type 2 cytokines may represent evolution of a regulatory sequence exploited by adaptive immunity.
Quantum deletion: Beyond the no-deletion principle
International Nuclear Information System (INIS)
Adhikari, Satyabrata
2005-01-01
Suppose we are given two identical copies of an unknown quantum state and we wish to delete one copy from among the given two copies. The quantum no-deletion principle restricts us from perfectly deleting a copy but it does not prohibit us from deleting a copy approximately. Here we construct two types of a 'universal quantum deletion machine' which approximately deletes a copy such that the fidelity of deletion does not depend on the input state. The two types of universal quantum deletion machines are (1) a conventional deletion machine described by one unitary operator and (2) a modified deletion machine described by two unitary operators. Here it is shown that the modified deletion machine deletes a qubit with fidelity 3/4, which is the maximum limit for deleting an unknown quantum state. In addition to this we also show that the modified deletion machine retains the qubit in the first mode with average fidelity 0.77 (approx.) which is slightly greater than the fidelity of measurement for two given identical states, showing how precisely one can determine its state [S. Massar and S. Popescu, Phys. Rev. Lett. 74, 1259 (1995)]. We also show that the deletion machine itself is input state independent, i.e., the information is not hidden in the deleting machine, and hence we can delete the information completely from the deletion machine
Deletion of ultraconserved elements yields viable mice
Energy Technology Data Exchange (ETDEWEB)
Ahituv, Nadav; Zhu, Yiwen; Visel, Axel; Holt, Amy; Afzal, Veena; Pennacchio, Len A.; Rubin, Edward M.
2007-07-15
Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lacking these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
ABCA7 frameshift deletion associated with Alzheimer disease in African Americans
Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.
2016-01-01
Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719
Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
Theoretical analysis of noncanonical base pairing interactions in ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.
Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas
2014-01-01
Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.
International Nuclear Information System (INIS)
Turker, Mitchell S.; Pieretti, Maura; Kumar, Sudha
1997-01-01
The P19H22 mouse embryonal carcinoma cell line is characterized by a hemizygous deficiency for the chromosome 8 encoded aprt (adenine phosphoribosyltransferase) gene and heterozygosity for many chromosome 8 loci. We have previously demonstrated that this cell line is suitable for mutational studies because it is permissive of events ranging in size from base-pair substitutions at the aprt locus to apparent loss of chromosome 8. Large mutational events, defined by loss of the remaining aprt allele, were found to predominate in spontaneous mutants and those induced by ionizing radiation. In this study we have used a PCR based assay to screen for loss of heterozygosity at microsatellite loci both proximal and distal to aprt in 137 Cs-induced and spontaneous aprt mutants. This approach allowed us to distinguish apparent interstitial deletional events from apparent recombinational events. Significantly, 32.5% (26 of 80) of the mutational events induced by 137 Cs appeared to be interstitial deletions as compared with 7.7% (6 of 78) in the spontaneous group. This difference was statistically significant (p 137 Cs caused a significant number of deletion mutations. Most 137 Cs-induced interstitial deletions were larger than 6 cM, whereas none of the spontaneous deletions were larger than 6 cM. These results provide further support for the notion that ionizing radiation induces deletion mutations and validate the use of the P19H22 cell line for the study of events induced by ionizing radiation
Partial USH2A deletions contribute to Usher syndrome in Denmark.
Dad, Shzeena; Rendtorff, Nanna D; Kann, Erik; Albrechtsen, Anders; Mehrjouy, Mana M; Bak, Mads; Tommerup, Niels; Tranebjærg, Lisbeth; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth B
2015-12-01
Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment, progressive visual loss owing to retinitis pigmentosa and in some cases vestibular dysfunction. Usher syndrome is divided into three subtypes, USH1, USH2 and USH3. Twelve loci and eleven genes have so far been identified. Duplications and deletions in PCDH15 and USH2A that lead to USH1 and USH2, respectively, have previously been identified in patients from United Kingdom, Spain and Italy. In this study, we investigate the proportion of exon deletions and duplications in PCDH15 and USH2A in 20 USH1 and 30 USH2 patients from Denmark using multiplex ligation-dependent probe amplification (MLPA). Two heterozygous deletions were identified in USH2A, but no deletions or duplications were identified in PCDH15. Next-generation mate-pair sequencing was used to identify the exact breakpoints of the two deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Rare copy number deletions predict individual variation in intelligence.
Directory of Open Access Journals (Sweden)
Ronald A Yeo
2011-01-01
Full Text Available Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in "mutation load" emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent copy number variations (CNVs, and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77 had been administered the Wechsler Abbreviated Scale of Intelligence (WASI. After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = -.30, p = .01. As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES, we also examined the impact of ethnicity (Anglo/White vs. Other, as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed.
Rare Copy Number Deletions Predict Individual Variation in Intelligence
Yeo, Ronald A.; Gangestad, Steven W.; Liu, Jingyu; Calhoun, Vince D.; Hutchison, Kent E.
2011-01-01
Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in “mutation load” emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent) copy number variations (CNVs), and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77) had been administered the Wechsler Abbreviated Scale of Intelligence (WASI). After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = −.30, p = .01). As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES), we also examined the impact of ethnicity (Anglo/White vs. Other), as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less) adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed. PMID:21298096
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cheng, Ji-Hong; Liu, Wen-Chun; Chang, Ting-Tsung; Hsieh, Sun-Yuan; Tseng, Vincent S
2017-10-01
Many studies have suggested that deletions of Hepatitis B Viral (HBV) are associated with the development of progressive liver diseases, even ultimately resulting in hepatocellular carcinoma (HCC). Among the methods for detecting deletions from next-generation sequencing (NGS) data, few methods considered the characteristics of virus, such as high evolution rates and high divergence among the different HBV genomes. Sequencing high divergence HBV genome sequences using the NGS technology outputs millions of reads. Thus, detecting exact breakpoints of deletions from these big and complex data incurs very high computational cost. We proposed a novel analytical method named VirDelect (Virus Deletion Detect), which uses split read alignment base to detect exact breakpoint and diversity variable to consider high divergence in single-end reads data, such that the computational cost can be reduced without losing accuracy. We use four simulated reads datasets and two real pair-end reads datasets of HBV genome sequence to verify VirDelect accuracy by score functions. The experimental results show that VirDelect outperforms the state-of-the-art method Pindel in terms of accuracy score for all simulated datasets and VirDelect had only two base errors even in real datasets. VirDelect is also shown to deliver high accuracy in analyzing the single-end read data as well as pair-end data. VirDelect can serve as an effective and efficient bioinformatics tool for physiologists with high accuracy and efficient performance and applicable to further analysis with characteristics similar to HBV on genome length and high divergence. The software program of VirDelect can be downloaded at https://sourceforge.net/projects/virdelect/. Copyright © 2017. Published by Elsevier Inc.
Choe, Won Hyeok; Kim, Hong; Lee, So-Young; Choi, Yu-Min; Kwon, So Young; Moon, Hee Won; Hur, Mina; Kim, Bum-Joon
2017-12-12
Naturally occurring hepatitis B virus variants carrying a deletion in the preS1 start codon region may evolve during long-lasting virus-host interactions in chronic hepatitis B (CHB). The aim of this study was to determine the immune phase-specific prevalent patterns of preS1 start codon deletion variants and related factors during the natural course of CHB. A total of 399 CHB patients were enrolled. Genotypic analysis of three different preS1 start codon deletion variants (classified by deletion size: 15-base pair [bp], 18-bp, and 21-bp deletion variants) was performed. PreS1 start codon deletion variants were detected in 155 of 399 patients (38.8%). The predominant variant was a 15-bp deletion in the immune-tolerance phase (18/50, 36%) and an 18-bp deletion in the immune-clearance phase (69/183, 37.7%). A 21-bp deletion was the predominant variant in the low replicative phase (3/25, 12.0%) and reactivated hepatitis Be antigen (HBeAg)-negative phase (22/141, 15.6%). The 15-bp and 18-bp deletion variants were more frequently found in HBeAg-positive patients (P start codon deletion variants changes according to the immune phases of CHB infection, and each variant type is associated with different clinical parameters. PreS1 start codon deletion variants might interact with the host immune response differently according to their variant types. © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.
Learning preferences from paired opposite-based semantics
DEFF Research Database (Denmark)
Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier
2017-01-01
Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
International Nuclear Information System (INIS)
Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.
1988-01-01
The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage
A novel pseudo-complementary PNA G-C base pair
DEFF Research Database (Denmark)
Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn
2011-01-01
Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
International Nuclear Information System (INIS)
Latt, S.A.; Lalande, M.; Donlon, T.
1986-01-01
This paper describes a few of the many possible examples in which application of a molecular cytogenetic approach can ultimately lead to a new, important understanding about the statics and dynamics of human chromosome structure. In the case of retinoblastoma, cytological observations of deletions and linkage analysis have positioned the retinoblastoma locus to bank 13q14. This locus is grossly deleted in some spontaneous tumors. It is still necessary to locate more precisely and characterize the nature of the retinoblastoma locus, as well as the basis for the heterogeneity in deletions removing one copy of this locus. One is left with the possibility that those deletions that may be observed cytologically reflect but the tip of the iceberg of deletions; detection of others may require molecular probes. A related question is the nature of the DNA sequences at the deletion boundaries and the role they play in promoting these deletions
Conversion of Deletions during Recombination in Pneumococcal Transformation
Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.
1989-01-01
Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365
DEFF Research Database (Denmark)
Schmieder, Valerie; Bydlinski, Nina; Strasser, Richard
2017-01-01
(sgRNAs) for full gene deletions. This strategy also enables the targeting of regulatory regions, which would not respond to the conventional frameshift mutations, as shown by deleting the α-1,6-Fucosyltransferase 8 (FUT8) promoter resulting in a functional knock-out. Fut8 also served as model...
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
Efficiently Hiding Sensitive Itemsets with Transaction Deletion Based on Genetic Algorithms
Directory of Open Access Journals (Sweden)
Chun-Wei Lin
2014-01-01
Full Text Available Data mining is used to mine meaningful and useful information or knowledge from a very large database. Some secure or private information can be discovered by data mining techniques, thus resulting in an inherent risk of threats to privacy. Privacy-preserving data mining (PPDM has thus arisen in recent years to sanitize the original database for hiding sensitive information, which can be concerned as an NP-hard problem in sanitization process. In this paper, a compact prelarge GA-based (cpGA2DT algorithm to delete transactions for hiding sensitive itemsets is thus proposed. It solves the limitations of the evolutionary process by adopting both the compact GA-based (cGA mechanism and the prelarge concept. A flexible fitness function with three adjustable weights is thus designed to find the appropriate transactions to be deleted in order to hide sensitive itemsets with minimal side effects of hiding failure, missing cost, and artificial cost. Experiments are conducted to show the performance of the proposed cpGA2DT algorithm compared to the simple GA-based (sGA2DT algorithm and the greedy approach in terms of execution time and three side effects.
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Detection of mitochondrial DNA deletions in human cells induced by ionizing radiation
International Nuclear Information System (INIS)
Liu, Qing-Jie; Feng, Jiang-Bin; Lu, Xue; Li, Yu-Wen; Chen, De-Qing
2008-01-01
Full text: Purpose: To screen the novel mitochondrial DNA (mt DNA) deletions induced by ionizing radiation, and analyze the several kinds of mt DNA deletions, known as 3895 bp, 889 bp, 7436 bp or 4934 bp deletions. Methods: Long-range PCR with two pairs of primers, which could amplify the whole human mitochondrial genome, was used to analyze the lymphoblastoid cell line before and after exposed to 10 Gy 60 Co γ-rays. The limited condition PCR was used to certify the possible mt DNA deletion showed by long-range PCR. The PCR products were purified, cloned, sequenced and the sequence result were BLASTed. Regular PCR or nest-PCR were used to analyze the 3895 bp, 889 bp, 7436 bp or 4934 bp deletions before and after radiation exposure. The final PCR products were purified, sequenced and BALSTed on standard human mitochondrial genome sequence database. Results: (1) The predicted bands of mt DNA were observed on the control cell lines, and the possible mt DNA deletions were also detected on the irradiated cell lines. The deletions were certified by the limited condition PCR. The sequence BLAST results of the cloned PCR products showed that two kinds of deletions, 7455 bp deletion (nt 475-7929 in heavy strand) and 9225 bp deletion (nt 7714-369 in heavy strand), which were between two 8 bp direct repeats. Further bioinformatics analysis showed that the two deletions were novel deletions. (2) The 889 bp and 3895 bp deletion were not detected for the cell line samples not exposed to 60 Co γ-rays. The 889 bp and 3895 bp deletions were detected on samples exposed to 10 Gy 60 Co γ-rays. The BALST results showed that the 889 bp and 3895 deletions flanked nt 11688 bp-12576, nt 548 bp-4443, respectively. The 7436 bp deletion levels were not changed much before and after irradiation. (3) The 4934 bp deletions had the same pattern as 7436 bp deletion, but it could induced by radiation. Conclusions: Ionizing radiation could induce the human lymphoblastoid two novel mt DNA
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Copy Number Deletion Has Little Impact on Gene Expression Levels in Racehorses
Directory of Open Access Journals (Sweden)
Kyung-Do Park
2014-09-01
Full Text Available Copy number variations (CNVs, important genetic factors for study of human diseases, may have as large of an effect on phenotype as do single nucleotide polymorphisms. Indeed, it is widely accepted that CNVs are associated with differential disease susceptibility. However, the relationships between CNVs and gene expression have not been characterized in the horse. In this study, we investigated the effects of copy number deletion in the blood and muscle transcriptomes of Thoroughbred racing horses. We identified a total of 1,246 CNVs of deletion polymorphisms using DNA re-sequencing data from 18 Thoroughbred racing horses. To discover the tendencies between CNV status and gene expression levels, we extracted CNVs of four Thoroughbred racing horses of which RNA sequencing was available. We found that 252 pairs of CNVs and genes were associated in the four horse samples. We did not observe a clear and consistent relationship between the deletion status of CNVs and gene expression levels before and after exercise in blood and muscle. However, we found some pairs of CNVs and associated genes that indicated relationships with gene expression levels: a positive relationship with genes responsible for membrane structure or cytoskeleton and a negative relationship with genes involved in disease. This study will lead to conceptual advances in understanding the relationship between CNVs and global gene expression in the horse.
Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.
2014-01-01
The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273
Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies
Directory of Open Access Journals (Sweden)
Laila K. Effat
2000-01-01
Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.
A Large PROP1 Gene Deletion in a Turkish Pedigree
Directory of Open Access Journals (Sweden)
Suheyla Gorar
2018-01-01
Full Text Available Pituitary-specific paired-like homeodomain transcription factor, PROP1, is associated with multiple pituitary hormone deficiency. Alteration of the gene encoding the PROP1 may affect somatotropes, thyrotropes, and lactotropes, as well as gonadotropes and corticotropes. We performed genetic analysis of PROP1 gene in a Turkish pedigree with three siblings who presented with short stature. Parents were first degree cousins. Index case, a boy, had somatotrope, gonadotrope, thyrotrope, and corticotrope deficiency. However, two elder sisters had somatotroph, gonadotroph, and thyrotroph deficiency and no corticotroph deficiency. On pituitary magnetic resonance, partial empty sella was detected with normal bright spot in all siblings. In genetic analysis, we found a gross deletion involving PROP1 coding region. In conclusion, we report three Turkish siblings with a gross deletion in PROP1 gene. Interestingly, although little boy with combined pituitary hormone deficiency has adrenocorticotropic hormone (ACTH deficiency, his elder sisters with the same gross PROP1 deletion have no ACTH deficiency. This finding is in line with the fact that patients with PROP1 mutations may have different phenotype/genotype correlation.
Tekin, M; Bodurtha, J N; Nance, W E; Pandya, A
2001-10-01
Klein-Waardenburg syndrome or Waardenburg syndrome type 3 (WS-III; MIM 148820) is characterized by the presence of musculoskeletal abnormalities in association with clinical features of Waardenburg syndrome type 1 (WS-I). Since the description of the first patient in 1947 (D. Klein, Arch Klaus Stift Vererb Forsch 1947: 22: 336-342), a few cases have been reported. Only occasional families have demonstrated autosomal-dominant inheritance of WS-III. In a previous report, a missense mutation in the paired domain of the PAX3 gene has been described in a family with dominant segregation of WS-III. In this report, we present a second family (mother and son) with typical clinical findings of WS-III segregating with a heterozygous 13-bp deletion in the paired domain of the PAX3 gene. Although homozygosity or compound heterozygosity has also been documented in patients with severe limb involvement, a consistent genotype-phenotype correlation for limb abnormalities associated with heterozygous PAX3 mutations has not previously been apparent. Heterozygous mutations could either reflect a unique dominant-negative effect or possibly the contribution of other unlinked genetic modifiers in determining the phenotype.
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
Ingre, Caroline; Wuolikainen, Anna; Marklund, Stefan L; Birve, Anna; Press, Rayomand; Andersen, Peter M
2016-01-01
Mutations in the superoxide dismutase (SOD1) gene have been linked to amyotrophic lateral sclerosis (ALS). A 50 base pair (bp) deletion of SOD1 has been suggested to reduce transcription and to be associated with later disease onset in ALS. This study was aimed to reveal if the 50 bp deletion influenced SOD1 enzymatic activity, occurrence and phenotype of the disease in a Swedish ALS/control cohort. Blood samples from 512 Swedish ALS patients and 354 Swedish controls without coding SOD1 mutations were analysed for the 50 bp deletion allele. The enzymatic activity of SOD1 in erythrocytes was analysed and genotype-phenotype correlations were assessed. Results demonstrated that the genotype frequencies of the 50 bp deletion were all found to be in Hardy-Weinberg equilibrium. No significant differences were found for age of onset, disease duration or site of onset. SOD1 enzymatic activity showed a statistically significant decreasing trend in the control group, in which the allele was associated with a 5% reduction in SOD1 activity. The results suggest that the 50 bp deletion has a moderate reducing effect on SOD1 synthesis. No modulating effects, however, were found on ALS onset, phenotype and survival in the Swedish population.
Do mtDNA Deletions Play a Role in the Development of Nasal Polyposis?
Directory of Open Access Journals (Sweden)
Arzu Tatar
2014-04-01
Full Text Available Objective:Nasal polyposis (NP is an inflammatory disease of the nasal mucosa and paranasal sinuses. Mitochondria are the cellular organelles which produce cellular energy by Oxidative Phosphorylation (OXPHOS, and they have own inheritance material, mtDNA. mtDNA is affected by reactive oxygen samples (ROS which are produced by both OXPHOS and the inflammatory process. The aim of this study was to investigate the 4977 bp and 7400 bp deletions of mtDNA in nasal polyposis tissue, and to indicate the possible association of mtDNA deletions with NP. Methods:Thirty-three patients, aged 15 to 65 years, with nasal polyposis were selected to be assessed for mitochondrial DNA deletions. The patients with possible mtDNA mutations due to mitochondrial disease, being treated with radiotherapy, of advanced age, with a familiar history, aspirin hypersensitivity, or a history of asthma, were excluded. Polyp excision surgery was applied to the treatment of the NP, and after histopathological diagnosis 1x1 cm of polyp tissue samples were used to isolate mtDNA. The 4977 bp and 7400 bp deletion regions, and two control regions of mtDNA were assessed by using four pairs of primers. DNA extractions from the NP tissues and peripheral blood samples of the patients were made, and then Polymerase Chain Reactions (PCR were made. PCR products were separated in 2% agarose gel.Results:No patient had either the 4977 bp deletion or the 7400 bp deletion in their NP tissue, and neither were these deletions evident in their peripheral blood. Two control sequences, one of them from a non-deleted region, and the other from a possible deletion region, were detected in the NP tissues and peripheral blood of all the patients.Conclusions:We had anticipated that some mtDNA deletion might have occurred in NP tissue due to the increased ROS levels caused by chronic inflammation, but we did not detect any deletion. Probably, the duration of inflammation in NP is insufficient to form mt
Spontaneous 8bp Deletion in Nbeal2 Recapitulates the Gray Platelet Syndrome in Mice
Tomberg, Kärt; Khoriaty, Rami; Westrick, Randal J.; Fairfield, Heather E.; Reinholdt, Laura G.; Brodsky, Gary L.; Davizon-Castillo, Pavel; Ginsburg, David; Di Paola, Jorge
2016-01-01
During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp) deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS), an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps) exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10−7). Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains. PMID:26950939
Spontaneous 8bp Deletion in Nbeal2 Recapitulates the Gray Platelet Syndrome in Mice.
Directory of Open Access Journals (Sweden)
Kärt Tomberg
Full Text Available During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS, an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10-7. Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains.
Mapping genomic deletions down to the base
DEFF Research Database (Denmark)
Dunø, Morten; Hove, Hanne; Kirchhoff, Maria
2004-01-01
the breakpoint of the third patient was mapped to a region previously predicted to be prone for rearrangements. One patient also harboured an inversion in connection with the deletion that disrupted the HDAC9 gene. All three patients showed clinical characteristics reminiscent of the hand-foot-genital syndrome...
Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H
2014-08-01
The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
Directory of Open Access Journals (Sweden)
Sergei Kuchin
2011-03-01
Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.
Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M
2005-02-01
Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.
2011-01-01
Background Qualitative and quantitative changes in human mitochondrial DNA (mtDNA) have been implicated in various cancer types. A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging. Methods We conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China. In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients. Results We found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027). In patients with the 4,977 bp deletion, the deletion level decreased as the cancer stage advanced (p = 0.031). Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion. Such mtDNA content increase correlated with the levels of the 4,977 bp deletion and with cancer stage (p deletion may play a role in the early stage of colorectal cancer, and it is also implicated in alteration of mtDNA content in cancer cells. PMID:21232124
Meurs, Kathryn M; Stern, Josh A; Reina-Doreste, Yamir; Maran, Brian A; Chdid, Lhoucine; Lahmers, Sunshine; Keene, Bruce W; Mealey, Katrina L
2015-09-01
β-Adrenergic receptor antagonists are widely utilized for the management of cardiac diseases in dogs. We have recently identified two deletion polymorphisms in the canine adrenoreceptor 1 (ADRB1) gene.We hypothesized that canine ADRB1 deletions would alter the structure of the protein, as well as the heart rate response to the β-adrenergic receptor antagonist, atenolol. The objectives of this study were to predict the impact of these deletions on the predicted structure of the protein and on the heart rate response to atenolol in a population of healthy adult dogs. Eighteen apparently healthy, mature dogs with (11) and without (seven) ADRB1 deletions were evaluated. The heart rate of the dogs was evaluated with a baseline ambulatory ECG before and 14-21 days after atenolol therapy (1 mg/kg orally q12 h). Minimum, average, and maximum heart rates were compared between groups of dogs (deletions, controls) using an unpaired t-test and within each group of dogs using a paired t-test. The protein structure of ADRB1 was predicted by computer modeling. Deletions were predicted to alter the structure of the ADRB1 protein. The heart rates of the dogs with deletions were lower than those of the control dogs (the average heart rates were significantly lower). ADRB1 deletions appear to have structural and functional consequences. Individual genome-based treatment recommendations could impact the management of dogs with heart disease.
Directory of Open Access Journals (Sweden)
Hütter Gero
2011-10-01
Full Text Available Abstract Background The natural function of the C-C chemokine receptor type 5 (CCR5 is poorly understood. A 32 base pair deletion in the CCR5 gene (CCR5-delta32 located on chromosome 3 results in a non-functional protein. It is supposed that this deletion causes an alteration in T-cell response to inflammation. For example, the presence of the CCR5-delta32 allele in recipients of allografts constitutes as an independent and protective factor associated with a decreased risk of graft-versus-host disease (GVHD and graft rejection. However, the mechanism of this beneficial effect of the deletion regarding GVHD is unknown. In this survey we searched for a CCR5-delta32 associated regulation of critical genes involved in the immune response and the development of GVHD. Methods We examined CD34+ hematopoietic progenitor cells derived from bone marrow samples from 19 healthy volunteers for the CCR5-delta32 deletion with a genomic PCR using primers flanking the site of the deletion. Results 12 individuals were found to be homozygous for CCR5 WT and 7 carried the CCR5-delta32 deletion heterozygously. Global gene expression analysis led to the identification of 11 differentially regulated genes. Six of them are connected with mechanisms of immune response and control: LRG1, CXCR2, CCRL2, CD6, CD7, WD repeat domain, and CD30L. Conclusions Our data indicate that the CCR5-delta32 mutation may be associated with differential gene expression. Some of these genes are critical for immune response, in the case of CD30L probably protective in terms of GVHD.
Signature scheme based on bilinear pairs
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.
Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J
2011-09-01
Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.
Accurate interaction energies of base pairing and base stacking. The final chapter
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Jurečka, Petr; Hobza, Pavel
2005-01-01
Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics
Directory of Open Access Journals (Sweden)
Ying-hui Li
2014-11-01
Full Text Available As a complement to single nucleotide polymorphisms (SNPs and simple sequence repeats (SSRs, biallelic insertions and deletions (InDels represent powerful molecular markers with desirable features for filling the gap in current genetic linkage maps. In this study, 28,908 small InDel polymorphisms (1–5 base pair, bp distributed genome-wide were identified and annotated by comparison of a whole-genome resequencing data set from two soybean [ (L. Merr.] genotypes, cultivar Zhonghunag13 (ZH and line Zhongpin03-5373 (ZP. The physical distribution of InDel polymorphisms in soybean genome was uneven, and matched closely with the distribution of previously annotated genes. The average density of InDel in the arm region was significantly higher than that in the pericentromeric region. The genomic regions that were fixed between the two elites were elucidated. With this information, five InDel markers within a putative quantitative trait locus (QTL for seed weight (SW, , were developed and used to genotype 254 recombinant inbred lines (RILs derived from the cross of ZP × ZH. Adding these five InDel markers to previously used SNP and SSR markers facilitated the discovery of further recombination events allowing fine-mapping the QTL to a 0.5 Mbp region. Our study clearly underlines the high value of InDel markers for map-based cloning and marker-assisted selection in soybean.
AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis
Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian
2016-01-01
Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
DFT study on metal-mediated uracil base pair complexes
Directory of Open Access Journals (Sweden)
Ayhan Üngördü
2017-11-01
Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
Skin fibroblasts from a D-deletion type retinoblastoma patient are abnormally X-ray sensitive
International Nuclear Information System (INIS)
Weichselbaum, R.R.; Nove, J.; Little, J.B.
1977-01-01
Retinoblastoma is a rare malignant eye tumour that appears either spontaneously or in genetically predisposed persons. The latter group is composed of persons who inherit the tumour with a dominant mode of transmission (the familial type) and those who have a deletion in the long arm of chromosome 13 referred to as the D-deletion type. When this deletion is present it is observed in many somatic cells and is often associated with structural defects. Survivors of the genetic forms of retinoblastoma have an increased risk of the development of cancers at other sites. A single genetic locus is unlikely to predispose many somatic cells to tumour formation unless a fundamental molecular defect, possibly related to DNA repair, is present. In order to investigate this hypothesis a study was made of the in vitro X-ray sensitivity of skin fibroblasts derived from three retinoblastoma patients, comprising a pair of twins with the familial type accompanied by no gross chromosome abnormalities, and a patient with the D-deletion type. It was found that fibroblasts derived from the D-deletion patient were significantly more radiosensitive than those from the other two patients. X-ray survival curves are shown. It is concluded that skin fibroblasts derived from a patient with the D-deletion variant of retinoblastoma are abnormally radiosensitive. Future investigations may indicate a specific defect in molecular repair of DNA that will explain the predisposition of these patients to the development of other tumours. (U.K.)
Panchromatic cooperative hyperspectral adaptive wide band deletion repair method
Jiang, Bitao; Shi, Chunyu
2018-02-01
In the hyperspectral data, the phenomenon of stripe deletion often occurs, which seriously affects the efficiency and accuracy of data analysis and application. Narrow band deletion can be directly repaired by interpolation, and this method is not ideal for wide band deletion repair. In this paper, an adaptive spectral wide band missing restoration method based on panchromatic information is proposed, and the effectiveness of the algorithm is verified by experiments.
Fast detection of deletion breakpoints using quantitative PCR
Directory of Open Access Journals (Sweden)
Gulshara Abildinova
2016-01-01
Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.
Directory of Open Access Journals (Sweden)
Carmen Elena Gómez
2017-12-01
Full Text Available An HIV-1 vaccine continues to be a major target to halt the AIDS pandemic. The limited efficacy of the RV144 phase III clinical trial with the canarypox virus-based vector ALVAC and a gp120 protein component led to the conclusion that improved immune responses to HIV antigens are needed for a more effective vaccine. In non-human primates, the New York vaccinia virus (NYVAC poxvirus vector has a broader immunogenicity profile than ALVAC and has been tested in clinical trials. We therefore analysed the HIV immune advantage of NYVAC after removing viral genes that act on several signalling pathways (Toll-like receptors—TLR—interferon, cytokines/chemokines, as well as genes of unknown immune function. We generated a series of NYVAC deletion mutants and studied immune behaviour (T and B cell to HIV antigens and to the NYVAC vector in mice. Our results showed that combined deletion of selected vaccinia virus (VACV genes is a valuable strategy for improving the immunogenicity of NYVAC-based vaccine candidates. These immune responses were differentially modulated, positive or negative, depending on the combination of gene deletions. The deletions also led to enhanced antigen- or vector-specific cellular and humoral responses. These findings will facilitate the development of optimal NYVAC-based vaccines for HIV and other diseases.
International Nuclear Information System (INIS)
Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1988-01-01
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met
Kamada, Fumiaki; Kure, Shigeo; Kudo, Takayuki; Suzuki, Yoichi; Oshima, Takeshi; Ichinohe, Akiko; Kojima, Kanako; Niihori, Tetsuya; Kanno, Junko; Narumi, Yoko; Narisawa, Ayumi; Kato, Kumi; Aoki, Yoko; Ikeda, Katsuhisa; Kobayashi, Toshimitsu; Matsubara, Yoichi
2006-01-01
Autosomal-dominant, nonsyndromic hearing impairment is clinically and genetically heterogeneous. We encountered a large Japanese pedigree in which nonsyndromic hearing loss was inherited in an autosomal-dominant fashion. A genome-wide linkage study indicated linkage to the DFNA2 locus on chromosome 1p34. Mutational analysis of KCNQ4 encoding a potassium channel revealed a novel one-base deletion in exon 1, c.211delC, which generated a profoundly truncated protein without transmembrane domains (p.Q71fsX138). Previously, six missense mutations and one 13-base deletion, c.211_223del, had been reported in KCNQ4. Patients with the KCNQ4 missense mutations had younger-onset and more profound hearing loss than patients with the 211_223del mutation. In our current study, 12 individuals with the c.211delC mutation manifested late-onset and pure high-frequency hearing loss. Our results support the genotype-phenotype correlation that the KCNQ4 deletions are associated with later-onset and milder hearing impairment than the missense mutations. The phenotypic difference may be caused by the difference in pathogenic mechanisms: haploinsufficiency in deletions and dominant-negative effect in missense mutations.
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Gene deletion is a critical tool for functional analysis. The targeted deletion of genes requires both a suitable method for the trans...
NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT
Directory of Open Access Journals (Sweden)
Testiana Deni Wijayatiningsih
2017-04-01
Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
Saveliev, S V; Cox, M M
1994-01-01
Thousands of DNA deletion events occur during macronuclear development in the ciliate Tetrahymena thermophila. In two deleted genomic regions, designated M and R, the eliminated sequences form circles that can be detected by PCR. However, the circles are not normal products of the reaction pathway. The circular forms occur at very low levels in conjugating cells, but are stable. Sequencing analysis showed that many of the circles (as many as 50% of those examined) reflected a precise deletion in the M and R regions. The remaining circles were either smaller or larger and contained varying lengths of sequences derived from the chromosomal DNA surrounding the eliminated region. The chromosomal junctions left behind after deletion were more precise, although deletions in either the M or R regions can generate any of several alternative junctions (1). Some new chromosomal junctions were detected in the present study. The results suggest that the deleted segment is released as a linear DNA species that is degraded rapidly. The species is only rarely converted to the stable circles we detect. The deletion mechanism is different from those proposed for deletion events in hypotrichous ciliates (2-4), and does not reflect a conservative site-specific recombination process such as that promoted by the bacteriophage lambda integrase (5). Images PMID:7838724
2012-01-01
Background Hepatitis B virus (HBV), because of its error-prone viral polymerase, has a high mutation rate leading to widespread substitutions, deletions, and insertions in the HBV genome. Deletions may significantly change viral biological features complicating the progression of liver diseases. However, the clinical conditions correlating to the accumulation of deleted mutants remain unclear. In this study, we explored HBV deletion patterns and their association with disease status and antiviral treatment by performing whole genome sequencing on samples from 51 hepatitis B patients and by monitoring changes in deletion variants during treatment. Clone sequencing was used to analyze preS regions in another cohort of 52 patients. Results Among the core, preS, and basic core promoter (BCP) deletion hotspots, we identified preS to have the highest frequency and the most complex deletion pattern using whole genome sequencing. Further clone sequencing analysis on preS identified 70 deletions which were classified into 4 types, the most common being preS2. Also, in contrast to the core and BCP regions, most preS deletions were in-frame. Most deletions interrupted viral surface epitopes, and are possibly involved in evading immuno-surveillance. Among various clinical factors examined, logistic regression showed that antiviral medication affected the accumulation of deletion mutants (OR = 6.81, 95% CI = 1.296 ~ 35.817, P = 0.023). In chronic carriers of the virus, and individuals with chronic hepatitis, the deletion rate was significantly higher in the antiviral treatment group (Fisher exact test, P = 0.007). Particularly, preS2 deletions were associated with the usage of nucleos(t)ide analog therapy (Fisher exact test, P = 0.023). Dynamic increases in preS1 or preS2 deletions were also observed in quasispecies from samples taken from patients before and after three months of ADV therapy. In vitro experiments demonstrated that preS2 deletions alone
Role of DNA deletion length in mutation and cell survival
International Nuclear Information System (INIS)
Braby, L.A.; Morgan, T.L.
1992-01-01
A model is presented which is based on the assumption that malignant transformation, mutation, chromosome aberration, and reproductive death of cells are all manifestations of radiation induced deletions in the DNA of the cell, and that the size of the deletion in relation to the spacing of essential genes determines the consequences of that deletion. It is assumed that two independent types of potentially lethal lesions can result in DNA deletions, and that the relative numbers of these types of damage is dependent on radiation quality. The repair of the damage reduces the length of a deletion, but does not always eliminate it. The predictions of this model are in good agreement with a wide variety of experimental evidence. (author)
Chawla, Mohit
2015-06-27
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi
2015-01-01
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae
Lang, Gregory I.; Murray, Andrew W.
2008-01-01
Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...
Schizophrenia and chromosomal deletions
Energy Technology Data Exchange (ETDEWEB)
Lindsay, E.A.; Baldini, A. [Baylor College of Medicine, Houston, TX (United States); Morris, M. A. [Univ. of Geneva School of Medicine, NY (United States)] [and others
1995-06-01
Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions
Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.
2018-01-01
Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Zhang, Yuetao
2012-01-01
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization
Deletion mutations of bacteriophage
International Nuclear Information System (INIS)
Ryo, Yeikou
1975-01-01
Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Energy Technology Data Exchange (ETDEWEB)
Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)
1995-11-06
Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R
2014-12-01
The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. Copyright © 2014 Elsevier B.V. All rights reserved.
4977-bp mitochondrial DNA deletion in infertile patients with varicocele.
Gashti, N G; Salehi, Z; Madani, A H; Dalivandan, S T
2014-04-01
Varicocele is the abnormal inflexion and distension of veins of the pampiniform plexus within spermatic cord and is one of the amendable causes of male infertility. It can increase reactive oxygen species (ROS) production in semen and cause oxidative stress. The purpose of this study was to analyse spermatozoa mtDNA 4977-bp deletion in infertile men with varicocele. To detect 4977-bp deletion in spermatozoa mtDNA, semen samples of 60 infertile patients with clinical varicocele and 90 normal men from northern Iran were prepared. After extraction of spermatozoa total DNA, Gap polymerase chain reaction (Gap PCR) was performed. 4977-bp deletion was observed in 81.66% of patients with varicocele, while approximately 15.55% of controls had this deletion. As spermatozoa from patients with varicocele had a high frequency of occurrence of 4977-bp deletion in mtDNA [OR = 24.18, 95% confidence interval (CI) = 10.15-57.57, P deletion in spermatozoa and cause infertility in north Iranian men. However, to determine the relation between sperm mtDNA 4977-bp deletion and varicocele-induced infertility, larger population-based studies are needed. It is concluded that there is an association between sperm mtDNA 4977-bp deletion and varicocele-induced infertility in the population studied. © 2013 Blackwell Verlag GmbH.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Strategies for state-dependent quantum deleting
International Nuclear Information System (INIS)
Song Wei; Yang Ming; Cao Zhuoliang
2004-01-01
A quantum state-dependent quantum deleting machine is constructed. We obtain a upper bound of the global fidelity on N-to-M quantum deleting from a set of K non-orthogonal states. Quantum networks are constructed for the above state-dependent quantum deleting machine when K=2. Our deleting protocol only involves a unitary interaction among the initial copies, with no ancilla. We also present some analogies between quantum cloning and deleting
Detection of genomic deletions in rice using oligonucleotide microarrays
Directory of Open Access Journals (Sweden)
Bordeos Alicia
2009-03-01
Full Text Available Abstract Background The induction of genomic deletions by physical- or chemical- agents is an easy and inexpensive means to generate a genome-saturating collection of mutations. Different mutagens can be selected to ensure a mutant collection with a range of deletion sizes. This would allow identification of mutations in single genes or, alternatively, a deleted group of genes that might collectively govern a trait (e.g., quantitative trait loci, QTL. However, deletion mutants have not been widely used in functional genomics, because the mutated genes are not tagged and therefore, difficult to identify. Here, we present a microarray-based approach to identify deleted genomic regions in rice mutants selected from a large collection generated by gamma ray or fast neutron treatment. Our study focuses not only on the utility of this method for forward genetics, but also its potential as a reverse genetics tool through accumulation of hybridization data for a collection of deletion mutants harboring multiple genetic lesions. Results We demonstrate that hybridization of labeled genomic DNA directly onto the Affymetrix Rice GeneChip® allows rapid localization of deleted regions in rice mutants. Deletions ranged in size from one gene model to ~500 kb and were predicted on all 12 rice chromosomes. The utility of the technique as a tool in forward genetics was demonstrated in combination with an allelic series of mutants to rapidly narrow the genomic region, and eventually identify a candidate gene responsible for a lesion mimic phenotype. Finally, the positions of mutations in 14 mutants were aligned onto the rice pseudomolecules in a user-friendly genome browser to allow for rapid identification of untagged mutations http://irfgc.irri.org/cgi-bin/gbrowse/IR64_deletion_mutants/. Conclusion We demonstrate the utility of oligonucleotide arrays to discover deleted genes in rice. The density and distribution of deletions suggests the feasibility of a
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
Photochemical selectivity in guanine-cytosine base-pair structures
Czech Academy of Sciences Publication Activity Database
Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.
2005-01-01
Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Xing, Changsheng; Ci, Xinpei; Sun, Xiaodong; Fu, Xiaoying; Zhang, Zhiqian; Dong, Eric N; Hao, Zhao-Zhe; Dong, Jin-Tang
2014-11-01
Krüppel-like factor 5 (KLF5) regulates multiple biologic processes. Its function in tumorigenesis appears contradictory though, showing both tumor suppressor and tumor promoting activities. In this study, we examined whether and how Klf5 functions in prostatic tumorigenesis using mice with prostate-specific deletion of Klf5 and phosphatase and tensin homolog (Pten), both of which are frequently inactivated in human prostate cancer. Histologic analysis demonstrated that when one Pten allele was deleted, which causes mouse prostatic intraepithelial neoplasia (mPIN), Klf5 deletion accelerated the emergence and progression of mPIN. When both Pten alleles were deleted, which causes prostate cancer, Klf5 deletion promoted tumor growth, increased cell proliferation, and caused more severe morphologic and molecular alterations. Homozygous deletion of Klf5 was more effective than hemizygous deletion. Unexpectedly, while Pten deletion alone expanded basal cell population in a tumor as reported, Klf5 deletion in the Pten-null background clearly reduced basal cell population while expanding luminal cell population. Global gene expression profiling, pathway analysis, and experimental validation indicate that multiple mechanisms could mediate the tumor-promoting effect of Klf5 deletion, including the up-regulation of epidermal growth factor and its downstream signaling molecules AKT and ERK and the inactivation of the p15 cell cycle inhibitor. KLF5 also appears to cooperate with several transcription factors, including CREB1, Sp1, Myc, ER and AR, to regulate gene expression. These findings validate the tumor suppressor function of KLF5. They also yield a mouse model that shares two common genetic alterations with human prostate cancer-mutation/deletion of Pten and deletion of Klf5.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo
2014-01-01
A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Ramos-Zaldívar, Héctor M; Martínez-Irías, Daniel G; Espinoza-Moreno, Nelson A; Napky-Rajo, José S; Bueso-Aguilar, Tulio A; Reyes-Perdomo, Karla G; Montes-Gambarelli, Jimena A; Euceda, Isis M; Ponce-Barahona, Aldo F; Gámez-Fernández, Carlos A; Moncada-Arita, Wilberg A; Palomo-Bermúdez, Victoria A; Jiménez-Faraj, Julia E; Hernández-Padilla, Amanda G; Olivera, Denys A; Robertson, Kevin J; Leiva-Sanchez, Luis A; Herrera-Paz, Edwin Francisco
2016-06-13
Chromosomal region 7q21.3 comprises approximately 5.2 mega base pairs that include genes DLX5/6, SHFM1, and DYNC1I1 associated with split hand/split foot malformation 1. So far, there are reports of eight families with deletion of DYNC1I1 and preserved DLX5/6 associated with ectrodactyly. From these families, only three patients did not present ectrodactyly and, unlike our patient, no other cases have been described as having craniofacial dysmorphology, mitral valve prolapse, kyphoscoliosis, inguinal herniae, or personality disorder. There is no designation described in the literature for patients with syndromic manifestations without ectrodactyly, which hinders diagnosis. We report the case of a 44-year-old mestizo (combined European and Amerindian descent) man with a 3191 kilo base pairs deletion and International System for Human Cytogenetic Nomenclature array 7q21.3 (93,389,222-96,579,845)x1. Clinical manifestations included micrognathia, retrognathia, wormian bones, auditory canal stenosis, depressed nasal bridge, epicanthal fold, fullness of upper eyelid, long philtrum, low-set ears, sensorineural hearing loss, kyphoscoliosis, bilateral inguinal herniae, mild mitral valve prolapse, and paranoid personality disorder. His isolated DNA was analyzed using a CytoScan HD Microarray system. Chromosome Analysis Suite software was utilized for the microarray analysis. All copy number changes were determined using the human genome build 19 (hg19/NCBI build 37). Cases of deletions within chromosome 7q21.3 that include the split hand/split foot malformation 1 region represent a diagnostic challenge when not presenting ectrodactyly despite being syndromic. Due to the heterogeneity of the region, a better method to group and classify these patients is needed to facilitate their clinical diagnosis. For this purpose, we suggest that patients with 7q21.3 deletion including DYNC1I1 and preserved DLX5/6 without ectrodactyly, accompanied by craniofacial dysmorphology
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
ErasuCrypto: A Light-weight Secure Data Deletion Scheme for Solid State Drives
Directory of Open Access Journals (Sweden)
Liu Chen
2017-01-01
Full Text Available Securely deleting invalid data from secondary storage is critical to protect users’ data privacy against unauthorized accesses. However, secure deletion is very costly for solid state drives (SSDs, which unlike hard disks do not support in-place update. When applied to SSDs, both erasure-based and cryptography-based secure deletion methods inevitably incur large amount of valid data migrations and/or block erasures, which not only introduce extra latency and energy consumption, but also harm SSD lifetime.
Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W
2013-05-04
The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.
Guo, Tianze; Bi, Siyu; Liu, Jiaming
2018-04-01
This essay legally restrains the illegal content based on the e-commerce directive and introduces that the European countries detect and notify illegal content through the instructions of competent authorities, notification of credible flaggers, user reports and technical tools. The illegal content should be deleted through the service terms and transparency report basing on prevent excessive deletions system. At the same time, use filters to detect and filter to against the recurrence of illegal content. By analyzing the advantages of China under the environment of cracking down on illegal content, this essay concludes that the success of China in cracking down on illegal content lies in all-round collaborative management model of countries, governments, enterprises and individuals. At the end of the essay, one is to build a training corpus that can automatically update the ability to identify the illegal content. And it proposes an optimization scheme that establish a complete set of address resolution procedures and classify IP address data according to big data analysis and DNS protection module to prevent hackers from spreading illegal content by tampering with DNS segments.
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...
Indian Academy of Sciences (India)
The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
A comparison of 100 human genes using an alu element-based instability model.
Cook, George W; Konkel, Miriam K; Walker, Jerilyn A; Bourgeois, Matthew G; Fullerton, Mitchell L; Fussell, John T; Herbold, Heath D; Batzer, Mark A
2013-01-01
The human retrotransposon with the highest copy number is the Alu element. The human genome contains over one million Alu elements that collectively account for over ten percent of our DNA. Full-length Alu elements are randomly distributed throughout the genome in both forward and reverse orientations. However, full-length widely spaced Alu pairs having two Alus in the same (direct) orientation are statistically more prevalent than Alu pairs having two Alus in the opposite (inverted) orientation. The cause of this phenomenon is unknown. It has been hypothesized that this imbalance is the consequence of anomalous inverted Alu pair interactions. One proposed mechanism suggests that inverted Alu pairs can ectopically interact, exposing both ends of each Alu element making up the pair to a potential double-strand break, or "hit". This hypothesized "two-hit" (two double-strand breaks) potential per Alu element was used to develop a model for comparing the relative instabilities of human genes. The model incorporates both 1) the two-hit double-strand break potential of Alu elements and 2) the probability of exon-damaging deletions extending from these double-strand breaks. This model was used to compare the relative instabilities of 50 deletion-prone cancer genes and 50 randomly selected genes from the human genome. The output of the Alu element-based genomic instability model developed here is shown to coincide with the observed instability of deletion-prone cancer genes. The 50 cancer genes are collectively estimated to be 58% more unstable than the randomly chosen genes using this model. Seven of the deletion-prone cancer genes, ATM, BRCA1, FANCA, FANCD2, MSH2, NCOR1 and PBRM1, were among the most unstable 10% of the 100 genes analyzed. This algorithm may lay the foundation for comparing genetic risks posed by structural variations that are unique to specific individuals, families and people groups.
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
An entropy-based improved k-top scoring pairs (TSP) method for ...
African Journals Online (AJOL)
An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Precise deletion of gene(s) of interest, while leaving the rest of the genome unchanged, provides the ideal product to determine that particular gene’s function in the living organism. In this protocol we describe the OSCAR method of precise and rapid deletion plasmid construction. OSCAR relies on t...
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
DEFF Research Database (Denmark)
Hertz, Jens Michael; Tommerup, N; Sørensen, F B
1995-01-01
We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Energy Technology Data Exchange (ETDEWEB)
Sutcliffe, J.S.,; Nakao, M.; Beaudet, A.L. [Baylor College of Medicine, Houston, TX (United States)] [and others
1994-09-01
Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are associated with paternal and maternal deficiencies, respectively, of gene expression within human chromosome 15q11-q13, and are caused by deletion, uniparental disomy, or other mutations. Four transcripts designated PAR-5, PAR-7, PAR-1 and PAR-4 were isolated and localized to a region within 300 kb telomeric to the gene encoding small nuclear ribonucleoprotein-associated polypeptide N (SNRPN). Analysis of the transcripts in cultured fibroblasts and lymphoblasts from deletion patients demonstrated that SNRPN, PAR-5 and PAR-1 are expressed exclusively from the paternal chromosome, defining an imprinted domain that spans at least 200 kb. All three imprinted transcripts were absent in cells from three PWS patients (one pair of sibs and one sporadic case) with small deletions that involve a differentially methylated CpG island containing a previously undescribed 5{prime} untranslated exon ({alpha}) of SNRPN. Methylation of the CpG island is specific for the maternal chromosome consistent with paternal expression of the imprinted domain. One deletion, which is benign when maternally transmitted, extends upstream <30 kb from the CpG island, and is associated with altered methylation centromeric to SNRPN, and loss of transcription telomeric to SNRPN, implying the presence of an imprinting control region around the CpG island containing exon {alpha}.
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
International Nuclear Information System (INIS)
Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo
2012-01-01
Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.
Brand deletion: How the decision-making approach affects deletion success
Directory of Open Access Journals (Sweden)
Víctor Temprano-García
2018-04-01
Full Text Available Literature on brand deletion (BD, a critical and topical decision within a firm's marketing strategy, is extremely scarce. The present research is concerned with the decision-making process and examines the effect on BD success of three different approaches to decision-making – rational, intuitive and political – and of the interaction between the rational and political approaches. The moderating effect of the type of BD – i.e., total brand killing or disposal vs. brand name change – is also analyzed. The model is tested on a sample of 155 cases of BD. Results point to positive effects on BD success of both rationality and intuition, and a negative effect of politics. Findings also indicate that the negative impact of political behavior on BD success is minimized in the absence of evidence and objective information and when the BD is undertaken through a brand name change. JEL classification: L10, M31, Keywords: Brand deletion, Rational decision-making, Intuitive decision-making, Political decision-making, Brand deletion success
Delayed chromosomal instability caused by large deletion
International Nuclear Information System (INIS)
Ojima, M.; Suzuki, K.; Kodama, S.; Watanabe, M.
2003-01-01
Full text: There is accumulating evidence that genomic instability, manifested by the expression of delayed phenotypes, is induced by X-irradiation but not by ultraviolet (UV) light. It is well known that ionizing radiation, such as X-rays, induces DNA double strand breaks, but UV-light mainly causes base damage like pyrimidine dimers and (6-4) photoproducts. Although the mechanism of radiation-induced genomic instability has not been thoroughly explained, it is suggested that DNA double strand breaks contribute the induction of genomic instability. We examined here whether X-ray induced gene deletion at the hprt locus induces delayed instability in chromosome X. SV40-immortalized normal human fibroblasts, GM638, were irradiated with X-rays (3, 6 Gy), and the hprt mutants were isolated in the presence of 6-thioguanine (6-TG). A 2-fold and a 60-fold increase in mutation frequency were found by 3 Gy and 6 Gy irradiation, respectively. The molecular structure of the hprt mutations was determined by multiplex polymerase chain reaction of nine exons. Approximately 60% of 3 Gy mutants lost a part or the entire hprt gene, and the other mutants showed point mutations like spontaneous mutants. All 6 Gy mutants show total gene deletion. The chromosomes of the hprt mutants were analyzed by Whole Human Chromosome X Paint FISH or Xq telomere FISH. None of the point or partial gene deletion mutants showed aberrations of X-chromosome, however total gene deletion mutants induced translocations and dicentrics involving chromosome X. These results suggest that large deletion caused by DNA double strand breaks destabilizes chromosome structure, which may be involved in an induction of radiation-induced genomic instability
Some analogies between quantum cloning and quantum deleting
International Nuclear Information System (INIS)
Qiu Daowen
2002-01-01
We further verify the impossibility of deleting an arbitrary unknown quantum state, and also show it is impossible to delete two nonorthogonal quantum states as a consequence of unitarity of quantum mechanics. A quantum approximate (deterministic) deleting machine and a probabilistic (exact) deleting machine are constructed. The estimation for the global fidelity characterizing the efficiency of the quantum approximate deleting is given. We then demonstrate that unknown nonorthogonal states chosen from a set with their multiple copies can evolve into a linear superposition of multiple deletions and failure branches by a unitary process if and only if the states are linearly independent. It is notable that the proof for necessity is somewhat different from Pati's [Phys. Rev. Lett. 83, 2849 (1999)]. Another deleting machine for the input states that are unnecessarily linearly independent is also presented. The bounds on the success probabilities of these deleting machines are derived. So we expound some preliminary analogies between quantum cloning and deleting
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls
Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David
2015-01-01
International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.
The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.
Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J
2013-01-01
Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.
Han, Peng; Sun, Qi; Zhao, Suhui; Zhang, Qiwei; Wan, Chengsong
2014-06-01
To construct enterohemorrhagic Escherichia coli (EHEC) O157: H7 ppk gene deletion strains and study its biological characteristics. The gene fragment of kanamycin resistance was amplified using a pair of homologous arm primers whose 5' and 3' ends were homologous with ppk gene and kanamycin resistance gene, respectively. EHEC O157: H7 EDL933w competent strains were prepared and transformed via electroporation with the amplification products. The ppk gene was replaced by kanamycin resistance gene using pKD46-mediated Red recombination system. The recombinant strain was confirmed by PCR and sequencing, and its morphology, growth ability and adhesion were assessed using Gram staining, OD600 value and Giemsa staining. We established a ppk-deleted EHEC O157:H7 EDL933w strain with kanamycin resistance and compared the biological characteristics of the wild-type and mutant strains, which may facilitate further study of the regulatory mechanism of ppk gene.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Directory of Open Access Journals (Sweden)
Marcella D Cervantes
Full Text Available The unicellular eukaryote Tetrahymena thermophila has seven mating types. Cells can mate only when they recognize cells of a different mating type as non-self. As a ciliate, Tetrahymena separates its germline and soma into two nuclei. During growth the somatic nucleus is responsible for all gene transcription while the germline nucleus remains silent. During mating, a new somatic nucleus is differentiated from a germline nucleus and mating type is decided by a stochastic process. We report here that the somatic mating type locus contains a pair of genes arranged head-to-head. Each gene encodes a mating type-specific segment and a transmembrane domain that is shared by all mating types. Somatic gene knockouts showed both genes are required for efficient non-self recognition and successful mating, as assessed by pair formation and progeny production. The germline mating type locus consists of a tandem array of incomplete gene pairs representing each potential mating type. During mating, a complete new gene pair is assembled at the somatic mating type locus; the incomplete genes of one gene pair are completed by joining to gene segments at each end of germline array. All other germline gene pairs are deleted in the process. These programmed DNA rearrangements make this a fascinating system of mating type determination.
Ramos-Zald?var, H?ctor M.; Mart?nez-Ir?as, Daniel G.; Espinoza-Moreno, Nelson A.; Napky-Rajo, Jos? S.; Bueso-Aguilar, Tulio A.; Reyes-Perdomo, Karla G.; Montes-Gambarelli, Jimena A.; Euceda, Isis M.; Ponce-Barahona, Aldo F.; G?mez-Fern?ndez, Carlos A.; Moncada-Arita, Wilberg A.; Palomo-Berm?dez, Victoria A.; Jim?nez-Faraj, Julia E.; Hern?ndez-Padilla, Amanda G.; Olivera, Denys A.
2016-01-01
Background Chromosomal region 7q21.3 comprises approximately 5.2 mega base pairs that include genes DLX5/6, SHFM1, and DYNC1I1 associated with split hand/split foot malformation 1. So far, there are reports of eight families with deletion of DYNC1I1 and preserved DLX5/6 associated with ectrodactyly. From these families, only three patients did not present ectrodactyly and, unlike our patient, no other cases have been described as having craniofacial dysmorphology, mitral valve prolapse, kypho...
Haploid deletion strains of Saccharomyces cerevisiae that determine survival during space flight
Johanson, Kelly; Allen, Patricia L.; Gonzalez-Villalobos, Romer A.; Nesbit, Jacqueline; Nickerson, Cheryl A.; Höner zu Bentrup, Kerstin; Wilson, James W.; Ramamurthy, Rajee; D'Elia, Riccardo; Muse, Kenneth E.; Hammond, Jeffrey; Freeman, Jake; Stodieck, Louis S.; Hammond, Timothy G.
2007-02-01
This study identifies genes that determine survival during a space flight, using the model eukaryotic organism, Saccharomyces cerevisiae. Select strains of a haploid yeast deletion series grew during storage in distilled water in space, but not in ground based static or clinorotation controls. The survival advantages in space in distilled water include a 133-fold advantage for the deletion of PEX19, a chaperone and import receptor for newly- synthesized class I peroxisomal membrane proteins, to 77-40 fold for deletion strains lacking elements of aerobic respiration, isocitrate metabolism, and mitochondrial electron transport. Following automated addition of rich growth media, the space flight was associated with a marked survival advantage of strains with deletions in catalytically active genes including hydrolases, oxidoreductases and transferases. When compared to static controls, space flight was associated with a marked survival disadvantage of deletion strains lacking transporter, antioxidant and catalytic activity. This study identifies yeast deletion strains with a survival advantage during storage in distilled water and space flight, and amplifies our understanding of the genes critical for survival in space.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Time series regression-based pairs trading in the Korean equities market
Kim, Saejoon; Heo, Jun
2017-07-01
Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.
Oncolytic Replication of E1b-Deleted Adenoviruses
Directory of Open Access Journals (Sweden)
Pei-Hsin Cheng
2015-11-01
Full Text Available Various viruses have been studied and developed for oncolytic virotherapies. In virotherapy, a relatively small amount of viruses used in an intratumoral injection preferentially replicate in and lyse cancer cells, leading to the release of amplified viral particles that spread the infection to the surrounding tumor cells and reduce the tumor mass. Adenoviruses (Ads are most commonly used for oncolytic virotherapy due to their infection efficacy, high titer production, safety, easy genetic modification, and well-studied replication characteristics. Ads with deletion of E1b55K preferentially replicate in and destroy cancer cells and have been used in multiple clinical trials. H101, one of the E1b55K-deleted Ads, has been used for the treatment of late-stage cancers as the first approved virotherapy agent. However, the mechanism of selective replication of E1b-deleted Ads in cancer cells is still not well characterized. This review will focus on three potential molecular mechanisms of oncolytic replication of E1b55K-deleted Ads. These mechanisms are based upon the functions of the viral E1B55K protein that are associated with p53 inhibition, late viralmRNAexport, and cell cycle disruption.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Prediction of plant promoters based on hexamers and random triplet pair analysis
Directory of Open Access Journals (Sweden)
Noman Nasimul
2011-06-01
Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Probabilistic cloning and deleting of quantum states
International Nuclear Information System (INIS)
Feng Yuan; Zhang Shengyu; Ying Mingsheng
2002-01-01
We construct a probabilistic cloning and deleting machine which, taking several copies of an input quantum state, can output a linear superposition of multiple cloning and deleting states. Since the machine can perform cloning and deleting in a single unitary evolution, the probabilistic cloning and other cloning machines proposed in the previous literature can be thought of as special cases of our machine. A sufficient and necessary condition for successful cloning and deleting is presented, and it requires that the copies of an arbitrarily presumed number of the input states are linearly independent. This simply generalizes some results for cloning. We also derive an upper bound for the success probability of the cloning and deleting machine
International Nuclear Information System (INIS)
Superti-Furga, A.; Gugler, E.; Gitzelmann, R.; Steinmann, B.
1988-01-01
The authors have studied a patient with severe, dominantly inherited Ehlers-Danlos syndrome type IV. The results indicate that this patient carries a deletion of 3.3 kilobase pairs in the triple helical coding domain of one of the two alleles for the pro-α-chains of type III collagen (COL3A1). His cultured skin fibroblasts contain equal amounts of normal length mRNA and of mRNA shortened by approximately 600 bases, and synthesize both normal and shortened pro-α1(III)-chains. In procollagen molecules containing one or more shortened chains, a triple helix is formed with a length of only about 780 amino acids. The mutant procollagen molecules have decreased thermal stability, are less efficiently secreted, and are not processed as their normal counterpart. The deletion in this family is the first mutation to be described in COL3A1
46 CFR 67.171 - Deletion; requirement and procedure.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Deletion; requirement and procedure. 67.171 Section 67...; Requirement for Exchange, Replacement, Deletion, Cancellation § 67.171 Deletion; requirement and procedure. (a... provided in § 67.161, and the vessel is subject to deletion from the roll of actively documented vessels...
Size unlimited markerless deletions by a transconjugative plasmid-system in Bacillus licheniformis.
Rachinger, Michael; Bauch, Melanie; Strittmatter, Axel; Bongaerts, Johannes; Evers, Stefan; Maurer, Karl-Heinz; Daniel, Rolf; Liebl, Wolfgang; Liesegang, Heiko; Ehrenreich, Armin
2013-09-20
Conjugative shuttle vectors of the pKVM series, based on an IncP transfer origin and the pMAD vector with a temperature sensitive replication were constructed to establish a markerless gene deletion protocol for Bacilli without natural competence such as the exoenzyme producer Bacillus licheniformis. The pKVM plasmids can be conjugated to strains of B. licheniformis and B. subtilis. For chromosomal gene deletion, regions flanking the target gene are fused and cloned in a pKVM vector prior to conjugative transfer from Escherichia coli to B. licheniformis. Appropriate markers on the vector backbone allow for the identification of the integration at the target locus and thereafter the vector excision, both events taking place via homologous recombination. The functionality of the deletion system was demonstrated with B. licheniformis by a markerless 939 bp in-frame deletion of the yqfD gene and the deletion of a 31 kbp genomic segment carrying a PBSX-like prophage. Copyright © 2013 Elsevier B.V. All rights reserved.
Moddemeijer, R
In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a
A comparison of 100 human genes using an alu element-based instability model.
Directory of Open Access Journals (Sweden)
George W Cook
Full Text Available The human retrotransposon with the highest copy number is the Alu element. The human genome contains over one million Alu elements that collectively account for over ten percent of our DNA. Full-length Alu elements are randomly distributed throughout the genome in both forward and reverse orientations. However, full-length widely spaced Alu pairs having two Alus in the same (direct orientation are statistically more prevalent than Alu pairs having two Alus in the opposite (inverted orientation. The cause of this phenomenon is unknown. It has been hypothesized that this imbalance is the consequence of anomalous inverted Alu pair interactions. One proposed mechanism suggests that inverted Alu pairs can ectopically interact, exposing both ends of each Alu element making up the pair to a potential double-strand break, or "hit". This hypothesized "two-hit" (two double-strand breaks potential per Alu element was used to develop a model for comparing the relative instabilities of human genes. The model incorporates both 1 the two-hit double-strand break potential of Alu elements and 2 the probability of exon-damaging deletions extending from these double-strand breaks. This model was used to compare the relative instabilities of 50 deletion-prone cancer genes and 50 randomly selected genes from the human genome. The output of the Alu element-based genomic instability model developed here is shown to coincide with the observed instability of deletion-prone cancer genes. The 50 cancer genes are collectively estimated to be 58% more unstable than the randomly chosen genes using this model. Seven of the deletion-prone cancer genes, ATM, BRCA1, FANCA, FANCD2, MSH2, NCOR1 and PBRM1, were among the most unstable 10% of the 100 genes analyzed. This algorithm may lay the foundation for comparing genetic risks posed by structural variations that are unique to specific individuals, families and people groups.
NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex
International Nuclear Information System (INIS)
Li, Ying; Wilson, W.D.; Zon, G.
1991-01-01
1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted
Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes
Directory of Open Access Journals (Sweden)
Ji-Jian Chin
2014-01-01
Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Efficient and provable secure pairing-free security-mediated identity-based identification schemes.
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Leszczynski, J.
2001-01-01
Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001
On Deletion of Sutra Translation
Institute of Scientific and Technical Information of China (English)
CHEN Shu-juan
2017-01-01
Dao An's the metaphor of translation "wine diluted with water' ' expressed a view about translation that had been abridged.Later Kumarajiva provided metaphor "rice chewed—tasteless and downright disgusting".Both of them felt regretted at the weakening of taste,sometimes even the complete loss of flavor caused by deletion in translation of Buddhist sutras.In early sutra translation,deletion is unavoidable which made many sutra translators felt confused and drove them to study it further and some even managed to give their understanding to this issue.This thesis will discuss the definition,and what causes deletion and the measures adopted by the sutra translators.
Optimal in-feed amino acid ratio for broiler breeder hens based on deletion studies.
Dorigam, J C P; Sakomura, N K; Sarcinelli, M F; Gonçalves, C A; de Lima, M B; Peruzzi, N J
2017-12-01
An ideal amino acid ratio (IAAR) for breeder hens is needed for maximum nitrogen retention (NR) taking into account nitrogen deposition in body (ND B ), feathers (ND F ) and egg mass (NEM) to improve dietary protein efficiency. Thus, the aim of this study was to apply the deletion method to derive the IAAR for broiler breeder hens. The nitrogen balance trials were performed from 31 to 35 weeks and from 46 to 50 weeks. Twelve treatments with eight replicates and one hen per cage were used. A balanced diet (BD) was formulated to meet the requirement of all nutrients. The other diets were formulated diluting 55% of BD with corn starch and refilled with amino acids (AAs) and other ingredients, except the AA tested. Each trial lasted 25 days. Feather losses, egg production and egg weight were recorded daily, and the samples were stored to further determine NEM and nitrogen in feather losses (ND FL ). At the start and the end of each period, a group of birds were slaughtered to further determine ND B and ND F . The NR was calculated as the sum of ND B , ND F , ND FL , NEM and the nitrogen maintenance requirement (NMR). The deletion of valine greatly depressed the NR in peak production (31 to 35 weeks) while the deletion of the isoleucine greatly depressed the NR of the hens from 46 to 50 weeks of age. The percentual reduction in NR and the per cent of the AA to delete from the BD were used to calculate the AA requirement. The average IAAR was Lys 100, Met+Cys 86, Trp 23, Thr 80, Arg 113, Val 90, Ile 91, Leu 133, Phe+Tyr 108, Gly+Ser 94 and His 35. The IAAR was in line with the recommendation from the literature, validating deletion method with the advantages from a rapid and low-cost procedure. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.
Möller, M; Hellberg, Å; Olsson, M L
2018-02-01
ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.
Exploration of methods to localize DNA sequences missing from c-locus deletions
International Nuclear Information System (INIS)
Albritton, L.M.; Russell, L.B.; Montgomery, C.S.
1987-01-01
The authors have earlier characterized a large number of radiation-induced mutations at the c locus (on Chromosome 7) through genetic analysis, including extensive complementation tests. Based on this work, they have postulated that many of these mutations are deletions of various lengths, overlapping at c (the marker used in the mutation-rate experiments that generated the mutants). It was possible to apportion these deletions among 13 complementation groups and to fit them to a linear map of 8 functional units. Collectively, the deletions extend from a point between tp and c to one between sh-1 and Hbb, i.e., a genetic distance of from 6 to 10 cM, corresponding to at least 10 4 Kb of DNA. This year, the authors completed a pilot study designed to explore methods for finding DNA sequences that map to the region covered by the various c-deletions. The general plan was to probe DNA with clones derived from Chromosome-7-enriched libraries or with sequences known (or suspected) to reside in Chromosome 7. Three methods were explored for deriving the c-region-deficient DNA: (a) from mouse-hamster somatic-cell hydrids retaining a deleted mouse Chromosome 7, but no homologue; (b) from F 1 hybrids of M. musculus domesticus (carrying a c-locus deletion) by M. spretus; and (c) from F 1 hybrids of M. domesticus stocks carrying complementing deletions
The detection of large deletions or duplications in genomic DNA.
Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R
2002-11-01
While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.
DEFF Research Database (Denmark)
Carli, Lorenzo; Genta, G; Cantatore, Angela
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...
Energy Technology Data Exchange (ETDEWEB)
Romac, S; Leong, P; Sockett, H; Hutchinson, F [Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry
1989-09-20
The DNA base sequence changes induced by mutagenesis with ultraviolet light have been determined in a gene on a chromosome of cultured Chinese hamster ovary (CHO) cells. The gene was the Excherichia coli gpt gene, of which a single copy was stably incorporated and expressed in the CHO cell genome. The cells were irradiated with ultraviolet light and gpt{sup -} colonies were selected by resistance to 6-thioguanine. The gpt gene was amplified from chromosomal DNA by use of the polymerase chain reaction (PCR) and the amplified DNA sequenced directly by the dideoxy method. Of the 58 sequenced mutants of independent origin 53 were base change mutations. Forty-one base substitutions were single base changes, ten had two adjacent (or tandem) base changes, and one had two base changes separated by a single base-pair. Only one mutant had a multiple base change mutation with two or more well separated base changes. In contrast much higher levels of such mutations were reported in ultraviolet mutagenesis of genes on a shuttle vector in primate cells. Two deletions of a single base-pair were observed and three deletions ranging from 6 to 37 base-pairs. The mutation spectrum in the gpt gene had similarities to the ultraviolet mutation spectra for several genes in prokaryotes, which suggests similarities in mutational mechanisms in prokaryotes and eukaryotes. (author).
Kostner, David; Rachinger, Michael; Liebl, Wolfgang; Ehrenreich, Armin
2017-11-01
Bacillus licheniformis strains are used for the large-scale production of industrial exoenzymes from proteinaceous substrates, but details of the amino acid metabolism involved are largely unknown. In this study, two chromosomal genes putatively involved in amino acid metabolism of B. licheniformis were deleted to clarify their role. For this, a convenient counterselection system for markerless in-frame deletions was developed for B. licheniformis. A deletion plasmid containing up- and downstream DNA segments of the chromosomal deletion target was conjugated to B. licheniformis and integrated into the genome by homologous recombination. Thereafter, the counterselection was done by using a codBA cassette. The presence of cytosine deaminase and cytosine permease exerted a conditionally lethal phenotype on B. licheniformis cells in the presence of the cytosine analogue 5-fluorocytosine. Thereby clones were selected that lost the integrated vector sequence and the anticipated deletion target after a second recombination step. This method allows the construction of markerless mutants in Bacillus strains in iterative cycles. B. licheniformis MW3 derivatives lacking either one of the ORFs BL03009 or BL00190, encoding a putative alanine dehydrogenase and a similar putative enzyme, respectively, retained the ability to grow in minimal medium supplemented with alanine as the carbon source. In the double deletion mutant MW3 ΔBL03009 ΔBL00190, however, growth on alanine was completely abolished. These data indicate that the two encoded enzymes are paralogues fulfilling mutually replaceable functions in alanine utilization, and suggest that in B. licheniformis MW3 alanine utilization is initiated by direct oxidative transamination to pyruvate and ammonium.
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.
2014-01-01
Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
Energy Technology Data Exchange (ETDEWEB)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)
2016-02-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
International Nuclear Information System (INIS)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.
2016-01-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes
Screening for calreticulin mutations in a cohort of patients suspected ...
African Journals Online (AJOL)
Of the 36 types of insertions and deletions identified, type 1 (a. 52-base pair deletion) and type 2 (a 5-base pair insertion) mutations account for >80% of CALR mutations.[7] Phenotypic differences between type 1 and type 2 carriers have been implicated. [3] All recurrent mutations cause a frameshift in the region encoding.
Dye-sensitized solar cell with a pair of carbon-based electrodes
International Nuclear Information System (INIS)
Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun
2012-01-01
We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
PandA : pairings and arithmetic
Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.
2014-01-01
This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give
Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.
Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi
2018-02-19
It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .
A strong deletion bias in nonallelic gene conversion.
Directory of Open Access Journals (Sweden)
Raquel Assis
Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.
Characterization of five partial deletions of the factor VIII gene
International Nuclear Information System (INIS)
Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.
1987-01-01
Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
Periventricular heterotopia in a boy with interstitial deletion of chromosome 4p.
Gawlik-Kuklinska, Katarzyna; Wierzba, Jolanta; Wozniak, Agnieszka; Iliszko, Mariola; Debiec-Rychter, Maria; Dubaniewicz-Wybieralska, Miroslawa; Limon, Janusz
2008-01-01
We report on a 4-year-old boy with a proximal interstitial deletion in the short arm of chromosome 4p with the karyotype 46,XY,del(4)(p14p15.32),inv(9)(p13q13). For a precise delineation of the deleted region, an array-based comparative genomic hybridization (a-CGH) analysis was performed. The proband's phenotype and cytogenetic findings are compared with previously reported cases with proximal 4p deletion syndrome. The syndrome is associated with normal growth, varying degrees of mental retardation, characteristic facial appearance and minor dysmorphic features. Additionally, our patient developed a seizure disorder due to abnormal neuronal migration, i.e., periventricular heterotopia.
A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.
Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques
2016-01-01
We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.
Directory of Open Access Journals (Sweden)
Rie Kawai
2012-03-01
Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.
76 FR 5142 - Procurement List; Additions and Deletion
2011-01-28
... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and deletion from the Procurement List. SUMMARY: This action adds services to the Procurement.... Contracting Activity: Department of Transportation, Federal Aviation Administration, Jamaica, NY. Deletion On...
Association between F508 deletion in CFTR and chronic pancreatitis risk.
Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli
2017-09-01
The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Analysis of human HPRT- deletion mutants by the microarray-CGH (comparative genomic hybridization)
International Nuclear Information System (INIS)
Kodaira, M.; Sasaki, K.; Tagawa, H.; Omine, H.; Kushiro, J.; Takahashi, N.; Katayama, H.
2003-01-01
We are trying to evaluate genetic effects of radiation on human using mutation frequency as an indicator. For the efficient detection of mutations, it is important to understand the mechanism and the characteristics of radiation-induced mutations. We have started the analysis of hypoxanthine-guanine phosphoribosyl transferase (HPRT) mutants induced by X-ray in order to clarify the deletion size and the mutation-distribution. We analyzed 39 human X-ray induced HPRT-deletion mutants by using the microarray-CGH. The array for this analysis contains 57 BAC clones covering as much as possible of the 4Mb of the 5' side and 10Mb of the 3' side of the HPRT gene based on the NCBI genome database. DNA from parent strain and each HPRT-mutant strain are labeled with Cy5 and Cy3 respectively, and were mixed and hybridized on the array. Fluorescent intensity ratio of the obtained spots was analyzed using software we developed to identify clones corresponding to the deletion region. The deletion in these strains ranged up to 3.5 Mb on the 5' side and 6 Mb on the 3' side of the HPRT gene. Deletions in 13 strains ended around BAC clones located at about 3 Mb on the 5' side. On the 3' side, deletions extended up to the specific clones located at 1.5 Mb in 11 strains. The mutations seem to be complex on the 3' end of deletion; some accompanied duplications with deletions and others could not be explained by one mutation event. We need to confirm these results, taking into account the experimental reproducibility and the accuracy of the published genetic map. The results of the research using the microarray-CGH help us to search the regions where deletions are easily induced and to identify the factors affecting the range of deletions
Directory of Open Access Journals (Sweden)
Phelan Mary C
2008-05-01
Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements
Directory of Open Access Journals (Sweden)
Björkhem Gudrun
2008-01-01
Full Text Available Abstract Background Subtelomeric regions are gene rich and deletions in these chromosomal segments have been demonstrated to account for approximately 2.5% of patients displaying mental retardation with or without association of dysmorphic features. However, cases that report de novo terminal deletions on chromosome arm 15q are rare. Methods In this study we present the first example of a detailed molecular genetic mapping of a de novo deletion in involving 15q26.2-qter, caused by the formation of a dicentric chromosome 15, using metaphase FISH and tiling resolution (32 k genome-wide array-based comparative genomic hybridization (CGH. Results After an initial characterization of the dicentric chromosome by metaphase FISH, array CGH analysis mapped the terminal deletion to encompass a 6.48 megabase (Mb region, ranging from 93.86–100.34 Mb on chromosome 15. Conclusion In conclusion, we present an additional case to the growing family of reported cases with 15q26-deletion, thoroughly characterized at the molecular cytogenetic level. In the deleted regions, four candidate genes responsible for the phenotype of the patient could be delineated: IGFR1, MEF2A, CHSY1, and TM2D3. Further characterization of additional patients harboring similar 15q-aberrations might hopefully in the future lead to the description of a clear cut clinically recognizable syndrome.
78 FR 29119 - Procurement List; Additions and Deletion
2013-05-17
... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and Deletion from the Procurement List. SUMMARY: This action adds products and services to the... Activity: Washington Headquarters Services (WHS), Acquisition Directorate, Washington, DC. Deletion On 4/5...
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
Directory of Open Access Journals (Sweden)
Zixiang Xu
Full Text Available Gene knockout has been used as a common strategy to improve microbial strains for producing chemicals. Several algorithms are available to predict the target reactions to be deleted. Most of them apply mixed integer bi-level linear programming (MIBLP based on metabolic networks, and use duality theory to transform bi-level optimization problem of large-scale MIBLP to single-level programming. However, the validity of the transformation was not proved. Solution of MIBLP depends on the structure of inner problem. If the inner problem is continuous, Karush-Kuhn-Tucker (KKT method can be used to reformulate the MIBLP to a single-level one. We adopt KKT technique in our algorithm ReacKnock to attack the intractable problem of the solution of MIBLP, demonstrated with the genome-scale metabolic network model of E. coli for producing various chemicals such as succinate, ethanol, threonine and etc. Compared to the previous methods, our algorithm is fast, stable and reliable to find the optimal solutions for all the chemical products tested, and able to provide all the alternative deletion strategies which lead to the same industrial objective.
44 CFR 5.27 - Deletion of identifying details.
2010-10-01
... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Deletion of identifying... Availability of General Agency Information, Rules, Orders, Policies, and Similar Material § 5.27 Deletion of..., interpretation, or staff manual or instruction. However, the justification for each deletion will be explained...
Directory of Open Access Journals (Sweden)
Stephen C Collins
2010-03-01
Full Text Available Fragile X syndrome (FXS is caused by loss of function mutations in the FMR1 gene. Trinucleotide CGG-repeat expansions, resulting in FMR1 gene silencing, are the most common mutations observed at this locus. Even though the repeat expansion mutation is a functional null mutation, few conventional mutations have been identified at this locus, largely due to the clinical laboratory focus on the repeat tract.To more thoroughly evaluate the frequency of conventional mutations in FXS-like patients, we used an array-based method to sequence FMR1 in 51 unrelated males exhibiting several features characteristic of FXS but with normal CGG-repeat tracts of FMR1. One patient was identified with a deletion in FMR1, but none of the patients were found to have other conventional mutations.These data suggest that missense mutations in FMR1 are not a common cause of the FXS phenotype in patients who have normal-length CGG-repeat tracts. However, screening for small deletions of FMR1 may be of clinically utility.
19 CFR 142.49 - Deletion of C-4 Code.
2010-04-01
.... Entry filers may delete C-4 Codes from Line Release by notifying the port director in writing on a Deletion Data Loading Sheet. Such notification shall state the C-4 Code which is to be deleted, the port... TREASURY (CONTINUED) ENTRY PROCESS Line Release § 142.49 Deletion of C-4 Code. (a) By Customs. A port...
International Nuclear Information System (INIS)
Sinnott, P.; Collier, S.; Dyer, P.A.; Harris, R.; Strachan, T.; Costigan, C.
1990-01-01
The HLA-linked human steroid 21-hydroxylase gene CYP21B and its closely homologous pseudogene CYP21A are each normally located centromeric to a fourth component of complement (C4) gene, C4B and C4A, respectively, in an organization suggesting tandem duplication of a ca. 30-kilobase DNA unit containing a CYP21 gene and a C4 gene. Such an organization has been considered to facilitate gene deletion and addition events by unequal crossover between the tandem repeats. The authors have identified a steroid 21-hydroxylase deficiency patient who has a maternally inherited disease haplotype that carries a de novo deletion of a ca. 30-kilobase repeat unit including the CYP21B gene and associated C4B gene. This disease haplotype appears to have been generated as a result of meiotic unequal crossover between maternal homologous chromosomes. One of the maternal haplotypes is the frequently occurring HLA-DR3,B8,A1 haplotype that normally carries a deletion of a ca. 30-kilobase unit including the CYP21A gene and C4A gene. Haplotypes of this type may possible act as premutations, increasing the susceptibility of developing a 21-hydroxylase deficiency mutation by facilitating unequal chromosome pairing
Paired structures and other opposite-based models
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel
2015-01-01
, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...
5 CFR 2502.18 - Deletion of exempted information.
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deletion of exempted information. 2502.18... Charges for Search and Reproduction § 2502.18 Deletion of exempted information. Where requested records... the remainder of the records, they shall be disclosed by the Office with deletions. To each such...
78 FR 75912 - Procurement List; Addition and Deletion
2013-12-13
... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Addition to and deletion from the Procurement List. SUMMARY: This action adds a service to the Procurement...: General Services Administration, Fort Worth, TX Deletion On 11/1/2013 (78 FR 65618), the Committee for...
International Nuclear Information System (INIS)
Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun
2017-01-01
Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.
Allam, Amin
2015-07-14
Motivation: Next-generation sequencing generates large amounts of data affected by errors in the form of substitutions, insertions or deletions of bases. Error correction based on the high-coverage information, typically improves de novo assembly. Most existing tools can correct substitution errors only; some support insertions and deletions, but accuracy in many cases is low. Results: We present Karect, a novel error correction technique based on multiple alignment. Our approach supports substitution, insertion and deletion errors. It can handle non-uniform coverage as well as moderately covered areas of the sequenced genome. Experiments with data from Illumina, 454 FLX and Ion Torrent sequencing machines demonstrate that Karect is more accurate than previous methods, both in terms of correcting individual-bases errors (up to 10% increase in accuracy gain) and post de novo assembly quality (up to 10% increase in NGA50). We also introduce an improved framework for evaluating the quality of error correction.
Boyer-Moore Algorithm in Retrieving Deleted Short Message Service in Android Platform
Rahmat, R. F.; Prayoga, D. F.; Gunawan, D.; Sitompul, O. S.
2018-02-01
Short message service (SMS) can be used as digital evidence of disclosure of crime because it can strengthen the charges against the offenders. Criminals use various ways to destroy the evidence, including by deleting SMS. On the Android OS, SMS is stored in a SQLite database file. Deletion of SMS data is not followed by bit deletion in memory so that it is possible to rediscover the deleted SMS. Based on this case, the mobile forensic needs to be done to rediscover the short message service. The proposed method in this study is Boyer-Moore algorithm for searching string matching. An auto finds feature is designed to rediscover the short message service by searching using a particular pattern to rematch a text with the result of the hex value conversion in the database file. The system will redisplay the message for each of a match. From all the testing results, the proposed method has quite a high accuracy in rediscovering the short message service using the used dataset. The search results to rediscover the deleted SMS depend on the possibility of overwriting process and the vacuum procedure on the database file.
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
5 CFR 1631.17 - Deletion of exempted information.
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deletion of exempted information. 1631.17... Deletion of exempted information. Where requested records contain matters which are exempted under 5 U.S.C... disclosed by the Board with deletions. To each such record, the Board shall attach a written justification...
78 FR 27369 - Procurement List; Additions and Deletion
2013-05-10
... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and Deletion from the Procurement List. SUMMARY: This action adds products to the Procurement..., Philadelphia, PA. Deletion On 4/5/2013 (78 FR 20622-20623), the Committee for Purchase From People Who Are...
49 CFR 7.6 - Deletion of identifying detail.
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Deletion of identifying detail. 7.6 Section 7.6... To Be Made Public by DOT § 7.6 Deletion of identifying detail. Whenever it is determined to be... the deletion will accompany the record published or made available for inspection. ...
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J
2012-09-12
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.
A Comparative Study of Quantum and Classical Deletion
International Nuclear Information System (INIS)
Shen Yao; Hao Liang; Long Guilu
2010-01-01
Here in this letter, we study the difference between quantum and classical deletion. We point out that the linear mapping deletion operation used in the impossibility proof for quantum systems applies also to classical system. The general classical deletion operation is a combined operation of measurement and transformation, i.e., first read the state and then transfer the state to the standard blank state. Though both quantum information and classical information can be deleted in an open system, quantum information cannot be recovered while classical information can be recovered. (general)
New traits in crops produced by genome editing techniques based on deletions
Wiel, van de C.C.M.; Schaart, J.G.; Lotz, L.A.P.; Smulders, M.J.M.
2017-01-01
One of the most promising New Plant Breeding Techniques is genome editing (also called gene editing) with the help of a programmable site-directed nuclease (SDN). In this review, we focus on SDN-1, which is the generation of small deletions or insertions (indels) at a precisely defined location in
Directory of Open Access Journals (Sweden)
Das Tanmoy
2012-03-01
Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.
36 CFR 1275.58 - Deletion of restricted portions.
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Deletion of restricted... HISTORICAL MATERIALS OF THE NIXON ADMINISTRATION Access by the Public § 1275.58 Deletion of restricted... materials after the deletion of the portions which are restricted under this § 1275.50 or § 1275.52. ...
75 FR 69638 - Procurement List; Additions and Deletion
2010-11-15
... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and deletion from the Procurement List. SUMMARY: This action adds products and a service to the...), DENVER, CO. Deletion On 9/17/2010 (75 FR 56995-56996), the Committee for Purchase From People Who Are...
Genetics Home Reference: proximal 18q deletion syndrome
... characteristic features. Most cases of proximal 18q deletion syndrome are the result of a new (de novo) deletion and are not inherited from a ... J, Fox PT, Stratton RF, Perry B, Hale DE. Recurrent interstitial deletions of proximal 18q: a new syndrome involving expressive speech delay. Am J Med Genet ...
Song, Li; Cui, Hongyu; Tang, Lijie; Qiao, Xinyuan; Liu, Min; Jiang, Yanping; Cui, Wen; Li, Yijing
2014-07-01
Integration plasmids are often used in constructing chromosomal mutations, as it enables the alternation of genes at any location by integration or replacement. Food-grade integration vectors can integrate into the host genome without introducing any selectable markers or residual bases, and the recombination often happens in non-coding region. In this study we used the temperature-sensitive pWV01 replicon to construct 2 chloramphenicol-resistant integration plasmids (pGBHC32-upp) containing the uracil phosphoribosyl transferase (upp) gene as a counterselective marker for Lactobacillus casei (L. casei) ATCC393 and Lactococcus lactis (L. lactis) MG1363. We then ligated the designed homologous arms to the pGBHC32-upp plasmids to allow their integration to the bacterial chromosome, and selected upp deletion mutants of L. casei ATCC393 and L. lactis MG1363 in the presence of 5-fluorouracil (5-FU). Analysis of genetic stability, growth curve, carbon utilization and scanning electronic microscopy showed that, except for 5-FU resistance, there were no significant differences between the wild type and mutant lactic acid bacteria. The integration system and the upp deletion strains could be used in the insertion or deletion of genes at any location of the chromosome of both L. casei ATCC 393 and L. lactis MG1363, and the homologous recombination would not introduce any selectable markers or residual bases. These mutant strains can be further investigated for heterologous protein expression and construction of a live mucosal vaccine carrier. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jamie A. O'Rourke
2013-06-01
Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.
Saveliev, S V; Cox, M M
1996-01-01
We provide a molecular description of key intermediates in the deletion of two internal eliminated sequences (IES elements), the M and R regions, during macronuclear development in Tetrahymena thermophila. Using a variety of PCR-based methods in vivo, double-strand breaks are detected that are generated by hydrolytic cleavage and correspond closely to the observed chromosomal junctions left behind in the macronuclei. The breaks exhibit a temporal and structural relationship to the deletion reaction that provides strong evidence that they are intermediates in the deletion pathway. Breaks in the individual strands are staggered by 4 bp, producing a four nucleotide 5' extension. Evidence is presented that breaks do not occur simultaneously at both ends. The results are most consistent with a deletion mechanism featuring initiation by double-strand cleavage at one end of the deleted element, followed by transesterification to generate the macronuclear junction on one DNA strand. An adenosine residue is found at all the nucleophilic 3' ends used in the postulated transesterification step. Evidence for the transesterification step is provided by detection of a 3' hydroxyl that would be liberated by such a step at a deletion boundary where no other DNA strand ends are detected. Images PMID:8654384
Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei
2014-04-01
α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.
Non-standard base pairing and stacked structures in methyl xanthine clusters
Czech Academy of Sciences Publication Activity Database
Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.
2008-01-01
Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008
Changes in DNA base sequence induced by gamma-ray mutagenesis of lambda phage and prophage
Energy Technology Data Exchange (ETDEWEB)
Tindall, K.R.; Stein, J.; Hutchinson, F.
1988-04-01
Mutations in the cI (repressor) gene were induced by gamma-ray irradiation of lambda phage and of prophage, and 121 mutations were sequenced. Two-thirds of the mutations in irradiated phage assayed in recA host cells (no induction of the SOS response) were G:C to A:T transitions; it is hypothesized that these may arise during DNA replication from adenine mispairing with a cytosine product deaminated by irradiation. For irradiated phage assayed in host cells in which the SOS response had been induced, 85% of the mutations were base substitutions, and in 40 of the 41 base changes, a preexisting base pair had been replaced by an A:T pair; these might come from damaged bases acting as AP (apurinic or apyrimidinic) sites. The remaining mutations were 1 and 2 base deletions. In irradiated prophage, base change mutations involved the substitution of both A:T and of G:C pairs for the preexisting pairs; the substitution of G:C pairs shows that some base substitution mechanism acts on the cell genome but not on the phage. In the irradiated prophage, frameshifts and a significant number of gross rearrangements were also found.
Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.
Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B
2010-05-14
Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
29 CFR 1610.20 - Deletion of exempted matters.
2010-07-01
... 29 Labor 4 2010-07-01 2010-07-01 false Deletion of exempted matters. 1610.20 Section 1610.20 Labor... Production or Disclosure Under 5 U.S.C. 552 § 1610.20 Deletion of exempted matters. Where requested records... the remainder of the records, they shall be disclosed by the Commission with deletions. To each such...
Directory of Open Access Journals (Sweden)
Michael A Thomas
Full Text Available The global health burden engendered by human immunodeficiency virus (HIV-induced acquired immunodeficiency syndrome (AIDS is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1 through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and
Thomas, Michael A; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A; Venzon, David; Robert-Guroff, Marjorie
2013-01-01
The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a
Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.
Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam
2015-01-21
Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however
Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators
International Nuclear Information System (INIS)
Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.
1985-01-01
The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states
DELETION AND 5'CPG ISLAND METHYLATION OF p15 GENE IN BRAIN GLIOMA
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
Objective: To investigate the abnormality of p15 gene in brain glioma and the correlation of it with occurrence or malignant progression of brain glioma. Methods: Deletion and 5'CPG island methylation of p15 gene were detected by the methods of PCR and PCR-based methylation in 56 cases of brain glioma. Results: Out of 43 cases of high grade glioma, 14 cases were found to have homozygous deletion of p15E1, while none of the 13 cases of low grade glioma was found to have deletion of p15E1 (P<0.05). Methylation of 5'CPG Island of p15 gene was found only in four cases of glioma. Conclusion: Abnormality of p15 gene may involved in the occurrence and malignant progression of brain glioma. Homozygous deletion of gene is the major mechanism of inactivation for p15 gene in brain glioma.
Detection of 1p36 deletion by clinical exome-first diagnostic approach.
Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei
2016-01-01
Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis.
Energy Technology Data Exchange (ETDEWEB)
Borg, Matthew K., E-mail: matthew.borg@strath.ac.uk [Department of Mechanical and Aerospace Engineering, University of Strathclyde, Glasgow G1 1XJ (United Kingdom); Lockerby, Duncan A., E-mail: duncan.lockerby@warwick.ac.uk [School of Engineering, University of Warwick, Coventry CV4 7AL (United Kingdom); Reese, Jason M., E-mail: jason.reese@ed.ac.uk [School of Engineering, University of Edinburgh, Edinburgh EH9 3JL (United Kingdom)
2014-02-21
The emergence of new applications of molecular dynamics (MD) simulation calls for the development of mass-statting procedures that insert or delete particles on-the-fly. In this paper we present a new mass-stat which we term FADE, because it gradually “fades-in” (inserts) or “fades-out” (deletes) molecules over a short relaxation period within a MD simulation. FADE applies a time-weighted relaxation to the intermolecular pair forces between the inserting/deleting molecule and any neighbouring molecules. The weighting function we propose in this paper is a piece-wise polynomial that can be described entirely by two parameters: the relaxation time scale and the order of the polynomial. FADE inherently conserves overall system momentum independent of the form of the weighting function. We demonstrate various simulations of insertions of atomic argon, polyatomic TIP4P water, polymer strands, and C{sub 60} Buckminsterfullerene molecules. We propose FADE parameters and a maximum density variation per insertion-instance that restricts spurious potential energy changes entering the system within desired tolerances. We also demonstrate in this paper that FADE compares very well to an existing insertion algorithm called USHER, in terms of accuracy, insertion rate (in dense fluids), and computational efficiency. The USHER algorithm is applicable to monatomic and water molecules only, but we demonstrate that FADE can be generally applied to various forms and sizes of molecules, such as polymeric molecules of long aspect ratio, and spherical carbon fullerenes with hollow interiors.
International Nuclear Information System (INIS)
Borg, Matthew K.; Lockerby, Duncan A.; Reese, Jason M.
2014-01-01
The emergence of new applications of molecular dynamics (MD) simulation calls for the development of mass-statting procedures that insert or delete particles on-the-fly. In this paper we present a new mass-stat which we term FADE, because it gradually “fades-in” (inserts) or “fades-out” (deletes) molecules over a short relaxation period within a MD simulation. FADE applies a time-weighted relaxation to the intermolecular pair forces between the inserting/deleting molecule and any neighbouring molecules. The weighting function we propose in this paper is a piece-wise polynomial that can be described entirely by two parameters: the relaxation time scale and the order of the polynomial. FADE inherently conserves overall system momentum independent of the form of the weighting function. We demonstrate various simulations of insertions of atomic argon, polyatomic TIP4P water, polymer strands, and C 60 Buckminsterfullerene molecules. We propose FADE parameters and a maximum density variation per insertion-instance that restricts spurious potential energy changes entering the system within desired tolerances. We also demonstrate in this paper that FADE compares very well to an existing insertion algorithm called USHER, in terms of accuracy, insertion rate (in dense fluids), and computational efficiency. The USHER algorithm is applicable to monatomic and water molecules only, but we demonstrate that FADE can be generally applied to various forms and sizes of molecules, such as polymeric molecules of long aspect ratio, and spherical carbon fullerenes with hollow interiors
Probabilistic deletion of copies of linearly independent quantum states
International Nuclear Information System (INIS)
Feng Jian; Gao Yunfeng; Wang Jisuo; Zhan Mingsheng
2002-01-01
We show that each of two copies of the nonorthogonal states randomly selected from a certain set S can be probabilistically deleted by a general unitary-reduction operation if and only if the states are linearly independent. We derive a tight bound on the best possible deleting efficiencies. These results for 2→1 probabilistic deleting are also generalized into the case of N→M deleting (N,M positive integers and N>M)
International Nuclear Information System (INIS)
Oleynik, Danila; Petrosyan, Artem; Garonne, Vincent; Campana, Simone
2012-01-01
The ATLAS Distributed Data Management project DQ2 is responsible for the replication, access and bookkeeping of ATLAS data across more than 100 distributed grid sites. It also enforces data management policies decided on by the collaboration and defined in the ATLAS computing model. The DQ2 Deletion Service is one of the most important DDM services. This distributed service interacts with 3rd party grid middleware and the DQ2 catalogues to serve data deletion requests on the grid. Furthermore, it also takes care of retry strategies, check-pointing transactions, load management and fault tolerance. In this paper special attention is paid to the technical details which are used to achieve the high performance of service, accomplished without overloading either site storage, catalogues or other DQ2 components. Special attention is also paid to the deletion monitoring service that allows operators a detailed view of the working system.
International Nuclear Information System (INIS)
Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi
2010-01-01
2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Utilization of deletion bins to anchor and order sequences along the wheat 7B chromosome.
Belova, Tatiana; Grønvold, Lars; Kumar, Ajay; Kianian, Shahryar; He, Xinyao; Lillemo, Morten; Springer, Nathan M; Lien, Sigbjørn; Olsen, Odd-Arne; Sandve, Simen R
2014-09-01
A total of 3,671 sequence contigs and scaffolds were mapped to deletion bins on wheat chromosome 7B providing a foundation for developing high-resolution integrated physical map for this chromosome. Bread wheat (Triticum aestivum L.) has a large, complex and highly repetitive genome which is challenging to assemble into high quality pseudo-chromosomes. As part of the international effort to sequence the hexaploid bread wheat genome by the international wheat genome sequencing consortium (IWGSC) we are focused on assembling a reference sequence for chromosome 7B. The successful completion of the reference chromosome sequence is highly dependent on the integration of genetic and physical maps. To aid the integration of these two types of maps, we have constructed a high-density deletion bin map of chromosome 7B. Using the 270 K Nimblegen comparative genomic hybridization (CGH) array on a set of cv. Chinese spring deletion lines, a total of 3,671 sequence contigs and scaffolds (~7.8 % of chromosome 7B physical length) were mapped into nine deletion bins. Our method of genotyping deletions on chromosome 7B relied on a model-based clustering algorithm (Mclust) to accurately predict the presence or absence of a given genomic sequence in a deletion line. The bin mapping results were validated using three different approaches, viz. (a) PCR-based amplification of randomly selected bin mapped sequences (b) comparison with previously mapped ESTs and (c) comparison with a 7B genetic map developed in the present study. Validation of the bin mapping results suggested a high accuracy of the assignment of 7B sequence contigs and scaffolds to the 7B deletion bins.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
International Nuclear Information System (INIS)
Shull, B.C.; Chen, K.C.; Lederman, M.; Stout, E.R.; Bates, R.C.
1988-01-01
Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8. These clones were stable during propagation in Escherichia coli JM107. All clones tested were found to be infectious by the criteria of plaque titer and progressive cytophathic effect after transfection into bovine fetal lung cells. Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3')-terminal deletions of up to 34 bases. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. Full-length genomic clones with 3' flip and 3' flop conformations were constructed and were found to have equal infectivity. Expression of capsid proteins from tranfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of [ 35 S]methionine-labeled cell lysates. Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection. Independently, a series of genomic clones with increasingly larger 3'-terminal deletions was prepared from separately subcloned 3'-terminal fragments. Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3' end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal. End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus
Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida
2013-06-01
Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.
Efficient Implementation of the Pairing on Mobilephones Using BREW
Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki
Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.
Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.
2012-01-01
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947
DEFF Research Database (Denmark)
Bisgaard, A-M; Kirchhoff, M; Nielsen, J E
2008-01-01
A deletion on one chromosome and a mutant allele on the other may cause an autosomal recessive disease. We report on two patients with mental retardation, dysmorphic features and low catalytic activity of arylsulfatase A. One patient had a pathogenic mutation in the arylsulfatase A gene (ARSA......) and succumbed to metachromatic leukodystrophy (MLD). The other patient had a pseudoallele, which does not lead to MLD. The presenting clinical features and low arylsulfatase A activity were explained, in each patients, by a deletion of 22q13 and, thereby, of one allele of ARSA....
75 FR 56995 - Procurement List Proposed Additions and Deletion
2010-09-17
... Additions and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Additions to and Deletion From the Procurement List. SUMMARY: The Committee is proposing to add... aggregated by the Defense Logistics Agency Troop Support, Philadelphia, PA. Deletion Regulatory Flexibility...
76 FR 60810 - Procurement List; Proposed Additions and Deletion
2011-09-30
... Additions and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Additions to and Deletion from the Procurement List. SUMMARY: The Committee is proposing to add... Activity: Department of Energy, Idaho Operations Office, Idaho Falls, ID. DELETION Regulatory Flexibility...
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Metalophillic attraction in the consecutive T-HgII-T DNA base pairs
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír
2012-01-01
Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry
Are there ethnic differences in deletions in the dystrophin gene?
Energy Technology Data Exchange (ETDEWEB)
Banerjee, M.; Verma, I.C. [All India Inst. of Medical Sciences, New Delhi (India)
1997-01-20
We studied 160 cases of Duchenne muscular dystrophy (DMD) drawn from all parts of India, using multiplex PCR of 27 exons. Of these, 103 (64.4%) showed intragenic deletions. Most (69.7%) of the deletions involved exons 45-51. The phenotype of cases with deletion of single exons did not differ significantly from those with deletion of multiple exons. The distribution of deletions in studies from different countries was variable, but this was accounted for either by the small number of cases studied, or by fewer exons analyzed. It is concluded that there is likely to be no ethnic difference with respect to deletions in the DMD gene. 38 refs., 2 figs., 3 tabs.
77 FR 31335 - Procurement List; Proposed Additions and Deletion
2012-05-25
.... Services Service Type/Location: Laundry and Dry Cleaning Service, Buckley Air Force Base Lodging & Medical... products and services to the Procurement List that will be furnished by nonprofit agencies employing persons who are blind or have other severe disabilities, and deletes a service previously provided by such...
Comprehensive analysis of pathogenic deletion variants in Fanconi anemia genes.
Flynn, Elizabeth K; Kamat, Aparna; Lach, Francis P; Donovan, Frank X; Kimble, Danielle C; Narisu, Narisu; Sanborn, Erica; Boulad, Farid; Davies, Stella M; Gillio, Alfred P; Harris, Richard E; MacMillan, Margaret L; Wagner, John E; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A; Chandrasekharappa, Settara C
2014-11-01
Fanconi anemia (FA) is a rare recessive disease resulting from mutations in one of at least 16 different genes. Mutation types and phenotypic manifestations of FA are highly heterogeneous and influence the clinical management of the disease. We analyzed 202 FA families for large deletions, using high-resolution comparative genome hybridization arrays, single-nucleotide polymorphism arrays, and DNA sequencing. We found pathogenic deletions in 88 FANCA, seven FANCC, two FANCD2, and one FANCB families. We find 35% of FA families carry large deletions, accounting for 18% of all FA pathogenic variants. Cloning and sequencing across the deletion breakpoints revealed that 52 FANCA deletion ends, and one FANCC deletion end extended beyond the gene boundaries, potentially affecting neighboring genes with phenotypic consequences. Seventy-five percent of the FANCA deletions are Alu-Alu mediated, predominantly by AluY elements, and appear to be caused by nonallelic homologous recombination. Individual Alu hotspots were identified. Defining the haplotypes of four FANCA deletions shared by multiple families revealed that three share a common ancestry. Knowing the exact molecular changes that lead to the disease may be critical for a better understanding of the FA phenotype, and to gain insight into the mechanisms driving these pathogenic deletion variants. © 2014 WILEY PERIODICALS, INC.
The significance of chromosome deletions in atomic-bomb survivors
International Nuclear Information System (INIS)
Tanaka, Kimio; Shigeta, Chiharu; Oguma, Nobuo; Kamada, Nanao; Deng, Z.; Niimi, Masanobu; Aisaka, Tadaichi.
1986-01-01
In 39 A-bomb survivors 40 years after exposure at ≤ 1,000 m from ground zero, the frequency and features of chromosome deletions in peripheral lymphocytes were examined using a differential staining technique. Simultaneously, in vitro irradiation experiment with Cf-252 was made to infer chromosome aberrations occuring immediately after exposure. Californium-252 with 100 rad induced dicentric and ring chromosomes in 40 % of the cells and acentric fragments in 44 %. Among the A-bomb survivors, chromosome aberrations were observed in 651 (21 %) of the total 3,136 cells. There were 146 cells with deletions (22 % of abnormal cells; 5 % of the total cells), and 10 cells with acentric fragment (0.3 % of the total cells). The figure for deletions was far higher than that reported in the literature. A large number of deletions were seen in chromosomes no.4, no.21, and no.22, and a few deletions in chromosomes no.7 and no.20. Significance of chromosome deletions is discussed. (Namekawa, K.)
VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI
Directory of Open Access Journals (Sweden)
Gun Gun Gumilar
2005-06-01
Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR
An extensive deletion causing overproduction of yeast iso-2-cytochrome c
International Nuclear Information System (INIS)
McKnight, G.L.; Cardillo, T.S.; Sherman, F.
1981-01-01
CYC7-H3 is a cis-dominant regulatory mutation that causes a 20-fold overproduction of yeast iso-2-cytochrome c. The CYC7-H3 mutation is an approximately 5 kb deletion with one breakpoint located in the 5' noncoding region of the CYC7 gene, approximately 200 base from the ATG initiation codon. The deletion apparently fuses a new regulatory region to the structural portion of the CYC7 locus. The CYC7-H3 deletion encompasses the RAD23 locus, which controls UV sensitivity and the ANP1 locus, which controls osmotic sensitivity. The gene cluster CYC7-RAD23-ANP1 displays striking similarity to the gene cluster CYC1-OSM1-RAD7, which controls, respectively, iso-1-cytochrome c, osmotic sensitivity and UV sensitivity. We suggest that these gene clusters are related by an ancient transpositional event
Detection of the deletion on Yp11.2 in a Chinese population.
Chen, Wenjing; Wu, Weiwei; Cheng, Jianding; Zhang, Yinming; Chen, Yong; Sun, Hongyu
2014-01-01
Sex determination tests based on Amelogenin gene as part of commercial PCR multiplex reaction kits have been widely applied in forensic DNA analysis. Mutations that cause dropout of Y chromosomal Amelogenin gene (AMELY) could lead to errors in gender determination and mixture interpretation. To infer the mechanism and estimate the dropout frequency of AMELY and adjacent Y-STRs, we studied 3 samples with AMELY dropout combined with DYS458 and/or DYS456 and 37 samples with DYS456 dropout. DYS456, DYS458 and AMELY are located in the Yp11.2 region. The singleplex amplification system showed the null alleles could be caused by fragment deletion in Yp11.2 rather than a point mutation in the primer binding region. After detection of the 17 Y-STR and 77 STS markers, the deletion map showed different patterns. The DYS456-AMELY-DYS458 deletion pattern was the largest, breaking from 3.60 Mb to 8.29 Mb in the Y chromosome, and the overall frequency was 0.0077%. The AMELY-DYS458 deletion pattern was broke from 6.74 Mb to 9.17 Mb, with a 0.0155% frequency. The DYS456 negative pattern was concentrated in two main deletion regions, with a 0.8220% frequency. The frequency of all negative pattern was 0.0155%. All the AMELY-DYS458 and DYS456-AMELY-DYS458, and 92% of the DYS456 deletion patterns belonged to Hg O3, the rest belonged to Hg Q. The DYS456 deletion pattern was first reported in Chinese population. The current and previous findings suggest additional gender test for ambiguous sex determination may be required. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
75 FR 7450 - Procurement List: Proposed Addition and Deletion
2010-02-19
... Addition and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed addition to and deletion from Procurement List. SUMMARY: The Committee is proposing to add to the... W6BA ACA, FT CARSON, COLORADO. Deletion Regulatory Flexibility Act Certification I certify that the...
77 FR 20795 - Procurement List Proposed Addition and Deletion
2012-04-06
... Addition and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Addition to and Deletion from the Procurement List. SUMMARY: The Committee is proposing to add a.... Deletion Regulatory Flexibility Act Certification I certify that the following action will not have a...
9q22 Deletion - First Familial Case
Directory of Open Access Journals (Sweden)
Yamamoto Toshiyuki
2011-06-01
Full Text Available Abstract Background Only 29 cases of constitutional 9q22 deletions have been published and all have been sporadic. Most associate with Gorlin syndrome or nevoid basal cell carcinoma syndrome (NBCCS, MIM #109400 due to haploinsufficiency of the PTCH1 gene (MIM *601309. Methods and Results We report two mentally retarded female siblings and their cognitively normal father, all carrying a similar 5.3 Mb microdeletion at 9q22.2q22.32, detected by array CGH (244 K. The deletion does not involve the PTCH1 gene, but instead 30 other gene,s including the ROR2 gene (MIM *602337 which causing both brachydactyly type 1 (MIM #113000 and Robinow syndrome (MIM #268310, and the immunologically active SYK gene (MIM *600085. The deletion in the father was de novo and FISH analysis of blood lymphocytes did not suggest mosaicism. All three patients share similar mild dysmorphic features with downslanting palpebral fissures, narrow, high bridged nose with small nares, long, deeply grooved philtrum, ears with broad helix and uplifted lobuli, and small toenails. All have significant dysarthria and suffer from continuous middle ear and upper respiratory infections. The father also has a funnel chest and unilateral hypoplastic kidney but the daughters have no malformations. Conclusions This is the first report of a familial constitutional 9q22 deletion and the first deletion studied by array-CGH which does not involve the PTCH1 gene. The phenotype and penetrance are variable and the deletion found in the cognitively normal normal father poses a challenge in genetic counseling.
Mitochondrial DNA deletion mutations in adult mouse cardiac side population cells
International Nuclear Information System (INIS)
Lushaj, Entela B.; Lozonschi, Lucian; Barnes, Maria; Anstadt, Emily; Kohmoto, Takushi
2012-01-01
We investigated the presence and potential role of mitochondrial DNA (mtDNA) deletion mutations in adult cardiac stem cells. Cardiac side population (SP) cells were isolated from 12-week-old mice. Standard polymerase chain reaction (PCR) was used to screen for the presence of mtDNA deletion mutations in (a) freshly isolated SP cells and (b) SP cells cultured to passage 10. When present, the abundance of mtDNA deletion mutation was analyzed in single cell colonies. The effect of different levels of deletion mutations on SP cell growth and differentiation was determined. MtDNA deletion mutations were found in both freshly isolated and cultured cells from 12-week-old mice. While there was no significant difference in the number of single cell colonies with mtDNA deletion mutations from any of the groups mentioned above, the abundance of mtDNA deletion mutations was significantly higher in the cultured cells, as determined by quantitative PCR. Within a single clonal cell population, the detectable mtDNA deletion mutations were the same in all cells and unique when compared to deletions of other colonies. We also found that cells harboring high levels of mtDNA deletion mutations (i.e. where deleted mtDNA comprised more than 60% of total mtDNA) had slower proliferation rates and decreased differentiation capacities. Screening cultured adult stem cells for mtDNA deletion mutations as a routine assessment will benefit the biomedical application of adult stem cells.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
Usefulness of MLPA in the detection of SHOX deletions.
Funari, Mariana F A; Jorge, Alexander A L; Souza, Silvia C A L; Billerbeck, Ana E C; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y
2010-01-01
SHOX haploinsufficiency causes a wide spectrum of short stature phenotypes, such as Leri-Weill dyschondrosteosis (LWD) and disproportionate short stature (DSS). SHOX deletions are responsible for approximately two thirds of isolated haploinsufficiency; therefore, it is important to determine the most appropriate methodology for detection of gene deletion. In this study, three methodologies for the detection of SHOX deletions were compared: the fluorescence in situ hybridization (FISH), microsatellite analysis and multiplex ligation-dependent probe amplification (MLPA). Forty-four patients (8 LWD and 36 DSS) were analyzed. The cosmid LLNOYCO3'M'34F5 was used as a probe for the FISH analysis and microsatellite analysis were performed using three intragenic microsatellite markers. MLPA was performed using commercial kits. Twelve patients (8 LWD and 4 DSS) had deletions in SHOX area detected by MLPA and 2 patients generated discordant results with the other methodologies. In the first case, the deletion was not detected by FISH. In the second case, both FISH and microsatellite analyses were unable to identify the intragenic deletion. In conclusion, MLPA was more sensitive, less expensive and less laborious; therefore, it should be used as the initial molecular method for the detection of SHOX gene deletion. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Multi-pair states in electron–positron pair creation
Directory of Open Access Journals (Sweden)
Anton Wöllert
2016-09-01
Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
Energy Technology Data Exchange (ETDEWEB)
Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.
2016-09-10
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
International Nuclear Information System (INIS)
Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.
2016-01-01
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
What Can We Learn From Point-of-Care Blood Glucose Values Deleted and Repeated by Nurses?
Corl, Dawn; Yin, Tom; Ulibarri, May; Lien, Heather; Tylee, Tracy; Chao, Jing; Wisse, Brent E
2018-03-01
Hospitals rely on point-of-care (POC) blood glucose (BG) values to guide important decisions related to insulin administration and glycemic control. Evaluation of POC BG in hospitalized patients is associated with measurement and operator errors. Based on a previous quality improvement (QI) project we introduced an option for operators to delete and repeat POC BG values suspected as erroneous. The current project evaluated our experience with deleted POC BG values over a 2-year period. A retrospective QI project included all patients hospitalized at two regional academic medical centers in the Pacific Northwest during 2014 and 2015. Laboratory Medicine POC BG data were reviewed to evaluate all inpatient episodes of deleted and repeated POC BG. Inpatient operators choose to delete and repeat only 0.8% of all POC BG tests. Hypoglycemic and extreme hyperglycemic BG values are more likely to be deleted and repeated. Of initial values values (18% of all values) are errors. Of values >400 mg/dL, 40% of deleted values (5% of all values) are errors. Not all repeated POC BG values are first deleted. Optimal use of the option to delete and repeat POC BG values values that are measurement/operator errors. Eliminating these errors significantly reduces documented rates of severe hypoglycemia and hyperglycemia, and has the potential to improve patient safety.
Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)
2014-12-11
Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs
International Nuclear Information System (INIS)
Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie
2015-01-01
Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm
Directory of Open Access Journals (Sweden)
Greenblatt Jack
2006-07-01
Full Text Available Abstract Background Identification of protein interaction networks has received considerable attention in the post-genomic era. The currently available biochemical approaches used to detect protein-protein interactions are all time and labour intensive. Consequently there is a growing need for the development of computational tools that are capable of effectively identifying such interactions. Results Here we explain the development and implementation of a novel Protein-Protein Interaction Prediction Engine termed PIPE. This tool is capable of predicting protein-protein interactions for any target pair of the yeast Saccharomyces cerevisiae proteins from their primary structure and without the need for any additional information or predictions about the proteins. PIPE showed a sensitivity of 61% for detecting any yeast protein interaction with 89% specificity and an overall accuracy of 75%. This rate of success is comparable to those associated with the most commonly used biochemical techniques. Using PIPE, we identified a novel interaction between YGL227W (vid30 and YMR135C (gid8 yeast proteins. This lead us to the identification of a novel yeast complex that here we term vid30 complex (vid30c. The observed interaction was confirmed by tandem affinity purification (TAP tag, verifying the ability of PIPE to predict novel protein-protein interactions. We then used PIPE analysis to investigate the internal architecture of vid30c. It appeared from PIPE analysis that vid30c may consist of a core and a secondary component. Generation of yeast gene deletion strains combined with TAP tagging analysis indicated that the deletion of a member of the core component interfered with the formation of vid30c, however, deletion of a member of the secondary component had little effect (if any on the formation of vid30c. Also, PIPE can be used to analyse yeast proteins for which TAP tagging fails, thereby allowing us to predict protein interactions that are not
Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs
Directory of Open Access Journals (Sweden)
Ye Zhi-Qiang
2011-08-01
Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.
41 CFR 51-2.3 - Notice of proposed addition or deletion.
2010-07-01
... addition or deletion. 51-2.3 Section 51-2.3 Public Contracts and Property Management Other Provisions... or deletion. At least 30 days prior to the Committee's consideration of the addition or deletion of a... Register announcing the proposed addition or deletion and providing interested persons an opportunity to...
International Nuclear Information System (INIS)
Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia
2014-01-01
The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.
Caduff, M; Bauer, A; Jagannathan, V; Leeb, T
2017-10-01
Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Novel features of 3q29 deletion syndrome: Results from the 3q29 registry
Glassford, Megan R.; Rosenfeld, Jill A.; Freedman, Alexa A.; Zwick, Michael E.
2016-01-01
3q29 deletion syndrome is caused by a recurrent, typically de novo heterozygous 1.6 Mb deletion, but because incidence of the deletion is rare (1 in 30,000 births) the phenotype is not well described. To characterize the range of phenotypic manifestations associated with 3q29 deletion syndrome, we have developed an online registry (3q29deletion.org) for ascertainment of study subjects and phenotypic data collection via Internet‐based survey instruments. We report here on data collected during the first 18 months of registry operation, from 44 patients. This is the largest cohort of 3q29 deletion carriers ever assembled and surveyed in a systematic way. Our data reveal that 28% of registry participants report neuropsychiatric phenotypes, including anxiety disorder, panic attacks, depression, bipolar disorder, and schizophrenia. Other novel findings include a high prevalence (64%) of feeding problems in infancy and reduced weight at birth for 3q29 deletion carriers (average reduction 13.9 oz (394 g), adjusted for gestational age and sex, P = 6.5e‐07). We further report on the frequency of heart defects, autism, recurrent ear infections, gastrointestinal phenotypes, and dental phenotypes, among others. We also report on the expected timing of delayed developmental milestones. This is the most comprehensive description of the 3q29 deletion phenotype to date. These results are clinically actionable toward improving patient care for 3q29 deletion carriers, and can guide the expectations of physicians and parents. These data also demonstrate the value of patient‐reported outcomes to reveal the full phenotypic spectrum of rare genomic disorders. © 2016 The Authors. American Journal of Medical Genetics Part A Published by Wiley Periodicals, Inc. PMID:26738761
Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode
2017-10-26
Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Updating the profile of C-terminal MECP2 deletions in Rett syndrome
Bebbington, A; Percy, A; Christodoulou, J; Ravine, D; Ho, G; Jacoby, P; Anderson, A; Pineda, M; Ben Zeev, B; Bahi-Buisson, N; Smeets, E; Leonard, H
2014-01-01
Objectives This study aimed to compare the phenotype of Rett syndrome cases with C-terminal deletions to that of cases with different MECP2 mutations and to examine the phenotypic variation within C-terminal deletions. Methods Cases were selected from InterRett, an international database and from the population-based Australian Rett Syndrome Database. Cases (n=832) were included if they had a pathogenic MECP2 mutation in which the nature of the amino acid change was known. Three severity scale systems were used, and individual aspects of the phenotype were also compared. Results Lower severity was associated with C-terminal deletions (n=79) compared to all other MECP2 mutations (e.g. Pineda scale C-terminals mean 15.0 (95% CI 14.0–16.0) vs 16.2 (15.9–16.5). Cases with C-terminal deletions were more likely to have a normal head circumference (odds ratio 3.22, 95% CI 1.53 – 6.79) and weight (odds ratio 2.97, 95% CI 1.25–5.76). Onset of stereotypies tended to be later (median age 2.5 years vs 2 years, pmiddle of the range. In terms of individual aspects of phenotype growth and ability to ambulate appear to be particular strengths. By pooling data internationally this study has achieved the case numbers to provide a phenotypic profile of C-terminal deletions in Rett syndrome. PMID:19914908
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
Genetics Home Reference: 17q12 deletion syndrome
... with 17q12 deletion syndrome have delayed development (particularly speech and language delays), intellectual disability, or behavioral or psychiatric disorders. Behavioral and psychiatric conditions that have been reported in people with 17q12 deletion syndrome include autism ...
47 CFR 76.1601 - Deletion or repositioning of broadcast signals.
2010-10-01
... 47 Telecommunication 4 2010-10-01 2010-10-01 false Deletion or repositioning of broadcast signals... RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Notices § 76.1601 Deletion or... to § 76.1601: No deletion or repositioning of a local commercial television station shall occur...
Attenuation of monkeypox virus by deletion of genomic regions
Lopera, Juan G.; Falendysz, Elizabeth A.; Rocke, Tonie E.; Osorio, Jorge E.
2015-01-01
Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivostudies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence.
Amino-acid composition after loop deletion drives domain swapping.
Nandwani, Neha; Surana, Parag; Udgaonkar, Jayant B; Das, Ranabir; Gosavi, Shachi
2017-10-01
Rational engineering of a protein to enable domain swapping requires an understanding of the sequence, structural and energetic factors that favor the domain-swapped oligomer over the monomer. While it is known that the deletion of loops between β-strands can promote domain swapping, the spliced sequence at the position of the loop deletion is thought to have a minimal role to play in such domain swapping. Here, two loop-deletion mutants of the non-domain-swapping protein monellin, frame-shifted by a single residue, were designed. Although the spliced sequence in the two mutants differed by only one residue at the site of the deletion, only one of them (YEIKG) promoted domain swapping. The mutant containing the spliced sequence YENKG was entirely monomeric. This new understanding that the domain swapping propensity after loop deletion may depend critically on the chemical composition of the shortened loop will facilitate the rational design of domain swapping. © 2017 The Protein Society.
The Yeast Deletion Collection: A Decade of Functional Genomics
Giaever, Guri; Nislow, Corey
2014-01-01
The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991
Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K
2007-11-01
Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
HOXA genes cluster: clinical implications of the smallest deletion
Pezzani, Lidia; Milani, Donatella; Manzoni, Francesca; Baccarin, Marco; Silipigni, Rosamaria; Guerneri, Silvana; Esposito, Susanna
2015-01-01
Background HOXA genes cluster plays a fundamental role in embryologic development. Deletion of the entire cluster is known to cause a clinically recognizable syndrome with mild developmental delay, characteristic facies, small feet with unusually short and big halluces, abnormal thumbs, and urogenital malformations. The clinical manifestations may vary with different ranges of deletions of HOXA cluster and flanking regions. Case presentation We report a girl with the smallest deletion reporte...
32 CFR 310.34 - Amendment and deletion of system notices.
2010-07-01
... 32 National Defense 2 2010-07-01 2010-07-01 false Amendment and deletion of system notices. 310.34... (CONTINUED) PRIVACY PROGRAM DOD PRIVACY PROGRAM Publication Requirements § 310.34 Amendment and deletion of... system. (see § 310.32(q)). (c) Deletion of system notices. (1) Whenever a system is discontinued...
Mosaic deletion of 20pter due to rescue by somatic recombination.
Martin, Megan M; Vanzo, Rena J; Sdano, Mallory R; Baxter, Adrianne L; South, Sarah T
2016-01-01
We report on a unique case of a mosaic 20pter-p13 deletion due to a somatic repair event identified by allele differentiating single nucleotide polymorphism (SNP) probes on chromosomal microarray. Small terminal deletions of 20p have been reported in a few individuals and appear to result in a variable phenotype. This patient was a 24-month-old female who presented with failure to thrive and speech delay. Chromosomal microarray analysis (CMA) performed on peripheral blood showed a 1.6 Mb deletion involving the terminus of 20p (20pter-20p13). This deletion appeared mosaic by CMA and this suspicion was confirmed by fluorescence in situ hybridization (FISH) analysis. Additionally, the deletion interval at 20p was directly adjacent to 15 Mb of mosaic copy-neutral loss of heterozygosity (LOH). The pattern of SNP probes was highly suggestive of a somatic repair event that resulted in rescue of the deleted region using the non-deleted homologue as a template. Structural mosaicism is rare and most often believed to be due to a postzygotic mechanism. This case demonstrates the additional utility of allele patterns to help distinguish mechanisms and in this case identified the possibility of either a post-zygotic repair of a germline deletion or a post-zygotic deletion with somatic recombination repair in a single step. © 2015 Wiley Periodicals, Inc.
75 FR 49481 - Procurement List; Additions and Deletion
2010-08-13
... added to the Procurement List: Services Service Type/Locations: Laundry Service, Atlanta VA Medical...: Additions to and deletion from the Procurement List. SUMMARY: This action adds services to the Procurement... disabilities and deletes a service from the Procurement List previously furnished by such agency. DATES...
Phosphatase and tensin homologue deleted on chromosome 10 ...
African Journals Online (AJOL)
Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...
Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.
Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C
2010-12-20
Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.
Deletions, Inversions, Duplications: Engineering of Structural Variants using CRISPR/Cas in Mice
Directory of Open Access Journals (Sweden)
Katerina Kraft
2015-02-01
Full Text Available Structural variations (SVs contribute to the variability of our genome and are often associated with disease. Their study in model systems was hampered until now by labor-intensive genetic targeting procedures and multiple mouse crossing steps. Here we present the use of CRISPR/Cas for the fast (10 weeks and efficient generation of SVs in mice. We specifically produced deletions, inversions, and also duplications at six different genomic loci ranging from 1.1 kb to 1.6 Mb with efficiencies up to 42%. After PCR-based selection, clones were successfully used to create mice via aggregation. To test the practicability of the method, we reproduced a human 500 kb disease-associated deletion and were able to recapitulate the human phenotype in mice. Furthermore, we evaluated the regulatory potential of a large genomic interval by deleting a 1.5 Mb fragment. The method presented permits rapid in vivo modeling of genomic rearrangements.
Investigations into nuclear pairing
International Nuclear Information System (INIS)
Clark, R.M.
2006-01-01
This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)
Campbell, Linda E.; Daly, Eileen; Toal, Fiona; Stevens, Angela; Azuma, Rayna; Catani, Marco; Ng, Virginia; van Amelsvoort, Therese; Chitnis, Xavier; Cutter, William; Murphy, Declan G. M.; Murphy, Kieran C.
2006-01-01
In people with velo-cardio-facial syndrome [or 22q11.2 deletion syndrome (22qDS)], a single interstitial deletion of chromosome 22q11.2 causes a wide spectrum of cognitive deficits ranging from global learning difficulties to specific cognitive deficits. People with 22qDS are also at high risk of
76 FR 78248 - Procurement List; Addition and Deletions
2011-12-16
.... Service Type/Location: Laundry Service, Stratton Medical Center, 113 Holland Ave, Albany, NY. [[Page 78249...: Addition to and Deletions from the Procurement List. SUMMARY: This action adds a service to the Procurement... disabilities, and deletes products and services from the Procurement List previously furnished by such agencies...
78 FR 21916 - Procurement List; Addition And Deletions
2013-04-12
..., the following service is added to the Procurement List: Service Service Type/Location: Laundry Service...: Addition to and Deletions from the Procurement List. SUMMARY: This action adds a service to the Procurement... disabilities, and deletes products and services from the Procurement List previously furnished by such agencies...
78 FR 53733 - Procurement List Additions and Deletions
2013-08-30
.../Location: Industrial Laundry Service, Bureau of Engraving and Printing, 9000 Blue Mound Road, Fort Worth...: Additions to and Deletions from the Procurement List. SUMMARY: This action adds products and services to the... severe disabilities, and deletes services from the Procurement List previously provided by such agencies...
42 CFR 401.118 - Deletion of identifying details.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Deletion of identifying details. 401.118 Section 401.118 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... Deletion of identifying details. When CMS publishes or otherwise makes available an opinion or order...
Penetrance and clinical consequences of a gross SDHB deletion in a large family.
Solis, D C; Burnichon, N; Timmers, H J L M; Raygada, M J; Kozupa, A; Merino, M J; Makey, D; Adams, K T; Venisse, A; Gimenez-Roqueplo, A-P; Pacak, K
2009-04-01
Mutations in the gene encoding subunit B of the mitochondrial enzyme succinate dehydrogenase (SDHB) are inherited in an autosomal dominant manner and are associated with hereditary paraganglioma (PGL) and pheochromocytoma. The phenotype of patients with SDHB point mutations has been previously described. However, the phenotype and penetrance of gross SDHB deletions have not been well characterized as they are rarely described. The objective was to describe the phenotype and estimate the penetrance of an exon 1 large SDHB deletion in one kindred. A retrospective and prospective study of 41 relatives across five generations was carried out. The main outcome measures were genetic testing, clinical presentations, plasma catecholamines and their O-methylated metabolites. Of the 41 mutation carriers identified, 11 were diagnosed with PGL, 12 were found to be healthy carriers after evaluation, and 18 were reportedly healthy based on family history accounts. The penetrance of PGL related to the exon 1 large SDHB deletion in this family was estimated to be 35% by age 40. Variable expressivity of the phenotype associated with a large exon 1 SDHB deletion was observed, including low penetrance, diverse primary PGL tumor locations, and malignant potential.
19 CFR 176.22 - Deletion of protest or entry number.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Deletion of protest or entry number. 176.22... Facts § 176.22 Deletion of protest or entry number. If any protest number or entry number is to be... authorized official making and approving the deletion. [T.D. 70-181, 35 FR 13433, Aug. 22, 1970] ...
Matched molecular pair-based data sets for computer-aided medicinal chemistry
Bajorath, Jürgen
2014-01-01
Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J
2013-12-12
The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.
Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing
2017-09-01
Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.
NPL deletion policy for RCRA-regulated TSD facilities finalized
International Nuclear Information System (INIS)
Anon.
1995-01-01
Under a new policy published by EPA on March 20, 1995, certain sites may be deleted from the National Priorities List (NPL) and deferred to RCRA corrective action. To be deleted from the NPL, a site must (1) be regulated under RCRA as a treatment, storage, or disposal (TSD) facility and (2) meet the four criteria specified by EPA. The new NPL deletion policy, which does not pertain to federal TSD facilities, became effective on April 19, 1995. 1 tab
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
The DrosDel Deletion Collection: A Drosophila Genomewide Chromosomal Deficiency Resource
Ryder, Edward; Ashburner, Michael; Bautista-Llacer, Rosa; Drummond, Jenny; Webster, Jane; Johnson, Glynnis; Morley, Terri; Chan, Yuk Sang; Blows, Fiona; Coulson, Darin; Reuter, Gunter; Baisch, Heiko; Apelt, Christian; Kauk, Andreas; Rudolph, Thomas
2007-01-01
We describe a second-generation deficiency kit for Drosophila melanogaster composed of molecularly mapped deletions on an isogenic background, covering ∼77% of the Release 5.1 genome. Using a previously reported collection of FRT-bearing P-element insertions, we have generated 655 new deletions and verified a set of 209 deletion-bearing fly stocks. In addition to deletions, we demonstrate how the P elements may also be used to generate a set of custom inversions and duplications, particularly...
Sorting genomes by reciprocal translocations, insertions, and deletions.
Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying
2010-01-01
The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.
Directory of Open Access Journals (Sweden)
Kristen Dilzell
2015-01-01
Full Text Available This case report concerns a 16-year-old girl with a 9.92 Mb, heterozygous interstitial chromosome deletion at 7q33-q35, identified using array comparative genomic hybridization. The patient has dysmorphic facial features, intellectual disability, recurrent infections, self-injurious behavior, obesity, and recent onset of hemihypertrophy. This patient has overlapping features with previously reported individuals who have similar deletions spanning the 7q32-q36 region. It has been difficult to describe an interstitial 7q deletion syndrome due to variations in the sizes and regions in the few patients reported in the literature. This case contributes to the further characterization of an interstitial distal 7q deletion syndrome.
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Generalised deletion designs | Gachii | African Journal of Science ...
African Journals Online (AJOL)
In this paper asymmetrical single replicate factorial designs are constructed from symmetrical single replicate factorial designs using the deletion technique. The study is along the lines of Voss(1986), Chauhan(1989) and Gachii and Odhiambo(1997). We give results for the general order deletion designs of the form sn-m1(s ...
Performance of quantum cloning and deleting machines over coherence
Karmakar, Sumana; Sen, Ajoy; Sarkar, Debasis
2017-10-01
Coherence, being at the heart of interference phenomena, is found to be an useful resource in quantum information theory. Here we want to understand quantum coherence under the combination of two fundamentally dual processes, viz., cloning and deleting. We found the role of quantum cloning and deletion machines with the consumption and generation of quantum coherence. We establish cloning as a cohering process and deletion as a decohering process. Fidelity of the process will be shown to have connection with coherence generation and consumption of the processes.
Familial deletion 18p syndrome: case report
Directory of Open Access Journals (Sweden)
Lemyre Emmanuelle
2006-07-01
Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.
Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients
Directory of Open Access Journals (Sweden)
Aziza Sbiti
2002-01-01
Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.
36 CFR 902.14 - Deletion of nondiscloseable information from requested records.
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Deletion of nondiscloseable... AVENUE DEVELOPMENT CORPORATION FREEDOM OF INFORMATION ACT General Administration § 902.14 Deletion of... segregable after deletion of the nondiscloseable portions, will be released. If the information in the...
46 CFR 67.513 - Application for evidence of deletion from documentation.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Application for evidence of deletion from documentation... AND MEASUREMENT OF VESSELS DOCUMENTATION OF VESSELS Fees § 67.513 Application for evidence of deletion from documentation. An application fee is charged for evidence of deletion from documentation in...
International Nuclear Information System (INIS)
Leitersdorf, E.; Hobbs, H.H.; Fourie, A.M.; Jacobs, M.; Van Der Westhuyzen, D.R.; Coetzee, G.A.
1988-01-01
The ligand-binding domain of the low density lipoprotein (LDL) receptor is composed of seven cysteine-rich repeats, each ∼ 40 amino acids long. Previous studies showed that if the first repeat of the ligand-binding domain (encoded by exon 2) is deleted, the receptor fails to bind an anti-LDL receptor monoclonal antibody (IgG-C7) but continues to bind LDL with high affinity. Cultured fibroblasts from a Black South African Xhosa patient (TT) with the clinical syndrome of homozygous familial hypercholesterolemia demonstrated high-affinity cell-surface binding of 125 I-labeled LDL but not 125 I-labeled IgG-C7. previous haplotype analysis, using 10 restriction fragment length polymorphic sites, suggested that the patient inherited two identical LDL receptor alleles. The polymerase chain reaction technique was used to selectively amplify exon 2 of the LDL receptor gene from this patient. Sequence analysis of the amplified fragment disclosed a deletion of six base pairs that removes two amino acids, aspartic acid and glycine, from the first cysteine-rich ligand binding repeat. The mutation creates a new Pst I restriction site that can be used to detect the deletion. The existence of this mutant allele confirms that the epitope of IgG-C7 is located in the first cysteine-rich repeat and that this repeat is not necessary for LDL binding. The mutant gene produced a normally sized 120-kilodalton LDL receptor precursor protein that matured to the 160-kilodalton form at less than one-fourth the normal rate
International Nuclear Information System (INIS)
Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively
Conditional Deletion of Pten Causes Bronchiolar Hyperplasia
Davé, Vrushank; Wert, Susan E.; Tanner, Tiffany; Thitoff, Angela R.; Loudy, Dave E.; Whitsett, Jeffrey A.
2007-01-01
Tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a lipid phosphatase that regulates multiple cellular processes including cell polarity, migration, proliferation, and carcinogenesis. In this work, we demonstrate that conditional deletion of Pten (PtenΔ/Δ) in the respiratory epithelial cells of the developing mouse lung caused epithelial cell proliferation and hyperplasia as early as 4 to 6 weeks of age. While bronchiolar cell differentiation was normal, as in...
34 CFR 5.16 - Deletion of identifying details.
2010-07-01
... 34 Education 1 2010-07-01 2010-07-01 false Deletion of identifying details. 5.16 Section 5.16 Education Office of the Secretary, Department of Education AVAILABILITY OF INFORMATION TO THE PUBLIC PURSUANT TO PUB. L. 90-23 (Eff. until 7-14-10) What Records Are Available § 5.16 Deletion of identifying...
Intracistronic complementation in the simian virus 40 A gene.
Tornow, J; Cole, C N
1983-01-01
A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452
Kathuria, Preetleen; Sharma, Purshotam; Manderville, Richard A; Wetmore, Stacey D
2017-08-21
Exposure to ochratoxin A (OTA), a possible human carcinogen, leads to many different DNA mutations. As a first step toward understanding the structural basis of OTA-induced mutagenicity, the present work uses a robust computational approach and a slipped mutagenic intermediate model previously studied for C 8 -dG aromatic amine adducts to analyze the conformational features of postreplication two-base deletion DNA duplexes containing OT-dG, the major OTA lesion at the C 8 position of guanine. Specifically, a total of 960 ns of molecular dynamics simulations (excluding trial simulations) were carried out on four OT-dG ionization states in three sequence contexts within oligomers containing the NarI recognition sequence, a known hotspot for deletion mutations induced by related adducts formed from known carcinogens. Our results indicate that the structural properties and relative stability of the competing "major groove" and "stacked" conformations of OTA adducted two-base deletion duplexes depend on both the OTA ionization state and the sequence context, mainly due to conformation-dependent deviations in discrete local (hydrogen-bonding and stacking) interactions at the lesion site, as well as DNA bending. When the structural characteristics of the OT-dG adducted two-base deletion duplexes are compared to those associated with previously studied C 8 -dG adducts, a greater understanding of the effects of the nucleobase-carcinogen linkage, and size of the carcinogenic moiety on the conformational preferences of damaged DNA is obtained. Most importantly, our work predicts key structural features for OT-dG-adducted deletion DNA duplexes, which in turn allow us to develop hypotheses regarding OT-dG replication outcomes. Thus, our computational results are valuable for the design and interpretation of future biochemical studies on the potentially carcinogenic OT-dG lesion.
Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions
Directory of Open Access Journals (Sweden)
I.J.P. Arnhold
1998-04-01
Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
UCP2 and 3 deletion screening and distribution in 15 pig breeds.
Li, Yanhua; Li, Hanjie; Zhao, Xingbo; Li, Ning; Wu, Changxin
2007-02-01
The uncoupling protein family is a mitochondrial anion carrier family. It plays an important role in the biological traits of animal body weight, basal metabolic rate and energy conversion. Using PCR and PCR-SSCP, we scanned the porcine uncoupling protein 2 gene (UCP2) and uncoupling protein 3 gene (UCP3) and found seven deletion sites, three in UCP2 and four in UCP3. The deletions in 15 pig breeds showed that deletion influenced weight. The genotype compounding of seven deletion sites in 15 pig breeds had significant effects on performance traits of the pig, such as body weight. We predicted the potential protein factor binding sites using the transcription factor analysis tool TFSearch version 1.3 online. Two deletions (1830 nt and 3219 nt) in UCP3 were found to change the transcriptional factor sites. The 16 bp deletion in 1830 nt added a SP1 site and a 6 bp deletion in 3219 nt removed two MZF1 sites. Seven deletion polymorphisms were covered in introns of linkage genes of UCP2 and UCP3, showing that UCPs have conservation and genetic reliability.
Molecular studies of deletions at the human steroid sulfatase locus
International Nuclear Information System (INIS)
Shapiro, L.J.; Yen, P.; Pomerantz, D.; Martin, E.; Rolewic, L.; Mohandas, T.
1989-01-01
The human steroid sulfatase gene (STS) is located on the distal X chromosome short arm close to the pseudoautosomal region but in a segment of DNA that is unique to the X chromosome. In contrast to most X chromosome-encoded genes, STS expression is not extinguished during the process of X chromosome inactivation. Deficiency of STS activity produced the syndrome of X chromosome-linked ichthyosis, which is one of the most common inborn errors of metabolism in man. Approximately 90% of STS - individuals have large deletions at the STS locus. The authors and others have found that the end points of such deletions are heterogeneous in their location. One recently ascertained subject was observed to have a 40-kilobase deletion that is entirely intragenic, permitting the cloning and sequencing of the deletion junction. Studies of this patient and of other X chromosome sequences in other subjects permit some insight into the mechanism(s) responsible for generating frequent deletions on the short arm of the X chromosome
Clival encephalocele and 5q15 deletion: a case report.
Puvabanditsin, Surasak; Malik, Imran; Garrow, Eugene; Francois, Lissa; Mehta, Rajeev
2015-03-01
A preterm neonate presenting with respiratory distress after birth was found to have a clival encephalocele, which is a variant of a basal encephalocele, and hypoplasia of the cerebellum. Genetic studies revealed a small deletion of the long arm of chromosome 5: 5q15 deletion. We report a rare variant of a basal encephalocele with a cerebellar malformation and 5q15 deletion. © The Author(s) 2014.
Male gametophytic sterility. 1 - Gametic sterilities and deletions in petunia
Energy Technology Data Exchange (ETDEWEB)
Cornu, A.; Maizonnier, D. (Station d' Amelioration des Plantes de l' I.N.R.A., Dijon (France))
1982-01-01
Terminal deletions induced by ionizing radiations in Petunia are not sexually transmitted. Cytogenetic study of plants with a heterozygous deletion and their progenies shows that this lack of transmission is accompanied by a gametic semi-sterility due to the fact that gametes carrying the deleted chromosome are not viable. The interest of such a male sterility with a gametophytic determinism for the study of sporophyte-gametophyte relationships is underlined.
Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.
Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A
1996-11-01
Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and
DEFF Research Database (Denmark)
Formenti, Luca Riccardo; Kielland-Brandt, Morten
2011-01-01
The use of statins is well established in human therapy, and model organisms such as Saccharomyces cerevisiae are commonly used in studies of drug action at molecular and cellular levels. The investigation of the resistance mechanisms towards statins may suggest new approaches to improve therapy...... based on the use of statins. We investigated the susceptibility to lovastatin of S. cerevisiae strains deleted for PDR genes, responsible for exporting hydrophobic and amphi-philic drugs, such as lovastatin. Strains deleted for the genes tested, PDR1, PDR3, PDR5 and SNQ2, exhibited remarkably different...
[Mitochondrial DNA4568 deletions in guinea-pig associated with presbycusis].
Wei, Xue-mei; Yang, Yuan; Liang, Chuang-yu; Zheng, Zhong
2006-12-01
To determine weather or not the mtDNA(4568) deletions in guinea-pig contribute to the development of presbycusis. Forty-four guinea-pigs were divided into 2 groups: group A (young control group, normal hearing, 22 guineas) and group B (aged group). The group B was subdivided into group B(1) (old normal hearing, 6 guineas) and group B(2) (old hearing loss, 16 guineas). First the guineas were tested by auditory brainstem response (ABR), and then the Cortis's tissues, auditory nerve tissues, brain and blood were harvested and the total DNA was extracted. The mtDNA(4568) deletion was analyzed by PCR. Hearing loss was occurred with age. The mtDNA(4568) deletion incidence of aged group in all tissues was significant higher than that of young control group (Ppresbycusis (B(2) group) were significant higher than that of aged normal hearing group (B(1) group) (Ppresbycusis and aged normal hearing group (P> 0.05). mtDNA(4568) deletion of guinea-pig possibly contributes to aging and mtDNA(4568) deletion in Cortis's and auditory nerve tissues of guinea-pig may be associated with presbycusis. There is no enough evidence to prove that the mtDNA(4568) deletions in brain and blood are related with presbycusis.
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses
Schnable, James C.; Freeling, Michael; Lyons, Eric
2012-01-01
The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519
14 CFR 1206.202 - Deletion of segregable portions of a record.
2010-01-01
... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Deletion of segregable portions of a record... AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.202 Deletion of segregable... that indication would harm an interest protected by the exemption in Subpart 3 under which the deletion...
TTY2 genes deletions as genetic risk factor of male infertility.
Shaveisi-Zadeh, F; Alibakhshi, R; Asgari, R; Rostami-Far, Z; Bakhtiari, M; Abdi, H; Movafagh, A; Mirfakhraie, R
2017-02-28
Y chromosome has a number of genes that are expressed in testis and have a role in spermatogenesis. TTY2L12A and TTY2L2A are the members of testis transcript Y2 (TTY2) that are Y linked multi-copy gene families, located on Yp11 and Yq11 loci respectively. The aim of this study was to investigate frequency of TTY2L12A and TTY2L2A deletions in azoospermic patients compared with fertile males. This study was performed on 45 infertile males with idiopathic azoospermia without any AZF micro deletions (group A), 33 infertile males with azoospermia which do not screened for AZF micro deletions (group B) and 65 fertile males (group C), from October 2013 to April 2015 in west of Iran. Polymerase chain reaction (PCR) method was used for detection of TTY2L12A and TTY2L2A gene deletions in studied groups. No deletions were detected in normal fertile males of group C. 1 out of 45 azoospermic males of group A (2.22%) and 3 out of 33 azoospermic males of group B (9.09%) had TTY2L2A deletion (p= 0.409 and p= 0.036 respectively), also 1 out of 45 azoospermic males of group A (2.22%) and 4 out of 33 azoospermic males of group B (12.12%) had TTY2L12A deletion (p= 0.409 and p= 0.011 respectively). None of azoospermic males in Group A and B had deletions in both genes. Our data showed significant correlation between non-obstructive azoospermia and TTY2L12A and TTY2L2A deletions. Thus, it seems that TTY2L12A and TTY2L2A deletions can consider as one of the genetic risk factors for non-obstructive azoospermia.
Numt-mediated double-strand break repair mitigates deletions during primate genome evolution.
Directory of Open Access Journals (Sweden)
Einat Hazkani-Covo
2008-10-01
Full Text Available Non-homologous end joining (NHEJ is the major mechanism of double-strand break repair (DSBR in mammalian cells. NHEJ has traditionally been inferred from experimental systems involving induced double strand breaks (DSBs. Whether or not the spectrum of repair events observed in experimental NHEJ reflects the repair of natural breaks by NHEJ during chromosomal evolution is an unresolved issue. In primate phylogeny, nuclear DNA sequences of mitochondrial origin, numts, are inserted into naturally occurring chromosomal breaks via NHEJ. Thus, numt integration sites harbor evidence for the mechanisms that act on the genome over evolutionary timescales. We have identified 35 and 55 lineage-specific numts in the human and chimpanzee genomes, respectively, using the rhesus monkey genome as an outgroup. One hundred and fifty two numt-chromosome fusion points were classified based on their repair patterns. Repair involving microhomology and repair leading to nucleotide additions were detected. These repair patterns are within the experimentally determined spectrum of classical NHEJ, suggesting that information from experimental systems is representative of broader genetic loci and end configurations. However, in incompatible DSBR events, small deletions always occur, whereas in 54% of numt integration events examined, no deletions were detected. Numts show a statistically significant reduction in deletion frequency, even in comparison to DSBR involving filler DNA. Therefore, numts show a unique mechanism of integration via NHEJ. Since the deletion frequency during numt insertion is low, native overhangs of chromosome breaks are preserved, allowing us to determine that 24% of the analyzed breaks are cohesive with overhangs of up to 11 bases. These data represent, to the best of our knowledge, the most comprehensive description of the structure of naturally occurring DSBs. We suggest a model in which the sealing of DSBs by numts, and probably by other filler
Gelincik, Ozkan; Blecua, Pedro; Edelmann, Winfried; Kucherlapati, Raju; Zhou, Kathy; Jasin, Maria; Gümüş, Zeynep H.; Lipkin, Steven M.
2017-01-01
Homologous recombination (HR) enables precise DNA repair after DNA double strand breaks (DSBs) using identical sequence templates, whereas homeologous recombination (HeR) uses only partially homologous sequences. Homeologous recombination introduces mutations through gene conversion and genomic deletions through single-strand annealing (SSA). DNA mismatch repair (MMR) inhibits HeR, but the roles of mammalian MMR MutL homologues (MLH1, PMS2 and MLH3) proteins in HeR suppression are poorly characterized. Here, we demonstrate that mouse embryonic fibroblasts (MEFs) carrying Mlh1, Pms2, and Mlh3 mutations have higher HeR rates, by using 7,863 uniquely mapping paired direct repeat sequences (DRs) in the mouse genome as endogenous gene conversion and SSA reporters. Additionally, when DSBs are induced by gamma-radiation, Mlh1, Pms2 and Mlh3 mutant MEFs have higher DR copy number alterations (CNAs), including DR CNA hotspots previously identified in mouse MMR-deficient colorectal cancer (dMMR CRC). Analysis of The Cancer Genome Atlas CRC data revealed that dMMR CRCs have higher genome-wide DR HeR rates than MMR proficient CRCs, and that dMMR CRCs have deletion hotspots in tumor suppressors FHIT/WWOX at chromosomal fragile sites FRA3B and FRA16D (which have elevated DSB rates) flanked by paired homologous DRs and inverted repeats (IR). Overall, these data provide novel insights into the MMR-dependent HeR inhibition mechanism and its role in tumor suppression. PMID:29069730
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Partial USH2A deletions contribute to Usher syndrome in Denmark
DEFF Research Database (Denmark)
Dad, Shzeena; Rendtorff, Nanna Dahl; Kann, Erik
2015-01-01
deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.European Journal of Human Genetics advance online publication, 25 March 2015; doi:10.1038...
Traverse, Charles C; Ochman, Howard
2017-08-29
Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions
A Rare Syndrome of Deletion in 2 Siblings
Directory of Open Access Journals (Sweden)
Aravindhan Veerapandiyan MBBS
2017-08-01
Full Text Available The Glutamate receptor, ionotropic, delta 2 gene codes for an ionotropic glutamate delta-2 receptor, which is selectively expressed in cerebellar Purkinje cells, and facilitates cerebellar synapse organization and transmission. The phenotype associated with the deletion of Glutamate receptor, ionotropic, delta 2 gene in humans was initially defined in 2013. In this case report, the authors describe 2 brothers who presented with developmental delay, tonic upward gaze, nystagmus, oculomotor apraxia, hypotonia, hyperreflexia, and ataxia. They were found to have a homozygous intragenic deletion within the Glutamate receptor, ionotropic, delta 2 gene at exon 2. Our patients serve as an addition to the literature of previously reported children with this rare clinical syndrome associated with Glutamate receptor, ionotropic, delta 2 deletion.
10 CFR 9.19 - Segregation of exempt information and deletion of identifying details.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Segregation of exempt information and deletion of... Information Act Regulations § 9.19 Segregation of exempt information and deletion of identifying details. (a... deletions are made from parts of the record by computer, the amount of information deleted will be indicated...
Multiple Patterns of FHIT Gene Homozygous Deletion in Egyptian Breast Cancer Patients
International Nuclear Information System (INIS)
Ismail, H.M.S.; Zakhary, N.I.; Medhat, A.M.; Karim, A.M.
2011-01-01
Fragile histidine triad (FHIT) gene encodes a putative tumour suppressor protein. Loss of Fhit protein in cancer is attributed to different genetic alterations that affect the FHIT gene structure. In this study, we investigated the pattern of homozygous deletion that target the FHIT gene exons 3 to 9 genomic structure in Egyptian breast cancer patients. We have found that 65% (40 out of 62) of the cases exhibited homozygous deletion in at least one FHIT exon. The incidence of homozygous deletion was not associated with patients clinico pathological parameters including patients age, tumour grade, tumour type, and lymph node involvement. Using correlation analysis, we have observed a strong correlation between homozygous deletions of exon 3 and exon 4 (P<0.0001). Deletions in exon 5 were positively correlated with deletions in exon 7 (P<0.0001), Exon 8 (P<0.027), and exon 9 (P=0.04). Additionally, a strong correlation was observed between exons 8 and exon 9 (P<0.0001).We conclude that FHIT gene exons are homozygously deleted at high frequency in Egyptian women population diagnosed with breast cancer. Three different patterns of homozygous deletion were observed in this population indicating different mechanisms of targeting FHIT gene genomic structure.
Aguiar, Derek; Halldórsson, Bjarni V.; Morrow, Eric M.; Istrail, Sorin
2012-01-01
Motivation: The understanding of the genetic determinants of complex disease is undergoing a paradigm shift. Genetic heterogeneity of rare mutations with deleterious effects is more commonly being viewed as a major component of disease. Autism is an excellent example where research is active in identifying matches between the phenotypic and genomic heterogeneities. A considerable portion of autism appears to be correlated with copy number variation, which is not directly probed by single nucleotide polymorphism (SNP) array or sequencing technologies. Identifying the genetic heterogeneity of small deletions remains a major unresolved computational problem partly due to the inability of algorithms to detect them. Results: In this article, we present an algorithmic framework, which we term DELISHUS, that implements three exact algorithms for inferring regions of hemizygosity containing genomic deletions of all sizes and frequencies in SNP genotype data. We implement an efficient backtracking algorithm—that processes a 1 billion entry genome-wide association study SNP matrix in a few minutes—to compute all inherited deletions in a dataset. We further extend our model to give an efficient algorithm for detecting de novo deletions. Finally, given a set of called deletions, we also give a polynomial time algorithm for computing the critical regions of recurrent deletions. DELISHUS achieves significantly lower false-positive rates and higher power than previously published algorithms partly because it considers all individuals in the sample simultaneously. DELISHUS may be applied to SNP array or sequencing data to identify the deletion spectrum for family-based association studies. Availability: DELISHUS is available at http://www.brown.edu/Research/Istrail_Lab/. Contact: Eric_Morrow@brown.edu and Sorin_Istrail@brown.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22689755
Evaluation of 22q11.2 deletion in Cleft Palate patients
Prabodha, L. B. Lahiru; Dias, Dayanath Kumara; Nanayakkara, B. Ganananda; de Silva, Deepthi C.; Chandrasekharan, N. Vishvanath; Ileyperuma, Isurani
2012-01-01
Background: Cleft palate is the commonest multifactorial epigenetic disorder with a prevalence of 0.43-2.45 per 1000. The objectives of this study were to evaluate the clinical features and identify the 22q11.2 deletion in patients with cleft palate in Sri Lanka. Materials and Methods: Cleft patients attending a Teaching Hospital in Sri Lanka were recruited for this study. The relevant data were obtained from review of case notes, interviews, and examination of patients according to a standard evaluation sheet. Quantitative multiplex polymerase chain reaction (PCR) was performed to identify the 22q11.2 deletion. A gel documentation system (Bio-Doc) was used to quantify the PCR product following electrophoresis on 0.8% agarose gel. Results and Conclusion: There were 162 cleft palate patients of whom 59% were females. A total of 92 cleft palate subjects (56.2%) had other associated clinical features. Dysmorphic features (25.27%) and developmental delays (25.27%) were the commonest medical problems encountered. The cleft was limited to the soft palate in 125 patients, while in 25 patients it involved both the hard and the soft palate. There were seven subjects with bifid uvula and five subjects with submucous cleft palate. None of the patients had 22q11.2 deletion in this study population. A multicentered large population-based study is needed to confirm the results of this study and to develop guidelines on the appropriate use of 22q11.2 deletion testing, which are valid for cleft palate patients in Sri Lanka. PMID:23483617
Directory of Open Access Journals (Sweden)
Praveen Kumar Bharti
Full Text Available Plasmodium falciparum encoded histidine rich protein (HRP2 based malaria rapid diagnostic tests (RDTs are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions.This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR.Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521 and 1.8% (27/1521 of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0-25% (2.4, 95% CI; 1.6-3.3. The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0-8% (1.6, 95% CI; 1.0-2.4.This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs.
International Nuclear Information System (INIS)
Bianchi, Marzia; Rizza, Teresa; Verrigni, Daniela; Martinelli, Diego; Tozzi, Giulia; Torraco, Alessandra; Piemonte, Fiorella; Dionisi-Vici, Carlo; Nobili, Valerio; Francalanci, Paola; Boldrini, Renata; Callea, Francesco; Santorelli, Filippo Maria; Bertini, Enrico
2011-01-01
Highlights: ► Expanded array of mtDNA deletions. ► Pearson syndrome with prominent hepatopathy associated with single mtDNA deletions. ► Detection of deletions in fibroblasts and blood avoids muscle and liver biopsy. ► Look for mtDNA deletions before to study nuclear genes related to mtDNA depletion. -- Abstract: Hepatic involvement in mitochondrial cytopathies rarely manifests in adulthood, but is a common feature in children. Multiple OXPHOS enzyme defects in children with liver involvement are often associated with dramatically reduced amounts of mtDNA. We investigated two novel large scale deletions in two infants with a multisystem disorder and prominent hepatopathy. Amount of mtDNA deletions and protein content were measured in different post-mortem tissues. The highest levels of deleted mtDNA were in liver, kidney, pancreas of both patients. Moreover, mtDNA deletions were detected in cultured skin fibroblasts in both patients and in blood of one during life. Biochemical analysis showed impairment of mainly complex I enzyme activity. Patients manifesting multisystem disorders in childhood may harbour rare mtDNA deletions in multiple tissues. For these patients, less invasive blood specimens or cultured fibroblasts can be used for molecular diagnosis. Our data further expand the array of deletions in the mitochondrial genomes in association with liver failure. Thus analysis of mtDNA should be considered in the diagnosis of childhood-onset hepatopathies.
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.
D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing
2013-01-01
X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel
2015-01-01
In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
An Intelligent Model for Pairs Trading Using Genetic Algorithms.
Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
Energy Technology Data Exchange (ETDEWEB)
Bianchi, Marzia; Rizza, Teresa; Verrigni, Daniela [Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Diseases, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Martinelli, Diego [Division of Metabolism, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Tozzi, Giulia; Torraco, Alessandra; Piemonte, Fiorella [Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Diseases, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Dionisi-Vici, Carlo [Division of Metabolism, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Nobili, Valerio [Gastroenterology and Liver Unit, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Francalanci, Paola; Boldrini, Renata; Callea, Francesco [Dept. Pathology, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Santorelli, Filippo Maria [UOC Neurogenetica e Malattie Neuromuscolari, Fondazione Stella Maris, Pisa (Italy); Bertini, Enrico [Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Diseases, ' Bambino Gesu' Children' s Hospital, Rome (Italy); and others
2011-11-18
Highlights: Black-Right-Pointing-Pointer Expanded array of mtDNA deletions. Black-Right-Pointing-Pointer Pearson syndrome with prominent hepatopathy associated with single mtDNA deletions. Black-Right-Pointing-Pointer Detection of deletions in fibroblasts and blood avoids muscle and liver biopsy. Black-Right-Pointing-Pointer Look for mtDNA deletions before to study nuclear genes related to mtDNA depletion. -- Abstract: Hepatic involvement in mitochondrial cytopathies rarely manifests in adulthood, but is a common feature in children. Multiple OXPHOS enzyme defects in children with liver involvement are often associated with dramatically reduced amounts of mtDNA. We investigated two novel large scale deletions in two infants with a multisystem disorder and prominent hepatopathy. Amount of mtDNA deletions and protein content were measured in different post-mortem tissues. The highest levels of deleted mtDNA were in liver, kidney, pancreas of both patients. Moreover, mtDNA deletions were detected in cultured skin fibroblasts in both patients and in blood of one during life. Biochemical analysis showed impairment of mainly complex I enzyme activity. Patients manifesting multisystem disorders in childhood may harbour rare mtDNA deletions in multiple tissues. For these patients, less invasive blood specimens or cultured fibroblasts can be used for molecular diagnosis. Our data further expand the array of deletions in the mitochondrial genomes in association with liver failure. Thus analysis of mtDNA should be considered in the diagnosis of childhood-onset hepatopathies.
A local-world node deleting evolving network model
International Nuclear Information System (INIS)
Gu Yuying; Sun Jitao
2008-01-01
A new type network growth rule which comprises node addition with the concept of local-world connectivity and node deleting is studied. A series of theoretical analysis and numerical simulation to the LWD network are conducted in this Letter. Firstly, the degree distribution p(k) of this network changes no longer pure scale free but truncates by an exponential tail and the truncation in p(k) increases as p a decreases. Secondly, the connectivity is tighter, as the local-world size M increases. Thirdly, the average path length L increases and the clustering coefficient decreases as generally node deleting increases. Finally, trends up when the local-world size M increases, so as to k max . Hence, the expanding local-world can compensate the infection of the node deleting
A local-world node deleting evolving network model
Energy Technology Data Exchange (ETDEWEB)
Gu Yuying [Department of Mathematics, Tongji University, Shanghai 200092 (China); Sun Jitao [Department of Mathematics, Tongji University, Shanghai 200092 (China)], E-mail: sunjt@sh163.net
2008-06-16
A new type network growth rule which comprises node addition with the concept of local-world connectivity and node deleting is studied. A series of theoretical analysis and numerical simulation to the LWD network are conducted in this Letter. Firstly, the degree distribution p(k) of this network changes no longer pure scale free but truncates by an exponential tail and the truncation in p(k) increases as p{sub a} decreases. Secondly, the connectivity is tighter, as the local-world size M increases. Thirdly, the average path length L increases and the clustering coefficient
Brand deletion: How the decision-making approach affects deletion success
Víctor Temprano-García; Ana Isabel Rodríguez-Escudero; Javier Rodríguez-Pinto
2018-01-01
Literature on brand deletion (BD), a critical and topical decision within a firm's marketing strategy, is extremely scarce. The present research is concerned with the decision-making process and examines the effect on BD success of three different approaches to decision-making – rational, intuitive and political – and of the interaction between the rational and political approaches. The moderating effect of the type of BD – i.e., total brand killing or disposal vs. brand name change – is also...
Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA
International Nuclear Information System (INIS)
Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.
2003-01-01
Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
24 CFR 990.155 - Addition and deletion of units.
2010-04-01
... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Addition and deletion of units. 990.155 Section 990.155 Housing and Urban Development Regulations Relating to Housing and Urban...; Computation of Eligible Unit Months § 990.155 Addition and deletion of units. (a) Changes in public housing...
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C
2014-07-30
Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR
Energy Technology Data Exchange (ETDEWEB)
Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)
1994-09-01
Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
COSMID: A Web-based Tool for Identifying and Validating CRISPR/Cas Off-target Sites
Directory of Open Access Journals (Sweden)
Thomas J Cradick
2014-01-01
Full Text Available Precise genome editing using engineered nucleases can significantly facilitate biological studies and disease treatment. In particular, clustered regularly interspaced short palindromic repeats (CRISPR with CRISPR-associated (Cas proteins are a potentially powerful tool for modifying a genome by targeted cleavage of DNA sequences complementary to designed guide strand RNAs. Although CRISPR/Cas systems can have on-target cleavage rates close to the transfection rates, they may also have relatively high off-target cleavage at similar genomic sites that contain one or more base pair mismatches, and insertions or deletions relative to the guide strand. We have developed a bioinformatics-based tool, COSMID (CRISPR Off-target Sites with Mismatches, Insertions, and Deletions that searches genomes for potential off-target sites (http://crispr.bme.gatech.edu. Based on the user-supplied guide strand and input parameters, COSMID identifies potential off-target sites with the specified number of mismatched bases and insertions or deletions when compared with the guide strand. For each site, amplification primers optimal for the chosen application are also given as output. This ranked-list of potential off-target sites assists the choice and evaluation of intended target sites, thus helping the design of CRISPR/Cas systems with minimal off-target effects, as well as the identification and quantification of CRISPR/Cas induced off-target cleavage in cells.
Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam
2013-01-01
The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522
Age-related differences in 1p and 19q deletions in oligodendrogliomas
Directory of Open Access Journals (Sweden)
Del Bigio Marc R
2003-12-01
Full Text Available Abstract Background Recent reports indicate that anaplastic oligodendrogliomas frequently show allelic losses on chromosome arms 1p and 19q, and that these deletions are associated with better chemotherapeutic response and overall patient survival. Because of the diversified genetic makeup of the population and the centralized provincial referral system for brain tumor patients in Manitoba, the epidemiological features of such tumors sometimes differ from the published data acquired from non-community based settings. In this study, we assessed the prevalence of allelic deletions for chromosome arms 1p and 19q in anaplastic and in low-grade oligodendrogliomas in the Manitoba population. Methods Loss of heterozygosity (LOH analysis of brain tumors was carried out using 4 microsatellite markers (D1S508, D1S2734, D19S219 and D19S412 and a PCR based assay. The tumors were consecutively acquired during the period September 1999–March 2001 and a total of 63 tumors were assessed. Results We found that allelic loss of chromosome 1p and 19q was higher in oligodendrogliomas than in other diffuse gliomas and that for anaplastic oligodendrogliomas, younger patients exhibited significantly more deletions than older patients (>60 years of age. Conclusions These studies suggest that age may be a factor in the genetic alterations of oligodendrogliomas. In addition, these studies demonstrate that this assay can easily be carried out in a cost-effective manner in a small tertiary center.
The male gametophytic sterility. 1 - Gametic sterilities and deletions in petunia
International Nuclear Information System (INIS)
Cornu, A.; Maizonnier, D.
1982-01-01
Terminal deletions induced by ionizing radiations in Petunia are not sexually transmitted. Cytogenetic study of plants with a heterozygous deletion and their progenies shows that this lack of transmission is accompanied by a gametic semi-sterility due to the fact that gametes carrying the deleted chromosome are not viable. The interest of such a male sterility with a gametophytic determinism for the study of sporophyte-gametophyte relationships is underlined [fr
Deletion analysis of SMN1 and NAIP genes in southern Chinese children with spinal muscular atrophy
Institute of Scientific and Technical Information of China (English)
Yu-hua LIANG; Xiao-ling CHEN; Zhong-sheng YU; Chun-yue CHEN; Sheng BI; Lian-gen MAO; Bo-lin ZHOU; Xian-ning ZHANG
2009-01-01
Spinal muscular atrophy (SMA) is a disorder characterized by degeneration of lower motor neurons and occasionally bulbar motor neurons leading to progressive limb and trunk paralysis as well as muscular atrophy. Three types of SMA are rec-ognized depending on the age of onset, the maximum muscular activity achieved, and survivorship: SMA1, SMA2, and SMA3. The survival of motor neuron (SMN) gene has been identified as an SMA determining gene, whereas the neuronal apoptosis inhibitory protein (NAIP) gene is considered to be a modifying factor of the severity of SMA. The main objective of this study was to analyze the deletion of SMN1 and NAIP genes in southern Chinese children with SMA. Here, polymerase chain reaction (PCR) combined with restriction fragment length polymorphism (RFLP) was performed to detect the deletion of both exon 7 and exon 8 of SMNI and exon 5 of NAIP in 62 southern Chinese children with strongly suspected clinical symptoms of SMA. All the 32 SMAI patients and 76% (13/17) of SMA2 patients showed homozygous deletions for exon 7 and exon 8, and all the 13 SMA3 patients showed single deletion of SMN1 exon 7 along with 24% (4/17) of SMA2 patients. Eleven out of 32 (34%) SMA1 patients showed NAIP deletion, and none of SMA2 and SMA3 patients was found to have NAIP deletion. The findings of homozygous deletions of exon 7 and/or exon 8 of SMN1 gene confirmed the diagnosis of SMA, and suggested that the deletion of SMN1 exon 7 is a major cause of SMA in southern Chinese children, and that the NA1P gene may be a modifying factor for disease severity of SMA 1. The molecular diagnosis system based on PCR-RFLP analysis can conveniently be applied in the clinical testing, genetic counseling, prenatal diagnosis and preimplantation genetic diagnosis of SMA.
41 CFR 51-6.8 - Deletion of items from the Procurement List.
2010-07-01
... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Deletion of items from...-PROCUREMENT PROCEDURES § 51-6.8 Deletion of items from the Procurement List. (a) When a central nonprofit... shall notify the Committee staff immediately. Before reaching a decision to request a deletion of an...
International Nuclear Information System (INIS)
Le Beau, M.M.; Epstein, N.D.; O'Brien, S.J.; Nienhuis, A.W.; Yang, Y.C.; Clark, S.C.; Rowley, J.D.
1987-01-01
The gene IL-3 encodes interleukin 3, a hematopoietic colony-stimulating factor (CSF) that is capable of supporting the proliferation of a broad range of hematopoietic cell types. By using somatic cell hybrids and in situ chromosomal hybridization, the authors localized this gene to human chromosome 5 at bands q23-31, a chromosomal region that is frequently deleted [del(5q)] in patients with myeloid disorders. By in situ hybridization, IL-3 was found to be deleted in the 5q-chromosome of one patient with refractory anemia who had a del(5)(q15q33.3), of three patients with refractory anemia (two patients) or acute nonlymphocytic leukemia (ANLL) de novo who had a similar distal breakpoint [del(5)(q13q33.3)], and of a fifth patient, with therapy-related ANLL, who had a similar distal breakpoint in band q33[del(5)(q14q33.3)]. Southern blot analysis of somatic cell hybrids retaining the normal or the deleted chromosome 5 from two patients with the refractory anemia 5q- syndrome indicated that IL-3 sequences were absent from the hybrids retaining the deleted chromosome 5 but not from hybrids that had a cytologically normal chromosome 5. Thus, a small segment of chromosome 5 contains IL-3, GM-CSF, CSF-1, and FMS. The findings and earlier results indicating that GM-CSF, CSF-1, and FMS were deleted in the 5q- chromosome, suggest that loss of IL-3 or of other CSF genes may play an important role in the pathogenesis of hematologic disorders associated with a del(5q)
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
DEFF Research Database (Denmark)
Kirchhoff, Maria; Bisgaard, Anne-Marie; Stoeva, Radka
2009-01-01
Partial deletions of the long arm of chromosome 13 lead to variable phenotypes dependant on the size and position of the deleted region. In order to update the phenotypic map of chromosome 13q21.1-qter deletions, we applied 244k Agilent oligonucleotide-based array-CGH to determine the exact break......-genotype correlation on chromosome 13. In contrast to previous reports of carriers of 13q32 band deletions as the most seriously affected patients, we present two such individuals with long-term survival, 28 and 2.5 years....
Homozygous Deletions and Recurrent Amplifications Implicate New Genes Involved in Prostate Cancer
Directory of Open Access Journals (Sweden)
Wennuan Liu
2008-08-01
Full Text Available Prostate cancer cell lines provide ideal in vitro systems for the identification and analysis of prostate tumor suppressors and oncogenes. A detailed characterization of the architecture of prostate cancer cell line genomes would facilitate the study of precise roles of various genes in prostate tumorigenesis in general. To contribute to such a characterization, we used the GeneChip 500K single nucleotide polymorphic (SNP array for analysis of genotypes and relative DNA copy number changes across the genome of 11 cell lines derived from both normal and cancerous prostate tissues. For comparison purposes, we also examined the alterations observed in the cell lines in tumor/normal pairs of clinical samples from 72 patients. Along with genome-wide maps of DNA copy number changes and loss of heterozygosity for these cell lines, we report previously unreported homozygous deletions and recurrent amplifications in prostate cancers in this study. The homozygous deletions affected a number of biologically important genes, including PPP2R2A and BNIP3L identified in this study and CDKN2A/CDKN2B reported previously. Although most amplified genomic regions tended to be large, amplifications at 8q24.21 were of particular interest because the affected regions are relatively small, are found in multiple cell lines, are located near MYC, an oncogene strongly implicated in prostate tumorigenesis, and are known to harbor SNPs that are associated with inherited susceptibility for prostate cancer. The genomic alterations revealed in this study provide an important catalog of positional information relevant to efforts aimed at deciphering the molecular genetic basis of prostate cancer.
Pudupakam, R S; Huang, Y W; Opriessnig, T; Halbur, P G; Pierson, F W; Meng, X J
2009-01-01
Hepatitis E virus (HEV) is an important human pathogen, although little is known about its biology and replication. Comparative sequence analysis revealed a hypervariable region (HVR) with extensive sequence variations in open reading frame 1 of HEV. To elucidate the role of the HVR in HEV replication, we first constructed two HVR deletion mutants, hHVRd1 and hHVRd2, with in-frame deletion of amino acids (aa) 711 to 777 and 747 to 761 in the HVR of a genotype 1 human HEV replicon. Evidence of HEV replication was detected in Huh7 cells transfected with RNA transcripts from mutant hHVRd2, as evidenced by expression of enhanced green fluorescent protein. To confirm the in vitro results, we constructed three avian HEV mutants with various HVR deletions: mutants aHVRd1, with deletion of aa 557 to 585 (Delta557-585); aHVRd2 (Delta612-641); and aHVRd3 (Delta557-641). Chickens intrahepatically inoculated with capped RNA transcripts from mutants aHVRd1 and aHVRd2 developed active viral infection, as evidenced by seroconversion, viremia, and fecal virus shedding, although mutant aHVRd3, with complete HVR deletion, was apparently attenuated in chickens. To further verify the results, we constructed four additional HVR deletion mutants using the genotype 3 swine HEV as the backbone. Mutants sHVRd2 (Delta722-781), sHVRd3 (Delta735-765), and sHVRd4 (Delta712-765) were shown to tolerate deletions and were infectious in pigs intrahepatically inoculated with capped RNA transcripts from the mutants, whereas mutant sHVRd1 (Delta712-790), with a nearly complete HVR deletion, exhibited an attenuation phenotype in infected pigs. The data from these studies indicate that deletions in HVR do not abolish HEV infectivity in vitro or in vivo, although evidence for attenuation was observed for HEV mutants with a larger or nearly complete HVR deletion.
An environment-mediated quantum deleter
International Nuclear Information System (INIS)
Srikanth, R.; Banerjee, Subhashish
2007-01-01
Environment-induced decoherence presents a great challenge to realizing a quantum computer. We point out the somewhat surprising fact that decoherence can be useful, indeed necessary, for practical quantum computation, in particular, for the effective erasure of quantum memory in order to initialize the state of the quantum computer. The essential point behind the deleter is that the environment, by means of a dissipative interaction, furnishes a contractive map towards a pure state. We present a specific example of an amplitude damping channel provided by a two-level system's interaction with its environment in the weak Born-Markov approximation. This is contrasted with a purely dephasing, non-dissipative channel provided by a two-level system's interaction with its environment by means of a quantum nondemolition interaction. We point out that currently used state preparation techniques, for example using optical pumping, essentially perform as quantum deleters
Energy Technology Data Exchange (ETDEWEB)
Hoop, R.C.; Schwartz, L.S.; Hoffman, E.P. [Univ. of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Russo, L.S. [Univ. of Florida, Jacksonville, FL (United States); Riconda, D.L. [Orlando Regional Medical Center, Orlando, FL (United States)
1994-02-01
Two male cousins with Duchenne muscular dystrophy were found to have different maternal dystrophin gene haplotypes and different deletion mutations. One propositus showed two noncontiguous deletions-one in the 5{prime}, proximal deletional hotspot region, and the other in the 3{prime}, more distal deletional hotspot region. The second propositus showed only the 5{prime} deletion. Using multiple fluorescent exon dosage and fluorescent multiplex CA repeat linkage analyses, the authors show that the mother of each propositus carries both deletions on the same grandmaternal X chromosome. This paradox is explained by a single recombinational event between the 2 deleted regions of one of the carrier`s dystrophin genes, giving rise to a son with a partially {open_quotes}repaired{close_quotes} gene retaining only the 5{prime} deletion. 20 refs., 4 figs.
PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS
Directory of Open Access Journals (Sweden)
Editorial Foreword
2015-12-01
Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain
Multigene deletions in lung adenocarcinomas from irradiated and control mice
International Nuclear Information System (INIS)
Zhang, Y.; Woloschak, G.E.
1996-01-01
K-ras codon 12 point mutations mRb and p53 gene deletions were examined in tissues from 120 normal lungs and lung adenocarcinomas that were Formalin-treated and paraffin-embedded 25 years ago. The results showed that 12 of 60 (20%) lung adenocarcinomas had mRb deletions. All lung adenocarcinomas that were initially found bearing deleted mRb had p53 deletions (15 of 15; 100%). A significantly higher mutation frequency for K-ras codon 12 point mutations was also found in the lung adenocarcinomas from mice exposed to 24 once-weekly neutron irradiation (10 of 10; 100%) compared with those exposed to 24 or 60 once-weekly γ-ray doses (5 of 10; 50%). The data suggested that p53 and K-ras gene alterations were two contributory factors responsible for the increased incidence of lung adenocarcinoma in B6CF 1 male mice exposed to protracted neutron radiation
Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.
Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M
1997-01-01
RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620
Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan
2016-01-01
It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...
Czech Academy of Sciences Publication Activity Database
Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír
2016-01-01
Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016
Generalized pairing strategies-a bridge from pairing strategies to colorings
Directory of Open Access Journals (Sweden)
Győrffy Lajos
2016-12-01
Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.
Multi-user distribution of polarization entangled photon pairs
Energy Technology Data Exchange (ETDEWEB)
Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)
2015-10-14
We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.
Basset, Jean-Marie
2016-06-09
The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.
Deletion of the pH sensor GPR4 decreases renal acid excretion.
Sun, Xuming; Yang, Li V; Tiegs, Brian C; Arend, Lois J; McGraw, Dennis W; Penn, Raymond B; Petrovic, Snezana
2010-10-01
Proton receptors are G protein-coupled receptors that accept protons as ligands and function as pH sensors. One of the proton receptors, GPR4, is relatively abundant in the kidney, but its potential role in acid-base homeostasis is unknown. In this study, we examined the distribution of GPR4 in the kidney, its function in kidney epithelial cells, and the effects of its deletion on acid-base homeostasis. We observed GPR4 expression in the kidney cortex, in the outer and inner medulla, in isolated kidney collecting ducts, and in cultured outer and inner medullary collecting duct cells (mOMCD1 and mIMCD3). Cultured mOMCD1 cells exhibited pH-dependent accumulation of intracellular cAMP, characteristic of GPR4 activation; GPR4 knockdown attenuated this accumulation. In vivo, deletion of GPR4 decreased net acid secretion by the kidney and resulted in a nongap metabolic acidosis, indicating that GPR4 is required to maintain acid-base homeostasis. Collectively, these findings suggest that GPR4 is a pH sensor with an important role in regulating acid secretion in the kidney collecting duct.
Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G
To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.
Directory of Open Access Journals (Sweden)
Muhammad Rauzan
Full Text Available Chronic myeloid leukemia (CML treatment has been improved by tyrosine kinase inhibitors (TKIs such as imatinib mesylate (IM but various factors can cause TKI resistance in patients with CML. One factor which contributes to TKI resistance is a germline intronic deletion polymorphism in the BCL2-like 11 (BIM gene which impairs the expression of pro-apoptotic splice isoforms of BIM. SB939 (pracinostat is a hydroxamic acid based HDAC inhibitor with favorable pharmacokinetic, physicochemical and pharmaceutical properties, and we investigated if this drug could overcome BIM deletion polymorphism-induced TKI resistance. We found that SB939 corrects BIM pre-mRNA splicing in CML cells with the BIM deletion polymorphism, and induces apoptotic cell death in CML cell lines and primary cells with the BIM deletion polymorphism. More importantly, SB939 both decreases the viability of CML cell lines and primary CML progenitors with the BIM deletion and restores TKI-sensitivity. Our results demonstrate that SB939 overcomes BIM deletion polymorphism-induced TKI resistance, and suggest that SB939 may be useful in treating CML patients with BIM deletion-associated TKI resistance.
Mondal Roy, Sutapa
2018-08-01
The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.
Construction of a psb C deletion strain in Synechocystis 6803.
Goldfarb, N; Knoepfle, N; Putnam-Evans, C
1997-01-01
Synechocystis 6803 is a cyanobacterium that carries out-oxygenic photosynthesis. We are interested in the introduction of mutations in the large extrinsic loop region of the CP43 protein of Photosystem II (PSII). CP43 appears to be required for the stable assembly of the PSII complex and also appears to play a role in photosynthetic oxygen evolution. Deletion of short segments of the large extrinsic loop results in mutants incapable of evolving oxygen. Alterations in psbC, the gene encoding CP43, are introduced into Synechocystis 6803 by transformation and homologous recombination. Specifically, plasmid constructs bearing the site-directed mutations are introduced into a deletion strain where the portion of the gene encoding the area of mutation has been deleted and replaced by a gene conferring antibiotic resistance. We have constructed a deletion strain of Synechocystis appropriate for the introduction of mutations in the large extrinsic loop of CP43 and have used it successfully to produce site-directed mutants.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Energy Technology Data Exchange (ETDEWEB)
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)
2015-07-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2015-03-01
Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
The first Dutch SDHB founder deletion in paraganglioma – pheochromocytoma patients
Directory of Open Access Journals (Sweden)
Devilee Peter
2009-04-01
Full Text Available Abstract Background Germline mutations of the tumor suppressor genes SDHB, SDHC and SDHD play a major role in hereditary paraganglioma and pheochromocytoma. These three genes encode subunits of succinate dehydrogenase (SDH, the mitochondrial tricarboxylic acid cycle enzyme and complex II component of the electron transport chain. The majority of variants of the SDH genes are missense and nonsense mutations. To date few large deletions of the SDH genes have been described. Methods We carried out gene deletion scanning using MLPA in 126 patients negative for point mutations in the SDH genes. We then proceeded to the molecular characterization of deletions, mapping breakpoints in each patient and used haplotype analysis to determine whether the deletions are due to a mutation hotspot or if a common haplotype indicated a single founder mutation. Results A novel deletion of exon 3 of the SDHB gene was identified in nine apparently unrelated Dutch patients. An identical 7905 bp deletion, c.201-4429_287-933del, was found in all patients, resulting in a frameshift and a predicted truncated protein, p.Cys68HisfsX21. Haplotype analysis demonstrated a common haplotype at the SDHB locus. Index patients presented with pheochromocytoma, extra-adrenal PGL and HN-PGL. A lack of family history was seen in seven of the nine cases. Conclusion The identical exon 3 deletions and common haplotype in nine patients indicates that this mutation is the first Dutch SDHB founder mutation. The predominantly non-familial presentation of these patients strongly suggests reduced penetrance. In this small series HN-PGL occurs as frequently as pheochromocytoma and extra-adrenal PGL.
Error-correcting pairs for a public-key cryptosystem
International Nuclear Information System (INIS)
Pellikaan, Ruud; Márquez-Corbella, Irene
2017-01-01
Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)
Directory of Open Access Journals (Sweden)
Mudasir Mudasir
2010-06-01
Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+ most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA Keywords: DNA Binding, mixed-ligand complexes
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1994-01-01
From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.
Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A
2018-06-04
Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Recurrence and Variability of Germline EPCAM Deletions in Lynch Syndrome
Kuiper, Roland P.; Vissers, Lisenka E. L. M.; Venkatachalam, Ramprasath; Bodmer, Danielle; Hoenselaar, Eveline; Goossens, Monique; Haufe, Aline; Kamping, Eveline; Niessen, Renee C.; Hogervorst, Frans B. L.; Gille, Johan J. P.; Redeker, Bert; Tops, Carli M. J.; van Gijn, Marielle E.; van den Ouweland, Ans M. W.; Rahner, Nils; Steinke, Verena; Kahl, Philip; Holinski-Feder, Elke; Morak, Monika; Kloor, Matthias; Stemmler, Susanne; Betz, Beate; Hutter, Pierre; Bunyan, David J.; Syngal, Sapna; Culver, Julie O.; Graham, Tracy; Chan, Tsun L.; Nagtegaal, Iris D.; van Krieken, J. Han J. M.; Schackert, Hans K.; Hoogerbrugge, Nicoline; van Kessel, Ad Geurts; Ligtenberg, Marjolijn J. L.
Recently, we identified 3' end deletions in the EPCAM gene as a novel cause of Lynch syndrome. These truncating EPCAM deletions cause allele-specific epigenetic silencing of the neighboring DNA mismatch repair gene MSH2 in tissues expressing EPCAM. Here we screened a cohort of unexplained Lynch-like
The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA
Czech Academy of Sciences Publication Activity Database
Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.
2002-01-01
Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2013-01-01
of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Directory of Open Access Journals (Sweden)
Yong Jun Choi
Full Text Available Ku70 and Ku80 form a heterodimer called Ku that forms a holoenzyme with DNA dependent-protein kinase catalytic subunit (DNA-PKCS to repair DNA double strand breaks (DSBs through the nonhomologous end joining (NHEJ pathway. As expected mutating these genes in mice caused a similar DSB repair-defective phenotype. However, ku70(-/- cells and ku80(-/- cells also appeared to have a defect in base excision repair (BER. BER corrects base lesions, apurinic/apyrimidinic (AP sites and single stand breaks (SSBs utilizing a variety of proteins including glycosylases, AP endonuclease 1 (APE1 and DNA Polymerase β (Pol β. In addition, deleting Ku70 was not equivalent to deleting Ku80 in cells and mice. Therefore, we hypothesized that free Ku70 (not bound to Ku80 and/or free Ku80 (not bound to Ku70 possessed activity that influenced BER. To further test this hypothesis we performed two general sets of experiments. The first set showed that deleting either Ku70 or Ku80 caused an NHEJ-independent defect. We found ku80(-/- mice had a shorter life span than dna-pkcs(-/- mice demonstrating a phenotype that was greater than deleting the holoenzyme. We also found Ku70-deletion induced a p53 response that reduced the level of small mutations in the brain suggesting defective BER. We further confirmed that Ku80-deletion impaired BER via a mechanism that was not epistatic to Pol β. The second set of experiments showed that free Ku70 and free Ku80 could influence BER. We observed that deletion of either Ku70 or Ku80, but not both, increased sensitivity of cells to CRT0044876 (CRT, an agent that interferes with APE1. In addition, free Ku70 and free Ku80 bound to AP sites and in the case of Ku70 inhibited APE1 activity. These observations support a novel role for free Ku70 and free Ku80 in altering BER.
Genomic rearrangements by LINE-1 insertion-mediated deletion in the human and chimpanzee lineages.
Han, Kyudong; Sen, Shurjo K; Wang, Jianxin; Callinan, Pauline A; Lee, Jungnam; Cordaux, Richard; Liang, Ping; Batzer, Mark A
2005-01-01
Long INterspersed Elements (LINE-1s or L1s) are abundant non-LTR retrotransposons in mammalian genomes that are capable of insertional mutagenesis. They have been associated with target site deletions upon insertion in cell culture studies of retrotransposition. Here, we report 50 deletion events in the human and chimpanzee genomes directly linked to the insertion of L1 elements, resulting in the loss of approximately 18 kb of sequence from the human genome and approximately 15 kb from the chimpanzee genome. Our data suggest that during the primate radiation, L1 insertions may have deleted up to 7.5 Mb of target genomic sequences. While the results of our in vivo analysis differ from those of previous cell culture assays of L1 insertion-mediated deletions in terms of the size and rate of sequence deletion, evolutionary factors can reconcile the differences. We report a pattern of genomic deletion sizes similar to those created during the retrotransposition of Alu elements. Our study provides support for the existence of different mechanisms for small and large L1-mediated deletions, and we present a model for the correlation of L1 element size and the corresponding deletion size. In addition, we show that internal rearrangements can modify L1 structure during retrotransposition events associated with large deletions.
Conditional deletion of Pten causes bronchiolar hyperplasia.
Davé, Vrushank; Wert, Susan E; Tanner, Tiffany; Thitoff, Angela R; Loudy, Dave E; Whitsett, Jeffrey A
2008-03-01
Tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a lipid phosphatase that regulates multiple cellular processes including cell polarity, migration, proliferation, and carcinogenesis. In this work, we demonstrate that conditional deletion of Pten (Pten(Delta/Delta)) in the respiratory epithelial cells of the developing mouse lung caused epithelial cell proliferation and hyperplasia as early as 4 to 6 weeks of age. While bronchiolar cell differentiation was normal, as indicated by beta-tubulin and FOXJ1 expression in ciliated cells and by CCSP expression in nonciliated cells, cell proliferation (detected by expression of Ki-67, phospho-histone-H3, and cyclin D1) was increased and associated with activation of the AKT/mTOR survival pathway. Deletion of Pten caused papillary epithelial hyperplasia characterized by a hypercellular epithelium lining papillae with fibrovascular cores that protruded into the airway lumens. Cell polarity, as assessed by subcellular localization of cadherin, beta-catenin, and zonula occludens-1, was unaltered. PTEN is required for regulation of epithelial cell proliferation in the lung and for the maintenance of the normal simple columnar epithelium characteristics of bronchi and bronchioles.
Impaired spermatogenesis and gr/gr deletions related to Y chromosome haplogroups in Korean men.
Directory of Open Access Journals (Sweden)
Jin Choi
Full Text Available Microdeletion of the Azoospermia Factor (AZF regions in Y chromosome is a well-known genetic cause of male infertility resulting from spermatogenetic impairment. However, the partial deletions of AZFc region related to spermatogenetic impairment are controversial. In this study, we characterized partial deletion of AZFc region in Korean patients with spermatogenetic impairment and assessed whether the DAZ and CDY1 contributes to the phenotype in patients with gr/gr deletions. Total of 377 patients with azoo-/oligozoospermia and 217 controls were analyzed using multiplex polymerase chain reaction (PCR, analysis of DAZ-CDY1 sequence family variants (SFVs, and quantitative fluorescent (QF-PCR. Of the 377 men with impaired spermatogenesis, 59 cases (15.6% had partial AZFc deletions, including 32 gr/gr (8.5%, 22 b2/b3 (5.8%, four b1/b3 (1.1% and one b3/b4 (0.3% deletion. In comparison, 14 of 217 normozoospermic controls (6.5% had partial AZFc deletions, including five gr/gr (2.3% and nine b2/b3 (4.1% deletions. The frequency of gr/gr deletions was significantly higher in the azoo-/oligozoospermic group than in the normozoospermic control group (p = 0.003; OR = 3.933; 95% CI = 1.509-10.250. Concerning Y haplogroup, we observed no significant differences in the frequency of gr/gr deletions between the case and the control groups in the YAP+ lineages, while gr/gr deletion were significantly higher in azoo-/oligozoospermia than normozoospermia in the YAP- lineage (p = 0.004; OR = 6.341; 95% CI = 1.472-27.312. Our data suggested that gr/gr deletion is associated with impaired spermatogenesis in Koreans with YAP- lineage, regardless of the gr/gr subtypes.
Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.
Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K
2018-01-01
Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.
English for au pairs the au pair's guide to learning English
Curtis, Lucy
2014-01-01
English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.
Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.
2010-01-01
Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010
Directory of Open Access Journals (Sweden)
Kateřina Klapilová
2014-01-01
Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.
DEFF Research Database (Denmark)
Bower, Stanley G.; Hove-Jensen, Bjarne; Switzer, Robert L.
1988-01-01
in a 416-base-pair 5' untranslated leader in the prsA transcript, which was shown by deletion to be necessary for maximal synthesis of phosphoribosylpyrophosphate synthetase. The S. typhimurium leader contains a 115-base-pair insert relative to the E. coli leader. The insert appears to have no functional...
Coexistence of 9p Deletion Syndrome and Autism Spectrum Disorder
Günes, Serkan; Ekinci, Özalp; Ekinci, Nuran; Toros, Fevziye
2017-01-01
Deletion or duplication of the short arm of chromosome 9 may lead to a variety of clinical conditions including craniofacial and limb abnormalities, skeletal malformations, mental retardation, and autism spectrum disorder. Here, we present a case report of 5-year-old boy with 9p deletion syndrome and autism spectrum disorder.
Generating Bona Fide Mammalian Prions with Internal Deletions.
Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel
2016-08-01
Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2014-01-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...
Omar, Aimi Farehah; Ismail, Ismanizan
2016-11-01
Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.
Energy Technology Data Exchange (ETDEWEB)
Thanh, L.T.; Man, Nguyen Thi; Morris, G.E. [Wales Institute, Clwyd (United Kingdom)] [and others
1995-08-28
We have produced a new panel of 20 monoclonal antibodies (mAbs) against a region of the dystrophin protein corresponding to a deletion-prone region of the Duchenne muscular dystrophy gene (exons 45-50). We show that immunohistochemistry or Western blotting with these {open_quotes}exon-specific{close_quotes} mAbs can provide a valuable addition to Southern blotting or PCR methods for the accurate identification of genetic deletions in Becker muscular dystrophy patients. The antibodies were mapped to the following exons: exon 45 (2 mAbs), exon 46 (6), exon 47 (1), exons 47/48 (4), exons 48-50 (6), and exon 50 (1). PCR amplification of single exons or groups of exons was used both to produce specific dystrophin immunogens and to map the mAbs obtained. PCR-mediated mutagenesis was also used to identify regions of dystrophin important for mAb binding. Because the mAbs can be used to characterize the dystrophin produced by individual muscle fibres, they will also be useful for studying {open_quotes}revertant{close_quotes} fibres in Duchenne muscle and for monitoring the results of myoblast therapy trials in MD patients with deletions in this region of the dystrophin gene. 27 refs., 7 figs., 3 tabs.
Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.
García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M
2014-01-01
The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.
Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA
International Nuclear Information System (INIS)
Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.
2002-01-01
3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids
22q13.3 Deletion Syndrome: An Underdiagnosed Cause of Mental Retardation
Directory of Open Access Journals (Sweden)
ilknur Erol
2015-03-01
Full Text Available Phelan-McDermid syndrome, also known as 22q13.3 deletion syndrome, is characterized by global developmental delay, absent or delayed speech, generalized hypotonia, and minor physical anomalies. The deletion typically involves the terminal band 22q13.3 and has been associated with both familial and de-novo translocations. We report the case of an 11-year-old Turkish girl with 22q13.3 deletion syndrome presenting with repeated seizures during the course of a rubella infection. We also review the clinical features of 22q13.3 deletion syndrome and emphasize the importance of considering a rare microdeletion syndrome for idiopathic mental retardation when results of a routine karyotype analysis are normal. To the best of our knowledge, this is the first reported case of a Turkish patient with isolated 22q13.3 deletion syndrome. [Cukurova Med J 2015; 40(1.000: 169-173
Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping
2016-02-22
We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.
Multi-exon deletions of the FBN1 gene in Marfan syndrome
Directory of Open Access Journals (Sweden)
Schrijver Iris
2001-10-01
Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.
McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F
2014-04-01
Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A
Linguistic and Psychomotor Development in Children with Chromosome 14 Deletions
Zampini, Laura; D'Odorico, Laura; Zanchi, Paola; Zollino, Marcella; Neri, Giovanni
2012-01-01
The present study focussed on a specific type of rare genetic condition: chromosome 14 deletions. Children with this genetic condition often show developmental delays and brain and neurological problems, although the type and severity of symptoms varies depending on the size and location of the deleted genetic material. The specific aim of the…
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation
Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.
2011-01-01
Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.
Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S
1996-03-01
In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.
Minor, Agata; Wong, Edgar Chan; Harmer, Karynn; Ma, Sai
2007-08-01
The azoospermic factor (AZF) region is critical for normal spermatogenesis since microdeletions and partial deletions have been associated with infertility. We investigate the diagnostic ability of karyotyping in detecting clinically relevant Y chromosome deletions. The clinical significance of heterochromatin deletions, microdeletions and partial AZFc deletions is also evaluated. A patient with a Yq deletion, affected by severe oligoasthenoteratozoospermia, underwent intracytoplasmic sperm injection (ICSI) which resulted in the birth of a healthy baby boy. The patient, his father and his son underwent Y chromosome microdeletion and partial AZFc deletion screening. We also studied the aneuploidy rate in the sperm of the patient by fluorescent in situ hybridization. AZF microdeletions were absent in the family. However, microdeletion analysis confirmed that the Yq deletion was limited to the heterochromatin. We found a partial AZFc gr/gr deletion in all three family members. We observed an increased rate of sex chromosome aneuploidy in the infertile patient. Cytogenetic analysis was misleading in identifying the Yq breakpoint. Infertility observed in the patient was associated with the gr/gr partial deletion. However, because of the incomplete penetrance of gr/gr deletions, the consequence of the vertical transmission of the deletion through ICSI remains unknown. Copyright (c) 2007 John Wiley & Sons, Ltd.
Cook, R Kimberley; Christensen, Stacey J; Deal, Jennifer A; Coburn, Rachel A; Deal, Megan E; Gresens, Jill M; Kaufman, Thomas C; Cook, Kevin R
2012-01-01
Chromosomal deletions are used extensively in Drosophila melanogaster genetics research. Deletion mapping is the primary method used for fine-scale gene localization. Effective and efficient deletion mapping requires both extensive genomic coverage and a high density of molecularly defined breakpoints across the genome. A large-scale resource development project at the Bloomington Drosophila Stock Center has improved the choice of deletions beyond that provided by previous projects. FLP-mediated recombination between FRT-bearing transposon insertions was used to generate deletions, because it is efficient and provides single-nucleotide resolution in planning deletion screens. The 793 deletions generated pushed coverage of the euchromatic genome to 98.4%. Gaps in coverage contain haplolethal and haplosterile genes, but the sizes of these gaps were minimized by flanking these genes as closely as possible with deletions. In improving coverage, a complete inventory of haplolethal and haplosterile genes was generated and extensive information on other haploinsufficient genes was compiled. To aid mapping experiments, a subset of deletions was organized into a Deficiency Kit to provide maximal coverage efficiently. To improve the resolution of deletion mapping, screens were planned to distribute deletion breakpoints evenly across the genome. The median chromosomal interval between breakpoints now contains only nine genes and 377 intervals contain only single genes. Drosophila melanogaster now has the most extensive genomic deletion coverage and breakpoint subdivision as well as the most comprehensive inventory of haploinsufficient genes of any multicellular organism. The improved selection of chromosomal deletion strains will be useful to nearly all Drosophila researchers.
Thermodynamics of pairing phase transition in nuclei
International Nuclear Information System (INIS)
Karim, Afaque; Ahmad, Shakeb
2014-01-01
The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied
Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region.
Gatta, Valentina; Palka, Chiara; Chiavaroli, Valentina; Franchi, Sara; Cannataro, Giovanni; Savastano, Massimo; Cotroneo, Antonio Raffaele; Chiarelli, Francesco; Mohn, Angelika; Stuppia, Liborio
2014-07-23
SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients.Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region.
Loupe, Jacob; Sampath, Srirangan; Lacassie, Yves
2014-10-01
We report an African-American family that was identified after the proposita was referred for diagnostic evaluation at 4½ months with a history of Hirschsprung and dysmorphic features typical of Waardenburg syndrome (WS). Family evaluation revealed that the father had heterochromidia irides and hypertelorism supporting the clinical diagnosis of WS; however, examination of the mother revealed characteristic facial and digital features of Coffin-Lowry syndrome (CLS). Molecular testing of the mother identified a novel 2 bp deletion (c.865_866delCA) in codon 289 of RPS6KA3 leading to a frame-shift and premature termination of translation 5 codons downstream (NM_004586.2:p.Gln289ValfsX5). This deletion also was identified in the proposita and her three sisters with a clinical suspicion of CLS, all of whom as carriers for this X-linked disorder had very subtle manifestations. The molecular confirmation of WS type 4 (Shah-Waardenburg; WS4) was not as straightforward. To evaluate WS types 1-4, multiple sequential molecular tests were requested, including Sanger sequencing of all exons, and deletion/duplication analysis using MLPA for PAX3, MITF, SOX10, EDN3 and EDNRB. Although sequencing did not identify any disease causing variants, MLPA identified a heterozygous deletion of the entire EDNRB in the father. This deletion was also found in the proposita and the oldest child. Since the heterozygous deletion was the only change identified in EDNRB, this family represents one of the few cases of an autosomal dominant inheritance of WS4 involving the endothelin pathway. Altogether, clinical evaluation of the family revealed one child to be positive for WS4 and two positive for CLS, while two children were positive for both diseases simultaneously (including the proposita) while another pair test negative for either disease. This kinship is an example of the coincidence of two conditions co-segregating in one family, with variable phenotypes requiring molecular testing to
Ion-pair chromatography of nucleic acid derivatives
International Nuclear Information System (INIS)
Perrone, P.A.; Brown, P.R.
1985-01-01
Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented
Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric
2005-03-10
Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
Directory of Open Access Journals (Sweden)
Maréchal Eric
2005-03-01
Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
Deletion Mutagenesis and Identification of Causative Mutations in Maize.
Jia, Shangang; Li, Aixia; Zhang, Chi; Holding, David
2018-01-01
We describe a method for gamma-irradiation of mature maize seeds to generate mutants with opaque endosperm and reduced kernel fill phenotypes. We also describe methods for mapping mutants and identifying causal gene mutations. Using this method, a population of 1788M2 families and 47 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes was developed. For molecular characterization of the mutants, we utilized a novel functional genomics platform that combines separate Bulked Segregant RNA and exome sequencing data sets (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. We also describe the use of exome capture sequencing of F2 mutant and normal pools to perform mapping and candidate gene identification without the need for separate RNA-seq (BSEx-seq). To exemplify the utility of the deletion mutants for functional genomics and provide proof-of-concept for the bioinformatics platform, we summarize the identification of the causative deletion in two mutants. Mutant 937, which was characterized by BSREx-seq, harbors a 6203-bp in-frame deletion covering six exons within the Opaque-1 gene on chromosome 4. Preliminary investigation of opaque mutant 1486 with BSEx-seq shows a tight mapping interval and associated deletion on chromosome 10.
ASYMMETRIC EFFECTS OF ADDED VERSUS DELETED FEATURE OF STIMULUS ON RECOGNITION MEMORY
内野, 八潮; 箱田, 裕司
2000-01-01
This article reviewed a number of studies which revealed superiority of addition over deletion. Such an asymmetric effect was found in picture recognitioa memory, discrimination learning, proofreading for misspellings and so on. However, few studies have controlled typicality of original stimulus or the effect of addition and deletion on typicality of changed stimulus. Therefore this article focussed particularly on the studies in which addition and deletion applied to original stimulus was d...
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
International Nuclear Information System (INIS)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.
2012-01-01
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
Energy Technology Data Exchange (ETDEWEB)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)
2012-04-15
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino
Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua
2013-09-01
There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.
Energy Technology Data Exchange (ETDEWEB)
Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)
2017-08-15
The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)
International Nuclear Information System (INIS)
Straehle, U.; Klock, G.; Schuetz, G.
1987-01-01
To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same
DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D
2012-09-01
We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.
Heart defects and other features of the 22q11 distal deletion syndrome
DEFF Research Database (Denmark)
Fagerberg, Christina Ringmann; Graakjaer, Jesper; Heinl, Ulrike D
2013-01-01
patients with 22q11 distal deletions, of whom two have complex congenital heart malformation, thus broadening the phenotypic spectrum. We compare cardiac malformations reported in 22q11 distal deletion to those reported in the common 22q11 deletion syndrome. We also review the literature for patients...... with 22q11 distal deletions, and discuss the possible roles of haploinsufficiency of the MAPK1 gene. We find the most frequent features in 22q11 distal deletion to be developmental delay or learning disability, short stature, microcephalus, premature birth with low birth weight, and congenital heart...... malformation ranging from minor anomalies to complex malformations. Behavioral problems are also seen in a substantial portion of patients. The following dysmorphic features are relatively common: smooth philtrum, abnormally structured ears, cleft palate/bifid uvula, micro-/retrognathia, upslanting palpebral...
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Seven gene deletions in seven days
DEFF Research Database (Denmark)
Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus
2015-01-01
Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering ...
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.
2013-01-01
We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of
Adiabatic pair creation in heavy-ion and laser fields
International Nuclear Information System (INIS)
Pickl, P.; Durr, D.
2008-01-01
The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)
Sagan, Bruce E.; Savage, Carla D.
2012-01-01
We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...
Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization.
Fantes, J A; Bickmore, W A; Fletcher, J M; Ballesta, F; Hanson, I M; van Heyningen, V
1992-01-01
Fluorescence in situ hybridization (FISH) with biotin-labeled probes mapping to 11p13 has been used for the molecular analysis of deletions of the WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation) locus. We have detected a submicroscopic 11p13 deletion in a child with inherited aniridia who subsequently presented with Wilms tumor in a horseshoe kidney, only revealed at surgery. The mother, who has aniridia, was also found to carry a deletion including both the ...
Lax pairs: a novel type of separability
International Nuclear Information System (INIS)
Fokas, A S
2009-01-01
An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)
Lopez, Genghis H; Turner, Robyn M; McGowan, Eunike C; Schoeman, Elizna M; Scott, Stacy A; O'Brien, Helen; Millard, Glenda M; Roulis, Eileen V; Allen, Amanda J; Liew, Yew-Wah; Flower, Robert L; Hyland, Catherine A
2018-03-01
The RhD blood group antigen is extremely polymorphic and the DEL phenotype represents one such class of polymorphisms. The DEL phenotype prevalent in East Asian populations arises from a synonymous substitution defined as RHD*1227A. However, initially, based on genomic and cDNA studies, the genetic basis for a DEL phenotype in Taiwan was attributed to a deletion of RHD Exon 9 that was never verified at the genomic level by any other independent group. Here we investigate the genetic basis for a Caucasian donor with a DEL partial D phenotype and compare the genomic findings to those initial molecular studies. The 3'-region of the RHD gene was amplified by long-range polymerase chain reaction (PCR) for massively parallel sequencing. Primers were designed to encompass a deletion, flanking Exon 9, by standard PCR for Sanger sequencing. Targeted sequencing of exons and flanking introns was also performed. Genomic DNA exhibited a 1012-bp deletion spanning from Intron 8, across Exon 9 into Intron 9. The deletion breakpoints occurred between two 25-bp repeat motifs flanking Exon 9 such that one repeat sequence remained. Deletion mutations bordered by repeat sequences are a hallmark of slipped-strand mispairing (SSM) event. We propose this genetic mechanism generated the germline deletion in the Caucasian donor. Extensive studies show that the RHD*1227A is the most prevalent DEL allele in East Asian populations and may have confounded the initial molecular studies. Review of the literature revealed that the SSM model explains some of the extreme polymorphisms observed in the clinically significant RhD blood group antigen. © 2017 AABB.
Roberts, P A
1979-07-01
The high variability of chromomeric patterns in near-terminal regions of polytene chromosome arms has been explored in a number of races, strains and hybrids of Drosophila melanogaster. Traditional explanations for tip differences between strains (differential compaction of chromatin, somatic or germinal deletion) are examined and, in the light of the reported observations, rejected. The range of polytene tip variability and rates of change in wild races are greater than has been supposed: strains formerly considered to be terminally deleted appear to gain terminal bands; others, formerly considered normal, appear to have lost them. Strains with high cell-to-cell tip variability are also described. Cell-to-cell variations, as well as much of the observed rapid changes in tip appearance, are probably due to heritable differences in the location of an abrupt transition zone between polytene and nonpolytene chromatin. A quantitative relationship between the amount of certain subterminal bands present and the frequency of tip association of nonhomologous chromosomes is shown and its possible significance for chromosome is shown and its possible for chromosome pairing discussed.
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
Clinical and molecular consequences of exon 78 deletion in DMD gene.
Traverso, Monica; Assereto, Stefania; Baratto, Serena; Iacomino, Michele; Pedemonte, Marina; Diana, Maria Cristina; Ferretti, Marta; Broda, Paolo; Minetti, Carlo; Gazzerro, Elisabetta; Madia, Francesca; Bruno, Claudio; Zara, Federico; Fiorillo, Chiara
2018-03-19
We present a 13-year-old patient with persistent increase of serum Creatine Kinase (CK) and myalgia after exertion. Skeletal muscle biopsy showed marked reduction of dystrophin expression leading to genetic analysis of DMD gene by MLPA, which detected a single deletion of exon 78. To the best of our knowledge, DMD exon 78 deletion has never been described in literature and, according to prediction, it should lead to loss of reading frame in the dystrophin gene. To further assess the actual effect of exon 78 deletion, we analysed cDNA from muscle mRNA. This analysis confirmed the absence of 32 bp of exon 78. Exclusion of exon 78 changes the open reading frame of exon 79 and generate a downstream stop codon, producing a dystrophin protein of 3703 amino acids instead of 3685 amino acids. Albeit loss of reading frame usually leads to protein degradation and severe phenotype, in this case, we demonstrated that deletion of DMD exon 78 can be associated with a functional protein able to bind DGC complex and a very mild phenotype. This study adds a novel deletion in DMD gene in human and helps to define the compliance between maintaining/disrupting the reading frame and clinical form of the disease.
Leyman, Bregje; Boyen, Filip; Van Parys, Alexander; Verbrugghe, Elin; Haesebrouck, Freddy; Pasmans, Frank
2012-12-01
Vaccination is an important measure to control Salmonella contamination in the meat production chain. A previous study showed that both the ΔrfaJ and ΔrfaL strains are suitable markers and allow serological differentiation of infected and vaccinated animals. The aim of this study was to verify whether deletion of the lon gene in a Salmonella Typhimurium ΔrfaJ marker strain resulted in decreased environmental survival. Our results indicate that deletion of the lon gene in the ΔrfaJ strain did not affect invasiveness in IPEC-J2 cells and resulted in an increased susceptibility to UV, disinfectants (such as hydrogen peroxide and tosylchloramide sodium) and citric acid. Immunization of pigs with inactivated ΔrfaJ or ΔlonΔrfaJ vaccines allowed differentiation of infected and vaccinated pigs. Furthermore, deletion of the lon gene did not reduce the protection conferred by live wild type or ΔrfaJ vaccines against subsequent challenge with a virulent Salmonella Typhimurium strain in BALB/c mice. Based on our results in mice, we conclude that deletion of lon in ΔrfaJ contributes to environmental safety of the ΔrfaJ DIVA strain. Copyright © 2012 Elsevier Ltd. All rights reserved.
Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability
Directory of Open Access Journals (Sweden)
Yanli Ren
2017-01-01
Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.
Pair-correlations in swimmer suspensions
Nambiar, Sankalp; Subramanian, Ganesh
2017-11-01
Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.
Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.
Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun
α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.
Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi
2002-01-01
Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.
Induction of Mitochondrial DNA Deletion by Ionizing Radiation in Human Lung Fibroblast IMR-90 Cells
International Nuclear Information System (INIS)
Eom, Hyeon Soo; Jung, U Hee; Park, Hae Ran; Jo, Sung Kee
2009-01-01
Mitochondrial DNA (mtDNA) deletion is a well-known marker for oxidative stress and aging and also contributes to their unfavorable effects in cultured cells and animal tissues. This study was conducted to investigate the effect of ionizing radiation (IR) on mtDNA deletion and the involvement of reactive oxygen species (ROS) in this process in human lung fibroblast (IMR-90) cells. Young IMR-90 cells at population doubling (PD) 39 were irradiated with 137 Cs -rays and the intracellular ROS level was determined by 2',7'-dichlorofluorescein diacetate (DCFH-DA) and mtDNA common deletion (4977bp) was detected by nested PCR. Old cells at PD 55 and H 2 O 2 -treated young cells were compared as the positive control. IR increased the intracellular ROS level and mtDNA 4977 bp deletion in IMR-90 cells dose-dependently. The increases of ROS level and mtDNA deletion were also observed in old cells and H 2 O 2 -treated young cells. To confirm the increased ROS level is essential for mtDNA deletion in irradiated cells, the effects of N-acetylcysteine (NAC) on IRinduced ROS and mtDNA deletion were examined. 5 mM NAC significantly attenuated the IR-induced ROS increase and mtDNA deletion. These results suggest that IR induces the mtDNA deletion and this process is mediated by ROS in IMR-90 cells
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Ponderomotive effects in multiphoton pair production
Kohlfürst, Christian; Alkofer, Reinhard
2018-02-01
The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.
Muramatsu, Yukako; Tokita, Yoshihito; Mizuno, Seiji; Nakamura, Miho
2017-02-01
Williams syndrome (WS) is known for its uneven cognitive abilities, especially the difficulty in visuo-spatial cognition, though there are some inter-individual phenotypic differences. It has been proposed that the difficulty in visuo-spatial cognition of WS patients can be attributed to a haploinsufficiency of some genes located on the deleted region in 7q11.23, based on an examination of atypical deletions identified in WS patients with atypical cognitive deficits. According to this hypothesis, the inter-individual differences in visuo-spatial cognitive ability arise from variations in deletion. We investigated whether there were inter-individual differences in the visuo-spatial constructive abilities of five unrelated WS patients with the typical deletion on chromosome 7q11.23 that includes the candidate genes contributing visuo-spatial difficulty in WS patients. We used tests with three-dimensional factors such as Benton's three-dimensional block construction test, which are considered to be more sensitive than those with only two-dimensional factors. There were diverse inter-individual differences in the visuo-spatial constructive abilities among the present participants who shared the same typical genomic deletion of WS. One of the participants showed almost equivalent performances to typically developing adults in those tests. In the present study, we found a wide range of cognitive abilities in visuo-spatial construction even among the patients with a common deletion pattern of WS. The findings suggest that attributing differences in the phenotypes entirely to genetic factors such as an atypical deletion may not be always correct. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.